Independent fissile inventory verification in a large tank employing lutetium double spikes

International Nuclear Information System (INIS)

Carter, J.A.; Walker, R.L.; May, M.P.; Smith, D.H.; Hebble, T.L.

1987-01-01

A 3000-liter feed adjustment tank containing over 2400 L of uranium solution was assayed for its contents using the double spiking technique of isotope dilution mass spectrometry. Lutetium was the double spike, with the natural element used as the initial spike and enriched 176-Lu as the second. The ability of a remote sampling system was evaluated for its ability to introduce the lutetium and also to produce homogeneous sample solutions. The system was found to be satisfactory. Volumes of the tank can be measured to a precision of about 0.2%. The concentration of uranium was measured as 154.5 g/L uranium, thus giving a total of 382.3 kg in the tank as compared to the plant's best estimate of 383 kg. Uranium measurements were subjected to internal calibration calculations, with 233-U and 236-U being used as the reference isotopes. A diversion of 5% of the tank contents was simulated to evaluate the method's sensitivity in this regard. The ability of this method to give timely results of good precision makes it a strong candidate for use in material balance and inventory accountability applications; it also has potential use in quality assurance areas

DOTA-TATE peptides labelling with Lutetium 177: Preliminary study

International Nuclear Information System (INIS)

Aliaga, Eleazar; Robles, Anita; Ramos, Bertha; Martinez, Flor

2014-01-01

he peptide DOTA-TATE was labeled with lutetium 177 according to the methodology provided under the regional project RLA/6/074, sponsored by the IAEA. The labeling was done in 0.26 M gentisic acid solution in 0.8 M sodium acetate buffer, pH 5, at 100 °C for 30 minutes in a dry heating block. The radiochemical purity was assessed by thin layer chromatography, using ITLC SG strips and a mixture of 0.15 M ammonium acetate - methanol (1:1) as solvent. The radiolabeled peptide 177 Lu-DOTA-TATE reached a radiochemical purity of 98 % with a specific activity of 2,8 mCi/µg of peptide. (authors).

Electrochemistry and spectroelectrochemistry of tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine, Lu{sub 2}Pc{sub 4} and dimeric lutetium(III) phthalocyanine, Lu{sub 2}Pc{sub 2}(OAc){sub 2}

Energy Technology Data Exchange (ETDEWEB)

Koca, Atif [Chemical Engineering Department, Engineering Faculty, Marmara University, TR34722 Goeztepe, Istanbul (Turkey); Ceyhan, Tanju; Erbil, Mehmet K. [Department of Biochemistry, Division of Organic Chemistry, Guelhane Medical Academy (GATA), Ankara (Turkey); Ozkaya, Ali Riza [Department of Chemistry, Marmara University, TR34722 Goeztepe, Istanbul (Turkey)], E-mail: aliozkaya@marmara.edu.tr; Bekaroglu, Ozer [Department of Chemistry, Technical University of Istanbul, TR34469 Maslak, Istanbul (Turkey)], E-mail: obek@itu.edu.tr

2007-11-09

In this study, electrochemical, electrochromic and spectroelectrochemical properties of a tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine (Lu{sub 2}Pc{sub 4}2) were investigated explicitly as compared with a tert-butylcalix[4]arene bridged dimeric lutetium(III) phthalocyanine [Lu{sub 2}Pc{sub 2}(OAc){sub 2}1]. Distinctive differences between electrochemical and electrochromic properties of 1 and 2 were detected. Moreover, the properties of 1 and 2 were compared with previously reported S{sub 4}(CH{sub 2}){sub 4} bridged Lu{sub 2}Pc{sub 2}(OAc){sub 2} and Lu{sub 2}Pc{sub 4}. The calixarene bridged phthalocyanine (Pc) compounds, 1 and 2 showed well-defined electrochromic behaviour with green-blue and blue-purple colour transitions. The enhanced electrochromic properties of 2, as compared to 1, were attributed to its double-decker structure, probably allowing the formation of suitable ion channels for the counter ion movement in the solid film.

Effect of pressure on the bandstructure and superconductivity in lutetium

International Nuclear Information System (INIS)

Asokamani, R.; Natarajan, S.; Rajagopalan, M.; Sundararajan, V.; Suvasini, M.B.; Iyakutti, K.

1984-08-01

The detailed bandstructure and superconducting behaviour of lutetium at 230 kbar pressure is reported here. The electronic contribution eta to the electron-phonon mass enhancement lambda is studied within the rigid muffin-tin (RMT) approximation. The pd and df matrix elements are expressed in terms of 'd' bandwidth, Fermi energy and muffin-tin zero. The variations of Grueneisen parameter and Debye temperature with pressure are studied and applied in the calculation of Tsub(c). The calculated Tsub(c) value agrees fairly well with the experimental value. The changes in the conduction bandwidth and the electronic specific heat coefficient with pressure are found to be in agreement with theoretical prediction. (author)

Determination of lutetium (III) hydrolysis constants in the middle of ion force 1M sodium chloride at 303 K

International Nuclear Information System (INIS)

Jimenez R, M.; Solache R, M.J.; Ramirez G, J.J.; Rojas H, A.

1997-01-01

With the purpose to complete information about the lutetium (III) hydrolysis constants here is used the potentiometric method to determine those in the middle of ion force 1M sodium chloride at 303 K. (Author)

Cerium-doped single crystal and transparent ceramic lutetium aluminum garnet scintillators

International Nuclear Information System (INIS)

Cherepy, Nerine J.; Kuntz, Joshua D.; Tillotson, Thomas M.; Speaks, Derrick T.; Payne, Stephen A.; Chai, B.H.T.; Porter-Chapman, Yetta; Derenzo, Stephen E.

2007-01-01

For rapid, unambiguous isotope identification, scintillator detectors providing high-resolution gamma ray spectra are required. We have fabricated Lutetium Aluminum Garnet (LuAG) using transparent ceramic processing, and report a 2-mm thick ceramic exhibiting 75% transmission and light yield comparable to single-crystal LuAG:Ce. The LuAG:Ce luminescence peaks at 550 nm, providing an excellent match for Silicon Photodiode readout. LuAG is dense (6.67 g/cm 3 ) and impervious to water, exhibits good proportionality and a fast decay (∼40 ns), and we measure light yields in excess of 20,000 photons/MeV

X-ray fluorescence analysis of lutetium oxide/oxalate for rare earth impurities

International Nuclear Information System (INIS)

Chandola, L.C.; Khanna, P.P.

1985-01-01

An X-ray fluorescence spectrometric method for the analysis of lutetium oxide is described. The sample in the oxalate form is mixed with boric acid binding material and pressed into a pellet over supporting pellet of boric acid. A Philips PW 1220 wavelength dispersive semiautomatic X-ray fluorescence spectrometer is used for the analysis. The minimum determination limit is 0.002 percent for Y, Er and Yb and 0.005 percent for Tm. Calculations for theoretical minimum detection limits and percent standard deviations at each concentration of the standard are carried out. (author)

Hyperfine interactions in 111Cd-doped lutetium sesquioxide

International Nuclear Information System (INIS)

Errico, L.A.; Renteria, M.; Bibiloni, A.G.; Requejo, F.G.

1999-01-01

We report here first Perturbed Angular Correlation (PAC) results of the electric field gradient (EFG) characterisation at 111 Cd impurities located at both non-equivalent cation sites of the bixbyite structure of Lutetium sesquioxide, between room temperature (RT) and 1273 K. The comparison with results coming from a systematic 111 Cd PAC study in bixbyites and with point-charge model (PCM) predictions shows the presence of a trapped defect at RT in the neighbourhood of the asymmetric cation site, which is completely removed at T > 623 K. The anomalous EFG temperature dependence in Lu 2 O 3 can be described in the frame of a 'two-state' model with fluctuating interactions, which enables the experimental determination of the acceptor energy level introduced by the Cd impurity in the band-gap of the semiconductor and the estimation of the oxygen vacancy density in the sample

Study of lutetium nitrate reaction with orthophosphates of alkali metals and ammonium

International Nuclear Information System (INIS)

Davitashvili, E.G.; Dzhabishvili, N.A.; Orlovskij, V.P.; Kargareteli, L.N.

1986-01-01

The process of lutetium phosphate precipitation in systems Lu(NO 3 ) 3 - M 3 PO 4 -H 2 O, where M=K + , Na, NH 4 , at 25 deg was studied. Compounds LuPO 4 x2H 2 O, 5LuPO 4 xNa 3 PO 4 x16H 2 O, 2LuPO 4 xK 3 PO 4 x6H 2 O and 2LuPO 4 (NH 4 ) 3 PO 4 x6H 2 O were isolated. The compounds prepared are roentgenoamorphous. Results of thermal decomposition of the compounds are presented

Optical emission spectrographic analysis of lutetium oxide for rare earth impurities

International Nuclear Information System (INIS)

Chandola, L.C.; Dixit, V.S.

1986-01-01

An optical emission spectrographic (OES) method has been developed for the analysis of high purity lutetium oxide to determine rare earths Er, Tm, Yb and Y. The spectra are excited by a d.c. arc run at 10 A current after mixing the sample with graphite buffer in the weight ratio 1:1. A 1200 grooves/mm grating blazed at 3300 A is used for dispersion and a Kodak SA-1 plate for recording the spectrum. The detection limit is 0.001 per cent for Tm, Yb and Y while it is 0.005 per cent for Er. The relative standard deviation of the method is ± 13.4 per cent. (author)

Apparent molar volumes and compressibilities of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in N,N-dimethylformamide and N,N-dimethylacetamide

International Nuclear Information System (INIS)

Warmińska, Dorota; Fuchs, Anna; Lundberg, Daniel

2013-01-01

Highlights: ► In DMF the sequence values of both volumes and compressibilities of Ln 3+ ions are: La 3+ ≈ Gd 3+ > Lu 3+ . ► In DMA the ionic volumes of lanthanoid(III) metal ions are, within error limits, identical. ► Obtained results are the consequence of an ion–solvent bonding nature. -- Abstract: The concentration and temperature dependencies of density of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in N,N-dimethylformamide (DMF) and N,N-dimethylacetamide (DMA) have been determined. From density data the apparent molar volumes and partial molar volumes of the salts at infinite dilution as well as the expansibilities have been evaluated. The apparent molar isentropic compressibilities of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in DMF and DMA have been calculated from sound velocity data obtained at 298.15 K. The results have been discussed in terms of ion–solvent interactions

Hyperfine interactions in {sup 111}Cd-doped lutetium sesquioxide

Energy Technology Data Exchange (ETDEWEB)

Errico, L.A.; Renteria, M.; Bibiloni, A.G.; Requejo, F.G. [Universidad Nacional de La Plata, Programa TENAES (CONICET), Departamento de Fisica, Facultad de Ciencias Exactas (Argentina)

1999-09-15

We report here first Perturbed Angular Correlation (PAC) results of the electric field gradient (EFG) characterisation at {sup 111}Cd impurities located at both non-equivalent cation sites of the bixbyite structure of Lutetium sesquioxide, between room temperature (RT) and 1273 K. The comparison with results coming from a systematic {sup 111}Cd PAC study in bixbyites and with point-charge model (PCM) predictions shows the presence of a trapped defect at RT in the neighbourhood of the asymmetric cation site, which is completely removed at T > 623 K. The anomalous EFG temperature dependence in Lu{sub 2}O{sub 3} can be described in the frame of a 'two-state' model with fluctuating interactions, which enables the experimental determination of the acceptor energy level introduced by the Cd impurity in the band-gap of the semiconductor and the estimation of the oxygen vacancy density in the sample.

Formulation and characterization of lutetium-177-labeled stannous (tin) colloid for radiosynovectomy.

Science.gov (United States)

Arora, Geetanjali; Singh, Manoranjan; Jha, Pragati; Tripathy, Sarthak; Bal, Chandrasekhar; Mukherjee, Anirban; Shamim, Shamim A

2017-07-01

Easy large-scale production, easy availability, cost-effectiveness, long half-life, and favorable radiation characteristics have made lutetium-177 (Lu) a preferred radionuclide for use in therapy. Lutetium-177-labeled stannous (Lu-Sn) colloid particles were formulated for application in radiosynovectomy, followed by in-vitro and in-vivo characterization. Stannous chloride (SnCl2) solution and Lu were heated together, the pH was adjusted, and the particles were recovered by centrifugation. The heating time and amount of SnCl2 were varied to optimize the labeling protocol. The labeling efficiency (LE) and radiochemical purity (RCP) of the product were determined. The size and shape of the particles were determined by means of electron microscopy. In-vitro stability was tested in PBS and synovial fluid, and in-vivo stability was tested in humans. LE and RCP were greater than 95% and ∼99% (Rf=0-0.1), respectively. Aggregated colloidal particles were spherical (mean size: 241±47 nm). The product was stable in vitro for up to 7 days in PBS as well as in synovial fluid. Injection of the product into the infected knee joint of a patient resulted in its homogenous distribution in the intra-articular space, as seen on the scan. No leakage of activity was seen outside the knee joint even 7 days after injection, indicating good tracer binding and in-vivo stability. Lu-Sn colloid was successfully prepared with a high LE (>95%) and high RCP (99%) under optimized reaction conditions. Because of the numerous benefits of Lu and the ease of preparation of tin colloid particles, Lu-Sn colloid particles are significantly superior to its currently available counterparts for use in radiosynovectomy.

33 CFR 173.17 - Reciprocity.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reciprocity. 173.17 Section 173.17 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Numbering § 173.17 Reciprocity. (a) Section...

Photoelectric conversion and electrochromic properties of lutetium tetrakis(tert-butyl)bisphthalocyaninate

International Nuclear Information System (INIS)

Hu, Andrew Teh; Hu Tenyi; Liu Lungchang

2003-01-01

Both photoelectric and electrochromic effects on lutetium tetrakis(tert-butyl)bisphthalocyaninate (Lu(TBPc) 2 ) have been carried out in this study. Lu(TBPc) 2 is known for its electrochromic performance, but its photoelectric effect has not mentioned in the literature. The electrochromic properties of Lu(TBPc) 2 have been measured by cyclic voltammetry (CV) and UV-Vis spectrometer at the same time. It takes less than 1.5 s for the color to change from red to green under 0.9 V. Its cycle life is at least over 500 times. Furthermore, we also investigate its photoelectric conversion properties. Its photoelectric cell exhibits a positive photo-electricity conversion effect with a short-circuit photocurrent (46.4 μA/cm 2 ) under illumination of white light (1.201 mW/cm 2 )

21 CFR 173.290 - Trichloroethylene.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Trichloroethylene. 173.290 Section 173.290 Food and..., Lubricants, Release Agents and Related Substances § 173.290 Trichloroethylene. Tolerances are established for residues of trichloroethylene resulting from its use as a solvent in the manufacture of foods as follows...

19 CFR 173.0 - Scope.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Scope. 173.0 Section 173.0 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.0 Scope. This part deals with the general authority of review, the...

22 CFR 17.3 - Fault.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fault. 17.3 Section 17.3 Foreign Relations...) § 17.3 Fault. A recipient of an overpayment is without fault if he or she performed no act of... agency may have been at fault in initiating an overpayment will not necessarily relieve the individual...

21 CFR 173.210 - Acetone.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

49 CFR 173.173 - Paint, paint-related material, adhesives, ink and resins.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Paint, paint-related material, adhesives, ink and... Than Class 1 and Class 7 § 173.173 Paint, paint-related material, adhesives, ink and resins. (a) When..., paint-related material, adhesives, ink and resins must be packaged as follows: (1) As prescribed in...

49 CFR 173.322 - Ethyl chloride.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Ethyl chloride. 173.322 Section 173.322 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.322 Ethyl chloride. Ethyl chloride must be...

49 CFR 173.443 - Contamination control.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Contamination control. 173.443 Section 173.443... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.443 Contamination control. (a) The level of non-fixed (removable) radioactive contamination on the external surfaces of each package offered for...

21 CFR 173.160 - Candida guilliermondii.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Candida guilliermondii. 173.160 Section 173.160... CONSUMPTION Enzyme Preparations and Microorganisms § 173.160 Candida guilliermondii. The food additive Candida... the following conditions: (a) The food additive is the enzyme system of the viable organism Candida...

Electrochromism of solid films of blue form of lutetium phthalocyanine complexe

Energy Technology Data Exchange (ETDEWEB)

Gavrilov, V I; Konstantinov, A P; Luk' yanets, E A; Shelepin, I V

1986-12-01

Results of spectral-electrochemical study on electrochromic films of blue form of tret-butyl-substituted lutetium diphthalocyanine deposited on the surface of an electrode contacting with electrolyte aqueous solution are presented. In the 0.2-1.15 V potential range sweep of the electrode potential is followed by reversible change of the film colour in the following succession: blue reversible green reversible red. Electrochromic properties of the film confirm the corresponding spectral transitions from the initial state to monoelectron-oxidized and further on to the product of two-electron oxidation. Under potential sweeping towards the anode in the 1.4 V range and irreversible wave arises; potential achievement of this wave brings about complete change in the form of j, E-curves. The consequent electrode processes are followed by change in the film colour green - red that is associated witn mechanical fracture of the film.

21 CFR 173.230 - Ethylene dichloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ethylene dichloride. 173.230 Section 173.230 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.230 Ethylene dichloride. A tolerance of 30 parts per million is established for ethylene dichloride in spice oleoresins when present therein...

21 CFR 173.255 - Methylene chloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methylene chloride. 173.255 Section 173.255 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.255 Methylene chloride. Methylene chloride may be present in food under the following conditions: (a) In spice oleoresins as a residue from...

21 CFR 173.375 - Cetylpyridinium chloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cetylpyridinium chloride. 173.375 Section 173.375... CONSUMPTION Specific Usage Additives § 173.375 Cetylpyridinium chloride. Cetylpyridinium chloride (CAS Reg. No....1666 of this chapter, at a concentration of 1.5 times that of cetylpyridinium chloride. (c) The...

12 CFR 308.173 - Prevailing party.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Prevailing party. 308.173 Section 308.173 Banks....173 Prevailing party. (a) General rule. An eligible applicant who, following an adversary adjudication has gained victory on the merits in the proceeding is a “prevailing party”. An eligible applicant may...

49 CFR 173.323 - Ethylene oxide.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Ethylene oxide. 173.323 Section 173.323... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.323 Ethylene oxide. (a) For packaging ethylene oxide in non-bulk packagings, silver mercury or any of its alloys or copper may not be used in any...

Labelling of the peptide Dota-Octreotate with Lutetium 177

International Nuclear Information System (INIS)

Hernandez B, C.A.

2004-01-01

In this work is described the optimization of the reaction conditions to obtain the complex 177 Lu-Dota-TATE with a radiochemical purity > 95%, even so the studies of stability In vitro to the dilution in saline solution, stability in human serum and challenge to the cystein. The biodistribution studies are presented in mice Balb-C and the tests of biological recognition using one lines cellular of pancreatic adenoma (AR42-J). The obtained results show a high stability of the radio complex in vitro, since it doesn't suffer trans chelation from the Lutetium-177 to plasmatic proteins. The biodistribution tests in mice Balb-C demonstrated an appropriate lipophilly of the complex to be excreted in more proportion by the kidneys without significant accumulation in healthy tissues. It is necessary to mention that the drop activity specifies (3.54 μg / 37 MBq) obtained in the irradiation of 176 Lu 2 O 3 it allowed to verify the union of the 177 Lu-Dota-Tate to membrane receivers but without being able to obtain the saturation curves and competition required to characterize quantitatively the biological recognition. (Author)

46 CFR 173.010 - Definitions.

Science.gov (United States)

2010-10-01

... VESSEL USE Lifting § 173.010 Definitions. As used in this part— (a) Hook load means the weight of the object lifted by the crane. (b) Crane radius means the distance illustrated in Figure 173.010. EC01MR91...

34 CFR 668.173 - Refund reserve standards.

Science.gov (United States)

2010-07-01

... 34 Education 3 2010-07-01 2010-07-01 false Refund reserve standards. 668.173 Section 668.173 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Financial Responsibility § 668.173...

21 CFR 173.355 - Dichlorodifluoromethane.

Science.gov (United States)

2010-04-01

... with good manufacturing practice, as a direct-contact freezing agent for foods. (c) To assure safe use... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dichlorodifluoromethane. 173.355 Section 173.355 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...

29 CFR 1915.173 - Drums and containers.

Science.gov (United States)

2010-07-01

... 29 Labor 7 2010-07-01 2010-07-01 false Drums and containers. 1915.173 Section 1915.173 Labor... Vessels, Drums and Containers, Other Than Ship's Equipment § 1915.173 Drums and containers. (a) Shipping drums and containers shall not be pressurized to remove their contents. (b) A temporarily assembled...

49 CFR 173.3 - Packaging and exceptions.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging and exceptions. 173.3 Section 173.3... SHIPMENTS AND PACKAGINGS General § 173.3 Packaging and exceptions. (a) The packaging of hazardous materials.... standard packaging must be open to inspection by a representative of the Department. (b) The regulations...

13 CFR 120.173 - Lead-based paint.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Lead-based paint. 120.173 Section 120.173 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Policies Applying to All Business Loans Requirements Imposed Under Other Laws and Orders § 120.173 Lead-based paint. If...

21 CFR 173.275 - Hydrogenated sperm oil.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Hydrogenated sperm oil. 173.275 Section 173.275... CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.275 Hydrogenated sperm oil. The food additive hydrogenated sperm oil may be safely used in accordance with the following prescribed...

25 CFR 173.2 - Project engineer's authority.

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false Project engineer's authority. 173.2 Section 173.2 Indians... LANDS WITHDRAWN OR ACQUIRED IN CONNECTION WITH INDIAN IRRIGATION PROJECTS § 173.2 Project engineer's authority. The project engineer is the official charged with the responsibility for the enforcement of this...

49 CFR 173.183 - Nitrocellulose base film.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Nitrocellulose base film. 173.183 Section 173.183... Nitrocellulose base film. Films, nitrocellulose base, must be packaged in packagings conforming to the... tape or paper; authorized only for not over 600 m (1969 feet) of film. [Amdt. 173-224, 55 FR 52643 Dec...

21 CFR 173.55 - Polyvinylpyrrolidone.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Polyvinylpyrrolidone. 173.55 Section 173.55 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... a residual level not to exceed 40 parts per million. Wine As a clarifying agent, at a residual level...

{sup 177}Lutetium-DOTATATE peptide radio-receptor therapy for patients with endocrine neoplasm and the individualized semi-automatic dosimetry. A retrospective analysis; {sup 177}Lutetium-DOTATATE-Peptid-Radio-Rezeptor-Therapie bei Patienten mit neuroendokrinen Neoplasien und die individualisierte, semi-automatische-Dosimetrie. Eine retrospektive Analyse

Energy Technology Data Exchange (ETDEWEB)

Loeser, Anastassia

2016-09-28

The {sup 177}lutetium-DOTATATE peptide radio-receptor therapy is a promising approach for the palliative treatment of patients with inoperable endocrine neoplasm. The individually variable biological dispersion and the tumor uptake including the protection of critical organs require a precise and reliable organ and tumor dosimetry. The HERMES Hybrid dosimetry module has appeared as reliable and user-friendly tool for clinical application. The next step is supposed to by the complete integration of 3D SPECT imaging.

21 CFR 173.400 - Dimethyldialkylammonium chloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dimethyldialkylammonium chloride. 173.400 Section... HUMAN CONSUMPTION Specific Usage Additives § 173.400 Dimethyldialkylammonium chloride. Dimethyldialkylammonium chloride may be safely used in food in accordance with the following prescribed conditions: (a...

7 CFR 1150.173 - Confidential treatment.

Science.gov (United States)

2010-01-01

... reports of the number of persons subject to this subpart or statistical data collected therefrom, which... 7 Agriculture 9 2010-01-01 2009-01-01 true Confidential treatment. 1150.173 Section 1150.173 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing...

49 CFR 173.174 - Refrigerating machines.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Refrigerating machines. 173.174 Section 173.174 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Refrigerating machines. A refrigerating machine assembled for shipment and containing 7 kg (15 pounds) or less...

49 CFR 173.465 - Type A packaging tests.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Type A packaging tests. 173.465 Section 173.465 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.465 Type A packaging tests. (a) The packaging...

40 CFR 173.9 - Judicial review.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Judicial review. 173.9 Section 173.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES GOVERNING... Judicial review. The State may appeal an order rescinding, in whole or in part, its primary enforcement...

49 CFR 173.159 - Batteries, wet.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries, wet. 173.159 Section 173.159... Batteries, wet. (a) Electric storage batteries, containing electrolyte acid or alkaline corrosive battery fluid (wet batteries), may not be packed with other materials except as provided in paragraphs (g) and...

46 CFR 173.051 - Public nautical school ships.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school ships. 173.051 Section 173.051 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.051 Public nautical school ships. Each public nautical school...

Determination of K{sub ps} and {beta}{sub 1,H} in a wide interval of initial concentrations of lutetium; Determinacion de K{sub ps} y {beta}{sub 1,H} en un amplio intervalo de concentraciones iniciales del lutecio

Energy Technology Data Exchange (ETDEWEB)

Lopez-G, H.; Jimenez R, M.; Solache R, M. [ININ. Apdo. Postal 18-1027, Mexico D.F. (Mexico); Rojas H, A. [UAM-I, A.P. 55-534, 09340, Mexico. D.F. (Mexico)

2006-07-01

solubility product constants and the first of lutetium hydrolysis in the interval of initial concentration of 3.72 X 10{sup -5} to 2.09 X 10{sup -3} M of lutetium, in a 2M of NaCIO{sub 4} media, at 303 K and under conditions free of CO{sub 2} its were considered. The solubility diagrams (pLu{sub (ac)}-pC{sub H}) by means of a radiochemical method were obtained, and starting from its the pC{sub H} values that limit the saturation and no-saturation zones of the solutions were settled down. Those diagrams allowed, also, to calculate the solubility product constants of Lu(OH){sub 3}. The experimental data to the polynomial solubility equation were adjusted, what allowed to calculate those values of the solubility product constants of Lu(OH){sub 3} and to determine the first hydrolysis constant. The value of precipitation pC{sub H} diminishes when the initial concentration of the lutetium increases, while the values of K{sub ps} and {beta}{sub 1,H} its remain constant. (Author)

46 CFR 173.062 - Drainage of weather deck.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Drainage of weather deck. 173.062 Section 173.062 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.062 Drainage of weather deck. The weather deck of each sailing...

On the effect of ammonia and wet atmospheres on the conducting properties of different lutetium bisphthalocyanine thin films

International Nuclear Information System (INIS)

Parra, Vicente; Bouvet, Marcel; Brunet, Jerome; Rodriguez-Mendez, Maria Luz; Saja, Jose Antonio de

2008-01-01

In this article, we present new experimental data regarding the influence of ammonia (NH 3 ) and water (from wet atmospheres) in the conducting properties of lutetium bisphthalocyanine (LuPc 2 )-based films in two very different structural features, namely Langmuir-Blodgett (LB) and vacuum evaporated (VE) films, deposited onto interdigitated electrodes. We pay particular attention to the effect of the mass flow rate ratios of the active gases, which certainly influence the mechanism of conduction of the chemiresistors. The particular trends observed are discussed on the basis of two main contributions: the electronic effects and the competition between gases in the adsorption process

21 CFR 211.173 - Laboratory animals.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Laboratory animals. 211.173 Section 211.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS... Laboratory animals. Animals used in testing components, in-process materials, or drug products for compliance...

21 CFR 173.240 - Isopropyl alcohol.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Isopropyl alcohol. 173.240 Section 173.240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Solvents...

49 CFR 173.163 - Hydrogen fluoride.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen fluoride. 173.163 Section 173.163... Hydrogen fluoride. (a) Hydrogen fluoride (hydrofluoric acid, anhydrous) must be packaged as follows: (1) In... filling ratio of 0.84. (b) A cylinder removed from hydrogen fluoride service must be condemned in...

49 CFR 173.31 - Use of tank cars.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Use of tank cars. 173.31 Section 173.31... SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.31 Use of tank cars. (a) General. (1) No person may offer a hazardous material for transportation in a tank car unless the tank car...

49 CFR 173.185 - Lithium cells and batteries.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Lithium cells and batteries. 173.185 Section 173... Class 7 § 173.185 Lithium cells and batteries. (a) Cells and batteries. A lithium cell or battery, including a lithium polymer cell or battery and a lithium-ion cell or battery, must conform to all of the...

On the effect of ammonia and wet atmospheres on the conducting properties of different lutetium bisphthalocyanine thin films

Energy Technology Data Exchange (ETDEWEB)

Parra, Vicente [Ecole Superieure de Physique et Chimie Industrielles (ESPCI) and Laboratoire de Chimie Inorganique et Materiaux Moleculaires-CNRS UMR 7071, Universite Pierre et Marie Curie (Paris 6) (France); Bouvet, Marcel [Ecole Superieure de Physique et Chimie Industrielles (ESPCI) and Laboratoire de Chimie Inorganique et Materiaux Moleculaires-CNRS UMR 7071, Universite Pierre et Marie Curie (Paris 6) (France)], E-mail: marcel.bouvet@espci.fr; Brunet, Jerome [Universite Blaise Pascal, LASMEA-CNRS UMR 6602, Clermont-Ferrand (France); Rodriguez-Mendez, Maria Luz [Dept. Quimica Fisica y Quimica Inorganica, Escuela Tecnica Superior de Ingenieros Industriales (E.T.S.I.I), Universidad de Valladolid (Spain); Saja, Jose Antonio de [Dept. Fisica de la Materia Condensada, Facultad de Ciencias, Universidad de Valladolid (Spain)

2008-10-31

In this article, we present new experimental data regarding the influence of ammonia (NH{sub 3}) and water (from wet atmospheres) in the conducting properties of lutetium bisphthalocyanine (LuPc{sub 2})-based films in two very different structural features, namely Langmuir-Blodgett (LB) and vacuum evaporated (VE) films, deposited onto interdigitated electrodes. We pay particular attention to the effect of the mass flow rate ratios of the active gases, which certainly influence the mechanism of conduction of the chemiresistors. The particular trends observed are discussed on the basis of two main contributions: the electronic effects and the competition between gases in the adsorption process.

On the use of X-ray absorption spectroscopy to elucidate the structure of lutetium adenosine mono- and triphosphate complexes.

Science.gov (United States)

Mostapha, S; Berthon, C; Fontaine-Vive, F; Gaysinski, M; Guérin, L; Guillaumont, D; Massi, L; Monfardini, I; Solari, P L; Thomas, O P; Charbonnel, M C; Den Auwer, C

2014-02-01

Although the physiological impact of the actinide elements as nuclear toxicants has been widely investigated for half a century, a description of their interactions with biological molecules remains limited. It is however of primary importance to better assess the determinants of actinide speciation in cells and more generally in living organisms to unravel the molecular processes underlying actinide transport and deposition in tissues. The biological pathways of this family of elements in case of accidental contamination or chronic natural exposure (in the case of uranium rich soils for instance) are therefore a crucial issue of public health and of societal impact. Because of the high chemical affinity of those actinide elements for phosphate groups and the ubiquity of such chemical functions in biochemistry, phosphate derivatives are considered as probable targets of these cations. Among them, nucleotides and in particular adenosine mono- (AMP) and triphosphate (ATP) nucleotides occur in more chemical reactions than any other compounds on the earth's surface, except water, and are therefore critical target molecules. In the present study, we are interested in trans-plutonium actinide elements, in particular americium and curium that are more rarely considered in environmental and bioaccumulation studies than early actinides like uranium, neptunium and plutonium. A first step in this strategy is to work with chemical analogues like lanthanides that are not radioactive and therefore allow extended physical chemical characterization to be conducted that are difficult to perform with radioactive materials. We describe herein the interaction of lutetium(III) with adenosine AMP and ATP. With AMP and ATP, insoluble amorphous compounds have been obtained with molar ratios of 1:2 and 1:1, respectively. With an excess of ATP, with 1:2 molar ratio, a soluble complex has been obtained. A combination of spectroscopic techniques (IR, NMR, ESI-MS, EXAFS) together with quantum

49 CFR 173.23 - Previously authorized packaging.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Previously authorized packaging. 173.23 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.23 Previously authorized packaging. (a) When the regulations specify a packaging with a specification marking...

Lutetium 177-Labeled Cetuximab Evaluation for Radioimmunotherapeutic Applications

Directory of Open Access Journals (Sweden)

Kamal Yavari

2012-06-01

Full Text Available Background & Objectives: The monoclonal antibody cetuximab binds to EGFR and thus provides an opportunity to create both imaging and therapeutic modalities that target this receptor. The potential of cetuximab as a radioimmunoconjugate was investigated and quality control tests (in vitro and in vivo were performed as a first step in the production of a new radiopharmaceutical.   Methods : Cetuximab solution was dialyzed and concentrated using an Amicon Ultra-15 filter. Purified antibody was labeled with lutetium-177 using the acyclic bifunctional chelator, DOTA-NHS, and radioimmunoconjugates were purified by PD10 columns. Radiochemical purity and stability in buffer and human blood serum were determined using thin layer chromatography. Integrity of the radiolabeled complex was checked by SDS-PAGE. Preliminary biodistribution studies in normal mice model performed to determine radioimmunoconjugates distribution up to 72h.   Results: The radiochemical purity of the complex was 98±1%. The stabilities in phosphate buffer and in human blood serum at 96 hours post-preparation were 96±2 % and 78±4%, respectively. All of the samples, controls and radiolabeled antibodies, showed a similar pattern of migration in the gel electrophoresis. Biodistribution of Lu177-cetuximab was evaluated in normal mice and the highest ID/g% was observed in the blood (13.2±1.3% at 24 hours and the liver (9.1±1.3% at 24 hours.   Conclusion: Our results show that DOTA-cituximab can be labeled with 177Lu. Lu177-cetuximab has sufficient stability and retains its integrity. The new complex could be considered for further evaluation in animals and possibly in humans as a new radiopharmaceutical for use in radioimmunotherapy of cancers.

14 CFR 25.173 - Static longitudinal stability.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 25.173... AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Flight Stability § 25.173 Static... forces (including friction) must be as follows: (a) A pull must be required to obtain and maintain speeds...

19 CFR 173.1 - Authority to review for error.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to review for error. 173.1 Section 173.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.1 Authority to review for error. Port directors...

7 CFR 993.173 - Reports of accounting.

Science.gov (United States)

2010-01-01

... 7 Agriculture 8 2010-01-01 2010-01-01 false Reports of accounting. 993.173 Section 993.173... accounting. (a) Independent handler's reports of accounting. Within 10 days (exclusive of Saturdays, Sundays... association, makes an accounting or settlement with a producer or dehydrator for prunes delivered to him, he...

49 CFR 173.194 - Gas identification sets.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Gas identification sets. 173.194 Section 173.194... Gas identification sets. Gas identification sets containing poisonous material must be packaged in... silical gel, gas identification sets may be shipped as follows: (1) If the poisonous material does not...

49 CFR 173.219 - Life-saving appliances.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Life-saving appliances. 173.219 Section 173.219... Life-saving appliances. (a) A life-saving appliance, self-inflating or non-self-inflating, containing small quantities of hazardous materials that are required as part of the life-saving appliance must...

Luminescence and energy transfer processes in (Lu,Tb).sub.3./sub.Al.sub.5./sub.O.sub.12./sub. single crystalline films doped with Ce.sup.3+./sup.

Czech Academy of Sciences Publication Activity Database

Bartosiewicz, Karol; Babin, Vladimir; Nikl, Martin; Mareš, Jiří A.; Zorenko, Yu.; Gorbenko, V.

2016-01-01

Roč. 173, May (2016), s. 141-148 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA ČR GAP204/12/0805 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : lutetium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline films Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.686, year: 2016

40 CFR 265.173 - Management of containers.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 265.173... DISPOSAL FACILITIES Use and Management of Containers § 265.173 Management of containers. (a) A container... waste. (b) A container holding hazardous waste must not be opened, handled, or stored in a manner which...

40 CFR 264.173 - Management of containers.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 264.173... Use and Management of Containers § 264.173 Management of containers. (a) A container holding hazardous... container holding hazardous waste must not be opened, handled, or stored in a manner which may rupture the...

14 CFR 23.173 - Static longitudinal stability.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 23.173... Stability § 23.173 Static longitudinal stability. Under the conditions specified in § 23.175 and with the airplane trimmed as indicated, the characteristics of the elevator control forces and the friction within...

21 CFR 173.250 - Methyl alcohol residues.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl alcohol residues. 173.250 Section 173.250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD.... Methyl alcohol may be present in the following foods under the conditions specified: (a) In spice...

49 CFR 173.2 - Hazardous materials classes and index to hazard class definitions.

Science.gov (United States)

2010-10-01

....50 1 1.6 Extremely insensitive detonating substances 173.50 2 2.1 Flammable gas 173.115 2 2.2 Non-flammable compressed gas 173.115 2 2.3 Poisonous gas 173.115 3 Flammable and combustible liquid 173.120 4 4.1 Flammable solid 173.124 4 4.2 Spontaneously combustible material 173.124 4 4.3 Dangerous when wet...

Enthalpies of mixing in binary liquid alloys of lutetium with 3d metals

Energy Technology Data Exchange (ETDEWEB)

Ivanov, Michael; Berezutski, Vadim [National Academy of Sciences, Kyiv (Ukraine). I. Frantsevich Institute for Problems of Materials Science; Usenko, Natalia; Kotova, Natalia [Taras Shevchenko National Univ., Kyiv (Ukraine). Dept. of Chemistry

2017-01-15

The enthalpies of mixing in binary liquid alloys of lutetium with chromium, cobalt, nickel and copper were determined at 1 773 - 1 947 K by isoperibolic calorimetry. The enthalpies of mixing in the Lu-Cr melts (measured up to 40 at.% Cr) demonstrate endothermic effects (ΔH = 6.88 ± 0.66 kJ . mol{sup -1} at x{sub Lu} = 0.60), whereas significant exothermic enthalpies of mixing have been established within a wide composition region for the Co-Lu, Ni-Lu and Cu-Lu liquid alloys. Minimum values of the integral enthalpy of mixing are as follows: ΔH{sub min} = -23.57 ± 1.41 kJ . mol{sup -1} at x{sub Lu} = 0.38 for the Co-Lu system; ΔH{sub min} = -48.65 ± 2.83 kJ . mol{sup -1} at x{sub Lu} = 0.40 for the Ni-Lu system; ΔH{sub min} = -24.63 ± 1.52 kJ . mol{sup -1} at x{sub Lu} = 0.37 for the Cu-Lu system.

49 CFR 173.6 - Materials of trade exceptions.

Science.gov (United States)

2010-10-01

...-reactive (see § 173.124), poisonous by inhalation (see § 173.133), or a hazardous waste. (b) Packaging. (1..., boxes or compartments. (4) For gasoline, a packaging must be made of metal or plastic and conform to the...

27 CFR 25.173 - Brewer in default.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Brewer in default. 25.173... OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.173 Brewer in default. (a) When a... the brewer is otherwise in default in payment of tax under § 25.164, beer may not be removed for...

36 CFR 1192.173 - Automated guideway transit vehicles and systems.

Science.gov (United States)

2010-07-01

.... Vertical alignment may be accomplished by vehicle air suspension or other suitable means of meeting the... vehicles and systems. 1192.173 Section 1192.173 Parks, Forests, and Public Property ARCHITECTURAL AND... TRANSPORTATION VEHICLES Other Vehicles and Systems § 1192.173 Automated guideway transit vehicles and systems. (a...

32 CFR 173.3 - Profit reduction clause.

Science.gov (United States)

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false Profit reduction clause. 173.3 Section 173.3... violating 18 U.S.C. 201-224 (bribery, graft, and conflicts of interest), 18 U.S.C. 371 (conspiracy), 18 U.S.... 1341 (fraud), 18 U.S.C. 1343 (fraud by wire) for any act in connection with or related to the obtaining...

Study of the viability of the production of lutetium - 177 in the nuclear reactor IEA-R1 at IPEN/CNEN-SP

International Nuclear Information System (INIS)

Silva, Giovana Pasqualini da

2008-01-01

The - emitter 177 Lu is a promising therapeutic radioisotope for the curative treatment of cancer using labelled proteins. It has a half - life of 6.71 day and maximum and average (3 energies of 421 and 133 keV, respectively, resulting in a short range of irradiation of tissue. The decay is accompanied by the emission of low energy -radiation of 208.3 keV (11%) and 113 keV (6.4%), suitable for simultaneous imaging. Lu can be produced by two different routes, namely, by irradiation of natural Lu 2 O 3 target ( 176 Lu, 2.6%) or enriched (in 176 Lu) Lu 2 O 3 target, and also by irradiation of Yb target (Yb 2 O 3 ) followed by radiochemical separation of Lu from Yb isotopes. The objective of this work is the development of a method of the production of 177 Lu through of the (n, gamma) nuclear reaction, by the direct and indirect method of production. Targets of lutetium oxide and ytterbium oxide were irradiated for evaluation of the activity produced and the chemical separation of lutetium and ytterbium was studied using different ion exchange resins. For the direct method, the best results were obtained using the target Lu 2 O 3 enriched in 39.6%. The best results for the indirect method were achieved with the process of separation using 0.25M - HlBA as eluent. The results showed that it is possible to produce 177 Lu of low specific activity for labeling molecules used for bone pain relief and in radiosynoviortesy. (author)

19 CFR 191.173 - Imported duty-paid derivatives (no manufacture).

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Imported duty-paid derivatives (no manufacture). 191.173 Section 191.173 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... § 191.173 Imported duty-paid derivatives (no manufacture). When the basis for drawback under 19 U.S.C...

1 CFR 17.3 - Criteria for emergency publication.

Science.gov (United States)

2010-01-01

... 1 General Provisions 1 2010-01-01 2010-01-01 false Criteria for emergency publication. 17.3..., AND PROCESSING OF DOCUMENTS FILING FOR PUBLIC INSPECTION AND PUBLICATION SCHEDULES Emergency Schedule § 17.3 Criteria for emergency publication. The emergency schedule is designed to provide the fastest...

21 CFR 133.173 - Pasteurized process cheese food.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese food. 133.173 Section 133.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

49 CFR 173.206 - Packaging requirements for chlorosilanes.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging requirements for chlorosilanes. 173.206...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Non-bulk Packaging for Hazardous Materials Other Than Class 1 and Class 7 § 173.206 Packaging requirements for chlorosilanes. (a) When § 172.101 of this...

49 CFR 173.316 - Cryogenic liquids in cylinders.

Science.gov (United States)

2010-10-01

... filling density for hydrogen, cryogenic liquid is defined as the percent ratio of the weight of lading in... 49 Transportation 2 2010-10-01 2010-10-01 false Cryogenic liquids in cylinders. 173.316 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.316 Cryogenic liquids in...

Optical Fibre NO2 Sensor Based on Lutetium Bisphthalocyanine in a Mesoporous Silica Matrix

Directory of Open Access Journals (Sweden)

Marc Debliquy

2018-03-01

Full Text Available In this article, we describe a NO2 sensor consisting of a coating based on lutetium bisphthalocyanine (LuPc2 in mesoporous silica. The sensor exploits the absorption spectrum change of this material which strongly and reversibly decreases in contact with NO2. NO2 is measured by following the amplitude change in the reflected spectrum of the coating deposited on the tip of a silica fibre. As diffusion of NO2 in LuPc2 is slow, the response time could be slow. To reduce it, the active molecules are dispersed in a mesoporous silica matrix deposited by a sol-gel process (Evaporation Induced Self Assembly avoiding the formation of large crystals. Doing so, the response is fairly fast. As the recovery is slow at room temperature, the recovery time is reduced by exposure to UV light at 365 nm. This UV light is directly introduced in the fibre yielding a practical sensor sensitive to NO2 in the ppm range suitable for pollution monitoring.

49 CFR 173.189 - Batteries containing sodium or cells containing sodium.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries containing sodium or cells containing sodium. 173.189 Section 173.189 Transportation Other Regulations Relating to Transportation PIPELINE AND... Than Class 1 and Class 7 § 173.189 Batteries containing sodium or cells containing sodium. (a...

9 CFR 381.173 - Mechanically Separated (Kind of Poultry).

Science.gov (United States)

2010-01-01

... Poultry). 381.173 Section 381.173 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

Solvent extraction of anionic chelate complexes of lanthanum(III), europium(III), lutetium(III), scandium(III), and indium(III) with 2-thenoyltrifluoroacetone as ion-pairs with tetrabutylammonium ions

International Nuclear Information System (INIS)

Noro, Junji; Sekine, Tatsuya.

1992-01-01

The solvent extraction of lanthanum(III), europium(III), lutetium(III), scandium(III), and indium(III) in 0.1 mol dm -3 sodium nitrate solutions with 2-thenoyltrifluoroacetone (Htta) in the absence and presence of tetrabutylammonium ions (tba + ) into carbon tetrachloride was measured. The extraction of lanthanum(III), europium(III), and lutetium(III) was greatly enhanced by the addition of tba + ; this could be explained in terms of the extraction of a ternary complex, M(tta) 4 - tba + . However, the extractions of scandium(III) and indium(III) were nearly the same when tba + was added. The data were treated on the basis of the formation equilibrium of the ternary complex from the neutral chelate, M(tta) 3 , with the extracted ion-pairs of the reagents, tta - tba + , in the organic phase. It was concluded that the degree of association of M(tta) 3 with the ion-pair, tta - tba + , is greater in the order La(tta) 3 ≅ Eu(tta) 3 > Lu(tta) 3 , or that the stability of the ternary complex in the organic phase is higher in the order La(tta) 4 - tba + ≅ Eu(tta) 4 - tba + > Lu(tta) 4 - tba + . This is similar to those of adduct metal chelates of Htta with tributylphosphate (TBP) in synergistic extraction systems. (author)

Photodynamic therapy with motexafin lutetium for rectal cancer: a preclinical model in the dog.

Science.gov (United States)

Ross, H M; Smelstoys, J A; Davis, G J; Kapatkin, A S; Del Piero, F; Reineke, E; Wang, H; Zhu, T C; Busch, T M; Yodh, A G; Hahn, S M

2006-10-01

Local recurrence of rectal cancer remains a significant clinical problem despite multi-modality therapy. Photodynamic Therapy (PDT) is a cancer treatment which generates tumor kill through the production of singlet oxygen in cells containing a photosensitizing drug when exposed to laser light of a specific wavelength. PDT is a promising modality for prevention of local recurrence of rectal cancer for several reasons: tumor cells may selectively retain photosensitizer at higher levels than normal tissues, the pelvis after mesorectal excision is a fixed space amenable to intra-operative illumination, and PDT can generate toxicity in tissues up to 1 cm thick. This study evaluated the safety, tissue penetration of 730 nm light, normal tissue toxicity and surgical outcome in a dog model of rectal resection after motexafin lutetium-mediated photodynamic therapy. Ten mixed breed dogs were used. Eight dogs underwent proctectomy and low rectal end to end stapled anastomosis. Six dogs received the photosensitizing agent motexafin lutetium (MLu, Pharmacyclics, Inc., Sunnyvale, CA) of 2 mg/kg preoperatively and underwent subsequent pelvic illumination of the transected distal rectum of 730 nm light with light doses ranging from 0.5 J/cm(2) to 10 J/cm(2) three hours after drug delivery. Two dogs received light, but no drug, and underwent proctectomy and low-rectal stapled anastomosis. Two dogs underwent midline laparotomy and pelvic illumination. Light penetration in tissues was determined for small bowel, rectum, pelvic sidewall, and skin. Clinical outcomes were recorded. Animals were sacrificed at 14 days and histological evaluation was performed. All dogs recovered uneventfully. No dog suffered an anastomotic leak. Severe tissue toxicity was not seen. Histological findings at necropsy revealed mild enteritis in all dogs. The excitation light penetration depths were 0.46 +/- 0.18, 0.46 +/- 0.15, and 0.69 +/- 0.39 cm, respectively, for rectum, small bowel, and peritoneum in

21 CFR 173.70 - Chloromethylated aminated styrene-divinylbenzene resin.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Chloromethylated aminated styrene-divinylbenzene resin. 173.70 Section 173.70 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Polymer...

49 CFR 173.182 - Barium azide-50 percent or more water wet.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Barium azide-50 percent or more water wet. 173.182 Section 173.182 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... Class 1 and Class 7 § 173.182 Barium azide—50 percent or more water wet. Barium azide—50 percent or more...

49 CFR 173.218 - Fish meal or fish scrap.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Fish meal or fish scrap. 173.218 Section 173.218... Fish meal or fish scrap. (a) Except as provided in Column (7) of the HMT in § 172.101 of this subchapter, fish meal or fish scrap, containing at least 6%, but not more than 12% water, is authorized for...

40 CFR 141.173 - Filtration.

Science.gov (United States)

2010-07-01

... PRIMARY DRINKING WATER REGULATIONS Enhanced Filtration and Disinfection-Systems Serving 10,000 or More People § 141.173 Filtration. A public water system subject to the requirements of this subpart that does... treatment, direct filtration, slow sand filtration, or diatomaceous earth filtration. A public water system...

Lutetium-177 DOTATATE Production with an Automated Radiopharmaceutical Synthesis System.

Science.gov (United States)

Aslani, Alireza; Snowdon, Graeme M; Bailey, Dale L; Schembri, Geoffrey P; Bailey, Elizabeth A; Pavlakis, Nick; Roach, Paul J

2015-01-01

Peptide Receptor Radionuclide Therapy (PRRT) with yttrium-90 ((90)Y) and lutetium-177 ((177)Lu)-labelled SST analogues are now therapy option for patients who have failed to respond to conventional medical therapy. In-house production with automated PRRT synthesis systems have clear advantages over manual methods resulting in increasing use in hospital-based radiopharmacies. We report on our one year experience with an automated radiopharmaceutical synthesis system. All syntheses were carried out using the Eckert & Ziegler Eurotope's Modular-Lab Pharm Tracer® automated synthesis system. All materials and methods used were followed as instructed by the manufacturer of the system (Eckert & Ziegler Eurotope, Berlin, Germany). Sterile, GMP-certified, no-carrier added (NCA) (177)Lu was used with GMP-certified peptide. An audit trail was also produced and saved by the system. The quality of the final product was assessed after each synthesis by ITLC-SG and HPLC methods. A total of 17 [(177)Lu]-DOTATATE syntheses were performed between August 2013 and December 2014. The amount of radioactive [(177)Lu]-DOTATATE produced by each synthesis varied between 10-40 GBq and was dependant on the number of patients being treated on a given day. Thirteen individuals received a total of 37 individual treatment administrations in this period. There were no issues and failures with the system or the synthesis cassettes. The average radiochemical purity as determined by ITLC was above 99% (99.8 ± 0.05%) and the average radiochemical purity as determined by HPLC technique was above 97% (97.3 ± 1.5%) for this period. The automated synthesis of [(177)Lu]-DOTATATE using Eckert & Ziegler Eurotope's Modular-Lab Pharm Tracer® system is a robust, convenient and high yield approach to the radiolabelling of DOTATATE peptide benefiting from the use of NCA (177)Lu and almost negligible radiation exposure of the operators.

21 CFR 173.280 - Solvent extraction process for citric acid.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Solvent extraction process for citric acid. 173.280... HUMAN CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.280 Solvent extraction process for citric acid. A solvent extraction process for recovery of citric acid from...

49 CFR 173.474 - Quality control for construction of packaging.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Quality control for construction of packaging. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.474 Quality control for construction of packaging. Prior to the first use of any packaging for the shipment of Class 7...

21 CFR 173.140 - Esterase-lipase derived from Mucor miehei.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Esterase-lipase derived from Mucor miehei. 173.140... HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.140 Esterase-lipase derived from Mucor miehei. Esterase-lipase enzyme, consisting of enzyme derived from Mucor miehei var. Cooney et Emerson by...

49 CFR 173.159a - Exceptions for non-spillable batteries.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Exceptions for non-spillable batteries. 173.159a... Class 1 and Class 7 § 173.159a Exceptions for non-spillable batteries. (a) Exceptions for hazardous...-spillable batteries offered for transportation or transported in accordance with this section are subject to...

33 CFR 173.85 - Fees levied by the Coast Guard.

Science.gov (United States)

2010-07-01

.... 173.85 Section 173.85 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Issue of Certificate of.... (b) Fees are payable by check or money-order made payable to the “U.S. Coast Guard”; by major credit...

49 CFR 173.172 - Aircraft hydraulic power unit fuel tank.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Aircraft hydraulic power unit fuel tank. 173.172... Class 1 and Class 7 § 173.172 Aircraft hydraulic power unit fuel tank. Aircraft hydraulic power unit fuel tanks containing a mixture of anhydrous hydrazine and monomethyl hydrazine (M86 fuel) and designed...

21 CFR 173.368 - Ozone.

Science.gov (United States)

2010-04-01

... CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.368 Ozone. Ozone (CAS Reg. No. 10028-15-6) may be safely used in the treatment, storage, and processing of foods, including meat and poultry (unless such use is precluded by standards of identity in 9...

49 CFR 173.403 - Definitions.

Science.gov (United States)

2010-10-01

... emitters and low toxicity alpha emitters or 0.04 Bq/cm2 for all other alpha emitters. Contamination exists... containers.” Graphite means, for the purposes of § 173.453, graphite with a boron equivalent content less... A2/g. Low toxicity alpha emitters means natural uranium; depleted uranium; natural thorium; uranium...

49 CFR 173.161 - Chemical kits and first aid kits.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

Displaying of formation of atomic clusters in radioactive lutetium oxide films

International Nuclear Information System (INIS)

Kartashov, V.M.; Troitskata, A.G.

2002-01-01

We earlier reported the results of our investigations of electron spectra of radioactive lutetium oxide films on the magnetic β-spectrometer π√2 with momentum resolution 0.04-0.1 %. The researches were conducted many times during ≅15 years, and a lot of the data has resulted us in the conclusion about possible formation of toroidal structures in these films. It is impossible to consider a radioactive oxide layer, deposited on metallic foil support having the electric potential of its foil support on all its depth because of its high dielectric properties. There is the potential gradient (≅10 6 -10 7 V/c) on its depth because of constant outflow of electrons from its surface. Our experiments included in itself also giving a potential, accelerating for electrons, to the metallic foil support. In this case we received a capability to watch the segments of auto emission and low energy Auger electrons. The analysis of the threshold relations and behavior (in time) of the M 4 NN and M 5 NN Auger electron intensities have resulted us in the conclusion that the greatest contribution to structure formations of these oxide films is introduced by electrons of M 4 -, M 5 - and N-sub-shell of ytterbium atoms (being formed as the result of radioactive decay of the lutetium fraction with half-times from 140 to 1200 days). The auto emission electron spectrum testifies to composite scission of M4 and M5 stationary states of the atom. It is possible to offer as the explanation a quantum flat rotator. If the particle orbit un-compresses the solenoid with a magnetic flux Φ, power condition of a rotator E m =h 2 (m-Φ/Φ 0 ) 2 /(8πm e R 0 2 ), where m e - electron mass, R 0 - an electron orbit radius; m - a magnetic quantum number, a Φ 0 =h c/e - a quantum of magnetic flux. At a quantum flow Φ=nΦ 0 (n - integer) and the power spectrum does not differ from a spectrum without the solenoid. The behavior (in time) of the experimental auto emission electron spectrum responds

21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.

Science.gov (United States)

2010-04-01

... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...

46 CFR 173.058 - Double bottom requirements.

Science.gov (United States)

2010-10-01

... PERTAINING TO VESSEL USE School Ships § 173.058 Double bottom requirements. Each new sailing school vessel... service must comply with the double bottom requirements in §§ 171.105 through 171.109, inclusive, of this...

Labelling of the peptide Dota-Octreotate with Lutetium 177; Marcado del peptido Dota-Octreotate con Lutecio 177

Energy Technology Data Exchange (ETDEWEB)

Hernandez B, C.A

2004-07-01

In this work is described the optimization of the reaction conditions to obtain the complex {sup 177} Lu-Dota-TATE with a radiochemical purity > 95%, even so the studies of stability In vitro to the dilution in saline solution, stability in human serum and challenge to the cystein. The biodistribution studies are presented in mice Balb-C and the tests of biological recognition using one lines cellular of pancreatic adenoma (AR42-J). The obtained results show a high stability of the radio complex in vitro, since it doesn't suffer trans chelation from the Lutetium-177 to plasmatic proteins. The biodistribution tests in mice Balb-C demonstrated an appropriate lipophilly of the complex to be excreted in more proportion by the kidneys without significant accumulation in healthy tissues. It is necessary to mention that the drop activity specifies (3.54 {mu}g / 37 MBq) obtained in the irradiation of {sup 176} Lu{sub 2}O{sub 3} it allowed to verify the union of the {sup 177}Lu-Dota-Tate to membrane receivers but without being able to obtain the saturation curves and competition required to characterize quantitatively the biological recognition. (Author)

19 CFR 173.5 - Review of entry covering household or personal effects.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Review of entry covering household or personal effects. 173.5 Section 173.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... authority to grant. Where the port director has no authority to grant the waiver, the application shall be...

21 CFR 173.395 - Trifluoromethane sulfonic acid.

Science.gov (United States)

2010-04-01

...) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.395 Trifluoromethane sulfonic acid. Trifluoromethane sulfonic acid... acid) may safely be used in the production of cocoa butter substitute from palm oil (1-palmitoyl-2...

49 CFR 17.3 - What programs and activities of the Department are subject to these regulations?

Science.gov (United States)

2010-10-01

... 49 Transportation 1 2010-10-01 2010-10-01 false What programs and activities of the Department are subject to these regulations? 17.3 Section 17.3 Transportation Office of the Secretary of Transportation INTERGOVERNMENTAL REVIEW OF DEPARTMENT OF TRANSPORTATION PROGRAMS AND ACTIVITIES § 17.3 What programs and activities...

49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.

Science.gov (United States)

2010-10-01

... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

49 CFR 173.340 - Tear gas devices.

Science.gov (United States)

2010-10-01

... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.340 Tear gas devices. (a) Packagings for...) Tear gas devices may not be assembled with, or packed in the same packaging with, mechanically- or manually-operated firing, igniting, bursting, or other functioning elements unless of a type and design...

Physico-chemical study of erbium, thulium ytterbium and lutetium butyrates

International Nuclear Information System (INIS)

Loginova, V.E.; Dvornikova, L.M.; Khazov, L.A.; Rubinshtejn, A.S.

1975-01-01

Er-Lu butyrates have been obtained. The crystals of the obtained salts had an identical shape of combinations of hexagonal prisms and pyramids. The values of the refraction index, measured by the method of circular screening and use of immersion liquids, were found to be close to each other in all the salts considered. The densities of the crystallohydrates of rare earth element butyrates, measured by the pycnometric method in isooctane, increases in the order of Er, Tm, Lu: 1.73; 1.74; 1.79 g/cm 3 , respectively. Infrared spectra of rare earth element butyrates were studied, and the main ware frequencies of maximum absorption were determined with a view of finding the character of the bond between the metal and the anion. A thermo-differential and a thermo-gravimetric investigation of rare earth element butyrates was carried out

40 CFR 98.173 - Calculating GHG emissions.

Science.gov (United States)

2010-07-01

... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Iron and Steel Production § 98.173 Calculating GHG emissions... for the process as specified in paragraphs (b)(1)(i) through (b)(1)(vii) of this section. The... the gaseous fuel (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf per kg-mole at standard...

Synthesis and up-conversion white light emission of RE{sup 3+}-doped lutetium oxide nanocubes as a single compound

Energy Technology Data Exchange (ETDEWEB)

Hu Shanshan [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Yang Jun, E-mail: jyang@swu.edu.cn [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li Chunxia [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Lin Jun, E-mail: jlin@ciac.jl.cn [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

2012-04-16

Highlights: Black-Right-Pointing-Pointer Uniform and dispersive cubic precursor can be synthesized by sample hydrothermal process. Black-Right-Pointing-Pointer Hydrothermal precursor could transform to Lu{sub 2}O{sub 3}:RE{sup 3+} with its original cubic morphology. Black-Right-Pointing-Pointer Nearly equal intensities of blue, green, and red emissions under single 980 nm laser. Black-Right-Pointing-Pointer Lu{sub 2}O{sub 3}:RE{sup 3+} show bright white light emission, clearly visible to the naked eyes. Black-Right-Pointing-Pointer Chromaticity coordinate is very close to the standard equal energy white light illuminate. - Abstract: Uniform and dispersive Lu{sub 2}O{sub 3}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} nanocubes have been successfully synthesized by hydrothermal process with subsequent calcination at 900 Degree-Sign C. The as-formed RE{sup 3+}-doped lutetium oxide precursor via the hydrothermal process, as a template, could transform to RE{sup 3+}-doped Lu{sub 2}O{sub 3} with their original cubic morphology and slight shrinkage in the size after post-annealing process. The formation mechanism for the lutetium oxide precursor cubes has been proposed. Under single wavelength diode laser excitation of 980 nm, the as-obtained Lu{sub 2}O{sub 3}:3%Yb{sup 3+}/0.5%Er{sup 3+}/0.3%Tm{sup 3+} nanocubes show nearly equal intensities of blue (Tm{sup 3+}: {sup 1}G{sub 4} {yields} {sup 3}H{sub 6}), green (Er{sup 3+}: ({sup 2}H{sub 11/2}, {sup 4}S{sub 3/2}) {yields} {sup 4}I{sub 15/2}), and red (Er{sup 3+}: {sup 4}F{sub 9/2} {yields} {sup 4}I{sub 15/2}) emissions, which produces bright white light emission, clearly visible to the naked eyes. The main pathways to populate the upper emitting states come from the energy-transfer processes from Yb{sup 3+} to Tm{sup 3+}/Er{sup 3+}, respectively. The chromaticity coordinate of the Lu{sub 2}O{sub 3}:3%Yb{sup 3+}/0.5%Er{sup 3+}/0.3%Tm{sup 3+} sample is calculated to be about x = 0.3403 and y = 0.3169, which falls exactly within the

Spectroscopic studies of lutetium pyro-silicates Lu2Si2O7 doped with bismuth and europium

International Nuclear Information System (INIS)

Bretheau-Raynal, Francoise

1981-01-01

Single crystals of thortveitite structure pyro-silicates were grown by a floating zone technique associated with an arc image furnace. The samples were systematically characterized by X-Ray diffraction and microprobe analysis. Thanks to oriented single crystals of Lu 2 Si 2 O 7 , Yb 2 Si 2 O 7 and Sc 2 Si 2 O 7 , the recorded infrared and Raman spectra allow complete attribution of internal and external vibration modes, in good agreement with group theory predictions for C 2h factor group. Spectroscopic studies of Eu 3+ doping ion in Lu 2 Si 2 O 7 confirm C 2 point symmetry for the cationic site. Oscillator strengths and Judd-Ofelt parameters for Eu 3+ were calculated. A three level scheme ( 1 S 0 , 3 P 0 , 3 P 1 ) of Bi 3+ ion is used to explain radiative and non radiative mechanisms in Lu 2 Si 2 O 7 doped with bismuth. Finally, the mechanisms of low temperature (T =9 K) energy transfer between Bi 3+ and Eu 3+ in lutetium pyro-silicate was studied. The transfer occurs by non radiative process, without any diffusion of the excitation energy within the donor system and is due to dipole-dipole interactions between Bi 3+ and Eu 3+ ions. (author) [fr

30 CFR 206.173 - How do I calculate the alternative methodology for dual accounting?

Science.gov (United States)

2010-07-01

... measured at facility measurement points whose quality exceeds 1,000 Btu/cf are subject to dual accounting... for dual accounting? 206.173 Section 206.173 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... the alternative methodology for dual accounting? (a) Electing a dual accounting method. (1) If you are...

49 CFR 173.7 - Government operations and materials.

Science.gov (United States)

2010-10-01

...) Determining the airworthiness and directing maintenance of the aircraft; and (3) Dispatching the aircraft... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.7 Government operations and materials. (a) Hazardous... regulations in this subchapter or in packagings of equal or greater strength and efficiency as certified by...

46 CFR 173.007 - Location of the hook load.

Science.gov (United States)

2010-10-01

... PERTAINING TO VESSEL USE Lifting § 173.007 Location of the hook load. When doing the calculations required in this subpart, the hook load must be considered to be located at the head of the crane. ...

Tank 241-B-108, cores 172 and 173 analytical results for the final report

Energy Technology Data Exchange (ETDEWEB)

Nuzum, J.L., Fluoro Daniel Hanford

1997-03-04

The Data Summary Table (Table 3) included in this report compiles analytical results in compliance with all applicable DQOS. Liquid subsamples that were prepared for analysis by an acid adjustment of the direct subsample are indicated by a `D` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a fusion digest are indicated by an `F` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a water digest are indicated by a I.wl. or an `I` in the A column of Table 3. Due to poor precision and accuracy in original analysis of both Lower Half Segment 2 of Core 173 and the core composite of Core 173, fusion and water digests were performed for a second time. Precision and accuracy improved with the repreparation of Core 173 Composite. Analyses with the repreparation of Lower Half Segment 2 of Core 173 did not show improvement and suggest sample heterogeneity. Results from both preparations are included in Table 3.

21 CFR 173.21 - Perfluorinated ion exchange membranes.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Perfluorinated ion exchange membranes. 173.21... ion exchange membranes. Substances identified in paragraph (a) of this section may be safely used as ion exchange membranes intended for use in the treatment of bulk quantities of liquid food under the...

33 CFR 173.27 - Numbers: Display; size; color.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Numbers: Display; size; color...: Display; size; color. (a) Each number required by § 173.15 must: (1) Be painted on or permanently attached...; (3) Contrast with the color of the background and be distinctly visible and legible; (4) Have spaces...

21 CFR 173.320 - Chemicals for controlling microorganisms in cane-sugar and beet-sugar mills.

Science.gov (United States)

2010-04-01

...-sugar and beet-sugar mills. 173.320 Section 173.320 Food and Drugs FOOD AND DRUG ADMINISTRATION... controlling microorganisms in cane-sugar and beet-sugar mills. Agents for controlling microorganisms in cane-sugar and beet-sugar mills may be safely used in accordance with the following conditions: (a) They are...

Lutetium-177 - Broad Production Capabilities are Expected to Stimulate Clinical Applications of this Important Therapeutic Radioisotope

International Nuclear Information System (INIS)

Knapp, F.F. Jr.

2009-01-01

Lutetium-177 (Lu-177) is of broad interest for therapeutic applications where the deposition of localized radiation can benefit from the limited soft tissue penetration of the 0.497 MeV beta particle (max. = 2.76 mm). Examples of Lu-177 therapeutic strategies include treatment of small SS2/SS5-expressing tumors with targeted peptides and radiosynovectomy. Emission of a 208 keV gamma photon (11 %) allows imaging for evaluation of localization and biokinetics, and for targeting applications, correlation of uptake with therapeutic response. A broad spectrum of research reactors with even modest thermal neutron flux (e.g. > 1 x 10 14 ) can produce carrier-added Lu-177 with sufficient specific activity (SA) > 10 Ci/mg Lu by the 'direct' approach by irradiation of Lu-176. For low SA applications, thermal flux of > 10 13 in low-medium flux reactors provides sufficient SA (> 0.5 mCi Lu-177/mg) for preparation of Lu-EDTMP for synovectomy. Although relative Lu-177m/Lu-177 activity levels from 'direct' production can be very low (> 10 -5 ), the Lu-177m impurity levels can present an issue with radioactive waste storage requirements at some institutions. The alternative 'indirect' approach using decay of reactor produced ytterbium-177 available from by neutron irradiation of enriched Yb-176 targets provides no-carrier-added (nca) Lu-177 (theoretical SA = 109 Ci/mg Lu). Purification of the microscopic levels of nca Lu-177 from macroscopic Yb levels at the high multi Curie production level is a more challenging approach, since production yields are relatively low even at high thermal flux (e.g. 2 x 10 15 neutrons/cm 2 /sec). In addition, high mass Lu/Yb separation is especially time consuming, can generate significant waste, and the relatively expensive Yb-176 target material (> 97%, ∼ $ 20/mg) must be recovered, re-purified and used for subsequent target preparation. However, a number of effective methods for the Lu/Yb separation and Yb recovery have been reported, and even

49 CFR 173.60 - General packaging requirements for explosives.

Science.gov (United States)

2010-10-01

... explosives contained in the package, so that neither interaction between the explosives and the packaging... 49 Transportation 2 2010-10-01 2010-10-01 false General packaging requirements for explosives. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1...

14 CFR 135.173 - Airborne thunderstorm detection equipment requirements.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airborne thunderstorm detection equipment... Aircraft and Equipment § 135.173 Airborne thunderstorm detection equipment requirements. (a) No person may... the aircraft is equipped with either approved thunderstorm detection equipment or approved airborne...

49 CFR 173.466 - Additional tests for Type A packagings designed for liquids and gases.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Additional tests for Type A packagings designed...) Materials § 173.466 Additional tests for Type A packagings designed for liquids and gases. (a) In addition to the tests prescribed in § 173.465, Type A packagings designed for liquids and gases must be...

25 CFR 1000.173 - How does a newly selected Tribe/Consortium initiate the negotiation phase?

Science.gov (United States)

2010-04-01

... 25 Indians 2 2010-04-01 2010-04-01 false How does a newly selected Tribe/Consortium initiate the negotiation phase? 1000.173 Section 1000.173 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN SELF-DETERMINATION AND EDUCATIO...

49 CFR 173.312 - Requirements for shipment of MEGCs.

Science.gov (United States)

2010-10-01

...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.312 Requirements... MEGC's structural or service equipment may be affected. (4) No person may fill or offer for... requalification due date. (5) Prior to filling and offering a MEGC for transportation, the MEGC's structural and...

49 CFR 173.306 - Limited quantities of compressed gases.

Science.gov (United States)

2010-10-01

... container must be weighed and leak tested. The leak detection equipment must be sufficiently sensitive to... Section 173.306 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... softening provided that it does not leak. (vi) As an alternative to the hot water bath test in paragraph (a...

Tumor vessel normalization by the PI3K inhibitor HS-173 enhances drug delivery.

Science.gov (United States)

Kim, Soo Jung; Jung, Kyung Hee; Son, Mi Kwon; Park, Jung Hee; Yan, Hong Hua; Fang, Zhenghuan; Kang, Yeo Wool; Han, Boreum; Lim, Joo Han; Hong, Soon-Sun

2017-09-10

Tumor vessels are leaky and immature, which causes poor oxygen and nutrient supply to tumor vessels and results in cancer cell metastasis to distant organs. This instability of tumor blood vessels also makes it difficult for anticancer drugs to penetrate and reach tumors. Numerous tumor vessel normalization approaches have been investigated for improving drug delivery into tumors. In this study, we investigated whether phosphoinositide 3-kinase (PI3K) inhibitors are able to improve vascular structure and function over the prolonged period necessary to achieve effective vessel normalization. The PI3K inhibitors, HS-173 and BEZ235 potently suppressed tumor growth and hypoxia, and increased tumor apoptosis in animal models. PI3K inhibitors also induced a regular, flat monolayer of endothelial cells (ECs) in vessels, improving stability of vessel structure, and normalized tumor vessels by increasing vascular maturity, pericyte coverage, basement membrane thickness, and tight-junctions. These effects resulted in a decrease in tumor vessel tortuosity and vessel thinning, and improved vessel function and blood flow. The tumor vessel stabilization effect of the PI3K inhibitor HS-173 also decreased the number of metastatic lung nodules in vivo metastasis model. Furthermore, HS-173 improved the delivery of doxorubicin into the tumor region, enhancing its anticancer effects. Mechanistic studies suggested that PI3K inhibitor HS-173-induced vessel normalization reflected changes in endothelial Notch signaling. Taken together, our findings indicate that vessel normalization by PI3K inhibitors restrained tumor growth and metastasis while improving chemotherapy by enhancing drug delivery into the tumor, suggesting that HS-173 may have a therapeutic value as an enhancer or an anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

49 CFR 173.418 - Authorized packages-pyrophoric Class 7 (radioactive) materials.

Science.gov (United States)

2010-10-01

... must not be fissile unless excepted by § 173.453; (b) Contained in sealed and corrosion resistant receptacles with positive closures (friction or slip-fit covers or stoppers are not authorized); (c) Free of...

49 CFR 173.428 - Empty Class 7 (radioactive) materials packaging.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Empty Class 7 (radioactive) materials packaging... SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.428 Empty Class 7 (radioactive) materials packaging. A packaging which previously contained Class 7 (radioactive...

46 CFR 173.025 - Additional intact stability standards: Counterballasted vessels.

Science.gov (United States)

2010-10-01

...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.025 Additional intact stability standards: Counterballasted vessels. (a) Each vessel equipped to counterballast while lifting must be shown... loading and operation and at each combination of hook load and crane radius. (b) When doing the...

The therapeutic threesome, Iodine 131, Lutetium-111 and Rhenium-188 Radionuclide Trifecta

International Nuclear Information System (INIS)

Turner, J.H.

2007-01-01

-limited and manageable. In a physician-sponsored Australian Phase II clinical study grade III/IV haematological toxicity occurred (4% platelets, 16% neutrophils). Objective response rate (ORR) was 76% and Complete Remission (CR) was achieved in 53% (3). The majority of our patients now qualify for outpatient radioimmuno-therapy with 131 Irituximab and monitoring of carer radiation exposure demonstrates that the IAEA and ICRP guidelines of less than 5 mSv per episode of treatment were satisfied in all carers, and visitors to the household were exposed to less than 1 mSv. First-line 131 I-rituximab is now given to patients presenting with newly diagnosed indolent stage IIB, III, IV follicular non-Hodgkin's lymphoma who do not wish to be exposed to the toxic effects of induction chemotherapy. In the INITIAL phase II clinical trial at Fremantle Hospital, after first-line 131 I-rituximab radioimmunotherapy, patients also undergo maintenance rituximab therapy to maintain remission. Clinical ORR is 100% with 80% CR in all patients, as evaluated by 18F-FDG PET imaging at 3 months. This is comparable with the reported ORR of first-line radioimmuno-therapy with 131 I-tositumomab (Bexxar) (4) and achieves the same ORR of standard R-CHOP chemotherapy regimens without the associated toxicity, or any requirement for hospital admission. 2. Lutetium-177 Octreotate Neuroendocrine malignancy is not amenable to chemotherapy and if unresectable due to metastases, usually in liver, the only effective treatment with intent-to cure is radiopeptide therapy. Lutetium-177 octreotate has been demonstrated to achieve ORR 45%, CR 2% (5) which is better than the results of the most effective but relatively more toxic chemotherapy regimen of Streptozotocin + 5FU + Doxorubicin. In an attempt to improve response rates we performed a pilot study of 177 Lu octreotate and capecitabine chemotherapy radiosensitizing therapy comprising 4 cycles of 7.4 GBq 177 Lu-octreotate with 2 weeks 1600 mg/m 2 capecitabine, at

49 CFR 173.164 - Mercury (metallic and articles containing mercury).

Science.gov (United States)

2010-10-01

... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions

International Nuclear Information System (INIS)

Fernandez R, E.

2008-01-01

The stability constants of La 3+ , Pr 3+ , Eu 3+ , Er 3+ and Lu 3+ chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl 2+ ) or two chemical species (LnCl 2+ and LnCl 2 + ). The Specific Ion Interaction Theory was applied to the values of log β I Ln , Cl and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log β I Ln , 2Cl , due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log β I Ln , CI , log β I Ln , 2CI values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log β I Ln , Cl data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

21 CFR 173.315 - Chemicals used in washing or to assist in the peeling of fruits and vegetables.

Science.gov (United States)

2010-04-01

... peeling of fruits and vegetables. 173.315 Section 173.315 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in washing or to assist in the peeling of fruits and vegetables. Chemicals may be safely used to wash or to assist in the peeling of fruits and vegetables in accordance with the following conditions...

Radiolabeling of substance P with Lutetium-177 and biodistribution study in AR42J pancreatic tumor xenografted Nude mice

International Nuclear Information System (INIS)

Araujo, Bortoleti de; Pujatti, Priscilla Brunelli; Barrio, Ofelia; Caldeira, Jose S.; Mengatti, Jair; Suzuki, Miriam F.

2008-01-01

Pancreatic tumor (PT) is a neuroendocrine neoplasm that usually origin metastases in the respiratory and gastrointestinal tract. In recent years, new developments in targeted therapies have emerged and the presence of peptide receptors at the cell membrane of PT constitutes the basis of the clinical use of specific radiolabeled ligands. Substance P, an 11-amino acid peptide which has an important role in modulating pain transmission trough neurokinin 1 and 2 receptors (NKr), may play a role in the pathogenesis of PT, because approximately 10% of these tumors over express NKr. The aim of the present work was to produce a pure and stable SP analog (DOTA-SP) radiolabeled with Lutetium-177 ( 177 Lu), and to evaluate its in vivo target to AR42J pancreatic tumor cells in Nude mice in other to verify if SP can be used in this pancreatic tumor detection and treatment. 177 Lu (half-life 6.7 days) has both β and γ-emissions suitable for radiotherapy and imaging respectively. Substance P was successfully labeled with high yield (>99%) at optimized conditions and kept stable for more than 72 hours at 4 deg C and 24 hours in human plasma. Biodistribution studies showed that SP excretion was mainly performed by renal pathway. In addition, 177 Lu-DOTA-SP showed higher uptake by tumor than normal pancreas, indicating the presence of NK receptors in AR42J pancreatic tumor. (author)

49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

HS-173, a Novel PI3K Inhibitor, Attenuates the Activation of Hepatic Stellate Cells in Liver Fibrosis

Science.gov (United States)

Son, Mi Kwon; Ryu, Ye-Lim; Jung, Kyung Hee; Lee, Hyunseung; Lee, Hee Seung; Yan, Hong Hua; Park, Heon Joo; Ryu, Ji-Kan; Suh, Jun–Kyu; Hong, Sungwoo; Hong, Soon-Sun

2013-01-01

Hepatic stellate cells (HSCs) are the primary source of matrix components in liver disease such as fibrosis. Phosphatidylinositol 3-kinase (PI3K) signaling in HSCs has been shown to induce fibrogenesis. In this study, we evaluated the anti-fibrotic activity of a novel imidazopyridine analogue (HS-173) in human HSCs as well as mouse liver fibrosis. HS-173 strongly suppressed the growth and proliferation of HSCs and induced the arrest at the G2/M phase and apoptosis in HSCs. Furthermore, it reduced the expression of extracellular matrix components such as collagen type I, which was confirmed by an in vivo study. We also observed that HS-173 blocked the PI3K/Akt signaling pathway in vitro and in vivo. Taken together, HS-173 suppressed fibrotic responses such as cell proliferation and collagen synthesis by blocking PI3K/Akt signaling. Therefore, we suggest that this compound may be an effective therapeutic agent for ameliorating liver fibrosis through the inhibition of PI3K signaling. PMID:24326778

49 CFR 173.33 - Hazardous materials in cargo tank motor vehicles.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Hazardous materials in cargo tank motor vehicles... Transportation § 173.33 Hazardous materials in cargo tank motor vehicles. (a) General requirements. (1) No person may offer or accept a hazardous material for transportation in a cargo tank motor vehicle except as...

Study of the viability of the production of lutetium - 177 in the nuclear reactor IEA-R1 at IPEN/CNEN-SP; Estudo da viabilidade de producao do lutecio - 177 no reator nuclear IEA-R1 do IPEN/CNEN-SP

Energy Technology Data Exchange (ETDEWEB)

Silva, Giovana Pasqualini da

2008-07-01

The {sup -} emitter {sup 177} Lu is a promising therapeutic radioisotope for the curative treatment of cancer using labelled proteins. It has a half - life of 6.71 day and maximum and average (3 energies of 421 and 133 keV, respectively, resulting in a short range of irradiation of tissue. The decay is accompanied by the emission of low energy -radiation of 208.3 keV (11%) and 113 keV (6.4%), suitable for simultaneous imaging. Lu can be produced by two different routes, namely, by irradiation of natural Lu{sub 2}O{sub 3} target ({sup 176}Lu, 2.6%) or enriched (in {sup 176}Lu) Lu{sub 2}O{sub 3} target, and also by irradiation of Yb target (Yb{sub 2}O{sub 3}) followed by radiochemical separation of Lu from Yb isotopes. The objective of this work is the development of a method of the production of {sup 177} Lu through of the (n, gamma) nuclear reaction, by the direct and indirect method of production. Targets of lutetium oxide and ytterbium oxide were irradiated for evaluation of the activity produced and the chemical separation of lutetium and ytterbium was studied using different ion exchange resins. For the direct method, the best results were obtained using the target Lu{sub 2}O{sub 3} enriched in 39.6%. The best results for the indirect method were achieved with the process of separation using 0.25M - HlBA as eluent. The results showed that it is possible to produce {sup 177} Lu of low specific activity for labeling molecules used for bone pain relief and in radiosynoviortesy. (author)

49 CFR 173.195 - Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution).

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen cyanide, anhydrous, stabilized... Hazardous Materials Other Than Class 1 and Class 7 § 173.195 Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution). (a) Hydrogen cyanide, anhydrous, stabilized, must be packed in...

The kinase domain residue serine 173 of Schizosaccharomyces pombe Chk1 kinase is critical for the response to DNA replication stress

Directory of Open Access Journals (Sweden)

Naomi Coulton

2017-12-01

Full Text Available While mammalian Chk1 kinase regulates replication origins, safeguards fork integrity and promotes fork progression, yeast Chk1 acts only in G1 and G2. We report here that the mutation of serine 173 (S173A in the kinase domain of fission yeast Chk1 abolishes the G1-M and S-M checkpoints with little impact on the G2-M arrest. This separation-of-function mutation strongly reduces the Rad3-dependent phosphorylation of Chk1 at serine 345 during logarithmic growth, but not when cells experience exogenous DNA damage. Loss of S173 lowers the restrictive temperature of a catalytic DNA polymerase epsilon mutant (cdc20.M10 and is epistatic with a mutation in DNA polymerase delta (cdc6.23 when DNA is alkylated by methyl-methanesulfate (MMS. The chk1-S173A allele is uniquely sensitive to high MMS concentrations where it displays a partial checkpoint defect. A complete checkpoint defect occurs only when DNA replication forks break in cells without the intra-S phase checkpoint kinase Cds1. Chk1-S173A is also unable to block mitosis when the G1 transcription factor Cdc10 (cdc10.V50 is impaired. We conclude that serine 173, which is equivalent to lysine 166 in the activation loop of human Chk1, is only critical in DNA polymerase mutants or when forks collapse in the absence of Cds1.

49 CFR 173.477 - Approval of packagings containing greater than 0.1 kg of non-fissile or fissile-excepted uranium...

Science.gov (United States)

2010-10-01

... kg of non-fissile or fissile-excepted uranium hexafluoride. 173.477 Section 173.477 Transportation... non-fissile or fissile-excepted uranium hexafluoride. (a) Each offeror of a package containing more than 0.1 kg of uranium hexafluoride must maintain on file for at least one year after the latest...

49 CFR 173.150 - Exceptions for Class 3 (flammable and combustible liquids).

Science.gov (United States)

2010-10-01

... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS... § 173.156. (d) Alcoholic beverages. An alcoholic beverage (wine and distilled spirits as defined in 27...-on baggage; or (3) Is a Packing Group III alcoholic beverage in a packaging of 250 L (66 gallons) or...

46 CFR 173.020 - Intact stability standards: Counterballasted and non-counterballasted vessels.

Science.gov (United States)

2010-10-01

...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.020 Intact stability standards... vessel that is not equipped to counter-ballast while lifting must be shown by design calculations to... and crane radius. (b) Each vessel must have a righting arm curve with the following characteristics...

Three-quasiparticle isomer in 173Ta and the excitation energy dependence of K -forbidden transition rates

OpenAIRE

Wood, RT; Walker, PM; Lane, G J; Carroll, R. J.; Cullen, David; Dracoulis, G D; Hota, S. S.; Kibédi, T.; Palalani, N; Podolyak, Zs.; Reed, MW; Schiffl, K; Wright, A.M

2017-01-01

Using the 168Er(10B,5n) reaction at a beam energy of 68 MeV, new data have been obtained for the population and decay of a T1/2=148ns, Kπ=21/2− three-quasiparticle isomer at 1717 keV in 173Ta. Revised decay energies and intensities have been determined, together with newly observed members of a rotational band associated with the isomer. By comparison with other isomers in the A≈180 deformed region, the 173Ta isomer properties help to specify the key degrees of freedom that determine K-forbid...

49 CFR 173.134 - Class 6, Division 6.2-Definitions and exceptions.

Science.gov (United States)

2010-10-01

... transportation and also capable of cutting or penetrating skin or a packaging material. Sharps includes needles... § 173.199, as appropriate. (9) Dried blood spots or specimens for fecal occult blood detection placed on... cutting or penetrating skin or packaging material, the primary container must be capable of retaining the...

Quantifying public radiation exposure related to lutetium-177 octreotate therapy for the development of a safe outpatient treatment protocol.

Science.gov (United States)

Olmstead, Craig; Cruz, Kyle; Stodilka, Robert; Zabel, Pamela; Wolfson, Robert

2015-02-01

Radionuclide therapies, including treatment of neuroendocrine tumors with lutetium-177 (Lu-177) octreotate, often involve hospital admission to minimize radiation exposure to the public. Overnight admission due to Lu-177 octreotate therapy incurs additional cost for the hospital and is an inconvenience for the patient. This study endeavors to characterize the potential radiation risk to caregivers and the public should Lu-177 octreotate therapies be performed on an outpatient basis. Dose rate measurements of radiation emanating from 10 patients were taken 30 min, 4, and 20 h after initiation of Lu-177 octreotate therapy. Instadose radiation dose measurement monitors were also placed around the patients' rooms to assess the potential cumulative radiation exposure during the initial 30 min-4 h after treatment (simulating the hospital-based component of the outpatient model) as well as 4-20 h after treatment (simulating the discharged outpatient portion). The mean recorded dose rate at 30 min, 4, and 20 h after therapy was 20.4, 14.0, and 6.6 μSv/h, respectively. The majority of the cumulative dose readings were below the minimum recordable threshold of 0.03 mSv, with a maximum dose recorded of 0.18 mSv. Given the low dose rate and cumulative levels of radiation measured, the results support that an outpatient Lu-177 octreotate treatment protocol would not jeopardize public safety. Nevertheless, the concept of ALARA still requires that detailed radiation safety protocols be developed for Lu-177 octreotate outpatients to minimize radiation exposure to family members, caregivers, and the general public.

OBIECTUL INFRACŢIUNII PREVĂZUTE LA ART.173 CP RM

Directory of Open Access Journals (Sweden)

Mihaela BOTNARENCO

2015-11-01

Full Text Available În cadrul prezentului articol analizei este supus obiectul infracţiunii de hărţuire sexuală. Inter alia, autorul formulează definiţia conceptelor de inviolabilitate sexuală şi de libertate sexuală şi stabileşte situaţiile particulare în care aceste valori sociale şi relaţiile sociale aferente sunt proteguite prin incriminarea faptei infracţionale prevăzute la art.173 CP RM. Concomitent este studiat obiectul juridic secundar al infracţiunii de hărţuire sexuală în corelaţie cu acţiunea principală, dar şi cu acţiunea secundară din conţinutul laturii obiective a componenţei de infracţiune analizate.OBJECT OF CRIME PROVIDED BY ART.173 CRIMINAL CODE OF MOLDOVA The purpose of this article is to analyze the object of the sexual harassment. Inter alia, the author defines the notions of sexual inviolability and sexual freedom as well as identifies the specific situations when these social values and related social relationships are protected by the criminal law. Moreover, the author makes a thorough analysis of the secondary legal object of this crime in connection with main and secondary acts included in the objective side of sexual harassment.

49 CFR 173.476 - Approval of special form Class 7 (radioactive) materials.

Science.gov (United States)

2010-10-01

... (radioactive) materials must maintain on file for at least one year after the latest shipment, and provide to... evidence based on calculative methods to show that the material is able to pass the tests; or other... shipping papers as “Radioactive Material, Special Form, n.o.s.” [Amdt. 173-244, 60 FR 50307, Sept. 28, 1995...

Lithium perbromate monohydrate at 296 and 173 K

International Nuclear Information System (INIS)

Blackburn, A.C.; Gerkin, R.E.

1995-01-01

Lithium tetraoxobromate(1-) monohydrate, LiBrO 4 .H 2 O, whose perchlorate analog has not yet been described, is found to be isomorphic with NaBrO 4 .H 2 O and NaClO 4 .H 2 O. Each of the two inequivalent Li ions is coordinated by six O atoms, thus forming distorted octahedra, each of which has three inequivalent Li-O distances. At room temperature, the average Li(1)-O and Li(2)-O distances are 2.150 and 2.164 A, respectively. The perbromate ion displays very nearly regular tetrahedral geometry, although it is not subject to symmetry constraints. At 296 K the average observed Br-O distance is 1.610 (4) A and the average O-Br-O angle is 109.5 (6) , while at 173 K the corresponding values are 1.613 (4) A and 109.5 (7) . The perbromate ion shows rigid-body behavior but the lithium coordination polyhedra do not. At 296 K, the average rigid-body corrected Br-O distance in the perbromate ion is 1.624 (3) A, in excellent agreement with the corresponding value reported for NaBrO 4 .H 2 O. Refinement of the two inequivalent H atoms allowed detailed analysis of the hydrogen bonding, which is more extensive than in NaBrO 4 .H 2 O or in NaClO 4 .H 2 O. The average observed B values for the H atoms [2.9 (3) A 2 at 296 K and 2.8 (3) A 2 at 173 K] are sufficiently small to suggest that dynamic disordering of the H atoms (determined by magnetic resonance methods for NaClO 4 .H 2 O) is not significant in the title salt. (orig.)

49 CFR 173.220 - Internal combustion engines, self-propelled vehicles, mechanical equipment containing internal...

Science.gov (United States)

2010-10-01

... and vehicles with certain electronic equipment when transported by aircraft or vessel. When an... vehicles, mechanical equipment containing internal combustion engines, and battery powered vehicles or... Than Class 1 and Class 7 § 173.220 Internal combustion engines, self-propelled vehicles, mechanical...

Development of a novel bombesin analog radiolabeled with Lutetium-177: in vivo evaluation of the biological properties in Balb-C mice

International Nuclear Information System (INIS)

Pujatti, Priscilla Brunelli; Barrio, Ofelia; Santos, Josefina da Silva; Mengatti, Jair; Araujo, Elaine Bortoleti de

2008-01-01

Bombesin (BBN), a 14-aminoacid amphibian peptide homologue of mammalian gastrin-releasing peptide (GRP), has demonstrated the ability to bind with high affinity and specificity to GRP receptor, which are overexpressed on a variety of human cancers. A large number of BBN analogs were synthesized for this purpose and have shown to reduce tumor growth in mice. However, most of the studied analogs exhibit high abdominal accumulation, specially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. In this study we describe the results of radiolabeling with lutetium-177 ( 177 Lu) and in vivo biodistribution and pharmacokinetics studies in normal Balb-C mice of a novel bombesin analog (BBNp4) - DOTA-X-BBN(6-14), where X is a spacer of four aminoacids. This spacer was inserted between the chelator and the binding sequence in order to improve bombesin in vivo properties. BBNp4 was successfully labeled with high yield and kept stable for more than 96 hours at 4 deg C and 4 hours in human plasma. Data analysis obtained from the in vivo studies showed that the amount of BBNp4 present in plasma decreased rapidly and became almost undetectable at 60 min p.i., indicating rapid peptide excretion, which is performed mainly by renal pathway. In addition, biodistribution and single photon emission tomography showed low abdominal accumulation of 177 Lu-DOTA-X-BBN(6-14), indicating that this analog is a potential candidate for tumors target therapy. (author)

3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3.

Science.gov (United States)

Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki

2013-03-05

trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

Measurement of high energy neutrons via Lu(n,xn) reactions

International Nuclear Information System (INIS)

Henry, E.A.; Becker, J.A.; Archer, D.E.; Younes, W.; Stoyer, M.A.; Slaughter, D.

1997-07-01

High energy neutrons can be assayed by the use of the nuclear diagnostic material lutetium. We are measuring the (n,xn) cross sections for natural lutetium in order to develop it as a detector material. We are applying lutetium to diagnose the high energy neutrons produced in test target/blanket systems appropriate for the Accelerator Production of Tritium Project. 3 refs., 5 figs., 1 tab

Are there non-statistical effects in /sup 173/Yb(n,gamma)/sup 174/Yb?

International Nuclear Information System (INIS)

Pospisil, S.; Becvar, F.; Chrien, R.E.; Kopecky, J.

1987-01-01

The resonance-averaged capture of neutrons in 173 Yb has been studied at energy of 2 keV. With a statistical significance of 99.5% an enhancement of E1-transition to the neutron 2QP levels in 174 Yb is observed. 8 refs

A new topical hemostatic agent TT-173 reduces blood loss in a sheep model of total knee arthroplasty.

Science.gov (United States)

Centeno, Alberto; Rojas, Santiago; Arias, Belén; Miquel, Ignasi; Sánchez, Pilar; Ureta, Claudia; Rincón, Esther; López, Ramón; Murat, Jesús

2017-12-01

Total knee arthroplasty is associated with blood loss during the intervention and may require allogenic blood transfusion. Treatments such as tranexamic acid and fibrin sealants improved the bleeding control in several clinical trials, but the hemorrhage associated with the intervention is still significant. Thus far, very few studies have evaluated hemostatic treatments in animal models of total knee arthroplasty. This work describes a sheep model of bleeding associated with total knee arthroplasty and investigates a new class of hemostatic treatment based on recombinant tissue factor. Sheep were treated with the anticoagulant heparin, and the joint was accessed by a paramedial incision. Ligaments and menisci were eliminated and femoral condyles and tibia plateau were sectioned exposing the trabecular bone. An intra-articular drain was used to recover and quantify the blood loss during the 90-min period after treatment. The efficacy of one milligram and three milligrams of TT-173 was evaluated and compared with tranexamic acid. The occurrence of analytical alterations and systemic absorption was also investigated. Treatment with TT-173 reduced the blood loss in comparison with control or tranexamic acid. No significant differences were observed between the two doses evaluated. Moreover, a dose of six milligrams of TT-173 did not induce any clinical or analytical alteration, and significant systemic absorption was not observed. Data obtained strongly suggest that TT-173 could be useful in reducing the blood loss associated with total knee arthroplasty and without safety concerns derived from the systemic absorption of the product. Copyright © 2017 Elsevier B.V. All rights reserved.

Classroom Materials for Teaching "The Particle Nature of Matter." Practical Paper No. 173.

Science.gov (United States)

Pella, Milton O.; And Others

This document presents the lesson plans and tests used in the research study reported in Technical Report 173 (ED 070 658), together with descriptions of models and films developed for the teaching program. Thirty-one lessons are included, covering the topics of matter and energy; making interferences; particles; a model for matter; particles and…

Abnormal glomerular filtration rate in children, adolescents and young adults starts below 75 mL/min/1.73 m(2).

Science.gov (United States)

Pottel, Hans; Hoste, Liesbeth; Delanaye, Pierre

2015-05-01

The chronic kidney disease (CKD) classification system for children is similar to that for adults, with both mainly based on estimated glomerular filtration rate (eGFR) combined with fixed cut-off values. The main cut-off eGFR value used to define CKD is 60 mL/min/1.73 m(2), a value that is also applied for children older than 2 years of age, adolescents and young adults. Based on a literature search, we evaluated inclusion criteria for eGFR in clinical trials or research studies on CKD for children. We also collected information on direct measurements of GFR (mGFR) in children and adolescents, with the aim to estimate the normal reference range for GFR. Using serum creatinine (Scr) normal reference values and Scr-based eGFR-equations, we also evaluated the correspondence between Scr normal reference values and (e)GFR normal reference values. Based on our literature search, the inclusion of children in published CKD studies has been based on cut-off values for eGFR of >60 mL/min/1.73 m(2). The lower reference limits for mGFR far exceed this adult threshold. Using eGFR values calculated using Scr-based formulas, we found that abnormal Scr levels in children already correspond to eGFR values that are below a cut-off of 75 mL/min/1.73 m(2). Abnormal GFR in children, adolescents and young adults starts below 75 mL/min/1.73 m(2), and as abnormality is a sign of disease, we recommend referring children, adolescents and young adults with an (e)GFR of <75 mL/min/1.73 m(2) for further clinical assessment.

Development of the common law in view of Sections 39(2) and 173 ...

African Journals Online (AJOL)

The common (or non-statutory) law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the ...

Phase equilibria in the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K

Energy Technology Data Exchange (ETDEWEB)

Han, Feng; Luo, Hao [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Zhan, Yongzhong [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Guangxi Univ., Nanning (China). Center of Ecological Collaborative Innovation for Aluminum Industry

2017-10-15

The isothermal section of the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K has been experimentally determined. All equilibrated alloys were characterized via X-ray powder diffraction and scanning electron microscopy equipped with energy-dispersive X-ray analysis. A ternary phase Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} was found at 1 173 K. The experimental results show that the isothermal section consists of 11 single-phase regions, 26 two-phase regions and 13 three-phase regions. The existence of eight compounds, i.e. ZrSi{sub 2}, ZrSi, Zr{sub 5}Si{sub 4}, Zr{sub 3}Si{sub 2}, Zr{sub 2}Si, ZrB, ZrB{sub 2} and Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} in this system has been confirmed in the Zr-Si-ZrB{sub 2} region at 1 173 K.

49 CFR 173.9 - Transport vehicles or freight containers containing lading which has been fumigated.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Transport vehicles or freight containers... MATERIALS REGULATIONS SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.9 Transport... hazardous material. (b) No person may offer for transportation or transport a rail car, freight container...

3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3

Science.gov (United States)

Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki

2013-01-01

trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

Comparative performance of the CKD Epidemiology Collaboration (CKD-EPI) and the Modification of Diet in Renal Disease (MDRD) Study equations for estimating GFR levels above 60 mL/min/1.73 m2.

Science.gov (United States)

Stevens, Lesley A; Schmid, Christopher H; Greene, Tom; Zhang, Yaping Lucy; Beck, Gerald J; Froissart, Marc; Hamm, Lee L; Lewis, Julia B; Mauer, Michael; Navis, Gerjan J; Steffes, Michael W; Eggers, Paul W; Coresh, Josef; Levey, Andrew S

2010-09-01

The Modification of Diet in Renal Disease (MDRD) Study equation underestimates measured glomerular filtration rate (GFR) at levels>60 mL/min/1.73 m2, with variable accuracy among subgroups; consequently, estimated GFR (eGFR)>or=60 mL/min/1.73 m2 is not reported by clinical laboratories. Here, performance of a more accurate GFR-estimating equation, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation, is reported by level of GFR and clinical characteristics. Test of diagnostic accuracy. Pooled data set of 3,896 people from 16 studies with measured GFR (not used for the development of either equation). Subgroups were defined by eGFR, age, sex, race, diabetes, prior solid-organ transplant, and body mass index. eGFR from the CKD-EPI and MDRD Study equations and standardized serum creatinine. Measured GFR using urinary or plasma clearance of exogenous filtration markers. Mean measured GFR was 68+/-36 (SD) mL/min/1.73 m2. For eGFR73 m2, both equations have similar bias (median difference compared with measured GFR). For eGFR of 30-59 mL/min/1.73 m2, bias was decreased from 4.9 to 2.1 mL/min/1.73 m2 (57% improvement). For eGFR of 60-89 mL/min/1.73 m2, bias was decreased from 11.9 to 4.2 mL/min/1.73 m2 (61% improvement). For eGFR of 90-119 mL/min/1.73 m2, bias was decreased from 10.0 to 1.9 mL/min/1.73 m2 (75% improvement). Similar or improved performance was noted for most subgroups with eGFR73 m2, other than body mass indexor=90 mL/min/1.73 m2. Limited number of elderly people and racial and ethnic minorities with measured GFR. The CKD-EPI equation is more accurate than the MDRD Study equation overall and across most subgroups. In contrast to the MDRD Study equation, eGFR>or=60 mL/min/1.73 m2 can be reported using the CKD-EPI equation. Copyright (c) 2010 National Kidney Foundation, Inc. All rights reserved.

49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and...

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Transport requirements for low specific activity... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.427 Transport requirements for low specific... must be transported in accordance with the following conditions: (1) The external dose rate may not...

Fermented Milk Containing Bifidobacterium lactis DN-173 010 in Childhood Constipation: A Randomized, Double-Blind, Controlled Trial

NARCIS (Netherlands)

Tabbers, Merit M.; Chmielewska, Ania; Roseboom, Maaike G.; Crastes, Nolwenn; Perrin, Catherine; Reitsma, Johannes B.; Norbruis, Obbe; Szajewska, Hania; Benninga, Marc A.

2011-01-01

BACKGROUND: Constipation is a frustrating symptom affecting 3% of children worldwide. A fermented dairy product containing Bifidobacterium lactis strain DN-173 010 was effective in increasing stool frequency in constipated women. Our aim was to assess the effects of this product in constipated

Scintillation properties and X-ray irradiation hardness of Ce3+-doped Gd2O3-based scintillation glass

International Nuclear Information System (INIS)

Liu, Liwan; Shao, Chongyun; Zhang, Yu; Liao, Xili; Yang, Qiuhong; Hu, Lili; Chen, Danping

2016-01-01

Ce 3+ -doped Gd 2 O 3 -based scintillation glasses are prepared within an air or CO atmosphere. The effects of fluorine, lutetium, barium, and the melting atmosphere on the optical properties, scintillation properties and irradiation hardness are studied. Absorption spectra, luminescence spectra under UV and X-ray excitation, and the X-ray radiation-induced spectra are presented. The results show that the density can be increased by doping with fluorine, lutetium and barium. The luminescence intensity decreases after X-ray irradiation. Because of charge transfer quenching, fluorine and lutetium enhance the UV-excited and X-ray excited luminescence intensity, but barium decreases. Moreover, fluorine and lutetium are advantageous to irradiation hardness while barium is not. In addition, a non-reducing atmosphere provides a higher irradiation hardness than a reducing atmosphere. Fluorine-doped glass is promising to enhance luminescence intensity, promote irradiation hardness, and increase the density.

Multi-quasi-particle states in 173Hf

International Nuclear Information System (INIS)

Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

1991-01-01

Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd( 18 O, 5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 13/2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3qp states are the previously known K π =19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π =(13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5qp state with K π =(29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. (orig.)

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Study on gamma rays from the 173Ybsub (n,γ) 174Yb reaction with resonance neutrons

International Nuclear Information System (INIS)

Aldea, L.; Bechvarzh, F.; Gonzatko, Ya.; Pospishil, S; Telezhnikov, S.A.

1976-01-01

Relative intensities of primary transitions from individual 173 Yb + n resonances were measured. For 9 resonances with Jsub (π) = 2 - and for 8 transitions an experimental correlation coefficient Rsub(exp) = 0.40 between GITAsub(n lambda) 0 deg and Isub(*g lambda f) / Esub(*g) 5 deg was found to have a significance level 99.8 %

Multi-quasi-particles states in 173Hf

International Nuclear Information System (INIS)

Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

1990-10-01

Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd ( 18 O,5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 1 3 /2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3 qp states are the previously known K π 19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π = (13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5 qp state with K π = (29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. 28 refs., 2 tabs., 9 figs

49 CFR 173.301 - General requirements for shipment of compressed gases and other hazardous materials in cylinders...

Science.gov (United States)

2010-10-01

... less; (vi) A fire extinguisher; or (vii) A “B” style cylinder with a capacity of 40 ft 3 (1.13 m3) or an “MC” style cylinder with a capacity of 10 ft 3 (0.28m3) containing acetylene. (2) For cylinders... citations affecting § 173.301, see the List of CFR Sections Affected, which appears in the Finding Aids...

Studies of the radiolabeling and biodistribution of substance P using lutetium-177 as a radiotracer

International Nuclear Information System (INIS)

Lima, Clarice Maria de

2011-01-01

Malignant gliomas are primary brain tumors, resistant to various treatments, as chemotherapy, radiotherapy, induction of apoptosis and surgery. An alternative for the treatment of malignant gliomas is the radionuclide therapy. This technique apply radiolabeled molecules that selectively bind to tumor cells producing cytotoxic effect by dose irradiation, and resulting in death of tumor cells. Most protocols for radionuclide therapy of malignant brain tumors involve the administration of peptides labeled with β - emitting radioisotopes. The Substance P (SP) is an 11- amino acid neuropeptide, characterized by the C-terminal sequence Phe-X-Gly-Leu-Met-NH 2 . The use of SP labeled with different radionuclides including 177 Lu, have been proposed for in vivo treatment of tumors. SP is the most important target of neurokinin 1 receptors, over expressed in malignant gliomas. The objective of this work was to study conditions of radiolabeling DOTA-SP with 177 Lu, the stability of labeled compound and in vivo and in vitro, to develop a protocol production and evaluate the potential of the radiopharmaceutical in the therapy of gliomas. The labeling conditions were optimized varying the temperature, reaction time, activity of lutetium-177 chloride and mass of DOTA-SP. The radiochemical purity of preparations were analyzed by chromatographic techniques. The stability of 17L u -DOTA- SP radiolabeled with low activity of 177 Lu was evaluated for different time at 2-8 degree C or incubated in human serum. The stability of the labeled with high activity of 177 Lu was also analyzed in the presence of gentisic acid (6 mg / mL) added after the labeling reaction. The labeled conditions in low and high activity were subjected to evaluation for the ability to cause oxidation of methionine residue, adding the D-L- methionine amino acid to the reaction medium (6 mg / mL) and subsequent chromatographic evaluation. In vitro study with 177 Lu-DOTA-SP, radiolabeled in the absence and presence

Solvent extraction of lanthanum (III), europium (III), and lutetium (III) with 5,7-dichloro-8-quinolinol into chloroform in the absence and presence of tetrabutylammonium ions or trioctylphosphine oxide

International Nuclear Information System (INIS)

Noro, Junji; Sekine, Tatsuya.

1993-01-01

The solvent extractions of lanthanum(III), europium(III), and lutetium(III) (M 3+ ) in 0.1 moldm -3 sodium nitrate solutions with 5,7-dichloro-8-quinolinol (HA) into chloroform were studied in both the absence and presence of tetrabutylammonium ions (tba + ) or trioctylphosphine oxide (TOPO). In the absence of tba + or TOPO, the extracted species were the MA 3 and MA H A (self-adduct), though MA 4 - tba + was found when tba + was added; MA 3 TOPO and MA 3 (TOPO) 2 were found when TOPO was added in addition to the above mentioned two species. The anionic complex or TOPO adducts greatly enhanced the extraction. The data were statistically analyzed and the equilibrium constants for the extraction of these species, as well as the constants for the association of the HA, the A - tba + , or the TOPO on the MA 3 in the organic phase, were determined. The extraction of the MA 3 is better in the order LaA 3 3 3 . Although the values of the association constant of the HA or the TOPO on the MA 3 are rather similar for the three metal chelates, the constants for A - tba + are larger in the same order as mentioned above. Thus, the separation of these three metal ions by solvent extraction with this chelating extractant is not much affected by the addition of TOPO, but is greatly improved by the addition of tba + . (author)

49 CFR Appendix B to Part 173 - Procedure for Testing Chemical Compatibility and Rate of Permeation in Plastic Packaging and...

Science.gov (United States)

2010-10-01

... Rate of Permeation in Plastic Packaging and Receptacles B Appendix B to Part 173 Transportation Other... Plastic Packaging and Receptacles 1. The purpose of this procedure is to determine the chemical compatibility and permeability of liquid hazardous materials packaged in plastic packaging and receptacles...

Study of heat conductivity, electric conductivity and thermo-emf of BiSrCaCu2Ox and Bi1.82Sr1.73Ca1.73Ca1.25Cu2.2Ox systems

International Nuclear Information System (INIS)

Zhukova, T.B.; Parfen'eva, L.S.; Popov, V.V.; Melekh, B.T.; Smirnov, I.A.; Khalmedov, Kh.M.

1991-01-01

Phase compositions are determined and temperature dependences are measured of x-heat conductivity, ρ-electric resistance and α-thermo-emf of polycrystal, monophase, highly textured HTSC samples of BiSrCaCu 2 O x and Bi 1.82 Sr 1.73 Ca 1.25 Cu 2.2 O x produced through method of direct induction melting in the air in a cold container. Sample 'aging' after storage in the air and vacuum, leading to decrease in the number of foring phases and increase in the basic phase content as well as to change of x, ρ and α coefficients is identified

The human story of Crew 173- capturing a Mars analog mission

Science.gov (United States)

Shaw, Niamh; Musilova, Michaela; Pons Lorente, Arnau; Sisaid, Idriss; Naor, Roy; Blake, Richard

2017-04-01

An international crew of six scientists, engineers, artists and entrepreneurs with different space specialisations were selected by the Mars Society to take part in a Martian simulation in January 2017. An ambitious outreach and media strategy was developed, aimed at communicating the benefits of missions to Mars to the public and to capture the public's interest by telling the human story of the crew's mission. Entitled Crew 173 Team PRIMA, they entered the Mars Desert Research Station in the Utah Desert and conducted research in 3D printing, hydroponics, geology and astronomy. Both the scientific and community experience of this mission was documented through still image, video, audio, diary and daily journalling by the resident artist of the mission, Niamh Shaw. The full experience of the crew was documented (before, during and after the expedition), to capture each individual experience of the crew and the human experience of isolation of future human space missions.

High-Performance Low-Cost Portable Radiological and Nuclear Detectors Based on Colloidal Nanocrystals (TOPIC 07-B)

Science.gov (United States)

2016-07-01

The synthesized CNCs were optically very active and demonstrated very bright luminescence even under UV lamp excitation at room...temperature (Fig. 8.15). Fig. 8.16 shows absorption, Fig. 8.15. Visible luminescence from Pb3O2I2 under UV lamp excitation. M. Osiński, High-Performance Low...QCS - low-dimensional quantum confinement system LEDs – light-emitting diodes LuAG – lutetium aluminum garnet LYSO – lutetium yttrium

Development of lutetium-labeled bombesin derivates: relationship between structure and diagnostic-therapeutic activity for prostate tumor

International Nuclear Information System (INIS)

Pujatti, Priscilla Brunelli

2009-01-01

Bombesin (BBN) receptors - in particular, the gastrin-releasing peptide (GRP) receptor peptide - have been shown to be massively over expressed in several human tumors types, including prostate cancer, and could be an alternative as target for its treatment by radionuclide therapy (RNT). A large number of BBN analogs had already been synthesized for this purpose and have shown to reduce tumor growth in mice. Nevertheless, most of the studied analogs exhibit high abdominal accumulation, especially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. The goal of the present work was to radiolabel a novel series of bombesin derivatives with lutetium-177 and to evaluate the relationship between their structure and diagnostic-therapeutic activity for prostate tumor. The generic structure of studied peptides is DOTA-Phe-(Gly) n -BBN(6-14), where DOTA is the chelator, n is the number of glycine amino acids of Phe-(Gly) n spacer and BBN(6-14) is the bombesin sequence from the amino acid 6 to the amino acid 14. Preliminary studies were done to establish the ideal labeling conditions for obtaining the highest yield of labeled bombesin derivatives, determined by instant thin layer chromatography (ITLC-SG) and high performance liquid chromatography (HPLC). The stability of the preparations was evaluated either after storing at 2-8 degree C or incubation in human serum at 37 degree C and the partition coefficient was determined in n:octanol:water. In vivo studies were performed in both healthy Balb-c and Nude mice bearing PC-3 xenografts, in order to characterize the biological properties of labeled peptides. In vitro studies involved the evaluation of cold bombesin derivatives effect in PC-3 cells proliferation. Bombesin derivatives were successfully labeled with high yield at optimized conditions and exhibited high stability at 4 degree C. The analysis of the

Ontwikkeling van die gemenereg in die lig van artikel 39(2 en 173 van die Grondwet

Directory of Open Access Journals (Sweden)

LTC Harms

2004-10-01

Full Text Available DEVELOPMENT OF THE COMMON LAW IN VIEW OF SECTIONS 39(2 AND 173 OF THE CONSTITUTIONThe point of departure in the Constitution is that the existing legal order should largely be kept intact, despite the fact that this is disliked by some. The common (or non-statutory law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the common law with reference to especially the boni mores, moral standards and the common notion of what is right and fair. The Bill of Rights now is a source and summation of such notion.At times there had been an exaggerated call for petere fontes. The Courts however still have the competence to adapt the law to serve commercial and other needs, even without reference to the Bill of Rights. The underlying principles of the common law are largely, though not in all respects, consistent with the Bill of Rights. There is an essential distinction between the development of a rule of the common law in accordance with constitutional norms, and the invalidation of a rule which is inconsistent with the Constitution. Courts tend not to make this distinction and this leads to inconsistencies. Some believe that the common law is perfect and unaffected by the Bill of Rights. Others consider the Bill of Rights to have granted the judiciary a hunting license on the common law, making the positive law a matter of judicial discretion and allowing the courts to infringe upon the domain of the legislature and to ignore precedents. The common law consists of a myriad rules developed over many centuries involving great minds. It represents a fine web, the disturbance of which at one point may have severe unexpected consequences elsewhere. The new era makes extraordinary demands on judicial officers. The

Study of CPO resonances on the intercombination line in 173Yb

Science.gov (United States)

Kumar, Pushpander; Singh, Alok K.; Bharti, Vineet; Natarajan, Vasant; Pandey, Kanhaiya

2018-02-01

We study coherent population oscillations in an odd isotope of the two-electron atom Yb. The experiments are done using magnetic sublevels of the {F}g=5/2\\to {F}e=3/2 hyperfine transition in 173Yb of the {}1{{{S}}}0\\to {}3{{{P}}}1 intercombination line. The experiments are done both with and without an applied magnetic field. In the absence of an applied field, the complicated sublevel structure along with the saturated fluorescence effect causes the linewidth to be larger than the 190 kHz natural linewidth of the transition. In the presence of a field (of magnitude 330 mG), a well-defined quantization axis is present which results in the formation of two M-type systems. The total fluorescence is then limited by spin coherence among the ground sublevels. In addition, the pump beam gets detuned from resonance which results in a reduced scattering rate from the {}3{{{P}}}1 state. Both of these effects result in a reduction of the linewidth to a subnatural value of about 100 kHz.

41 CFR 302-9.173 - How many replacement POV's may my agency authorize me to transport to my post of duty at...

Science.gov (United States)

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false How many replacement POV's may my agency authorize me to transport to my post of duty at Government expense? 302-9.173... How many replacement POV's may my agency authorize me to transport to my post of duty at Government...

Extraction of nitrates of lanthanoids (3) of the yttrium group and yttrium (3) by trialkylbenzylammonium nitrate in toluene

International Nuclear Information System (INIS)

Pyartman, A.K.; Kovalev, S.V.; Keskinov, V.A.; Kopyrin, A.A.

1997-01-01

A study was made on extraction of nitrates of lanthanoids (3) of the yttrium group (terbium-lutetium) and yttrium (3) by trialkylbensylammonium nitrate in toluene at T=298.15 K pH 2. Extraction isotherms are described with account of formation of compound of (R 4 N) 2 [Ln(NO 3 ) 5 ] composition in organic phase. Values of extraction constants decreasing in terbium (3)-lutetium (3) series, were calculated. Value of extraction constant for yttrium (3) is close to the value of extraction constant for ytterbium (3). 13 refs., 2 figs., 3 tabs

The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

KAUST Repository

Lancellotti, S.

2015-08-13

Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

KAUST Repository

Lancellotti, S.; Peyvandi, F.; Pagliari, M.; Cairo, A.; Abdel-Azeim, Safwat; Chermak, Edrisse; Lazzareschi, I.; Mastrangelo, S.; Cavallo, Luigi; Oliva, R.; De Cristofaro, R.

2015-01-01

Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

Macrophage Migration Inhibitory Factor Promoter Polymorphisms (−794 CATT5–8 and −173 G>C: Relationship with mRNA Expression and Soluble MIF Levels in Young Obese Subjects

Directory of Open Access Journals (Sweden)

Inés Matia-García

2015-01-01

Full Text Available We analyzed the relationship of −794 CATT5–8 and −173 G>C MIF polymorphisms with mRNA and soluble MIF in young obese subjects. A total of 250 young subjects, 150 normal-weight and 100 obese subjects, were recruited in the study. Genotyping of −794 CATT5–8 and −173 G>C MIF polymorphisms was performed by PCR and PCR-RFLP, respectively. MIF mRNA expression was determined by real-time PCR and serum MIF levels were measured using an ELISA kit. For both MIF promoter polymorphisms, no significant differences in the genotype and allele frequencies between groups were observed. MIF mRNA expression was slightly higher in obese subjects than in normal-weight subjects (1.38-fold, while soluble MIF levels did not show differences between groups. In addition, we found an increase in MIF mRNA expression in carriers of the 6,6 and C/C genotypes and the 6G haplotype of the −794 CATT5–8 and −173 G>C MIF polymorphisms, although it was not significant. In conclusion, this study found no relationship between obesity and MIF gene promoter polymorphisms with MIF mRNA expression in young obese subjects.

Laparoscopic Heller-Dor for primary esophageal achalasia: outcomes in 173 patients.

Science.gov (United States)

Rosati, Riccardo; Fumagalli Romario, Uberto; Ceolin, Martina; Massaron, Simonetta; Peracchia, Alberto

2013-01-01

Laparoscopic Heller myotomy combined with anterior (Dor) fundoplication is the most widely-used surgical procedure for treating esophageal achalasia in Europe From November 1992 through May 2010 we performed laparoscopic Heller-Dor on 173 patients Conversion to laparotomy was required in three cases (1.7%) at the beginning of the experience (for mucosal) perforation which was the most frequent intraoperative complication, managed laparoscopically with the increasing experience. Five (2.9%) cases had minor postoperative complications. Clinical results were satisfactory in 99.4% of cases. One patient (0.6%) had severe persistent dysphagia. Mean esophageal diameter decreased from 50 mm ± 12 (range 20- 90) to 25 mm ± 7 (range 15-80). Lower esophageal sphincter pressure decreased from 32 mmHg (median, range 10- 93) pre-operatively to 11 mmHg (median, range 5-21) at one year follow up and residual pressure from 12 mmHg (median, range 3-30) to 4 mmHg (median, range 1-8). Impedance and pH monitoring showed normal levels in 39/47 (83%) patients who agreed to testing. The good outcomes of this experience, in part due to careful adherence to technical aspects of the operation, confirm that the laparoscopic Heller-Dor is the gold standard surgical treatment for esophageal achalasia.

Fibroblast Growth Factor-23 and Vitamin D Metabolism in Subjects with eGFR ≥60 ml/min/1.73 m².

Science.gov (United States)

Nakatani, Shinya; Nakatani, Ayumi; Tsugawa, Naoko; Yamada, Shinsuke; Mori, Katsuhito; Imanishi, Yasuo; Ishimura, Eiji; Okano, Toshio; Inaba, Masaaki

2015-01-01

Fibroblast growth factor (FGF)-23 and parathyroid hormone (PTH) are both potent phosphaturic hormones. Since they exert opposite effects on vitamin D metabolism, the measurement of 3 vitamin D metabolites; 25-hydroxyvitamin D (25-OH-D), 1,25-dihydroxyvitamin D (1,25(OH)2D), and 24,25-dihydroxyvitamin D (24,25(OH)2D), allows the distinction of the effects of FGF-23 from those of PTH. The aim of this study was to elucidate which factor, FGF-23 or PTH, plays a more important role in the regulation of vitamin D metabolites in subjects with estimated glomerular filtration (eGFR) ≥60 ml/min/1.73 m(2). Subjects with eGFR ≥60 ml/min/1.73 m(2) (n = 20) were enrolled and their serum levels of FGF-23, intact PTH, and vitamin D metabolites were determined. Serum FGF-23 correlated inversely with 1,25(OH)2D (r = -0.717, p = 0.0004) and the 1,25(OH)2D/25-OH-D ratio (r = -0.518, p = 0.019), compared with a significant positive correlation between serum intact PTH and the 1,25(OH)2D/25-OH-D ratio (r = 0.562, p = 0.010). Multiple regression analyses revealed serum FGF-23 as a significant factor that was associated with serum 1,25(OH)2D (β = -0.593, p = 0.018), 1,25(OH)2D/25-OH-D ratio (β = -0.521, p = 0.025), and the 24,25(OH)2D/1,25(OH)2D ratio (β = 0.632, p = 0.008), and intact PTH as a significant factor associated with the 1,25(OH)2D/25-OH-D ratio (β = 0.445, p = 0.028). This study demonstrated that, even in subjects with eGFR ≥60 ml/min/1.73 m(2), FGF-23 might play an important role in the regulation of vitamin D metabolism. In addition to the established role of PTH, the association between FGF-23 and indices of vitamin D metabolism suggested the potential role of FGF-23 on phosphate metabolism in such patients. © 2015 S. Karger AG, Basel.

Method of isolation of traces of americium by using the +6 oxidation state properties

International Nuclear Information System (INIS)

Kwinta, Jean; Michel, Jean-Jacques

1969-05-01

The authors present a method to separate traces of americium from a solution containing fission products and actinides. This method comprises the following steps: firstly, the oxidation of americium at the +6 state by ammonium persulfate and carrying over of actinides and III and IV lanthanides by lanthanum fluoride; secondly, the reduction by hydrazine of the oxidized americium and carrying over of the reduced americium by lutetium fluoride; and thirdly, the americium-lutetium separation by selective extractions either with di 2 ethyl hexyl phosphoric acid, or by fractionated elution on an anionic resin column by a mixture of nitric acid and methanol [fr

Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571).

Science.gov (United States)

Tabbers, Merit M; Chmielewska, Ania; Roseboom, Maaike G; Boudet, Claire; Perrin, Catherine; Szajewska, Hania; Benninga, Marc A

2009-03-18

Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30-50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency fermented dairy product is effective in the treatment of constipated children with a defecation frequency fermented dairy product containing Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5-10 minutes after each meal (3 times a day) and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence), adverse effects (nausea, diarrhoea, bad taste) and intake of rescue medication (Bisacodyl). Rate of success and rate of responders are also evaluated, with success defined as > or = 3 bowel movements per week and or = 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary) will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. This study is aimed to show that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency after 3 weeks of product consumption in children with functional constipation and a defecation

Determination of the constants of the solubility product of Ln(OH)3 and the effect of the chloride ions on the lanthanum hydrolysis, praseodymium and lutetium in aqueous solutions of ion force 2 Molar

International Nuclear Information System (INIS)

Lopez G, H.D.

2005-01-01

The behavior of lanthanum (III), praseodymium (III), and lutetium (III) was studied in 2 M NaClO 4 (aq) and 2 M NaCl (aq) at 303 K and free -CO 2 conditions. Solubility diagrams (p Ln(aq)-pC H ) were obtained by means of a radiochemical method. The pC H borderlines of saturation and unsaturation zones of the solutions and solubility product constants for Ln(OH) 3 were determined from these diagrams. The fitting of the solubility equation to the experimental values of p Ln(aq)-pC H diagrams allowed the calculation of the first hydrolysis and solubility product constants. Independently, the stability constants for the first species of hydrolysis were determined by means of pH titrations, the data were treated with the program SUPERQUAD and fitted to the mean ligand number equation. The stability constants for the species LnCl 2+ were as well calculated in 2M ionic strength and 303 K from the hydrolysis constant values obtained in both perchlorate and chloride media. The values obtained for La, Pr and Lu were: logK ps : 21.11 ± 0.09, 19.81 ± 0.11 and 18.10 ± 0.13 in 2M NaClO 4 ; logK ps : 22.22 ± 0.09, 21.45 ± 0.14 and 18.52 ± 0.29 in 2M NaCl; log β 1 : - 8.64 ± 0.02, - 8.37 ± 0.01 and - 7.95 ± 0.11 in 2M NaClO 4 ; log β 1 / : - 9.02 ± 0.11, - 8.75 ± 0.01 and - 8.12 ± 0.03 in 2M NaCl and the values for log β 1,Cl were - 0.0255, - 0.155 and - 0.758, respectively. (Author)

[Acute ethanol intoxication among children and adolescents. A retrospective analysis of 173 patients admitted to a university children hospital].

Science.gov (United States)

Schöberl, S; Nickel, P; Schmutzer, G; Siekmeyer, W; Kiess, W

2008-01-01

In the last time the alcohol consumption among children and adolescents is a big theme in all kind of media. The ethanol consumption among children and adolescents has risen during the last years, but also new hazardous drinking patterns like "binge-drinking" are increasing. These drinking episodes are responsible for many hospital presentations of children and adolescents with acute ethanol intoxication. This study is a retrospective analysis of 173 patients admitted to the university children hospital of Leipzig due to acute ethanol intoxication during the period 1998-2004. Investigated parameters were: socio-demographic factors, clinical presentation and management as well as quantity and type of alcohol. During the years 1998-2004 the rate of alcohol intoxicated patients in this study increased, from 1998-2003 at about 171.4%. Totally 173 patients with an average age of 14.5 years were admitted to the university children hospital. There were significantly more boys than girls. The mean blood alcohol concentration of these patients was 1.77%. Some of the patients had severe symptoms. 62 were unconscious, 2 were in coma and at least 3 patients had to be ventilated. A difference between socioeconomic groups could be observed by comparing the different school types. 44.8% of the patients went to the middle school. Furthermore 17 patients of this study had mental disorders or psychosocial problems and were therefore in psychological or psychiatric treatment. In this study a significant influence of social classes or psychosocial problems on alcohol consumption such as binge-drinking leading to acute ethanol intoxication could not be found. Alarming is the increasing number of ethanol intoxicated patients, the young age, the high measured blood ethanol concentrations and the severe symptoms of these patients. This is the reason why early and intensive prevention strategies are required.

Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571

Directory of Open Access Journals (Sweden)

Perrin Catherine

2009-03-01

Full Text Available Abstract Background Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30–50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency Methods/design It is a two nation (The Netherlands and Poland double-blind, placebo-controlled randomised multicentre trial in which 160 constipated children (age 3–16 years with a defecation frequency Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5–10 minutes after each meal (3 times a day and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence, adverse effects (nausea, diarrhoea, bad taste and intake of rescue medication (Bisacodyl. Rate of success and rate of responders are also evaluated, with success defined as ≥ 3 bowel movements per week and ≤1 faecal incontinence episode over the last 2 weeks of product consumption and responder defined as a subject reporting a stool frequency ≥ 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. Conclusion This

Luminescent determination of trace amounts of terbium using diantipyrylmethane and salicylic acid

Energy Technology Data Exchange (ETDEWEB)

Tishchenko, M A; Gerasimenko, G I; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Inst. Obshchej i Neorganicheskoj Khimii

1978-01-01

To elucidate the possibility of using pyrazolone-5-diantipyril-methane (DAM) derivative for determination of terbium microimpurities, the conditions have been studied of luminescent determination of terbium in complex compounds containing an ion of rare-earth element, diantipyrilmethane, and salicylic acid (Sal.). The ratio between the components in the complex REE-DAM-Sal is 1:1:3. La, Y, Gd do not affect the luminescence intensity of terbium complex. A luminescent method of determining terbium traces in highly pure oxides of lanthanum, gadolinium, lutetium, and yttrium has been developed in which suspensions of complex precipitation are used. The amount of terbium determined in oxide of lanthanum, gadolinium, and lutetium is (1-5)x10/sup -6/% and (2-3)x10/sup -5/% in yttrium oxide.

Revisão radiológica de 173 casos consecutivos de paracoccidioidomicose Radiological review of 173 consecutive cases of paracoccidioidomycosis

Directory of Open Access Journals (Sweden)

Henrique Simão Trad

2006-06-01

Full Text Available OBJETIVO: Revisar e determinar a incidência dos achados radiológicos mais importantes da paracoccidioidomicose, e verificar as possíveis variantes de suas apresentações. MATERIAIS E MÉTODOS: Foram revistos 173 casos consecutivos de paracoccidioidomicose, atendidos no período de 1970 a 1980. Os estudos radiológicos direcionados a cada caso foram reanalisados por no mínimo dois radiologistas experientes. RESULTADOS: Foram encontrados 94 casos de acometimento pulmonar isolado e 38 de acometimento pulmonar associado a lesões ganglionares, viscerais, ósseas e à tuberculose. Sem envolvimento pulmonar foram encontrados 41 casos, com lesões intestinais, viscerais, ósseas ou combinadas. Os principais achados radiológicos da forma pulmonar foram opacidade intersticial reticular e nodular bilateral, seguida por consolidação, também bilateral. As formas visceral e intestinal apresentaram lesões predominantes no fígado, jejuno e íleo. Na forma ganglionar houve predominância do comprometimento difuso abdominal e periférico, e no ósseo, áreas de lise principalmente em ossos longos e clavícula. CONCLUSÃO: A paracoccidioidomicose é doença granulomatosa comum no Brasil, acometendo principalmente o pulmão, tendo como porta de entrada a inalação dos esporos do fungo. Outras formas desta doença, menos freqüentes ou raras, devem ser permanentemente lembradas no diagnóstico diferencial.OBJECTIVE: To determine the incidence of most significant radiological findings of paracoccidioidomycosis and to verify its possible variants. MATERIALS AND METHODS: One hundred and seventy-three cases of paracoccidioidomycosis presented between 1970 and 1980 were reviewed, including their radiological workup reanalysis by at least two experienced radiologists. RESULTS: Ninety-four cases were pulmonary only and 38 were pulmonary associated with ganglial, visceral and osseous lesions or in association with tuberculosis. There was no pulmonary

Labeling of peptides and antibodies against different receptor human epidermal growth factors with different radionuclides and chemical and biological evaluation

International Nuclear Information System (INIS)

Calzada, V.

2011-01-01

This Master thesis presented at the University of the Oriental Republic of Uruguay, School of Chemistry studies the following topics: quality control in nuclear medicine, radiopharmaceuticals such as technetium and lutetium

Triangular flow of negative pions emitted in PbAu collisions at $\\sqrt{S_{NN}} = 17.3$ GeV

CERN Document Server

Adamová, D.

Differential triangular flow, $v_3(p_T)$, of negative pions is measured at $\\sqrt{s_{NN}}$= 17.3~GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30\\% with a mean centrality of 5.5\\%. This is the first measurement of the triangular flow at SPS energies. The $p_T$ range extends from about 0.05~GeV/c to more than 2~GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydro calculation combined with an UrQMD cascade model for the late stages.

The joint PNC-ORNL tank calibration experiment of 1991

International Nuclear Information System (INIS)

Smith, D.H.; Bostick, D.A.; McBay, E.H.; Carter, J.A.; Ehinger, M.H.

1991-11-01

A tank calibration experiment was carried out using the lutetium double spike technique as part of the joint PNC-DOE effort to establish nuclear safeguards at reprocessing plants. The experiment used a 3000 liter tank containing about 100g/L depleted uranium. Results were less than ideal, but the reasons for this are understood. The discussions between the two organizations were highly beneficial. The experiment served to identify two problems in the procedure that must be solved before anything else is tried: 1. Quantitative mixing of tracer of tank contents has not been achieved at PNC. This must be corrected. 2. A chemical procedure to isolate lutetium in a form compatible with good mass spectrometric analysis must be developed. It must be amenable to use in a hot cell. 6 refs., 6 figs., 2 tabs

Structural investigations of Lu.sub.2./sub.O.sub.3./sub. as single crystal and polycrystalline transparent ceramic

Czech Academy of Sciences Publication Activity Database

Guzik, M.; Pejchal, Jan; Yoshikawa, A.; Ito, A.; Goto, T.; Siczek, M.; Lis, T.; Boulon, J.

2014-01-01

Roč. 14, č. 7 (2014), 3327 -3334 ISSN 1528-7483 Institutional support: RVO:68378271 Keywords : lutetium oxide * structure * crystal growth * ceramics Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.891, year: 2014

Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions; Determinacion de las constantes de estabilidad de los complejos de lantano, praseodimio, europio, erbio y lutecio con iones cloruro

Energy Technology Data Exchange (ETDEWEB)

Fernandez R, E [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

2008-07-01

The stability constants of La{sup 3+}, Pr{sup 3+}, Eu{sup 3+}, Er{sup 3+} and Lu{sup 3+} chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl{sup 2+}) or two chemical species (LnCl{sup 2+} and LnCl{sub 2}{sup +}). The Specific Ion Interaction Theory was applied to the values of log {beta}{sup I}{sub Ln},{sub Cl} and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log {beta}{sup I}{sub Ln},{sub 2Cl}, due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log {beta}{sup I}{sub Ln},{sub CI}, log {beta}{sup I}{sub Ln},{sub 2CI} values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log {beta}{sup I}{sub Ln},{sub Cl} data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

Luminescence and scintillation properties of rare-earth-doped LuF.sub.3./sub. scintillation crystals

Czech Academy of Sciences Publication Activity Database

Pejchal, Jan; Fukuda, K.; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.

2015-01-01

Roč. 41, Mar SI (2015), s. 58-62 ISSN 0925-3467 Institutional support: RVO:68378271 Keywords : lutetium fluoride * scintillator * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.183, year: 2015

Triangular flow of negative pions emitted in PbAu collisions at √{sNN} = 17.3 GeV

Science.gov (United States)

Adamová, D.; Agakichiev, G.; Andronic, A.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Hering, G.; Holeczek, J.; Kalisky, M.; Karpenko, Iu.; Krobath, G.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Miśkowiec, D.; Panebrattsev, Y.; Petchenova, O.; Petráček, V.; Radomski, S.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Schuchmann, S.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Tsiledakis, G.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Yurevich, S.; Yurevich, V.

2017-01-01

Differential triangular flow, v3 (pT), of negative pions is measured at √{sNN} = 17.3 GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30% with a mean centrality of 5.5%. This is the first measurement as a function of transverse momentum of the triangular flow at SPS energies. The pT range extends from about 0.05 GeV/c to more than 2 GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydrodynamic calculation combined with an UrQMD cascade model for the late stages.

Effective atomic number, electron density and kerma of gamma ...

Indian Academy of Sciences (India)

rare element optical glass with oxides of tungsten, tantalum and thorium. ... Similarly, gadolinium and lutetium exhibit only +3 oxidation state because .... (σa) and effective molecular cross-section (σm) are related by the following equation: σa =.

Validation of GEANT3 simulation studies with a dual-head PMT ClearPET TM prototype

CERN Document Server

Ziemons, K; Streun, M; Pietrzyk, U

2004-01-01

The ClearPET TM project is proposed by working groups of the Crystal Clear Collaboration (CCC) to develop a 2/sup nd/ generation high performance small animal positron emission tomograph (PET). High sensitivity and high spatial resolution is foreseen for the ClearPET TM camera by using a phoswich arrangement combining mixed lutetium yttrium aluminum perovskite (LuYAP:Ce) and lutetium oxyorthosilicate (LSO) scintillating crystals. Design optimizations for the first photomultiplier tube (PMT) based ClearPET camera are done with a Monte-Carlo simulation package implemented on GEANT3 (CERN, Geneva, Switzerland). A dual-head prototype has been built to test the frontend electronics and was used to validate the implementation of the GEANT3 simulation tool. Multiple simulations were performed following the experimental protocols to measure the intrinsic resolution and the sensitivity profile in axial and radial direction. Including a mean energy resolution of about 27.0% the simulated intrinsic resolution is about (...

Preparation of LuAG Powders with Single Phase and Good Dispersion for Transparent Ceramics Using Co-Precipitation Method

Science.gov (United States)

Pan, Liangjie; Jiang, Benxue; Fan, Jintai; Yang, Qiuhong; Zhou, Chunlin; Zhang, Pande; Mao, Xiaojian; Zhang, Long

2015-01-01

The synthesis of pure and well dispersed lutetium aluminum garnet (LuAG) powder is crucial and important for the preparation of LuAG transparent ceramics. In this paper, high purity and well dispersed LuAG powders have been synthesized via co-precipitation method with lutetium nitrate and aluminum nitrate as raw materials. Ammonium hydrogen carbonate (AHC) was used as the precipitant. The influence of aging time, pH value, and dripping speed on the prepared LuAG powders were investigated. It showed that long aging duration (>15 h) with high terminal pH value (>7.80) resulted in segregation of rhombus Lu precipitate and Al precipitate. By decreasing the initial pH value or accelerating the dripping speed, rhombus Lu precipitate was eliminated and pure LuAG nano powders were synthesized. High quality LuAG transparent ceramics with transmission >75% at 1064 nm were fabricated using these well dispersed nano LuAG powders. PMID:28793510

Preparation of LuAG Powders with Single Phase and Good Dispersion for Transparent Ceramics Using Co-Precipitation Method

Directory of Open Access Journals (Sweden)

Liangjie Pan

2015-08-01

Full Text Available The synthesis of pure and well dispersed lutetium aluminum garnet (LuAG powder is crucial and important for the preparation of LuAG transparent ceramics. In this paper, high purity and well dispersed LuAG powders have been synthesized via co-precipitation method with lutetium nitrate and aluminum nitrate as raw materials. Ammonium hydrogen carbonate (AHC was used as the precipitant. The influence of aging time, pH value, and dripping speed on the prepared LuAG powders were investigated. It showed that long aging duration (>15 h with high terminal pH value (>7.80 resulted in segregation of rhombus Lu precipitate and Al precipitate. By decreasing the initial pH value or accelerating the dripping speed, rhombus Lu precipitate was eliminated and pure LuAG nano powders were synthesized. High quality LuAG transparent ceramics with transmission >75% at 1064 nm were fabricated using these well dispersed nano LuAG powders.

Response of Inorganic Scintillators to Neutrons of 3 and 15 MeV Energy

CERN Document Server

Lucchini, M; Pizzichemi, M; Chipaux, R; Jacquot, F; Mazue, H; Wolff, H; Lecoq, P; Auffray, E

2014-01-01

In the perspective of the development of future high energy physics experiments, homogeneous calorimeters based on inorganic scintillators can be considered for the detection of hadrons (e.g., calorimeter based on dual-readout technique). Although of high importance in the high energy physics framework as well as for homeland security applications, the response of these inorganic scintillators to neutrons has been only scarcely investigated. This paper presents results obtained using five common scintillating crystals (of size around 2x2x2 cm 3), namely lead tungstate (PbWO4), bismuth germanate (BGO), cerium fluoride (CeF3), Ce-doped lutetium-yttrium orthosilicate (LYSO:Ce) and lutetium aluminum garnet (LuAG:Ce) in a pulsed flux of almost mono-energetic (similar to 3 MeV and similar to 15 MeV) neutrons provided by the Van de Graff accelerator SAMES of CEA Valduc. Energy spectra have been recorded, calibrated and compared with Geant4 simulations computed with different physics models. The neutron detection eff...

MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

Science.gov (United States)

Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Jf, Muñoz-Valle

2018-07-15

Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

Ce(III) and Lu(III) metal-organic frameworks with Lewis acid metal sites: Preparation, sorption properties and catalytic activity in Knoevenagel condensation

Czech Academy of Sciences Publication Activity Database

Almáši, M.; Zeleňák, V.; Opanasenko, Maksym; Císařová, I.

2015-01-01

Roč. 243, APR 2015 (2015), s. 184-194 ISSN 0920-5861 R&D Projects: GA ČR GA14-07101S Institutional support: RVO:61388955 Keywords : cerium(III) * lutetium(III) * Benzene-1,3,5-tricarboxylate Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.312, year: 2015

Production of lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using soybean flour and rice straw as the substrate.

Science.gov (United States)

Zhu, Zhen; Zhang, Guoyi; Luo, Yi; Ran, Wei; Shen, Qirong

2012-05-01

This work was aimed to produce lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using agro-industrial byproducts. A central composite design was used to get the highest lipopeptides production. Results revealed that the optimal conditions for maximum lipopeptides production were 1.79% starch and 1.91% yeast extract by employing 5.58 g soybean flour and 3.67 g rice straw as the solid substrate with initial pH 7.5, moisture content 55% and a 10% inoculum level at 30°C for 2 days. Under these conditions, the experimental yield of lipopeptides reached 50.01 mg/gds, which was very close to the predicted value (49.91 mg/gds). At high concentration, the lipopeptides extracted from fermented substrates showed strong antibiotic activity against Rhizoctonia solani and Ralstonia solanacearum and certain emulsification but good emulsion stability. This is the first report on lipopeptides production that uses rice straw as a major substrate. Copyright © 2012 Elsevier Ltd. All rights reserved.

BITUMINOUS MIX RESPONSE TO PLASTIC DEFORMATIONS: COMPARISON OF THE SPANISH NLT-173 AND UNE-EN 12697-22 WHEEL-TRACKING TESTS

Directory of Open Access Journals (Sweden)

GEMA GARCÍA-TRAVÉ

2012-01-01

Full Text Available La formación de roderas es uno de los mayores deterioros que se producen en los firmes flexibles, lo que ocasiona la pérdida de regularidad superficial que repercute de forma negativa en la calidad del servicio prestado a los usuarios. Existen distintos ensayos de laboratorio que permiten evaluar las deformaciones plásticas producidas en las capas del pavimento, entre ellos podemos destacar los ensayos de simulación. El objetivo de esta investigación es analizar el comportamiento de una mezcla bituminosa en caliente frente a deformaciones plásticas, mediante dos métodos de ensayo diferentes; ensayo en pista de laboratorio de acuerdo a la normativa española NLT-173 y el ensayo de rodadura UNE-EN 12697-22 (ensayo obligatorio tras la entrada en vigor del Marcado CE de mezclas bituminosas en 2008. La finalidad última de este artículo es formular una propuesta de modificación de la normativa española (PG-3 sobre los límites exigibles en éste último ensayo.

Evaluation of the 175Lu(n,2n)174Lu, 175Lu(n,2n/sup 174m/Lu, and 175Lu(n,3n)173Lu cross sections from threshold to 20 MeV

International Nuclear Information System (INIS)

Philis, C.; Young, P.G.; Arthur, E.D.

1978-04-01

An evaluation of the 175 Lu(n,2n) 174 Lu, 175 Lu(n,2n)/sup 174m/Lu, and 175 Lu(n,3n) 173 Lu reactions from threshold to 20 MeV is presented. Available experimental data were renormalized to a consistent set of standards and were used along with results from statistical-preequilibrium model calculations to produce recommended curves for each of these reactions

Luminescence characteristics of the Ce.sup.3+./sup.-doped pyrosilicates: the case of La-admixed Gd.sub.2./sub.Si.sub.2./sub.O.sub.7./sub. single crystals

Czech Academy of Sciences Publication Activity Database

Jarý, Vítězslav; Nikl, Martin; Kurosawa, S.; Shoji, Y.; Mihóková, Eva; Beitlerová, Alena; Pazzi, G.P.; Yoshikawa, A.

2014-01-01

Roč. 118, č. 46 (2014), s. 26521-26529 ISSN 1932-7447 R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : lutetium silicate sci ntillators * floating-zone growth * electronic-structure * yttrium content * lyso crystals Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.772, year: 2014

Energy dependence of particle ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{_{NN}}} =$~6.3 to 17.3 GeV

CERN Document Server

Alt, C; Baatar, B; Barna, D; Bartke, J; Betev, L; Bialkowska, H; Blume, C; Boimska, B; Botje, M; Bracinik, J; Bramm, R; Bunccic, P; Cerny, V; Christakoglou, P; Chvala, O; Cramer, J G; Csató, P; Dinkelaker, P; Eckardt, V; Flierl, D; Fodor, Z; Foka, P; Friese, V; Gál, J; Gazdzicki, M; Genchev, V; Georgopoulos, G; Gladysz, E; Grebieszkow, K; Hegyi, S; Höhne, C; Kadija, K; Karev, A; Kliemant, M; Kniege, S; Kolesnikov, V I; Kornas, E; Korus, R; Kowalski, M; Kraus, I; Kreps, M; Kresan, D; Van Leeuwen, M; Lévai, P; Litov, L; Lungwitz, B; Makariev, M; Malakhov, A I; Mateev, M; Melkumov, G L; Mischke, A; Mitrovski, M; Molnár, J; Mrówczynski, St; Nicolic, V; Pálla, G; Panagiotou, A D; Panayotov, D; Petridis, A; Pikna, M; Prindle, D; Pühlhofer, F; Renfordt, R; Roland, C; Roland, G; Rybczynski, M; Rybicki, A; Sandoval, A; Schmitz, N; Schuster, T; Seyboth, P; Siklér, F; Sitár, B; Skrzypczak, E; Stefanek, G; Stock, R; Ströbele, H; Susa, T; Szentpétery, I; Sziklai, J; Szymanski, P; Trubnikov, V; Varga, D; Vassiliou, M; Veres, G I; Vesztergombi, G; Vranic, D; Wetzler, A; Wlodarczyk, Z; Yoo, I K

2009-01-01

We present recent measurements of the energy dependence of event-by-event fluctuations in the K/pi and (p + \\bar{p})/pi multiplicity ratios in heavy ion collisions at the CERN SPS. The particle ratio fluctuations were obtained for central Pb+Pb collisions at five collision energies, \\sqrt{s_{_{NN}}}, between 6.3 and 17.3 GeV. After accounting for the effects of finite-number statistics and detector resolution, we extract the strength of non-statistical fluctuations at each energy. For the K/pi ratio, larger fluctuations than expected for independent particle production are found at all collision energies. The fluctuations in the (p + \\bar{p})/pi ratio are smaller than expectations from independent particle production, indicating correlated pion and proton production from resonance decays. For both ratios, the deviation from purely statistical fluctuations shows an increase towards lower collision energies. The results are compared to transport model calculations, which fail to describe the energy dependence o...

Magnetic structures of holmium-lutetium alloys and superlattices

DEFF Research Database (Denmark)

Swaddling, P.P.; Cowley, R.A.; Ward, R.C.C.

1996-01-01

Alloys and superlattices of Ho and Lu have been grown using molecular beam epitaxy and their magnetic structures determined using neutron-scattering techniques. The 4f moments in the alloys form a helix at all compositions with the moments aligned in the basal plane perpendicular to the wave vector...... of the helix remaining coherent through the nonmagnetic Lu blocks. The neutron scattering from the superlattices is consistent with a model in which there are different phase advances of the helix turn angle through the Ho and Lu blocks, but with a localized moment on the Ho sites only. A comparison...... of Ho and Lu. At low temperatures, for superlattices with fewer than approximately twenty atomic planes of Ho, the Ho moments within a block undergo a phase transition from helical to ferromagnetic order, with the coupling between successive blocks dependent on the thickness of the Lu spacer....

Para-ter-butyl of calix(4)arene with acetamide-ether as inorganic-organic receiver

International Nuclear Information System (INIS)

Ramirez, F.M. de; Scopelliti, R.; Muller, G.; Buenzli J, C.G.; Charbonniere, L.

2001-01-01

A new functionalized calix(4)arene was designed and constructed with predetrmined properties to form lanthanides complexes and to sensibilize its luminescent properties. This, in addition to sensibilize that photophysical property and once formed the complex resulted a good receiver of organic molecules as it is demonstrated the crystal structure of the lutetium complex. (Author)

Luminescence and scintillation properties of Lu.sub.3./sub.Al.sub.5./sub.O.sub.12./sub. nanoceramics sintered by SPS method

Czech Academy of Sciences Publication Activity Database

Pejchal, Jan; Babin, Vladimir; Beitlerová, Alena; Kučerková, Romana; Pánek, D.; Barta, J.; Čuba, V.; Yamaji, A.; Kurosawa, S.; Mihóková, Eva; Ito, A.; Goto, T.; Nikl, Martin; Yoshikawa, A.

2016-01-01

Roč. 53, Mar (2016), s. 54-63 ISSN 0925-3467 R&D Projects: GA ČR GA13-09876S; GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : lutetium-aluminium-garnet * spark-plasma-sintering * nanoceramics * scintillator * Ce-doping Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.238, year: 2016

Studies of the radiolabeling and biodistribution of substance P using lutetium-177 as a radiotracer; Estudo da marcacao e biodistribuicao da substancia P utilizando lutecio-177 como radiotracador

Energy Technology Data Exchange (ETDEWEB)

Lima, Clarice Maria de

2011-07-01

Malignant gliomas are primary brain tumors, resistant to various treatments, as chemotherapy, radiotherapy, induction of apoptosis and surgery. An alternative for the treatment of malignant gliomas is the radionuclide therapy. This technique apply radiolabeled molecules that selectively bind to tumor cells producing cytotoxic effect by dose irradiation, and resulting in death of tumor cells. Most protocols for radionuclide therapy of malignant brain tumors involve the administration of peptides labeled with {beta}{sup -} emitting radioisotopes. The Substance P (SP) is an 11- amino acid neuropeptide, characterized by the C-terminal sequence Phe-X-Gly-Leu-Met-NH{sub 2}. The use of SP labeled with different radionuclides including {sup 177}Lu, have been proposed for in vivo treatment of tumors. SP is the most important target of neurokinin 1 receptors, over expressed in malignant gliomas. The objective of this work was to study conditions of radiolabeling DOTA-SP with {sup 177}Lu, the stability of labeled compound and in vivo and in vitro, to develop a protocol production and evaluate the potential of the radiopharmaceutical in the therapy of gliomas. The labeling conditions were optimized varying the temperature, reaction time, activity of lutetium-177 chloride and mass of DOTA-SP. The radiochemical purity of preparations were analyzed by chromatographic techniques. The stability of {sup 17L}u -DOTA- SP radiolabeled with low activity of {sup 177}Lu was evaluated for different time at 2-8 degree C or incubated in human serum. The stability of the labeled with high activity of {sup 177}Lu was also analyzed in the presence of gentisic acid (6 mg / mL) added after the labeling reaction. The labeled conditions in low and high activity were subjected to evaluation for the ability to cause oxidation of methionine residue, adding the D-L- methionine amino acid to the reaction medium (6 mg / mL) and subsequent chromatographic evaluation. In vitro study with {sup 177}Lu

Successful neoadjuvant peptide receptor radionuclide therapy for an inoperable pancreatic neuroendocrine tumour

Directory of Open Access Journals (Sweden)

Tiago Nunes da Silva

2018-04-01

Full Text Available Non-functional pancreatic neuroendocrine tumours (NETs can present with advanced local or distant (metastatic disease limiting the possibility of surgical cure. Several treatment options have been used in experimental neoadjuvant settings to improve the outcomes in such cases. Peptide receptor radionuclide therapy (PPRT using beta emitting radiolabelled somatostatin analogues has been used in progressive pancreatic NETs. We report a 55-year-old female patient with a 12.8 cm pancreatic NET with significant local stomach and superior mesenteric vein compression and liver metastases. The patient underwent treatment with [177Lutetium-DOTA0,Tyr3]octreotate (177Lu-octreotate for the treatment of local and metastatic symptomatic disease. Six months after 4 cycles of 177lutetium-octreotate, resolution of the abdominal complaints was associated with a significant reduction in tumour size and the tumour was rendered operable. Histology of the tumour showed a 90% necrotic tumour with abundant hyalinized fibrosis and haemorrhage compatible with PPRT-induced radiation effects on tumour cells. This report supports that PPRT has a role in unresectable and metastatic pancreatic NET.

Nutritional determinants of worldwide diabetes: an econometric study of food markets and diabetes prevalence in 173 countries.

Science.gov (United States)

Basu, Sanjay; Stuckler, David; McKee, Martin; Galea, Gauden

2013-01-01

Ageing and urbanization leading to sedentary lifestyles have been the major explanations proposed for a dramatic rise in diabetes worldwide and have been the variables used to predict future diabetes rates. However, a transition to Western diets has been suggested as an alternative driver. We sought to determine what socio-economic and dietary factors are the most significant population-level contributors to diabetes prevalence rates internationally. Multivariate regression models were used to study how market sizes of major food products (sugars, cereals, vegetable oils, meats, total joules) corresponded to diabetes prevalence, incorporating lagged and cumulative effects. The underlying social determinants of food market sizes and diabetes prevalence rates were also studied, including ageing, income, urbanization, overweight prevalence and imports of foodstuffs. Data were obtained from 173 countries. Population-based survey recipients were the basis for diabetes prevalence and food market data. We found that increased income tends to increase overall food market size among low- and middle-income countries, but the level of food importation significantly shifts the content of markets such that a greater proportion of available joules is composed of sugar and related sweeteners. Sugar exposure statistically explained why urbanization and income have been correlated with diabetes rates. Current diabetes projection methods may estimate future diabetes rates poorly if they fail to incorporate the impact of nutritional factors. Imported sugars deserve further investigation as a potential population-level driver of global diabetes.

Application of the pM'-pCH diagrams in the determination of hydrolysis constants of the lanthanides

International Nuclear Information System (INIS)

Lopez G, H.; Jimenez R, M.; Solache R, M.; Rojas H, A.

2001-01-01

The pM ' -pC H diagrams allowed to determine the saturation and non-saturation zones of Lu(OH) 3 in solid phase and those were applied for determining the hydrolysis and lutetium solubility constants, using the radioactive isotope Lu-177. The first constant of hydrolysis was also determined by the potentiometric method in absence of solid phase. (Author)

Character of changes in the thermodynamic properties of alloyed melts of rare-earth metals with low-melting-point p- and d-metals

International Nuclear Information System (INIS)

Yamshchikov, L.F.; Zyapaev, A.A.; Raspopin, S.P.

2003-01-01

Published data on thermodynamic characteristics of lanthanides in liquid-metal melts of gallium, indium and zinc were systematized. The monotonous change from lanthanum to lutetium was ascertained for activity values and activity coefficients of trivalent lanthanides in the melts, which permits calculating the values for the systems of fusible metals, where no experimental data are available [ru

Evaluation of the performance of national health systems in 2004-2011: An analysis of 173 countries.

Science.gov (United States)

Sun, Daxin; Ahn, Haksoon; Lievens, Tomas; Zeng, Wu

2017-01-01

In an effort to improve health service delivery and achieve better health outcomes, the World Health Organization (WHO) has called for improved efficiency of health care systems to better use the available funding. This study aims to examine the efficiency of national health systems using longitudinal country-level data. Data on health spending per capita, infant mortality rate (IMR), under 5 mortality rate (U5MR), and life expectancy (LE) were collected from or imputed for 173 countries from 2004 through 2011. Data envelopment analyses were used to evaluate the efficiency and regression models were constructed to examine the determinants of efficiency. The average efficiency of the national health system, when examined yearly, was 78.9%, indicating a potential saving of 21.1% of health spending per capita to achieve the same level of health status for children and the entire population, if all countries performed as well as their peers. Additionally, the efficiency of the national health system varied widely among countries. On average, Africa had the lowest efficiency of 67%, while West Pacific countries had the highest efficiency of 86%. National economic status, HIV/AIDS prevalence, health financing mechanisms and governance were found to be statistically associated with the efficiency of national health systems. Taking health financing as an example, a 1% point increase of social security expenses as a percentage of total health expenditure correlated to a 1.9% increase in national health system efficiency. The study underscores the need to enhance efficiency of national health systems to meet population health needs, and highlights the importance of health financing and governance in improving the efficiency of health systems, to ultimately improve health outcomes.

Energy dependence of kaon-to-proton ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{NN}}$ = 6.3 to 17.3 GeV

CERN Document Server

Anticic, T.; Barna, D.; Bartke, J.; Beck, H.; Betev, L.; Bialkowska, H.; Blume, C.; Bogusz, M.; Boimska, B.; Book, J.; Botje, M.; Buncic, P.; Cetner, T.; Christakoglou, P.; Chung, P.; Chvala, O.; Cramer, J.G.; Eckardt, V.; Fodor, Z.; Foka, P.; Friese, V.; Gazdzicki, M.; Grebieszkow, K.; Hohne, C.; Kadija, K.; Karev, A.; Kolesnikov, V.I.; Kollegger, T.; Kowalski, M.; Kresan, D.; Laszlo, A.; Lacey, R.; van Leeuwen, M.; Mackowiak, M.; Makariev, M.; Malakhov, A.I.; Mateev, M.; Melkumov, G.L.; Mitrovski, M.; Mrowczynski, St.; Nicolic, V.; Palla, G.; Panagiotou, A.D.; Peryt, W.; Pluta, J.; Prindle, D.; Puhlhofer, F.; Renfordt, R.; Roland, C.; Roland, G.; Rybczynski, M.; Rybicki, A.; Sandoval, A.; Schmitz, N.; Schuster, T.; Seyboth, P.; Sikler, F.; Skrzypczak, E.; Slodkowski, M.; Stefanek, G.; Stock, R.; Strobele, H.; Susa, T.; Szuba, M.; Utvic, M.; Varga, D.; Vassiliou, M.; Veres, G.I.; Vesztergombi, G.; Vranic, D.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.

2011-01-01

Kaons and protons carry large parts of two conserved quantities, strangeness and baryon number. It is argued that their correlation and thus also fluctuations are sensitive to conditions prevailing at the anticipated parton-hadron phase boundary. Fluctuations of the $(\\mathrm{K}^+ + \\mathrm{K}^-)/(\\mathrm{p}+\\bar{\\mathrm{p}})$ and $\\mathrm{K}^+/\\mathrm{p}$ ratios have been measured for the first time by NA49 in central Pb+Pb collisions at 5 SPS energies between $\\sqrt{s_{NN}}$= 6.3~GeV and 17.3~GeV. Both ratios exhibit a change of sign in $\\sigma_{\\mathrm{dyn}}$, a measure of non-statistical fluctuations, around $\\sqrt{s_{NN}}$ = 8~GeV. Below this energy, $\\sigma_{\\mathrm{dyn}}$ is positive, indicating higher fluctuation compared to a mixed event background sample, while for higher energies, $\\sigma_{\\mathrm{dyn}}$ is negative, indicating correlated emission of kaons and protons. The results are compared to UrQMD calculations which which give a good description at the higher SPS energies, but fail to reproduc...

Electron paramagnetic resonance study of exchange coupled Ce.sup.3+./sup. ions in Lu.sub.2./sub.SiO.sub.5./sub. single crystal scintillator

Czech Academy of Sciences Publication Activity Database

Buryi, Maksym; Laguta, Valentyn; Rosa, Jan; Nikl, Martin

2016-01-01

Roč. 90, Jul (2016), s. 23-26 ISSN 1350-4487 R&D Projects: GA ČR GAP204/12/0805; GA MŠk(CZ) LM2011029; GA MŠk LO1409 Institutional support: RVO:68378271 Keywords : electron paramagnetic resonance * scintillators * lutetium oxyorthosilicate * exchange coupled ions * cerium ions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.442, year: 2016

Thermoluminescent coactivated rare earth oxyhalide phosphors and x-ray image converters utilizing said phosphors

International Nuclear Information System (INIS)

Rabatin, J.G.

1984-01-01

Oxyhalides of lanthanum, gadolinium and lutetium coactivated with a first activator selected from bismuth and samarium to provide the color of light emission and a second coactivator (e.g. terbium or praseodymium) which increases the amount of stored energy in a stored radiographic latent image are found to be superior in their conversion efficiency of x-rays to visible light. (author)

Assignment of 4f-5d absorption bands in Ce-doped RAlO.sub.3./sub. (R=La, Gd, Y, Lu) perovskites

Czech Academy of Sciences Publication Activity Database

Mihóková, Eva; Nikl, Martin; Bacci, M.; Dušek, Michal; Petříček, Václav

2009-01-01

Roč. 79, č. 19 (2009), 1951309/1-1951309/7 ISSN 1098-0121 R&D Projects: GA MŠk ME 903; GA AV ČR IAA100100810 Institutional research plan: CEZ:AV0Z10100521 Keywords : cerium * EHT calculations * gadolinium compounds * lanthanum compounds * lutetium compounds * ultraviolet spectra * yttrium compounds Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.475, year: 2009

Modifications of micro-pulling-down method for the growth of selected Li-containing crystals for neutron scintillator and VUV scintillation crystals

Czech Academy of Sciences Publication Activity Database

Pejchal, Jan; Fujimoto, Y.; Chani, V.; Yanagida, T.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin; Beitlerová, Alena

2012-01-01

Roč. 360, SI (2012), 127–130 ISSN 0022-0248 R&D Projects: GA MŠk(CZ) 1M06002 Grant - others:AVČR(CZ) M100100910 Institutional research plan: CEZ:AV0Z10100521 Keywords : Ti-doping * micro-pulling-down * barium lutetium fluoride * lithium aluminate * neutron scintillator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.552, year: 2012

173 | Page

African Journals Online (AJOL)

Fr. Ikenga

Again, individuals and non-governmental organization (NGO's) suffer great restraint in .... by individuals or non-governmental organizations (NGOs) with observer status before the African. Commission on Human and ..... Innovations and Prospect of the African Court on Human and Peoples' Rights. In furtherance of effective ...

An inelastic neutron scattering study of the spin dynamics of Yb1-xLuxAl3

International Nuclear Information System (INIS)

Osborn, R.

1998-01-01

We present the results of a systematic inelastic neutron scattering study of the spin dynamics of the mixed valent compound YbAl 3 doped with nonmagnetic lutetium. The aim of the investigation is to clarify the origin of the unusual gap-like magnetic response observed in YbAl 3 , which can be modeled by two inelastic peaks: a narrow peak at 34 meV with HWHM, r = 6.4 ± 0.8 meV and a broad peak at 44 meV with Λ = 30 ± 1 meV. Lutetium substitution leads to a substantial increase in the linewidth (Λ = 9 ± 1 meV at x = 0.1) and a decrease in the intensity (down by 60% at x = 0.1) of the narrow component, with a negligible effect on the broad inelastic peak. This trend is confirmed with higher doping resulting in the complete suppression of the narrow peak at x ≥ 0.35. The results indicate that the narrow component arises from coherent excitation processes within the hybridized 4f-band, which are destroyed by disorder, while the broad component is not so sensitive to the loss of coherence

Novel Electro-Optical Coupling Technique for Magnetic Resonance-Compatible Positron Emission Tomography Detectors

Directory of Open Access Journals (Sweden)

Peter D. Olcott

2009-03-01

Full Text Available A new magnetic resonance imaging (MRI-compatible positron emission tomography (PET detector design is being developed that uses electro-optical coupling to bring the amplitude and arrival time information of high-speed PET detector scintillation pulses out of an MRI system. The electro-optical coupling technology consists of a magnetically insensitive photodetector output signal connected to a nonmagnetic vertical cavity surface emitting laser (VCSEL diode that is coupled to a multimode optical fiber. This scheme essentially acts as an optical wire with no influence on the MRI system. To test the feasibility of this approach, a lutetium-yttrium oxyorthosilicate crystal coupled to a single pixel of a solid-state photomultiplier array was placed in coincidence with a lutetium oxyorthosilicate crystal coupled to a fast photomultiplier tube with both the new nonmagnetic VCSEL coupling and the standard coaxial cable signal transmission scheme. No significant change was observed in 511 keV photopeak energy resolution and coincidence time resolution. This electro-optical coupling technology enables an MRI-compatible PET block detector to have a reduced electromagnetic footprint compared with the signal transmission schemes deployed in the current MRI/PET designs.

Novel electro-optical coupling technique for magnetic resonance-compatible positron emission tomography detectors.

Science.gov (United States)

Olcott, Peter D; Peng, Hao; Levin, Craig S

2009-01-01

A new magnetic resonance imaging (MRI)-compatible positron emission tomography (PET) detector design is being developed that uses electro-optical coupling to bring the amplitude and arrival time information of high-speed PET detector scintillation pulses out of an MRI system. The electro-optical coupling technology consists of a magnetically insensitive photodetector output signal connected to a nonmagnetic vertical cavity surface emitting laser (VCSEL) diode that is coupled to a multimode optical fiber. This scheme essentially acts as an optical wire with no influence on the MRI system. To test the feasibility of this approach, a lutetium-yttrium oxyorthosilicate crystal coupled to a single pixel of a solid-state photomultiplier array was placed in coincidence with a lutetium oxyorthosilicate crystal coupled to a fast photomultiplier tube with both the new nonmagnetic VCSEL coupling and the standard coaxial cable signal transmission scheme. No significant change was observed in 511 keV photopeak energy resolution and coincidence time resolution. This electro-optical coupling technology enables an MRI-compatible PET block detector to have a reduced electromagnetic footprint compared with the signal transmission schemes deployed in the current MRI/PET designs.

Monte Carlo simulation of simultaneous radiation detection in the hybrid tomography system ClearPET-XPAD3/CT

Energy Technology Data Exchange (ETDEWEB)

Dávila, H. Olaya, E-mail: hernan.olaya@uptc.edu.co; Martínez, S. A. [Physics Department, Universidad Pedagógica y Tecnológica de Colombia, Tunja-Colombia (Colombia); Sevilla, A. C., E-mail: acsevillam@unal.edu.co; Castro, H. F. [Physics Department, Universidad Nacional de Colombia, Bogotá D.C - Colombia (Colombia)

2016-07-07

Using the Geant4 based simulation framework SciFW1, a detailed simulation was performed for a detector array in the hybrid tomography prototype for small animals called ClearPET / XPAD, which was built in the Centre de Physique des Particules de Marseille. The detector system consists of an array of phoswich scintillation detectors: LSO (Lutetium Oxy-ortosilicate doped with cerium Lu{sub 2}SiO{sub 5}:Ce) and LuYAP (Lutetium Ortoaluminate of Yttrium doped with cerium Lu{sub 0.7}Y{sub 0.3}AlO{sub 3}:Ce) for Positron Emission Tomography (PET) and hybrid pixel detector XPAD for Computed Tomography (CT). Simultaneous acquisition of deposited energy and the corresponding time - position for each recorded event were analyzed, independently, for both detectors. interference between detection modules for PET and CT. Information about amount of radiation reaching each phoswich crystal and XPAD detector using a phantom in order to study the effectiveness by radiation attenuation and influence the positioning of the radioactive source {sup 22}Na was obtained. The simulation proposed will improve distribution of detectors rings and interference values will be taken into account in the new versions of detectors.

Monte Carlo simulation of simultaneous radiation detection in the hybrid tomography system ClearPET-XPAD3/CT

Science.gov (United States)

Dávila, H. Olaya; Sevilla, A. C.; Castro, H. F.; Martínez, S. A.

2016-07-01

Using the Geant4 based simulation framework SciFW1, a detailed simulation was performed for a detector array in the hybrid tomography prototype for small animals called ClearPET / XPAD, which was built in the Centre de Physique des Particules de Marseille. The detector system consists of an array of phoswich scintillation detectors: LSO (Lutetium Oxy-ortosilicate doped with cerium Lu2SiO5:Ce) and LuYAP (Lutetium Ortoaluminate of Yttrium doped with cerium Lu0.7Y0.3AlO3:Ce) for Positron Emission Tomography (PET) and hybrid pixel detector XPAD for Computed Tomography (CT). Simultaneous acquisition of deposited energy and the corresponding time - position for each recorded event were analyzed, independently, for both detectors. interference between detection modules for PET and CT. Information about amount of radiation reaching each phoswich crystal and XPAD detector using a phantom in order to study the effectiveness by radiation attenuation and influence the positioning of the radioactive source 22Na was obtained. The simulation proposed will improve distribution of detectors rings and interference values will be taken into account in the new versions of detectors.

Radiolabeling of trastuzumab with {sup 177}Lu via DOTA, a new radiopharmaceutical for radioimmunotherapy of breast cancer

Energy Technology Data Exchange (ETDEWEB)

Rasaneh, Samira [Department of Medical Physics, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Rajabi, Hossein [Department of Medical Physics, Tarbiat Modares University, Tehran (Iran, Islamic Republic of)], E-mail: hrajabi@modares.ac.ir; Babaei, Mohammad Hossein; Daha, Fariba Johari [Department of Radioisotope, Nuclear Science and Technology Research Institute, Tehran (Iran, Islamic Republic of); Salouti, Mojtaba [Department of Biology, School of Sciences, Islamic Azad University - Zanjan Branch, Zanjan (Iran, Islamic Republic of)

2009-05-15

Aim: Trastuzumab is a monoclonal antibody that is used in treating breast cancer. We labeled this monoclonal antibody with lutetium-177 and performed in vitro quality control tests as a first step in the production of a new radiopharmaceutical. Material and Methods: Trastuzumab was labeled with lutetium-177 using DOTA as chelator. Radiochemical purity and stability in buffer and human blood serum were determined using thin layer chromatography. Immunoreactivity and toxicity of the complex were tested on MCF7 breast cancer cell line. Results: The radiochemical purity of the complex was 96{+-}0.9%. The stabilities in phosphate buffer and in human blood serum at 96 h postpreparation were 93{+-}1.2% and 85{+-}3.5%, respectively. The immunoreactivity of the complex was 89{+-}1.4%. At a concentration of 1 nM, the complex killed 70{+-}3% of MCF7 cells. At 1.9 nM, 90{+-}5% of the cells were killed. Conclusions: The results showed that the new complex could be considered for further evaluation in animals and possibly in humans as a new radiopharmaceutical for use in radioimmunotherapy against breast cancer.

Low-temperature thermal properties of yttrium and lutetium dodecaborides

International Nuclear Information System (INIS)

Czopnik, A; Shitsevalova, N; Pluzhnikov, V; Krivchikov, A; Paderno, Yu; Onuki, Y

2005-01-01

The heat capacity (C p ) and dilatation (α) of YB 12 and LuB 12 are studied. C p of the zone-melted YB 12 tricrystal is measured in the range 2.5-70 K, of the zone-melted LuB 12 single crystal in the range 0.6-70 K, and of the LuB 12 powder sample in the range 4.3-300 K; α of the zone-melted YB 12 tricrystal and LuB 12 single crystals is measured in the range 5-200 K. At low temperatures a negative thermal expansion (NTE) is revealed for both compounds: for YB 12 at 50-70 K, for LuB 12 at 10-20 K and 60-130 K. Their high-temperature NTE is a consequence of nearly non-interacting freely oscillating metal ions (Einstein oscillators) in cavities of a simple cubic rigid Debye lattice formed by B 12 cage units. The Einstein temperatures are ∼254 and ∼164 K, and the Debye temperatures are ∼1040 K and ∼1190 K for YB 12 and LuB 12 respectively. The LuB 12 low-temperature NTE is connected with an induced low-energy defect mode. The YB 12 superconducting transition has not been detected up to 2.5 K

Lutetium-177-EDTMP for pain palliation in bone metastases

International Nuclear Information System (INIS)

Rutty Sola, Gisela A.; Arguelles, Maria G.; Bottazzini, Debora L.; Furnari, Juan C.; Vera Ruiz, H.

1999-01-01

Experiences with the new palliative agent Lu-177 EDTMP are summarized. The production of primary 177 Lu by the 176 Lu(n,γ) 177 Lu reaction and the synthesis of the radioactive complex are described as well as the procedures used for the control of the radionuclidic and the radiochemical purity. The stability of the compound has been also studied. The in vivo essays with rats and the use of the radiopharmaceutical, after a careful dose evaluation, in a patient with bone metastases from a breast cancer, show that the behaviour of Lu-177 EDTMP is similar to that of the analogue Sm-153 EDTMP. (author)

Crystal growth and scintillation properties of selected fluoride crystals for VUV scintillators

Czech Academy of Sciences Publication Activity Database

Pejchal, Jan; Fukuda, K.; Yamaji, A.; Yokota, Y.; Kurosawa, S.; Král, Robert; Nikl, Martin; Yoshikawa, A.

2014-01-01

Roč. 401, Sep (2014), s. 833-838 ISSN 0022-0248. [International Conference on Crystal Growth and Epitaxy /17./. Warsaw, 11.08.2013-16..08.2013] R&D Projects: GA MŠk LH12150 Institutional support: RVO:68378271 Keywords : vacuum-ultra-violet emission * micro-pulling-down method * barium -lutetium fluoride * erbium fluoride Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.698, year: 2014

Luminescence mechanism in doubly Gd, Nd-codoped fluoride crystals for VUV scintillators

Czech Academy of Sciences Publication Activity Database

Pejchal, Jan; Fukuda, K.; Babin, Vladimir; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin

2016-01-01

Roč. 169, Jan (2016), s. 682-689 ISSN 0022-2313. [International Conference on Luminescence and Optical Spectroscopy of Condensed Matter /17./. Wroclaw, 13.07.2014-18.07.2014] R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : barium –lutetium–yttrium fluoride * lutetium fluoride * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

Yttrium and rare earths separation by ion exchange resin

International Nuclear Information System (INIS)

Pinatti, D.G.; Ayres, M.J.G.; Ribeiro, S.; Silva, G.L.J.P.; Silva, M.L.C.P.; Martins, A.H.

1988-01-01

The experimental results of yttrium and rare earths separation from Brazilian xenotime are presented. The research consist in five stage: 1) Preparation of yttrium, erbium and lutetium standard solutions, from solubilization of pure oxides 2) yttrium and rare earths separation by ion exchange chromatrography 3) Separation and recovery of EDTA 4) Precipitation and calcination and 4) Analytical control of process. (C.G.C.) [pt

New candidates for active asteroids: Main-belt (145) Adeona, (704) Interamnia, (779) Nina, (1474) Beira, and near-Earth (162,173) Ryugu

Science.gov (United States)

Busarev, Vladimir V.; Makalkin, Andrei B.; Vilas, Faith; Barabanov, Sergey I.; Scherbina, Marina P.

2018-04-01

For the first time, spectral signs of subtle coma activity were observed for four main-belt primitive asteroids (145) Adeona, (704) Interamnia, (779) Nina, and (1474) Beira around their perihelion distances in September 2012, which were interpreted as manifestations of the sublimation of H2O ice in/under the surface matter (Busarev et al., 2015a, 2015b). We confirm the phenomenon for Nina when it approached perihelion in September 2016. At the same time, based on results of spectral observations of near-Earth asteroid (162,173) Ryugu (Vilas, 2008) being a target of Japan's Hayabusa 2 space mission, we suspected a periodic similar transient activity on the Cg-type asteroid. However, unlike the main-belt primitive asteroids demonstrating sublimation of ices close to their perihelion distances, the effect on Ryugu was apparently registered near aphelion. To explain the difference, we calculated the subsolar temperature depending on heliocentric distance of the asteroids, considered qualitative models of internal structure of main-belt and near-Earth primitive asteroids including ice and performed some analytical estimations. Presumed temporal sublimation/degassing activity of Ryugu is a sign of a residual frozen core in its interior. This could be an indication of a relatively recent transition of the asteroid from the main asteroid belt to the near-Earth area.

Addition compounds between lanthanide trifluoromethane sulphonates and N,N,N',N' - tetrametilmalonamida (TMMA)

International Nuclear Information System (INIS)

Bellis, V.M. de.

1984-01-01

The preparation and characterization of the addiction compounds between lanthanide trifluoromethanesulphonates with the N,N,N',N' - tetramethylmodomamide (TMMA) are reported. The characterization of the compounds obtained by microanalytical procedures, infrared spectra, conductance measurements, X-ray powder patterns, absorption spectra of the praseodymium, neodymium, holmium and erbium and the emission spectra of the europium and the europium-doped lanthanum and lutetium adducts were made. (M.J.C.) [pt

Abstracts of the 36. Brazilian congress of chemistry; 3. National meeting on thermal analysis and calorimetry; 9. Brazilian journey of chemistry scientific initiation; 2. National meeting on industrial chemistry; 4. Scientific marathon on chemistry; EXPOQUIMICA 96; 1. Workshop on in flow analysis; 1. Workshop on the environment: opportunities for the interdisciplinary research; 1. Workshop on chemical sensors and biosensors

International Nuclear Information System (INIS)

1996-01-01

The use of ceramic solid electrolytes for chemical sensors and the characterization of lanthanide III p-toluene-sulphonates as well as the chemical preparation of lutetium compounds are discussed. A Brazilian station for monitoring global atmospheric and the impacts on pollutants dispersion in Brazil are analysed. The catalytic liquefaction of sugar cane bagasse is considered as well as the study of higher alcohols reaction on zeolites is presented

Thermophysical Properties of Matter - The TPRC Data Series. Volume 4. Specific Heat - Metallic Elements and Alloys

Science.gov (United States)

1971-01-01

Indium—Indium alloys—Iron—iron alloys— lanthanum — load—lead alloys—lithium—lithium alloya—«agnaslum—magnaalum alloys—manganas^ —naoganasa alloys—marcury...Germanium 21 Gold 22 Hafnium 23 Holmium 24 Indium 25 Iridium 26 Iron 27 Lanthanum 28 Lead 29 Lithium 30 Lutetium 31 Magnesium 32 Manganese 33...hexahydrate (ErC^-eHjO Erbium gallate (see Trierbium pentagallium 1 dodecaoxide) 4 5 65 822 Freon 10 (see Carbon tetrachloride) Freon 11

Laser Spectroscopy Characterization of Materials for Frequency Agile Solid State Laser Systems

Science.gov (United States)

1991-03-15

Received 30 November 1987; revised manuscript received 29 January 1988) Single crystals of lanthanum lutetium gallium garnet (LaLuGaG) were grown by...group may be realized it gar- dleternte itf other materials can be found with spectral nets formed with lanthanum occupying tile dodecaliedrial ,1nl...array-pumped Nd: YAG and Nd: Lu: YAG lasers," Opt. inates and gallates with the malilite structure," in Tunable Lett. 14, 116-118 (1989). Solid State

USSR and Eastern Europe Scientific Abstracts, Physics. Number 46.

Science.gov (United States)

1978-11-02

magnetic field in the area of large fields, the harmonics are due to the resonances of the standing magnetic -plasma waves in the plate; in the area...parameters of cerium, gadolinium and lutetium orthovanadite. Polytherms of heat capacity, magnetization and magnetic susceptibility of these rare...of lasing in mixed ZnxCd^_xS single crystals, and it was found that the model of a simple " Fabry -Perot resonator ," i.e., an inverse layer on the

Synthesis and silica coating of calcia-doped ceria/plate-like titanate (K0.8Li0.27Ti1.73O4) nanocomposite by seeded polymerization technique

International Nuclear Information System (INIS)

El-Toni, Ahmed Mohamed; Yin, Shu; Sato, Tsugio

2007-01-01

Calcia-doped ceria is of potential interest as an ultraviolet (UV) radiation blocking material in personal care products because of the excellent UV light absorption property and low catalytic ability for the oxidation of organic materials superior to undoped ceria. In order to reduce the oxidation catalytic activity further, calcia-doped ceria was coated with amorphous silica by means of seeded polymerization technique. Generally, nanoparticles of inorganic materials do not provide a good coverage for human skin because of the agglomeration of the particles. The plate-like particles are required to enhance the coverage ability of inorganic materials. This can be accomplished by synthesis of calcia-doped ceria/plate-like potassium lithium titanate (K 0.8 Li 0.27 Ti 1.73 O 4 ) nanocomposite with subsequent silica coating to control catalytic activity of calcia-doped ceria. Calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was prepared by soft chemical method followed by silica coating via seeded polymerization technique. Silica coated calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was characterized by X-ray diffraction, SEM, TEM, XPS and FT-IR

Test report dot7A type A liquid packaging

Energy Technology Data Exchange (ETDEWEB)

Ketusky, E. T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Brandjes, C. [Ameriphysics LLC, Knoxville, TN (United States); Benoit, T. J. [Argonne National Lab. (ANL), Argonne, IL (United States)

2017-09-19

This section presents a general description of the DOT Specification 7A Type A liquid content packaging (HVYTAL), the liquid content evaluated as its payload, acceptable payload shipping configurations and features special to its use. This test report documents compliance with the regulatory safety requirements of 49 CFR Parts 173.24, 173.24a, 173.27, 173.410, 173.412, 173.461 – 173.466 and 178.350.

Neutron temperature measurements in a cryogenic hydrogenous moderator

International Nuclear Information System (INIS)

Ball, R.M.; Hoovler, G.S.; Lewis, R.H.

1995-01-01

Benchmarkings of neutronic calculations are most successful when there is a direct correlation between a measurement and an analytic result. In the thermal neutron energy region, the fluence rate as a function of moderator temperature and position within the moderator is an area of potential correlation. The measurement can be done by activating natural lutetium. The two isotopes of the element lutetium have widely different cross sections and permit the discrimination of flux shape and energy distributions at different reactor conditions. The 175 Lu has a 1/v dependence in the thermal energy region, and 176 Lu has a resonance structure that approximates a constant cross section in the same region. The saturation activation of the two isotopes has been measured in an insulated moderator container at the center of a thermal heterogeneous reactor designed for space nuclear propulsion. The measurements were made in a hydrogenous (polyethylene) moderator at three temperatures (83, 184, and 297 K) and five locations within the moderator. Simultaneously, the reactivity effect of the change in the moderator temperature was determined to be positive with an increase in temperature. The plot of activation shows the variation in neutron fluence rate and current with temperature and explains the positive reactivity coefficient. A neutron temperature can be inferred from a postulated Maxwell-Boltzmann distribution and compared with Monte Carlo or other calculations

Successive composition of two laser channels upon excitation of He-Ar-Xe (2.03 μm) and Ar-Xe (1.73 μm) mixtures by uranium fission fragments

International Nuclear Information System (INIS)

Pikulev, A A; Tsvetkov, V M; Sosnin, P V; Sinyanskii, A A

2009-01-01

The operation efficiency of the scheme with successive composition of two laser channels upon excitation of the active medium by uranium-235 fission fragments is studied experimentally and numerically. For the He:Ar:Xe = 380:380:1 mixture (at a pressure of 1 atm and the lasing wavelength λ = 2.03 μm) the maximum lasing power of a double channel (1 kW) is almost twice that of a single channel (540 W). Calculations show that in the case of ideal composition (without losses on mirrors) the lasing power of the double channel can be increased to 1.2 kW. For the Ar:Xe = 380:1 mixture (the pressure is 0.5 atm, λ = 1.73 μm) the maximum lasing power of the double channel (620 W) is slightly above that of the single channel (520 W), which is caused by the losses on aluminum mirrors employed for channel doubling and by a negative effect of optical inhomogeneities. In the case of ideal composition, the lasing power can be increased to 830 W. (lasers)

Measurement of the half-life of sup 1 sup 7 sup 6 Lu

CERN Document Server

Nir-El, Y

1998-01-01

The half-life of sup 1 sup 7 sup 6 Lu was determined by measuring the disintegration rate of a solution of lutetium oxide, using a calibrated HPGe detector, and found to be (3.69+-0.02)x10 sup 1 sup 0 y. It is recommended that the current adopted value be calculated from the grouping of three published values since 1983, including our value, the weighted mean of which is (3.73+-0.01)x10 sup 1 sup 0 y.

Single-shot positron annihilation lifetime spectroscopy with LYSO scintillators

OpenAIRE

Alonso, A. M.; Cooper, B. S.; Deller, A.; Cassidy, D. B.

2016-01-01

We have evaluated the application of a lutetium yttrium oxyorthosilicate (LYSO) based detector to single-shot positron annihilation lifetime spectroscopy. We compare this detector directly with a similarly configured PbWO4 scintillator, which is the usual choice for such measurements. We find that the signal to noise ratio obtained using LYSO is around three times higher than that obtained using PbWO4 for measurements of Ps excited to longer-lived (Rydberg) levels, or when they are ionized so...

First principle calculation of structure and lattice dynamics of Lu2Si2O7

Directory of Open Access Journals (Sweden)

Nazipov D.V.

2017-01-01

Full Text Available Ab initio calculations of crystal structure and Raman spectra has been performed for single crystal of lutetium pyrosilicate Lu2Si2O7. The types of fundamental vibrations, their frequencies and intensities in the Raman spectrum has been obtained for two polarizations. Calculations were made in the framework of density functional theory (DFT with hybrid functionals. The isotopic substitution was calculated for all inequivalent ions in cell. The results in a good agreement with experimental data.

The study of conjugation of anti-CD20 monoclonal antibody for labeling with metallic or lanthanides radionuclides

International Nuclear Information System (INIS)

Akanji, Akinkunmi Ganiyu

2012-01-01

Lymphomas are malignancies or cancers that start from the malign transformation of a lymphocyte in the lymphatic system. Generally, lymphomas start from the lymph nodes or from the agglomeration of the lymphatic tissues, organs like stomach, intestines, in some cases it can involve the bone marrow and the blood, it can also disseminate to other organs. Lymphomas are divided in two major categories: Hodgkin lymphoma and non-Hodgkin lymphoma (NHL). Patient with NHL are generally treated with radiotherapy alone or combined with immunotherapy using monoclonal antibody rituximab (MabThera®). Currently, monoclonal antibodies (Acm) conjugated with bifunctional chelate agents and radiolabeled with metallic or lanthanides radionuclides are a treatment reality for patients with NHL by the principle of radioimmunotherapy (RIT). This study focused on the conditions of conjugation of Acm rituximab (MabThera®) with bifunctional chelating agents DOTA and DTPA. Various parameters were studied: method of Acm purification, conditions of Acm conjugation, the method for determination of number of chelate agent coupled to the Acm, method for purification of the conjugated antibody Acm, conditions of labeling of the conjugated antibody with lutetium-177, method of purification of the radiolabeled immuno conjugate, method of radiochemical purity (RP), specific binding in vitro Raji cells (Human Burkitt) and biological distribution performed in normal Balb-c mouse. The three methodologies employed in pre-purification of Acm (dialysis, size exclusion chromatograph and dial filtration) demonstrated to be efficient; they provided sample recovery exceeding 90%. However, the methodology of dial filtration presents minimal sample loss, and gave the final recovery of the sample in micro liters; thereby facilitating sample use in subsequent experiments. Numbers of chelators attached to the Acm molecule was proportional to the molar ratio studied. When we evaluated the influence of different

The study of conjugation of anti-CD20 monoclonal antibody for labeling with metallic or lanthanides radionuclides; Estudo de conjugacao do anticorpo anti-CD20 para marcacao com radionuclideos metalicos ou lantanideos

Energy Technology Data Exchange (ETDEWEB)

Akanji, Akinkunmi Ganiyu

2012-07-01

Lymphomas are malignancies or cancers that start from the malign transformation of a lymphocyte in the lymphatic system. Generally, lymphomas start from the lymph nodes or from the agglomeration of the lymphatic tissues, organs like stomach, intestines, in some cases it can involve the bone marrow and the blood, it can also disseminate to other organs. Lymphomas are divided in two major categories: Hodgkin lymphoma and non-Hodgkin lymphoma (NHL). Patient with NHL are generally treated with radiotherapy alone or combined with immunotherapy using monoclonal antibody rituximab (MabThera Registered-Sign ). Currently, monoclonal antibodies (Acm) conjugated with bifunctional chelate agents and radiolabeled with metallic or lanthanides radionuclides are a treatment reality for patients with NHL by the principle of radioimmunotherapy (RIT). This study focused on the conditions of conjugation of Acm rituximab (MabThera Registered-Sign ) with bifunctional chelating agents DOTA and DTPA. Various parameters were studied: method of Acm purification, conditions of Acm conjugation, the method for determination of number of chelate agent coupled to the Acm, method for purification of the conjugated antibody Acm, conditions of labeling of the conjugated antibody with lutetium-177, method of purification of the radiolabeled immuno conjugate, method of radiochemical purity (RP), specific binding in vitro Raji cells (Human Burkitt) and biological distribution performed in normal Balb-c mouse. The three methodologies employed in pre-purification of Acm (dialysis, size exclusion chromatograph and dial filtration) demonstrated to be efficient; they provided sample recovery exceeding 90%. However, the methodology of dial filtration presents minimal sample loss, and gave the final recovery of the sample in micro liters; thereby facilitating sample use in subsequent experiments. Numbers of chelators attached to the Acm molecule was proportional to the molar ratio studied. When we evaluated

Indigenous development of TBq levels of "1"7"7Lu radioisotope production at RPhD for nuclear medicine applications - a successful venture

International Nuclear Information System (INIS)

Chakraborty, Sudipta; Vimalnath, K.V.; Dash, Ashutosh

2017-01-01

Lutetium-177 ("1"7"7Lu) has emerged as a potential radionuclide during last decade for the development of radionuclide therapy owing to its favorable nuclear decay characteristics (T_1_/_2=6.65 d, E_β_(_m_a_x) = 0.497 MeV, E_γ = 113 keV (6.4%) and 208 keV (11%)). The long half-life of this promising radioisotope offering distinct logistical advantage and feasibility of its large-scale production in medium flux Dhruva research reactor contributed to its success story

The migrant 152Eu as europium humate

International Nuclear Information System (INIS)

Klotz, D.

2001-01-01

Europium was used as a representative of the lanthanide group in the migration experiments in underground water. These 14 elements, with the atomic numbers of 58 (cerium) through 71 (lutetium) are quite similar in their chemical characteristics, and all of them will form metal-humate complexes with humic acids via proton exchange groups. Apart from the concentration, chemical composition and structure, also the particle size of these metal humates will vary strongly as it is dependent on the geochemistry and geophysics of the underground systems [de

Development of Scintillators in Nuclear Medicine

OpenAIRE

Khoshakhlagh, Mohammad; Islamian, Jalil Pirayesh; Abedi, Seyed Mohammad; Mahmoudian, Babak

2015-01-01

High-quality image is necessary for accurate diagnosis in nuclear medicine. There are many factors in creating a good image and detector is the most important one. In recent years, several detectors are studied to get a better picture. The aim of this paper is comparison of some type of these detectors such as thallium activated sodium iodide bismuth germinate cesium activated yttrium aluminum garnet (YAG: Ce) YAP: Ce “lutetium aluminum garnet activated by cerium” CRY018 “CRY019” lanthanum br...

Analysis of the spectrum of four-times-ionized lutetium (Lu V)

International Nuclear Information System (INIS)

Kaufman, V.; Sugar, J.

1978-01-01

Spectra of Lu obtained with a sliding spark discharge at peak currents of 50--500 A were recorded with a 10.7 m normal incidence spectrograph in the range of 500--2100 A. Intercomparison of spectra revealed a distinct separation of Lu III, IV, and V, the first two of which have already been anlayzed. The present work contains an interpretation of Lu V in which 419 lines are classified as transitions among 136 energy levels of the 4f 13 , 4f 12 5d, 4f 12 6s, and 4f 12 6p configurations. Calculated energy levels and eigenvectors, obtained with fitted values for the radial integrals, are given

The isolation of lutetium from gadolinium contained in Purex process solutions

International Nuclear Information System (INIS)

Bostick, D.T.; Vick, D.O.; May, M.P.; Walker, R.L.

1992-09-01

A chemical separation procedure has been devised to isolate Lu from Purex dissolver solutions containing the neutron poison, Gd. The isolation procedure involves the removal of U and >Pu from a dissolver solution using tributylphosphate solvent extraction. If required, solvent extraction using di-(2-ethylhexyl) phosphoric acid can be employed to further purify the sample be removing alkali and alkali earth elements. Finally, Lu is chromatographically separated from Gd and rare earth fission products on a Dowex 50W-X8 resin column using an alpha-hydroxyisobutyrate eluant. The success of the chemical separation procedure has been demonstrated in the quantitative recovery of as little as 1.4 ng Lu from solutions containing a 5000-fold excess of Gd. Additionally, Lu has been isolated from synthetic dissolver samples containing U, Ba, Cs, and Gd. Thermal emission MS data indicated that the Lu fraction of the synthetic sample was free of Gd interference

Development of lutetium-labeled bombesin derivates: relationship between structure and diagnostic-therapeutic activity for prostate tumor; Desenvolvimento de derivados da bombesina radiomarcados com lutecio-177: relacao estrutura e potencial diagnostico-terapeutico para tumor de prostata

Energy Technology Data Exchange (ETDEWEB)

Pujatti, Priscilla Brunelli

2009-07-01

Bombesin (BBN) receptors - in particular, the gastrin-releasing peptide (GRP) receptor peptide - have been shown to be massively over expressed in several human tumors types, including prostate cancer, and could be an alternative as target for its treatment by radionuclide therapy (RNT). A large number of BBN analogs had already been synthesized for this purpose and have shown to reduce tumor growth in mice. Nevertheless, most of the studied analogs exhibit high abdominal accumulation, especially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. The goal of the present work was to radiolabel a novel series of bombesin derivatives with lutetium-177 and to evaluate the relationship between their structure and diagnostic-therapeutic activity for prostate tumor. The generic structure of studied peptides is DOTA-Phe-(Gly){sub n}-BBN(6-14), where DOTA is the chelator, n is the number of glycine amino acids of Phe-(Gly){sub n} spacer and BBN(6-14) is the bombesin sequence from the amino acid 6 to the amino acid 14. Preliminary studies were done to establish the ideal labeling conditions for obtaining the highest yield of labeled bombesin derivatives, determined by instant thin layer chromatography (ITLC-SG) and high performance liquid chromatography (HPLC). The stability of the preparations was evaluated either after storing at 2-8 degree C or incubation in human serum at 37 degree C and the partition coefficient was determined in n:octanol:water. In vivo studies were performed in both healthy Balb-c and Nude mice bearing PC-3 xenografts, in order to characterize the biological properties of labeled peptides. In vitro studies involved the evaluation of cold bombesin derivatives effect in PC-3 cells proliferation. Bombesin derivatives were successfully labeled with high yield at optimized conditions and exhibited high stability at 4 degree C. The analysis of

Determination of the constants of the solubility product of Ln(OH){sub 3} and the effect of the chloride ions on the lanthanum hydrolysis, praseodymium and lutetium in aqueous solutions of ion force 2 Molar; Determinacion de las constantes del producto de solubilidad de Ln(OH){sub 3} y el efecto de los iones cloruro sobre la hidrolisis de lantano, praseodimio y lutecio en soluciones acuosas de fuerza ionica 2 Molar

Energy Technology Data Exchange (ETDEWEB)

Lopez G, H.D

2005-07-01

The behavior of lanthanum (III), praseodymium (III), and lutetium (III) was studied in 2 M NaClO{sub 4} (aq) and 2 M NaCl (aq) at 303 K and free -CO{sub 2} conditions. Solubility diagrams (p Ln(aq)-pC{sub H}) were obtained by means of a radiochemical method. The pC{sub H} borderlines of saturation and unsaturation zones of the solutions and solubility product constants for Ln(OH){sub 3} were determined from these diagrams. The fitting of the solubility equation to the experimental values of p Ln(aq)-pC{sub H} diagrams allowed the calculation of the first hydrolysis and solubility product constants. Independently, the stability constants for the first species of hydrolysis were determined by means of pH titrations, the data were treated with the program SUPERQUAD and fitted to the mean ligand number equation. The stability constants for the species LnCl{sup 2+} were as well calculated in 2M ionic strength and 303 K from the hydrolysis constant values obtained in both perchlorate and chloride media. The values obtained for La, Pr and Lu were: logK{sub ps}: 21.11 {+-} 0.09, 19.81 {+-} 0.11 and 18.10 {+-} 0.13 in 2M NaClO{sub 4}; logK{sub ps}: 22.22 {+-} 0.09, 21.45 {+-} 0.14 and 18.52 {+-} 0.29 in 2M NaCl; log {beta}{sub 1}: - 8.64 {+-} 0.02, - 8.37 {+-} 0.01 and - 7.95 {+-} 0.11 in 2M NaClO{sub 4}; log {beta}{sub 1}{sup /} : - 9.02 {+-} 0.11, - 8.75 {+-} 0.01 and - 8.12 {+-} 0.03 in 2M NaCl and the values for log {beta}{sub 1,Cl} were - 0.0255, - 0.155 and - 0.758, respectively. (Author)

A Search for Technosignatures from 14 Planetary Systems in the Kepler Field with the Green Bank Telescope at 1.15–1.73 GHz

Science.gov (United States)

Margot, Jean-Luc; Greenberg, Adam H.; Pinchuk, Pavlo; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, M. Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, Willow; Miles, Brittany; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse; Lynch, Ryan S.

2018-05-01

Analysis of Kepler mission data suggests that the Milky Way includes billions of Earth-sized planets in the habitable zone of their host stars. Current technology enables the detection of technosignatures emitted from a large fraction of the Galaxy. We describe a search for technosignatures that is sensitive to Arecibo-class transmitters located within ∼420 ly of Earth and transmitters that are 1000 times more effective than Arecibo within ∼13000 ly of Earth. Our observations focused on 14 planetary systems in the Kepler field and used the L-band receiver (1.15–1.73 GHz) of the 100 m diameter Green Bank Telescope. Each source was observed for a total integration time of 5 minutes. We obtained power spectra at a frequency resolution of 3 Hz and examined narrowband signals with Doppler drift rates between ±9 Hz s‑1. We flagged any detection with a signal-to-noise ratio in excess of 10 as a candidate signal and identified approximately 850,000 candidates. Most (99%) of these candidate signals were automatically classified as human-generated radio-frequency interference (RFI). A large fraction (>99%) of the remaining candidate signals were also flagged as anthropogenic RFI because they have frequencies that overlap those used by global navigation satellite systems, satellite downlinks, or other interferers detected in heavily polluted regions of the spectrum. All 19 remaining candidate signals were scrutinized and none were attributable to an extraterrestrial source.

Neutron activation analysis of the rare earth elements in Nasu hot springs

International Nuclear Information System (INIS)

Ikeda, Nagao; Takahashi, Naruto.

1978-01-01

Eleven rare earth elements (lanthanum, cerium, neodymium, samarium, europium, gadolinium, terbium, holmium, thulium, ytterbium and lutetium) in hot spring waters and sinter deposits in the Nasu area were determined by the neutron activation method. The rare earth elements in hot spring water were preconcentrated in ferric hydroxide precipitate and neutron-irradiated. The rare earth elements were chemically separated into lighter and heavier groups and the activity of each group was measured with a Ge(Li) detector. Distribution of the rare earth elements between the hot spring water and the sinter deposit was also discussed. (auth.)

Status of the lanthanides and actinides in the periodic table

International Nuclear Information System (INIS)

Holden, N.E.

1985-01-01

In extended discussions and correspondence with Ekkehard Fluck, the author was made aware of a problem with the Periodic Table, i.e., which element should be shown in the main table as the representative of the lanthanide series and the actinide series. In earlier discussion, he came to the conclusion that lanthanum and actinium are not the elements which should appear, but rather lutetium and lawrencium are more appropriate for inclusion in their place. This paper will attempt to justify the reasons for the above conclusions. 4 refs

Phase extraction equilibria in systems rare earth (3) nitrates-ammonium nitrate-water-trialkylmethylammonium nitrate

International Nuclear Information System (INIS)

Pyartman, A.K.; Kopyrin, A.A.; Puzikov, E.A.

1995-01-01

The distribution of rare earth metals (3) between aqueous and organic phases in the systems rare earth metal (3) (praseodymium-lutetium (3), yttrium (3)) nitrate-ammonium nitrate-water-trialkylmethylammonium (kerosene diluent nitrate has been studied. It is shown that in organic phase di- and trisolvates of metals (3) with tralkylmethylammonium nitrate are formed. The influence of concentration of rare earth metal (3) nitrate and ammonium nitrate on the values of extraction concentrational constants has been ascertained: they decrease with increase in the ordinal number of lanthanide (3). 11 refs., 4 figs. 1 tab

Finding of 13(2) , 17(3) -cyclopheophorbide a enol as a degradation product of chlorophyll in shrunk zooxanthellae of the coral Montipora digitata.

Science.gov (United States)

Suzuki, Toshiyuki; Casareto, Beatriz Estela; Shioi, Yuzo; Ishikawa, Yoshio; Suzuki, Yoshimi

2015-02-01

We examined the morphology and pigment composition of zooxanthellae in corals subjected to normal temperature (27°C) and thermal stress (32°C). We observed several normal and abnormal morphological types of zooxanthellar cells. Normal cells were intact and their chloroplasts were unbroken (healthy); abnormal cells were shrunken and had partially degraded or broken chloroplasts, or they were bleached and without chloroplasts. At 27°C, most healthy zooxanthellar cells were retained in the coral tissue, whereas shrunken zooxanthellae were expelled. Under thermal stress, the abundance of healthy zooxanthellae declined and the proportion of shrunken/abnormal cells increased in coral tissues. The rate of algal cell expulsion was reduced under thermal stress. Within the shrunken cells, we detected the presence of a chl-like pigment that is not ordinarily found in healthy zooxanthellae. Analysis of the absorption spectrum, absorption maxima, and retention time (by HPLC) indicated that this pigment was 13(2) , 17(3) -cyclopheophorbide a enol (cPPB-aE), which is frequently found in marine and lacustrine sediments, and in protozoans that graze on phytoplankton. The production of cPPB-aE in shrunken zooxanthellae suggests that the chls have been degraded to cPPB-aE, a compound that is not fluorescent. The lack of a fluorescence function precludes the formation of reactive oxygen species. We therefore consider the formation of cPPB-aE in shrunken zooxanthellae to be a mechanism for avoiding oxidative stress. © 2014 The Authors. Journal of Phycology published by Wiley Periodicals, Inc. on behalf of Phycological Society of America.

Effect of a fermented milk containing Bifidobacterium animalis DN-173 010 on the health-related quality of life and symptoms in irritable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial.

Science.gov (United States)

Guyonnet, D; Chassany, O; Ducrotte, P; Picard, C; Mouret, M; Mercier, C-H; Matuchansky, C

2007-08-01

Health-related quality of life (HRQoL) has been rarely evaluated as a primary endpoint in the assessment of the effect of probiotics on the irritable bowel syndrome (IBS). To study the effects of fermented milk containing Bifidobacterium animalis DN-173 010 and yoghurt strains on the IBS in a multicentre, double-blind, controlled trial. A total of 274 primary care adults with constipation-predominant IBS (Rome II) were randomized to consume for 6 weeks either the test fermented milk or a heat-treated yoghurt (control). HRQoL and digestive symptoms were assessed after 3 and 6 weeks on an intention-to-treat population of 267 subjects. The HRQoL discomfort score, the primary endpoint, improved (P food on discomfort HRQoL score and bloating in constipation-predominant IBS, and on stool frequency in subjects with <3 stools/week.

173 - 177 Falodun J

African Journals Online (AJOL)

DR. AMIN

palm oil mill effluent and NPK 15:15:15 fertilizer on the growth and yield of soyabean genotype ... growing maize and reported a significant effect on yield. Organic fertilizers supply the ... (1984) and significant differences among treatment.

Pages 166- 173.pmd

African Journals Online (AJOL)

Administrator

The logistic regression model to predict neonatal mortality had a good fit (AUC: 0.8507, misclassification rate: 13.6%) ... intensive care units, principal component analysis, logistic regression, ... between cost of neonatal care and length of stay.

Prediction of presence of kidney disease in a general patient population undergoing intravenous iodinated contrast enhanced computed tomography

Energy Technology Data Exchange (ETDEWEB)

Moos, Shira I.; Stoker, Jaap; Nagan, Gajenthiran; Weijert, Roderick S. de; Vemde, David N.H. van; Bipat, Shandra [Academic Medical Center, University of Amsterdam, Department of Radiology, G1-215, Amsterdam (Netherlands)

2014-06-15

To assess which risk factors can be used to reduce superfluous estimated glomerular filtration rate (eGFR) measurements before intravenous contrast medium administration. In consecutive patients, all decreased eGFR risk factors were assessed: diabetes mellitus (DM), history of urologic/nephrologic disease (HUND), nephrotoxic medication, cardiovascular disease, hypertension, age > 60 years, anaemia, malignancy and multiple myeloma/M. Waldenstroem. We studied four models: (1) all risk factors, (2) DM, HUND, hypertension, age > 60 years; (3) DM, HUND, cardiovascular disease, hypertension; (4) DM, HUND, age > 75 years and congestive heart failure. For each model, association with eGFR < 60 ml/min/1.73 m{sup 2} or eGFR < 45 ml/min/1.73 m{sup 2} was studied. A total of 998 patients, mean age 59.94 years were included; 112 with eGFR < 60 ml/min/1.73 m{sup 2} and 30 with eGFR < 45 ml/min/1.73 m{sup 2}. Model 1 detected 816 patients: 108 with eGFR < 60 ml/min/1.73 m{sup 2} and all 30 with eGFR < 45 ml/min/1.73 m{sup 2}. Model 2 detected 745 patients: 108 with eGFR < 60 ml/min/1.73 m{sup 2} and all 30 with eGFR < 45 ml/min/1.73 m{sup 2}. Model 3 detected 622 patients: 100 with eGFR < 60 ml/min/1.73 m{sup 2} and all 30 with eGFR < 45 ml/min/1.73 m{sup 2}. Model 4 detected 440 patients: 86 with eGFR < 60 ml/min/1.73 m{sup 2} and all 30 with eGFR < 45 ml/min/1.73 m{sup 2}. Associations were significant (p < 0.001). Model 4 is most effective, resulting in the lowest proportion of superfluous eGFR measurements while detecting all patients with eGFR < 45 ml/min/1.73 m{sup 2} and most with eGFR < 60 ml/min/1.73 m{sup 2}. (orig.)

Prediction of presence of kidney disease in patients undergoing intravenous iodinated contrast enhanced computed tomography: a validation study

Energy Technology Data Exchange (ETDEWEB)

Schreuder, Sanne M.; Stoker, Jaap; Bipat, Shandra [University of Amsterdam, Department of Radiology, Academic Medical Centre, G1-212, Amsterdam (Netherlands)

2017-04-15

To validate two previously presented models containing risk factors to identify patients with estimated glomerular filtration rate (eGFR) <60 ml/min/1.73 m{sup 2} or eGFR <45 ml/min/1.73 m{sup 2}. In random patients undergoing intravenous contrast-enhanced computed tomography (CECT) the following risk factors were assessed: history of urological/nephrological disease, hypertension, diabetes mellitus, anaemia, congestive heart failure, other cardiovascular disease or multiple myeloma or Waldenstroem disease. Data on kidney function, age, gender and type and indication of CECT were also registered. We studied two models: model A - diabetes mellitus, history of urological/nephrological disease, cardiovascular disease, hypertension; model B - diabetes mellitus, history of urological/nephrological disease, age >75 years and congestive heart failure. For each model, associations with eGFR <60 ml/min/1.73 m{sup 2} or eGFR <45 ml/min/1.73 m{sup 2} was studied. A total of 1,001 patients, mean age 60.36 years were included. In total, 92 (9.2 %) patients had an eGFR <60 ml/min/1.73 m{sup 2} and 11 (1.1 %) patients an eGFR <45 ml/min/1.73 m{sup 2}. Model A detected 543 patients: 81 with eGFR <60 ml/min/1.73 m{sup 2} (missing 11) and all 11 with eGFR <45 ml/min/1.73 m{sup 2}. Model B detected 420 patients: 70 (missing 22) with eGFR <60 ml/min/1.73 m{sup 2} and all 11 with eGFR <45 ml/min/1.73 m{sup 2}. Associations were significant (p < 0.05). Model B resulted in the lowest superfluous eGFR measurements while detecting all patients with eGFR <45 ml/min/1.73 m{sup 2} and nearly all with eGFR <60 ml/min/1.73 m{sup 2}. (orig.)

77 FR 36607 - Office of Hazardous Materials Safety Notice of Applications for Modification of Special Permit

Science.gov (United States)

2012-06-19

... modification of special permits (e.g. to provide for additional hazardous materials, packaging design changes... hazardous materials. 12102-M EQ Industrial 49 CFR 173.56(i); To modify the special Services, Inc. 173.56(b... 4.1. 13102-M Robertshaw Industrial 49 CFR 173.150(b); To modify the special Products dba 173.222(c...

Growth of large detector crystals. CRADA final report

International Nuclear Information System (INIS)

Boatner, L.A.; Samuelson, S.

1997-01-01

In the course of a collaborative research effort between L.A. Boatner of Oak Ridge National Laboratory and Prof. Alex Lempicki of the Department of Chemistry of Boston University, a new highly efficient and very fast scintillator for the detection of gamma-rays was discovered. This new scintillator consists of a single crystal of lutetium orthophosphate (LuPO 4 ) to which a small percentage of trivalent cerium is added as an activator ion. The new lutetium orthophosphate-cerium scintillator was found to be superior in performance to bismuth germanium oxide--a material that is currently widely used as a gamma-ray detector in a variety of medical, scientific, and technical applications. Single crystals of LuPO 4 and related rare-earth orthophosphates had been grown for a number of years in the ORNL Solid State Division prior to the discovery of the efficient gamma-ray-scintillation response of LuPO 4 :Ce. The high-temperature-solvent (flux-growth) method used for the growth of these crystals was capable of producing crystals in sizes that were adequate for research purposes but that were inadequate for commercial-scale production and widespread application. The CRADA between ORNL and Deltronic Crystal Industries of Dover, NJ was undertaken for the purpose of investigating alternate approaches, such as top-seeded-solution growth, to the growth of LuPO 4 :Ce scintillator crystals in sizes significantly larger than those obtainable through the application of standard flux-growth methods and, therefore, suitable for commercial sales and applications

Thermodynamic characteristics of dehydration of hexahydrates of erbium, thulium and lutetium chlorides

International Nuclear Information System (INIS)

Ukraintseva, Eh.A.; Sokolova, N.P.; Logvinenko, V.A.

1991-01-01

Temperature dependence of water vapour equilibrium pressure over the compounds of ErCl 3 ·6H-2O, TmCl 3 ·6H 2 O and LuCl 3 ·6H 2 O is studied by membrane method within the temperature range of 309-403 K. Dehydration process stoichiometry is determined thermogravimetrically under quasi-equilibrium conditions. All three compounds split off three molecules at the first stage of dehydration. ErCl 3 ·6H 2 O and TmCl 2 ·6H 2 O are very similar to terbium and disprosium chloride hexahydrates by vapour pressure value and dehydration enthalpy; enthalpy of the first dehydration stage is of the same character as those of nedymium, gadolinium and holmium chloride haxahydrates

Production and evaluation of Lutetium-177 maltolate as a possible therapeutic agent

International Nuclear Information System (INIS)

Hakimi, A.; Jalilian, A. R.; Bahrami Samani, A.; Ghannadi Maragheh, M.

2012-01-01

Development of oral therapeutic radiopharmaceuticals is a new concept in radiopharmacy. Due to the interesting therapeutic properties of 177 Lu and oral bioavailability of maltolate (MAL) metal complexes, 177 Lu-maltolate ( 177 Lu-MAL) was developed as a possible therapeutic compound for ultimate oral administration. The specific activity of 2.6-3 GBq/mg was obtained by irradiation of natural Lu 2 O 3 sample with thermal neutron flux of 4x10 13 n.cm -2 .s -1 for Lu-177. The product was converted into chloride form which was further used for labeling maltol (MAL). At optimized conditions a radiochemical purity of about >99% was obtained for 177 Lu-MAL shown by ITLC (specific activity, 970-1000 Mbq/mmole). The stability of the labeled compound as well as the partition coefficient was determined in the final solution up to 24h. Biodistribution studies of Lu-177 chloride and 177 Lu-MAL were carried out in wild-type rats for post-oral distribution phase data. Lu-MAL is a possible therapeutic agent in human malignancies for the bone palliation therapy so the efficacy of the compound should be tested in various animal models.

High pressure and temperature induced structural and elastic properties of lutetium chalcogenides

Science.gov (United States)

Shriya, S.; Kinge, R.; Khenata, R.; Varshney, Dinesh

2018-04-01

The high-pressure structural phase transition and pressure as well temperature induced elastic properties of rock salt to CsCl structures in semiconducting LuX (X = S, Se, and Te) chalcogenides compound have been performed using effective interionic interaction potential with emphasis on charge transfer interactions and covalent contribution. Estimated values of phase transition pressure and the volume discontinuity in pressure-volume phase diagram indicate the structural phase transition from ZnS to NaCl structure. From the investigations of elastic constants the pressure (temperature) dependent volume collapse/expansion, melting temperature TM, Hardness (HV), and young modulus (E) the LuX lattice infers mechanical stiffening, and thermal softening.

Kinetic properties of solid yttrium at high temperatures

International Nuclear Information System (INIS)

Ivliev, A.D.

1993-01-01

Analysis of results of experimental investigation into temperature-diffusivity, specific electroresistance and heat conductivity of yttrium is carried out. Peculiarities of variation of its kinetic characteristics under high temperatures are shown to result from two-band character of energy spectrum of collectivized electrons. In particular, growth of heat conductivity results from reduction of density of heavy electron states under heating. The suggested model describes kinetic characteristics of lutetium, as well. Usage of this model for the rest heavy rare-earth metals enables to make conclusion about reduction of magnetic scattering effcieincy in the rare-earth metals in proportion to approximation to melting temperature

Mutual solubility between hexane and three-n-butyl phosphate solvates of lanthanide(III) and thorium(IV) nitrates at various temperatures

International Nuclear Information System (INIS)

Keskinov, V.A.; Lishuk, V.V.; Pyartman, A.K.

2007-01-01

Phase diagrams of binary liquid systems of hexane-rare earth(III) nitrates solvates (rare earth - neodymium, gadolinium, yttrium, ytterbium, lutetium) and thorium(IV) with tri-n-butylphosphate are studied at different temperatures. Phase diagrams of binary systems consist of fields of homogeneous solutions and field of stratification into two liquid phases (I, II): phase I is enriched by hexane, and phase II - [Ln(NO 3 ) 3 (TBP) 3 ] (Ln=Nd, Gd, Y, Yb and Lu) or [Th(NO 3 ) 4 (TBP) 2 ]. Field of stratification into two liquid phases are decreased with growing temperature in binary systems [ru

Scintillator Evaluation for High-Energy X-Ray Diagnostics

International Nuclear Information System (INIS)

Lutz, S. S.; Baker, S. A.

2001-01-01

This report presents results derived from a digital radiography study performed using x-rays from a 2.3 MeV, rod-pinch diode. Detailed is a parameter study of cerium-doped lutetium ortho-silicate (LSO) scintillator thickness, as it relates to system resolution and detection quantum efficiency (DQE). Additionally, the detection statistics of LSO were compared with that of CsI(Tl). As a result of this study we found the LSO scintillator with a thickness of 3 mm to yield the highest system DQE over the range of spatial frequencies from 0.75 to 2.5 mm -1

Progress report for the Office of Safeguards and Security for FY 1982

International Nuclear Information System (INIS)

Smith, D.H.; McKown, H.S.; Walker, R.L.; Sherman, R.L.; Pritchard, C.A.; Carter, J.A.

1982-12-01

Progress in various areas funded by, or of interest to, the Office of Safeguards and Security during FY 1982 is reported. The quadrupole mass spectrometer and its mobile laboratory visited several sites; results were uniformly excellent. We designed, built, and evaluated a new ion source for this instrument; as a result, performance is considerably enhanced. We have completed initial evaluation of lutetium for use as a double spike in calibrating holding tanks or other vessels of indeterminate volume. Precisions and accuracies of about 0.1% were obtained. Two uranium standards have been evaluated using NBS isotopic standards and SALE samples

Prediction of presence of kidney disease in a general patient population undergoing intravenous iodinated contrast enhanced computed tomography.

Science.gov (United States)

Moos, Shira I; Stoker, Jaap; Nagan, Gajenthiran; de Weijert, Roderick S; van Vemde, David N H; Bipat, Shandra

2014-06-01

To assess which risk factors can be used to reduce superfluous estimated glomerular filtration rate (eGFR) measurements before intravenous contrast medium administration. In consecutive patients, all decreased eGFR risk factors were assessed: diabetes mellitus (DM), history of urologic/nephrologic disease (HUND), nephrotoxic medication, cardiovascular disease, hypertension, age > 60 years, anaemia, malignancy and multiple myeloma/M. Waldenström. We studied four models: (1) all risk factors, (2) DM, HUND, hypertension, age > 60 years; (3) DM, HUND, cardiovascular disease, hypertension; (4) DM, HUND, age > 75 years and congestive heart failure. For each model, association with eGFR < 60 ml/min/1.73 m(2) or eGFR < 45 ml/min/1.73 m(2) was studied. A total of 998 patients, mean age 59.94 years were included; 112 with eGFR < 60 ml/min/1.73 m(2) and 30 with eGFR < 45 ml/min/1.73 m(2). Model 1 detected 816 patients: 108 with eGFR < 60 ml/min/1.73 m(2) and all 30 with eGFR < 45 ml/min/1.73 m(2). Model 2 detected 745 patients: 108 with eGFR < 60 ml/min/1.73 m(2) and all 30 with eGFR < 45 ml/min/1.73 m(2). Model 3 detected 622 patients: 100 with eGFR < 60 ml/min/1.73 m(2) and all 30 with eGFR < 45 ml/min/1.73 m(2). Model 4 detected 440 patients: 86 with eGFR < 60 ml/min/1.73 m(2) and all 30 with eGFR < 45 ml/min/1.73 m(2). Associations were significant (p < 0.001). Model 4 is most effective, resulting in the lowest proportion of superfluous eGFR measurements while detecting all patients with eGFR < 45 ml/min/1.73 m(2) and most with eGFR < 60 ml/min/1.73 m(2). A major risk factor for contrast-induced nephropathy (CIN) is kidney disease. Risk factors are used to identify patients with pre-existent kidney disease. Evidence for risk factors to identify patients with kidney disease is limited. The number of eGFR measurements to detect kidney disease can be reduced.

Areva at March 31, 2014: Downturn in revenue as anticipated, to euro 1.781 bn (-17.3% like for like), Backlog of euro 40.2 bn

International Nuclear Information System (INIS)

Duperray, Julien; Berezowskyj, Katherine; Grange, Aurelie; Rosso, Jerome; Thebault, Alexandre; Scorbiac, Marie de; Repaire, Philippine du

2014-01-01

Following the marked growth of the nuclear operations in 2013, thanks in particular to the strength of recurring activities and the contribution of exceptional items such as significant uranium sales volumes and non-recurring foreign contracts, revenue in the first quarter of the year fell sharply, as Areva had anticipated. A strong seasonal effect will materialize in 2014, with greater activity to be expected in the second half of the year. As indicated when releasing 2013 annual results, the current economic environment is still unfavorable, with market prices deteriorating in the front end of the cycle and lackluster demand from customers for installed base services. AREVA's operations generated consolidated revenue of 1.781 billion euros in the first quarter of 2014, a decrease of 18.1% (-17.3 % like for like) compared with the same period in 2013. The Front End Business Group (BG) reported strong growth of +59.0% (+59.8% like for like). Revenue was down in the Mining, Reactors and Services, Back End and Renewable Energies BGs, at -63.0% (-62.3% like for like), -14.1% (-12.5% like for like), -41.7% (-41.6% like for like) and -38.2% (-34.6% like for like) respectively. Foreign exchange had a negative impact of 18 million euros over the period, while the change in consolidation scope had a negative impact of 3 million euros. The group's backlog reached 40.2 billion euros at March 31, 2014, a decrease of 2.9% compared with December 31, 2013 and of 8.8% year on year

177Lu-DOTA-Bevacizumab: Radioimmunotherapy Agent for Melanoma.

Science.gov (United States)

Camacho, Ximena; Calzada, Victoria; Fernandez, Marcelo; Alonso, Omar; Chammas, Roger; Riva, Eloisa; Gambini, Juan Pablo; Cabral, Pablo

2017-01-01

Vascular endothelial growth factor (VEGF) is one of the classic factors to tumor-induced angiogenesis in several types, including melanoma. Bevacizumab is a humanized monoclonal antibody directed against VEGF. To radiolabel Bevacizumab with 177-Lutetium as a potential radioimmunotherapy agent for melanoma. Bevacizumab was derivatized with DOTA-NHS-ester at 4 ºC for 18 h. DOTABevacizumab was radiolabeled with 177LuCl3 (15 MBq/mg) at 37 ºC for 1 h. The studies were performed in healthy and B16F1 tumor-bearing C57BL/6J mice at 24 and 48 h (n = 5). Scinthigraphic imaging studies were performed at 24 h to determine the radiochemical stability, targeting specificity and pharmacokinetics of the 177Lutetium-labeled antibody. DOTA-Bevacizumab was efficiently labeled with 177LuCl3 at 37 °C. The in-vitro stability of labeled product was optimal over 72 h. In-vivo biodistribution studies showed a high liver and tumor uptake of 177Lu-DOTA-Bevacizumab, with tumor-to-muscle ratios of 11.58 and 6.37 at 24 and 48 h p.i. Scintigraphic imaging of melanoma tumor-bearing C57BL/6J mice showed liver and a high tumor selective uptake of 177Lu-DOTA-Bevacizumab at 24 h. Our results support the potential role of 177Lu-DOTA-Bevacizumab as a novel radioimmunotherapy agent for melanoma. We hope that these novel molecular imaging agents will open the path to new diagnostic and therapeutic strategies for Melanoma disease. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Development of Scintillators in Nuclear Medicine

International Nuclear Information System (INIS)

Khoshakhlagh, Mohammad; Islamian, Jalil Pirayesh; Abedi, Seyed Mohammad; Mahmoudian, Babak

2015-01-01

High-quality image is necessary for accurate diagnosis in nuclear medicine. There are many factors in creating a good image and detector is the most important one. In recent years, several detectors are studied to get a better picture. The aim of this paper is comparison of some type of these detectors such as thallium activated sodium iodide bismuth germinate cesium activated yttrium aluminum garnet (YAG: Ce) YAP: Ce “lutetium aluminum garnet activated by cerium” CRY018 “CRY019” lanthanum bromide and cadmium zinc telluride. We studied different properties of these crystals including density, energy resolution and decay times that are more important factors affecting the image quality

Development of Scintillators in Nuclear Medicine.

Science.gov (United States)

Khoshakhlagh, Mohammad; Islamian, Jalil Pirayesh; Abedi, Seyed Mohammad; Mahmoudian, Babak

2015-01-01

High-quality image is necessary for accurate diagnosis in nuclear medicine. There are many factors in creating a good image and detector is the most important one. In recent years, several detectors are studied to get a better picture. The aim of this paper is comparison of some type of these detectors such as thallium activated sodium iodide bismuth germinate cesium activated yttrium aluminum garnet (YAG: Ce) YAP: Ce "lutetium aluminum garnet activated by cerium" CRY018 "CRY019" lanthanum bromide and cadmium zinc telluride. We studied different properties of these crystals including density, energy resolution and decay times that are more important factors affecting the image quality.

Detector for positronium temperature measurements by two-photon angular correlation

Science.gov (United States)

Cecchini, G. G.; Jones, A. C. L.; Fuentes-Garcia, M.; Adams, D. J.; Austin, M.; Membreno, E.; Mills, A. P.

2018-05-01

We report on the design and characterization of a modular γ-ray detector assembly developed for accurate and efficient detection of coincident 511 keV back-to-back γ-rays following electron-positron annihilation. Each modular detector consists of 16 narrow lutetium yttrium oxyorthosilicate scintillators coupled to a multi-anode Hamamatsu H12700B photomultiplier tube. We discuss the operation and optimization of 511 keV γ-ray detection resulting from testing various scintillators and detector arrangements concluding with an estimate of the coincident 511 keV detection efficiency for the intended experiment and a preliminary test representing one-quarter of the completed array.

4d--4f emission resonances in laser-produced plasmas

International Nuclear Information System (INIS)

O'Sullivan, G.; Carroll, P.K.

1981-01-01

Using targets containing compounds of the elements cesium through lutetium, we studied the spectra of laser-produced plasmas in the grazing-incidence region from 40 to 200 A. The spectra are characterized by strong regions of resonancelike emission extending typically over 9--18 eV. With increasing Z, the spectra show certain systematic variations in character and move monotonically toward shorter wavelengths. From a collisional-radiative plasma model, the ion stages responsible for the emision are identified as VIII through XVI. The resonances are attributed to 4-4f transitions that, because Dn = 0, tend to overlap for different ion stages of the same element

High spin K isomeric target of 177mLu

International Nuclear Information System (INIS)

Roig, O.; Belier, G.; Daugas, J.-M.; Delbourgo, P.; Maunoury, L.; Meot, V.; Morichon, E.; Sauvestre, J.-E.; Aupiais, J.; Boulin, Y.; Fioni, G.; Letourneau, A.; Marie, F.; Ridikas, D.

2004-01-01

The techniques used to produce a 177m Lu (J π =23/2 - ,T 1/2 =160.4 days) target are described in this paper. Firstly, an isotopic separation of an enriched lutetium sample was used to reach a purity of 176 Lu close to 99.993%. Afterwards, the high neutron flux of the Grenoble Institut Laue-Langevin reactor was used to produce the 177m Lu isomer by the 176 Lu(n,γ) reaction. Finally, a chemical separation was performed to extract 10 13 nuclei of 177m Lu. Thanks to this experiment, we have been able to estimate the destruction cross-section of the 177m Lu

78 FR 12415 - Notice of Applications for Modification of Special Permit

Science.gov (United States)

2013-02-22

... hazardous materials, packaging design changes, additional mode of transportation, etc.) are described in... 173.302(a), permit to authorize Columbus, OH. 173.304(a), a Class 8 packaging 173.304(d), group I... seamless stainless steel type 304 packaging and remove requirements when reoffered for transportation...

21 CFR 173.370 - Peroxyacids.

Science.gov (United States)

2010-04-01

... good manufacturing practice (unless precluded by the U.S. Department of Agriculture's standards of... the Division of Petition Review, Center for Food Safety and Applied Nutrition, Food and Drug... National Archives and Records Administration (NARA). For information on the availability of this material...

7 CFR 1.173 - Judges.

Science.gov (United States)

2010-01-01

... proceeding, (2) is related within the third degree by blood or marriage to any party to the proceeding, or (3... present. Any memorandum or other communication addressed to the Judicial Officer or a Judge, during the... prior to any hearing to be conducted by telephone or audio-visual telecommunication; (8) Require that...

33 CFR 173.3 - Definitions.

Science.gov (United States)

2010-07-01

...: (a) [Reserved] (b) Issuing authority means a State that has a numbering system approved by the Coast Guard or the Coast Guard where a number system has not been approved. Issuing authorities are listed in..., firm, partnership, corporation, company, association, joint-stock association, or governmental entity...

173 Résumé Abstract

African Journals Online (AJOL)

AKA BOKO

1Laboratoire de Physique Appliquée de l'Université de Fianarantsoa - Madagascar. 2 Département de Sciences Exactes ... 3 Laboratoire de Mathématiques Et Physique des Systèmes-Groupes de Mécanique. Énergétique à .... Par définition, la vitesse de séchage est la variation par rapport au temps de l'humidité absolue ...

49 CFR 173.308 - Lighters.

Science.gov (United States)

2010-10-01

... word “sample” must appear on the shipping paper as part of the proper shipping name or in association... lighter design conforms to paragraph (a) of this section and passes or does not pass the required leakage... at least three years thereafter, a copy of each lighter's test report must be maintained by the...

7 CFR 989.173 - Reports.

Science.gov (United States)

2010-01-01

... certified by an organic certification organization currently registered with the California Department of Food and Agriculture or such certifying organization accredited under the National Organic Program... shall provide copies of the organic certificate(s) applicable to the quantity of raisins reported as...

14 CFR 17.3 - Definitions.

Science.gov (United States)

2010-01-01

... issuance of a Contracting Officer final decision. Contract disputes for purposes of ADR only may also... communication or the use of ADR. The Default Adjudicative Process is conducted by a DRO or Special Master... Office of Dispute Resolution for Acquisition. For a post-award protest, the awardee of the contract that...

BDML Metadata: 173 [SSBD[Archive

Lifescience Database Archive (English)

Full Text Available NC-SA 0.180 af0395dc-f2a1-4e46-9a3b-28e282ab0526 0.105 x 0.105 x 0.5 (micrometer), 40 (second) http://ssbd.qbic.riken.jp/data.../source/Ce_KK_P002/RNAi_R10E4.4_061107_02.zip http://ssbd.qbic.riken.jp/data.../bdml/Ce_KK_P002/RNAi_R10E4.4_061107_02.bdml0.18.xml http://ssbd.qbic.riken.jp/data/pdpml/Ce_KK_...P002.pdpml0.06.xml http://ssbd.qbic.riken.jp/search/af0395dc-f2a1-4e46-9a3b-28e282ab0526/ http://ssbd.qbic.riken.jp/omero/webclient/?show=dataset-88 ...

47 CFR 87.173 - Frequencies.

Science.gov (United States)

2010-10-01

....000-117.975 MHz Q DGP Differential GPS. 108.050 MHz Q RLT 108.100-111.950 MHz Q RLL ILS Localizer. 108....600-121.925 MHz O, L, Q MA, FAC, MOU, RLT, GCO, RCO, RPC 25 kHz channel spacing. 121.950 MHz K FAS 121.... 122.700 MHz G, L MA, FAU, MOU Unicom at airports with no control tower; Aeronautical utility stations...

40 CFR 763.173 - Exemptions.

Science.gov (United States)

2010-07-01

... inadequate to allow the Agency to make a reasoned judgment on any of the information required in paragraph (d... the appropriate ban. This letter will be considered a final Agency action for purposes of judicial... notice will be considered a final Agency action for purposes of judicial review. (j) The length of an...

50 CFR 17.3 - Definitions.

Science.gov (United States)

2010-10-01

... part; Authentic native articles of handicrafts and clothing means items made by an Indian, Aleut, or... species, or a fire or other natural catastrophic event in areas prone to such events). Conservation plan... captive populations of the affected species: (a) Provision of health care, management of populations by...

21 CFR 173.50 - Polyvinylpolypyrrolidone.

Science.gov (United States)

2010-04-01

... percent acetic acid, and 50 percent alcohol, no more than 50 parts per million of extractables is obtained with each solvent. (c) It is used or intended for use as a clarifying agent in beverages and vinegar...

21 CFR 17.3 - Definitions.

Science.gov (United States)

2010-04-01

... AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL CIVIL MONEY PENALTIES... giving rise to civil money penalty actions brought under 21 U.S.C. 333(g)(1): (1) Significant departure... has the same definition for civil money penalty actions that may be brought under that act. (e) Any...

Lutetium-177 complexation of DOTA and DTPA in the presence of competing metals

International Nuclear Information System (INIS)

Watanabe, Satoshi; Ishioka, Noriko S.; Hashimoto, Kazuyuki

2013-01-01

177 Lu complexation of DOTA and DTPA is investigated by the addition of Ca(II), Fe(II) and Zn(II). The 177 Lu complexation yield of DTPA was higher than that of DOTA in the presence of Ca(II), Fe(II) and Zn(II). Therefore, it was found that the 177 Lu complexation of DTPA was more advantageous compared with DOTA in the presence of competing metals, Ca, Fe and Zn. (author)

Crystal growth and scintillation properties of Ce-doped sodium calcium lutetium complex fluoride

Czech Academy of Sciences Publication Activity Database

Wakahara, S.; Furuya, Y.; Yanagida, T.; Yokota, Y.; Pejchal, Jan; Sugiyama, M.; Kawaguchi, N.; Totsuka, D.; Yoshikawa, A.

2012-01-01

Roč. 34, č. 4 (2012), s. 729-732 ISSN 0925-3467 Institutional research plan: CEZ:AV0Z10100521 Keywords : scintillator * micro-pulling-down method * single crystal * gamma-ray stopping power Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.918, year: 2012

National Guard and Reserve Equipment Report for Fiscal Year 2012 (NGRER FY 2012)

Science.gov (United States)

2011-02-01

to be 97 percent filled; however, only 61 percent will be modernized.  HTV fleet is projected to be 100 percent filled; however, the 20-ton Dump ...185 91 49% $29.3M High Mobility Engineer Excavator 64 35 55% $7.3M Hydraulic Excavator (HYEX) 133 78 59% $19.5M Scrapers 410 364 89% $32.9M...A46758 $800,000 11 11 11 11 11 Aviation Radio Set, HF, AN/VRC-100(V)1 R81691 $33,707 173 173 173 173 238 Hoist , High Performance H39331 $142,338 221

77 FR 23803 - Office of Hazardous Materials Safety; Actions on Special Permit Applications

Science.gov (United States)

2012-04-20

...-M......... Conference of 49 CFR To modify the Radiation 172.203(d); special permit add Control Part............ Conference of 49 CFR Part To modify the Radiation 172, Subparts, special permit add Control C, D, E, F, G, 49...; additional mode of Berlin 173.345; transportation Packaging 173.346; (cargo vessel). (Former 173.359; Grantee...

77 FR 29450 - Actions on Special Permit Applications

Science.gov (United States)

2012-05-17

............ Conference of 49 CFR To modify the Radiation 172.203(d); special permit add Control Part 172, 49 CFR Part 172..., KY. the list of regulations exempted in paragraph 4. 11406-M......... Conference of 49 CFR Part To... mode of Berlin 173.345; transportation Packaging 173.346; (cargo vessel.) (Former 173.359; Grantee All...

77 FR 64843 - Actions on Special Permit Applications

Science.gov (United States)

2012-10-23

... modify the Industrial 173.150(b); special permit to Products dba 173.222(c); authorize the Invensys 173... changed from package to packaging would allow the containers to be shipped back to the manufacturer for... Base, IL. 176.84(c)(2); ammunition on and 176.136. United States Navy Container Ships. (mode 3) DENIED...

40 CFR 52.2479 - Contents of the federally approved, State submitted implementation plan.

Science.gov (United States)

2010-07-01

... [09/17/90] 173-430-040 Mobile field burners [09/17/90] 173-430-050 Other approvals [09/17/90] 173-430... General Definitions [12/11/80] Section 1.05 Special Definitions [9/9/99] Article 2—Gasoline Marketing...] Section 3.03 Can and Paper Coating Operations [2/10/94] Section 3.04 Motor Vehicle and Mobile Equipment...

In Vivo Measurement and Characterization of a Novel Formulation of [177Lu]-DOTA-Octreotate

Directory of Open Access Journals (Sweden)

Dale Bailey

2016-01-01

Full Text Available Objective(s:Lutetium-177 can be made with high specific activity and with no other isotopes of lutetium present, referred to as “No Carrier Added” (NCA 177Lu. We have radiolabelled DOTA-conjugated peptide DOTA‐(Tyr3‐octreotate with NCA 177Lu (“NCA-LuTATE” and used it in nearly 40 therapeutic administrations for subjects with neuroendocrine tumours or meningiomas. In this paper, we report on our initial studies on aspects of the biodistribution and dosimetry of NCA-LuTATE from gamma camera 2D whole body (WB and quantitative 3D SPECT (qSPECT 177Lu imaging. Methods: Thirteen patients received 39 NCA-LuTATE injections. Extensive WB planar and qSPECT imaging was acquired at approximately 0.5, 4, 24 and 96 h to permit estimates of clearance and radiation dose estimation using MIRD-based methodology (OLINDA-EXM. Results:The average amount of NCA-Lutate administered per cycle was 7839±520 MBq. Bi-exponential modelling of whole body clearance showed half lives for the fast & slow components of t½=2.1±0.6 h and t½=58.1±6.6 h respectively. The average effective dose to kidneys was 3.1±1.0 Gy per cycle. In eight patients completing all treatment cycles the average total dose to kidneys was 11.7±3.6 Gy. Conclusions: We have shown that NCA-LuTATE has an acceptable radiation safety profile and is a suitable alternative to Carrier-Added 177Lu formulations. The fast component of the radiopharmaceutical clearance was closely correlated with baseline renal glomerular filtration rate, and this had an impact on radiation dose to the kidneys. In addition, it has less radioactive waste issues and requires less peptide per treatment.

Element selective X-ray magnetic circular and linear dichroisms in ferrimagnetic yttrium iron garnet films

Energy Technology Data Exchange (ETDEWEB)

Rogalev, A. [European Synchrotron Radiation Facility (ESRF), B.P. 220, F-38043 Grenoble Cedex (France); Goulon, J. [European Synchrotron Radiation Facility (ESRF), B.P. 220, F-38043 Grenoble Cedex (France)], E-mail: goulon@esrf.fr; Wilhelm, F. [European Synchrotron Radiation Facility (ESRF), B.P. 220, F-38043 Grenoble Cedex (France); Brouder, Ch. [Institut de Mineralogie et de Physique des Milieux Condenses, UMR-CNRS 7590, Universite Paris VI-VII, 4 place Jussieu, F-75252 Paris Cedex 05 (France); Yaresko, A. [Max Planck Institute for Solid State Research, Heisenbergstrasse 1, 70569 Stuttgart (Germany); Ben Youssef, J.; Indenbom, M.V. [Laboratoire de Magnetisme de Bretagne, CNRS FRE 2697, UFR Sciences et Techniques, F-29328 Brest Cedex (France)

2009-12-15

X-ray magnetic circular dichroism (XMCD) was used to probe the existence of induced magnetic moments in yttrium iron garnet (YIG) films in which yttrium is partly substituted with lanthanum, lutetium or bismuth. Spin polarization of the 4d states of yttrium and of the 5d states of lanthanum or lutetium was clearly demonstrated. Angular momentum resolved d-DOS of yttrium and lanthanun was shown to be split by the crystal field, the two resolved substructures having opposite magnetic polarization. The existence of a weak orbital moment involving the 6p states of bismuth was definitely established with the detection of a small XMCD signal at the Bi M{sub 1}-edge. Difference spectra also enhanced the visibility of subtle changes in the Fe K-edge XMCD spectra of YIG and {l_brace}Y, Bi{r_brace}IG films. Weak natural X-ray linear dichroism signatures were systematically observed with all iron garnet films and with a bulk YIG single crystal cut parallel to the (1 1 1) plane: this proved that, at room temperature, the crystal cannot satisfy all requirements of perfect cubic symmetry (space group: Ia3-bar d), crystal distortions preserving at best trigonal symmetry (R3-bar or R3m). For the first time, a very weak X-ray magnetic linear dichroism (XMLD) was also measured in the iron K-edge pre-peak of YIG and revealed the presence of a tiny electric quadrupole moment in the ground-state charge distribution of iron atoms. Band-structure calculations carried out with fully relativistic LMTO-LSDA methods support our interpretation that ferrimagnetically coupled spins at the iron sites induce a spin polarization of the yttrium d-DOS and reproduce the observed crystal field splitting of the XMCD signal.

Element selective X-ray magnetic circular and linear dichroisms in ferrimagnetic yttrium iron garnet films

International Nuclear Information System (INIS)

Rogalev, A.; Goulon, J.; Wilhelm, F.; Brouder, Ch.; Yaresko, A.; Ben Youssef, J.; Indenbom, M.V.

2009-01-01

X-ray magnetic circular dichroism (XMCD) was used to probe the existence of induced magnetic moments in yttrium iron garnet (YIG) films in which yttrium is partly substituted with lanthanum, lutetium or bismuth. Spin polarization of the 4d states of yttrium and of the 5d states of lanthanum or lutetium was clearly demonstrated. Angular momentum resolved d-DOS of yttrium and lanthanun was shown to be split by the crystal field, the two resolved substructures having opposite magnetic polarization. The existence of a weak orbital moment involving the 6p states of bismuth was definitely established with the detection of a small XMCD signal at the Bi M 1 -edge. Difference spectra also enhanced the visibility of subtle changes in the Fe K-edge XMCD spectra of YIG and {Y, Bi}IG films. Weak natural X-ray linear dichroism signatures were systematically observed with all iron garnet films and with a bulk YIG single crystal cut parallel to the (1 1 1) plane: this proved that, at room temperature, the crystal cannot satisfy all requirements of perfect cubic symmetry (space group: Ia3-bar d), crystal distortions preserving at best trigonal symmetry (R3-bar or R3m). For the first time, a very weak X-ray magnetic linear dichroism (XMLD) was also measured in the iron K-edge pre-peak of YIG and revealed the presence of a tiny electric quadrupole moment in the ground-state charge distribution of iron atoms. Band-structure calculations carried out with fully relativistic LMTO-LSDA methods support our interpretation that ferrimagnetically coupled spins at the iron sites induce a spin polarization of the yttrium d-DOS and reproduce the observed crystal field splitting of the XMCD signal.

Influence of renal impairment on myocardial function in outpatients with systolic heart failure

DEFF Research Database (Denmark)

Bosselmann, Helle; Tønder, Niels; Sölétormos, György

2014-01-01

clinic. The patients underwent advanced echocardiography. Glomerular filtration rate was estimated by the CKD-EPI equation (eGFR) and patients grouped by eGFR: eGFR group-I, ≥ 90 ml/min/1.73 m(2); eGFR group-II, 60-89 ml/min/1.73 m(2); and eGFR group-III, ≤ 59 ml/min/1.73 m(2). Multivariate regression...

Intrinsic magnetic properties of hexagonal LuFeO3 and the effects of nonstoichiometry

Directory of Open Access Journals (Sweden)

Jarrett A. Moyer

2014-01-01

Full Text Available We used oxide molecular-beam epitaxy in a composition-spread geometry to deposit hexagonal LuFeO3 (h-LuFeO3 thin films with a monotonic variation in the Lu/Fe cation ratio, creating a mosaic of samples that ranged from iron rich to lutetium rich. We characterized the effects of composition variation with x-ray diffraction, atomic force microscopy, scanning transmission electron microscopy, and superconducting quantum interference device magnetometry. After identifying growth conditions leading to stoichiometric film growth, an additional sample was grown with a rotating sample stage. From this stoichiometric sample, we determined stoichiometric h-LuFeO3 to have a TN = 147 K and Ms = 0.018 μB/Fe.

Anti-correlated spectral motion in bisphthalocyanines: evidence for vibrational modulation of electronic mixing.

Science.gov (United States)

Prall, Bradley S; Parkinson, Dilworth Y; Ishikawa, Naoto; Fleming, Graham R

2005-12-08

We exploit a coherently excited nuclear wave packet to study nuclear motion modulation of electronic structure in a metal bridged phthalocyanine dimer, lutetium bisphthalocyanine, which displays two visible absorption bands. We find that the nuclear coordinate influences the energies of the underlying exciton and charge resonance states as well as their interaction; the interplay of the various couplings creates unusual anti-correlated spectral motion in the two bands. Excited state relaxation dynamics are the same regardless of which transition is pumped, with decay time constants of 1.5 and 11 ps. The dynamics are analyzed using a three-state kinetic model after relaxation from one or two additional states faster than the experimental time resolution of 50-100 fs.

Transparent Ceramic Scintillator Fabrication, Properties and Applications

International Nuclear Information System (INIS)

Cherepy, N.J.; Kuntz, J.D.; Roberts, J.J.; Hurst, T.A.; Drury, O.B.; Sanner, R.D.; Tillotson, T.M.; Payne, S.A.

2008-01-01

Transparent ceramics offer an alternative to single crystals for scintillator applications such as gamma ray spectroscopy and radiography. We have developed a versatile, scaleable fabrication method, using Flame Spray Pyrolysis (FSP) to produce feedstock which is readily converted into phase-pure transparent ceramics. We measure integral light yields in excess of 80,000 Ph/MeV with Cerium-doped Garnets, and excellent optical quality. Avalanche photodiode readout of Garnets provides resolution near 6%. For radiography applications, Lutetium Oxide offers a high performance metric and is formable by ceramics processing. Scatter in transparent ceramics due to secondary phases is the principal limitation to optical quality, and afterglow issues that affect the scintillation performance are presently being addressed

Radiosynthesis and preclinical studies of 177Lu-labeled sulfadiazine. A possible theranostic agent for deep-seated bacterial infection

International Nuclear Information System (INIS)

Syed Ali Raza Naqvi; Rashid Rasheed; Muhammad Tauqeer Ahmed; Ameer Fawad Zahoor

2017-01-01

Sulfadiazine acts through inhibition of bacterial dihydropteroate synthetase. The radio-labeling of sulfadiazine with lutetium-177 ( 177 Lu) is expected to serve as a theranostic agent for deep-seated bacterial infections. The radiosynthesis of 177 Lu-sulfadiazine indicated a > 95% yield under optimized reaction conditions, and promising stability was found in blood serum. Biodistribution data in the absence of infection revealed minimal accumulation in key body organs. Kidneys were the main excretory organs, showed an uptake of 1.76 ± 0.09% ID/g organ at 6-h post-injection. Biodistribution, scintigraphic data, glomerular filtration rate, and cytotoxicity results encourage clinical investigation of 177 Lu-sulfadiazine as a novel theranostic agent for deep-seated bacterial infection. (author)

High spin K isomeric target of {sup 177m}Lu

Energy Technology Data Exchange (ETDEWEB)

Roig, O. E-mail: olivier.roig@cea.fr; Belier, G.; Daugas, J.-M.; Delbourgo, P.; Maunoury, L.; Meot, V.; Morichon, E.; Sauvestre, J.-E.; Aupiais, J.; Boulin, Y.; Fioni, G.; Letourneau, A.; Marie, F.; Ridikas, D

2004-03-21

The techniques used to produce a {sup 177m}Lu (J{sup {pi}}=23/2{sup -},T{sub 1/2}=160.4 days) target are described in this paper. Firstly, an isotopic separation of an enriched lutetium sample was used to reach a purity of {sup 176}Lu close to 99.993%. Afterwards, the high neutron flux of the Grenoble Institut Laue-Langevin reactor was used to produce the {sup 177m}Lu isomer by the {sup 176}Lu(n,{gamma}) reaction. Finally, a chemical separation was performed to extract 10{sup 13} nuclei of {sup 177m}Lu. Thanks to this experiment, we have been able to estimate the destruction cross-section of the {sup 177m}Lu.

Tuberculosis in Scottish military veterans: evidence from a retrospective cohort study of 57 000 veterans and 173 000 matched non-veterans.

Science.gov (United States)

Bergman, Beverly P; Mackay, D F; Pell, J P

2017-02-01

Tuberculosis was a major cause of morbidity and manpower loss in the Armed Forces during World War II. Military control programmes commenced in the 1950s but were initially limited in scope by the many recruits who were already tuberculin positive on enlistment. The aim of our study was to examine whether veterans have an increased risk of tuberculosis compared with non-veterans. Retrospective cohort study of 57 000 veterans born 1945-1985, and 173 000 people with no record of military service, resident in Scotland, matched for age, sex and area of residence, using Cox proportional hazard analysis to compare the risk of tuberculosis overall, by birth cohort, length of service and year of diagnosis and to examine comorbidities. Over mean 29 years follow-up, 69 (0.12%) veterans were recorded as having tuberculosis, compared with 267 (0.15%) non-veterans (unadjusted HR 0.90, 95% CIs 0.69 to 1.19, p=0.463). Only the 1945-1949 veterans' birth cohort was at higher risk, unadjusted HR 1.54, 95% CIs 0.98 to 2.45, p=0.061, although the difference in risk did not achieve significance. Veterans born from 1950 were at significantly reduced risk of tuberculosis compared with non-veterans after adjusting for deprivation, HR 0.67, 95% CI 0.47 to 0.95, p=0.026. The most common comorbidities were smoking-related and alcohol-related disease. The risk of comorbid hepatitis B or C was very low, in both veterans and non-veterans. No length of service was associated with an increased risk of tuberculosis in comparison with non-veterans. Scottish veterans born before 1950 are at moderately increased risk of tuberculosis compared with age, sex and geographically matched civilians with no record of service, although the difference is not statistically significant. Scottish veterans born from 1950 show a reduction in risk compared with civilians. Tuberculosis should be considered in the differential diagnosis of respiratory disease in the older veteran. Published by the BMJ Publishing

Oxidative desulfurization of fuels catalyzed by Fenton-like ionic liquids at room temperature.

Science.gov (United States)

Jiang, Yunqing; Zhu, Wenshuai; Li, Huaming; Yin, Sheng; Liu, Hua; Xie, Qingjie

2011-03-21

Oxidation of the sulfur-containing compounds benzothiophene (BT), dibenzothiophene (DBT), and 4,6-dimethyldibenzothiophene (4,6-DMDBT) has been studied in a desulfurization system composed of model oil, hydrogen peroxide, and different types of ionic liquids [(C(8)H(17))(3)CH(3)N]Cl/FeCl(3), [(C(8)H(17))(3)CH(3)N]Cl/CuCl(2), [(C(8)H(17))(3)CH(3)N]Cl/ZnCl(2), [(C(8)H(17))(3)CH(3)N]Cl/SnCl(2), [(C(4)H(9))(3)CH(3)N]Cl/FeCl(3), [C(10)H(21)(CH(3))(3)N]Cl/FeCl(3), [(C(10)H(21))(2)(CH(3))(2)N]Cl/FeCl(3). Deep desulfurization is achieved in the Fenton-like ionic liquid [(C(8)H(17))(3)CH(3)N]Cl/FeCl(3) at 25 °C for 1 h. The desulfurization of DBT reaches 97.9%, in consuming very low amount of [(C(8)H(17))(3)CH(3)N]Cl/FeCl(3) (only 0.702 mmol). The reaction conditions, for example, the amount of [(C(8)H(17))(3)CH(3)N]Cl/FeCl(3) or H(2)O(2), the temperature, and the molar ratio of FeCl(3) to [(C(8)H(17))(3)CH(3)N]Cl, are investigated for this system. The oxidation reactivity of the different sulfur-containing compounds is found to decrease in the order of DBT>BT>4,6-DMDBT. The desulfurization system can be recycled six times without significant decrease in activity. The sulfur level of FCC gasoline could be reduced from 360 ppm to 110 ppm. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Luminescence and defects creation in Ce3+-doped aluminium and lutetium perovskites and garnets

International Nuclear Information System (INIS)

Krasnikov, A.; Savikhina, T.; Zazubovich, S.; Nikl, M.; Mares, J.A.; Blazek, K.; Nejezchleb, K.

2005-01-01

Luminescence, scintillation response, energy transfer and defect creation processes were studied at 4.2-300K for Ce 3+ -doped YAlO 3 , Lu x Y 1-x AlO 3 (x=0.3) and Lu 3 Al 5 O 12 crystals under excitation in the 2.5-11.5eV energy range. Influence of the charge and ionic radius of co-doping ions on the efficiency of these processes, the origin of the defects created and possible mechanisms of their formation were discussed

The beta strength function structure in β+ decay of lutetium, thulium and cesium isotopes

International Nuclear Information System (INIS)

Alkhazov, G.D.; Bykov, A.A.; Vitman, V.D.; Naumov, Yu.V.; Orlov, S.Yu.

1981-01-01

The spectra of total γ-absorption in the decays of some Lutecium, Thulium and Cesium isotopes have been measured. The probabilities for level population in the decay of the isotopes have been determined. The deduced beta strength functions reveal pronounced structure. Calculations of the strength functions using the Saxon-Woods potential and the residual Gamow-Teller interaction are presented. It is shown that in β + decay of light Thulium and Cesium isotopes the strength function comprises more than 70% of the Gamow-Teller excitations with μsub(tau) = +1. This result is the first direct observation of the Gamow-Teller resonance in β + decay of nuclei with Tsub(z) > O. (orig.)

Compartmental analysis to predict biodistribution in radiopharmaceutical design studies

Energy Technology Data Exchange (ETDEWEB)

Lima, Marina F.; Pujatti, Priscilla B.; Araujo, Elaine B.; Mesquita, Carlos H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: mflima@ipen.br

2009-07-01

The use of compartmental analysis allows the mathematical separation of tissues and organs to determinate the concentration of activity in each fraction of interest. Although the radiochemical purity must observe Pharmacopoeia specification (values upper 95%), very lower contains of free radionuclides could contribute significantly as dose in the neighborhood organs and make tumor up take studies not viable in case of radiopharmaceutical on the basis of labeled peptides. Animal studies with a product of Lutetium-177 labeled Bombesin derivative ({sup 177}Lu-BBNP) developed in IPEN-CNEN/SP and free Lutetium-177 developed in CNEA/EZEIZA was used to show how subtract free {sup 177}Lu contribution over {sup 177}Lu-BBNP to estimate the radiopharmaceutical potential as diagnosis or therapy agent. The first approach of the studies included the knowledge of chemical kinetics and mimetism of the Lutetium and the possible targets of the diagnosis/therapy to choose the possible models to apply over the sampling standard methods used in experimental works. A model with only one physical compartment (whole body) and one chemical compartment ({sup 177}Lu-BBNP) generated with the compartmental analysis protocol ANACOMP showed high differences between experimental and theoretical values over 2.5 hours, in spite of the concentration of activity had been in a good statistics rang of measurement. The values used in this work were residence time from three different kinds of study with free {sup 177}Lu: whole body, average excretion and maximum excretion as a chemical compartment. Activity concentration values as time function in measurements of total whole body and activity measurement in samples of blood with projection to total circulating blood volume with {sup 177}Lu-BBNP. Considering the two sources of data in the same modeling a better consistence was obtained. The next step was the statistic treatment of biodistribution and dosimetry in mice (Balb C) considering three chemical

Publications | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Building Capacity for Sustainable Responses to Climate Change in Cities of Portuguese-speaking Small Island Developing States (Cabo Verde and São Tomé e Príncipe) - Final Technical Report (restricted access). Small Island Developing States (SIDS) are highly vulnerable to climate change. In some locations coastal ...

21 CFR 173.65 - Divinylbenzene copolymer.

Science.gov (United States)

2010-04-01

... weight-percent ethyl-vinyl-benzene, and no more than 4 weight-percent nonpolymerizable impurities. (b) In... Archives and Records Administration (NARA). For information on the availability of this material at NARA...

35_173 - 179_BIO 015 Akhilendra

African Journals Online (AJOL)

userpc

population live in small and medium ci ... based development projects should focus ... nges of sustainability viz; lack of basic amenities and facilities, heal ... rds sustainable living environment of Damaturu town in Yobe Sta ... rojects should focus on major areas of water, electricity, housi .... Ministry of Lands and Housing.

10 CFR 205.173 - Public hearings.

Science.gov (United States)

2010-01-01

... proposed rule or regulation is likely to have a substantial impact on the Nation's economy or large numbers... hearing, together with the written comments submitted and other relevant information developed during the...

21 CFR 173.300 - Chlorine dioxide.

Science.gov (United States)

2010-04-01

... sodium chlorite by electrolysis. (2) The generator effluent contains at least 90 percent (by weight) of... Health Association, 800 I St. NW., Washington, DC 20001-3750. You may inspect a copy at the Center for...

21 CFR 173.340 - Defoaming agents.

Science.gov (United States)

2010-04-01

... cooking purposes, whereby no more than 10 parts per million is present in the cooked food. Formaldehyde As... alcohol Magnesium stearate As defined in § 172.863 of this chapter. Mineral oil: Conforming with § 172.878... chapter. Soybean oil fatty acids, hydroxylated Tallow, hydrogenated, oxidized or sulfated Tallow alcohol...

32 CFR 17.3 - Commission personnel.

Science.gov (United States)

2010-07-01

... with 32 CFR part 9, the Appointing Authority shall appoint at least three but no more than seven members and one or two alternate members. The Appointing Authority may remove members and alternate... Appointing Authority may replace the member, direct that an alternate member serve in the place of the...

49 CFR 173.29 - Empty packagings.

Science.gov (United States)

2010-10-01

... hazardous material shall be offered for transportation and transported in the same manner as when it.... (c) A non-bulk packaging containing only the residue of a hazardous material covered by Table 2 of... in Column 10a of the § 172.101 table for transportation by vessel, an empty drum or cylinder may be...

49 CFR 173.54 - Forbidden explosives.

Science.gov (United States)

2010-10-01

... dimension of which exceeds 23 mm (0.906 inch), or a toy torpedo containing a mixture of potassium chlorate... subpart. (b) An explosive mixture or device containing a chlorate and also containing: (1) An ammonium...

49 CFR 173.158 - Nitric acid.

Science.gov (United States)

2010-10-01

... as identified by American Iron and Steel Institute type number, and, in addition, the letters “HT” following the steel designation on containers subject to stress relieving or heat treatment during... °F)), (B) Stabilized Type 347 in the as-welded condition, (C) Stabilized Type 347 stress-relieved...

49 CFR 173.63 - Packaging exceptions.

Science.gov (United States)

2010-10-01

... transport personnel to remote work sites, such as offshore drilling units. (b) Cartridges, small arms, and... than 1 g explosive (excluding ignition and delay charges) that are electric blasting caps with leg wires 4 feet long or longer, delay connectors in plastic sheaths, or blasting caps with empty plastic...

Publications | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Physico-chemical characteristics and fatty acid profile of desert date kernel oil in ... Learning for an uncertain future : vulnerabilities of agricultural production to ... trends in temperature, rainfall, sunshine, humidity and tidal water level in the ...

43 CFR 17.3 - Discrimination prohibited.

Science.gov (United States)

2010-10-01

... participate in the program as an employee but only to the extent set forth in paragraph (c) of this section... impairing accomplishment of the objectives of the program as respect individuals of a particular race, color..., financial aid, or other benefits provided under a program receiving Federal financial assistance shall be...

WESF (173)Cs gamma ray sources

Science.gov (United States)

Kenna, B. T.

1984-10-01

The Waste Encapsulation and Storage Facility (WESP) at Hanford, Washington has been separating cesium from stored liquid defense waste since 1945. This is done to alleviate the heat generated by the decay of radioactive Cs137. The cesium is converted to CsCl, doubly encapsulated in 316l stainless steel, and placed in storage. The potential utility of these Cs137 capsules as gamma radiation sources was demonstrated. Registration of the capsule with the NRC as a sealed gamma source would facilitate the licensing of non-DOE irradiation facilities using this source. To grant this registration, the NRC requires characteristics of the capsule. It must also be demonstrated that the capsule will maintain its integrity under both normal circumstances and specified abnormal conditions. The required information is provided through collation of results of studies and tests done previously by other laboratories.

21 CFR 173.165 - Candida lipolytica.

Science.gov (United States)

2010-04-01

... may be safely used as the organism for fermentation production of citric acid in accordance with the... intended for use as a pure culture in the fermentation process for the production of citric acid from... such as oil, grease, detergent residues, etc. Examine all glassware including stoppers and stopcocks...

78 FR 51818 - Notice of Applications for Modification of Special Permits

Science.gov (United States)

2013-08-21

... provide for additional hazardous materials, packaging design changes, additional mode of transportation... additional packaging. 14188-M IDQ Operating Inc. 49 CFR 173.304(d), To modify the special Tarrytown, NY. 173...

75 FR 34523 - Office of Hazardous Materials Safety; Notice of Application for Special Permits

Science.gov (United States)

2010-06-17

... Manufacturing, 49 CFR To authorize the Incorporated 173.31(e)(2)(ii), manufacture, marking, Alexandria, LA. 173... Administration commerce of non-DOT (NASA) Washington, specification packaging DC. for the transportation in...

Electro-kinetic separation of rare earth elements using a redox-active ligand

Energy Technology Data Exchange (ETDEWEB)

Fang, Huayi; Cole, Bren E.; Qiao, Yusen; Bogart, Justin A.; Cheisson, Thibault; Manor, Brian C.; Carroll, Patrick J.; Schelter, Eric J. [Department of Chemistry, University of Pennsylvania, Philadelphia, PA (United States)

2017-10-16

Purification of rare earth elements is challenging due to their chemical similarities. All of the deployed separation methods rely on thermodynamic properties, such as distribution equilibria in solvent extraction. Rare-earth-metal separations based on kinetic differences have not been examined. Herein, we demonstrate a new approach for rare-earth-element separations by exploiting differences in the oxidation rates within a series of rare earth compounds containing the redox-active ligand [{2-(tBuN(O))C_6H_4CH_2}{sub 3}N]{sup 3-}. Using this method, a single-step separation factor up to 261 was obtained for the separation of a 50:50 yttrium-lutetium mixture. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

Simultaneous molecular and anatomical imaging of the mouse in vivo

International Nuclear Information System (INIS)

Goertzen, Andrew L; Meadors, A Ken; Silverman, Robert W; Cherry, Simon R

2002-01-01

Non-invasive imaging technologies are opening up new windows into mouse biology. We have developed a mouse imaging system that integrates positron emission tomography (PET) with x-ray computed tomography (CT), allowing simultaneous anatomic and molecular imaging in vivo with the potential for precise registration of the two image volumes. The x-ray system consists of a compact mini-focal x-ray tube and an amorphous selenium flat panel x-ray detector with a low-noise CMOS readout. The PET system uses planar arrays of lutetium oxyorthosilicate scintillator coupled to position-sensitive photomultiplier tubes. We describe the design of this dual-modality imaging system and show, for the first time, simultaneously acquired PET and CT images in a phantom and in mice

Simultaneous molecular and anatomical imaging of the mouse in vivo

Energy Technology Data Exchange (ETDEWEB)

Goertzen, Andrew L [Crump Institute for Molecular Imaging, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States); Meadors, A Ken [Crump Institute for Molecular Imaging, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States); Silverman, Robert W [Crump Institute for Molecular Imaging, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States); Cherry, Simon R [Department of Biomedical Engineering, University of California, Davis, Davis, CA (United States)

2002-12-21

Non-invasive imaging technologies are opening up new windows into mouse biology. We have developed a mouse imaging system that integrates positron emission tomography (PET) with x-ray computed tomography (CT), allowing simultaneous anatomic and molecular imaging in vivo with the potential for precise registration of the two image volumes. The x-ray system consists of a compact mini-focal x-ray tube and an amorphous selenium flat panel x-ray detector with a low-noise CMOS readout. The PET system uses planar arrays of lutetium oxyorthosilicate scintillator coupled to position-sensitive photomultiplier tubes. We describe the design of this dual-modality imaging system and show, for the first time, simultaneously acquired PET and CT images in a phantom and in mice.

Single crystalline LuAG fibers for homogeneous dual-readout calorimeters

International Nuclear Information System (INIS)

Pauwels, K; Gundacker, S; Lecoq, P; Lucchini, M; Auffray, E; Dujardin, C; Lebbou, K; Moretti, F; Xu, X; Petrosyan, A G

2013-01-01

For the next generation of calorimeters, designed to improve the energy resolution of hadrons and jets measurements, there is a need for highly granular detectors requiring peculiar geometries. Heavy inorganic scintillators allow compact homogeneous calorimeter designs with excellent energy resolution and dual-readout abilities. These scintillators are however not usually suited for geometries with a high aspect ratio because of the important losses observed during the light propagation. Elongated single crystals (fibers) of Lutetium Aluminium garnet (LuAG, Lu 3 Al 5 O 12 ) were successfully grown with the micropulling-down technique. We present here the results obtained with the recent fiber production and we discuss how the light propagation could be enhanced to reach attenuation lengths in the fibers better than 0.5 m

Design and development of 1 mm resolution PET detectors with position-sensitive PMTs

CERN Document Server

Shao, Y; Chatziioannou, A F

2002-01-01

We report our investigation of a positron emission tomography (PET) detector with 1 m spatial resolution. The prototype detector consists of a 9x9 array of 1x1x10 mm sup 3 lutetium oxyorthosilicate (LSO) scintillator crystals coupled to Hamamatsu R5900-M64 or R5900-C12 position sensitive PMT by either optical fibers or an optical fiber bundle. With a 511 eV gamma source, the intrinsic spatial resolution of this detector was measured to be 0.92 mm. All crystals were well resolved in the flood source histogram. The measured energy and coincidence timing resolutions were around 26% and 4 ns, respectively, demonstrating that sufficient light can be extracted from these small crystals for PET applications.

Correlation between temperature dependence of elastic moduli and Debye temperature of paramagnetic metal

International Nuclear Information System (INIS)

Bodryakov, V.Yu.; Povzner, A.A.

2000-01-01

The correlation between the temperature dependence of elastic moduli and the Debye temperature of paramagnetic metal is analyzed in neglect of the temperature dependence of the Poison coefficient σ within the frames of the Debye-Grueneisen presentations. It is shown, that namely the temperature dependence of the elastic moduli determines primarily the temperature dependence of the Debye temperature Θ(T). On the other hand, the temperature dependence Θ(T) very weakly effects the temperature dependence of the elastic moduli. The later made it possible to formulate the self-consistent approach to calculation of the elastic moduli temperature dependence. The numerical estimates of this dependence parameters are conducted by the example of the all around compression modulus of the paramagnetic lutetium [ru

78 FR 3966 - Notice of Applications for Modification of Special Permit

Science.gov (United States)

2013-01-17

... hazardous materials, packaging design changes, additional mode of transportation, etc.) are described in...), permit to authorize new 173.13(c)(1)(ii), packaging requirements 173.13(c)(1)(iv), for Division 6.1 PG II...

77 FR 58215 - Notice of Application for Special Permits

Science.gov (United States)

2012-09-19

... required labelling and placarding. (modes 1, 2, 4, 5) 15707-N Air Products and 49 CFR 173.240; To authorize the Chemicals, Inc., 173.242; 176.83. transportation in Allentown, PA. commerce of a gas purification...

76 FR 70811 - Notice of Applications for Modification of Special Permit

Science.gov (United States)

2011-11-15

... transportation (NASA) Washington, locations. DC. 14509-M Pacific Consolidated 49 CFR 173.302 To modify the... Alexandria, LA. (a)(2), 173.314, manufacture, marking, 179.100, 179.101, sale and use of three 179.102-3, 179...

Anticancer activity of botanical alkyl hydroquinones attributed to topoisomerase II poisoning

International Nuclear Information System (INIS)

Huang, C.-P.; Fang, W.-H.; Lin, L.-I.; Chiou, Robin Y.; Kan, L.-S.; Chi, N.-H.; Chen, Y.-R.; Lin, T.-Y.; Lin, S.-B.

2008-01-01

Cytotoxic alkyl hydroquinone compounds have been isolated from many plants. We previously isolated 3 structurally similar cytotoxic alkyl hydroquinone compounds from the sap of the lacquer tree Rhus succedanea L. belonging to the sumac family, which have a long history of medicinal use in Asia. Each has an unsaturated alkyl chain attached to the 2-position of a hydroquinone ring. One of these isolates, 10'(Z),13'(E),15'(E)-heptadecatrienylhydroquinone [HQ17(3)], being the most cytotoxic, was chosen for studying the anticancer mechanism of these compounds. We found that HQ17(3) was a topoisomerase (Topo) II poison. It irreversibly inhibited Topo IIα activity through the accumulation of Topo II-DNA cleavable complexes. A cell-based assay showed that HQ17(3) inhibited the growth of leukemia HL-60 cells with an EC 50 of 0.9 μM, inhibited the topoisomerase-II-deficient cells HL-60/MX2 with an EC 50 of 9.6 μM, and exerted no effect on peripheral blood mononuclear cells at concentrations up to 50 μM. These results suggest that Topo II is the cellular drug target. In HL-60 cells, HQ17(3) promptly inhibited DNA synthesis, induced chromosomal breakage, and led to cell death with an EC 50 about one-tenth that of hydroquinone. Pretreatment of the cells with N-acetylcysteine could not attenuate the cytotoxicity and DNA damage induced by HQ17(3). However, N-acetylcysteine did significantly reduce the cytotoxicity of hydroquinone. In F344 rats, intraperitoneal injection of HQ17(3) for 28 days induced no clinical signs of toxicity. These results indicated that HQ17(3) is a potential anticancer agent, and its structural features could be a model for anticancer drug design

Rift Valley fever virus NSs inhibits host transcription independently of the degradation of dsRNA-dependent protein kinase PKR.

Science.gov (United States)

Kalveram, Birte; Lihoradova, Olga; Indran, Sabarish V; Lokugamage, Nandadeva; Head, Jennifer A; Ikegami, Tetsuro

2013-01-20

Rift Valley fever virus (RVFV) encodes one major virulence factor, the NSs protein. NSs suppresses host general transcription, including interferon (IFN)-β mRNA synthesis, and promotes degradation of the dsRNA-dependent protein kinase (PKR). We generated a novel RVFV mutant (rMP12-NSsR173A) specifically lacking the function to promote PKR degradation. rMP12-NSsR173A infection induces early phosphorylation of eIF2α through PKR activation, while retaining the function to inhibit host general transcription including IFN-β gene inhibition. MP-12 NSs but not R173A NSs binds to wt PKR. R173A NSs formed filamentous structure in nucleus in a mosaic pattern, which was distinct from MP-12 NSs filament pattern. Due to early phosphorylation of eIF2α, rMP12-NSsR173A could not efficiently accumulate viral proteins. Our results suggest that NSs-mediated host general transcription suppression occurs independently of PKR degradation, while the PKR degradation is important to inhibit the phosphorylation of eIF2α in infected cells undergoing host general transcription suppression. Copyright © 2012 Elsevier Inc. All rights reserved.

Final Report: Scintillator Materials for Medical Applications, December 1, 1997 - November 30, 1999

International Nuclear Information System (INIS)

Lempicki, A.; Brecher, C.; Wojtowicz, A.J.; Szupryczynski, P.

2000-01-01

From the very beginning of our program we regarded the understanding of the scintillation mechanism as our primary mission. If in addition this understanding could lead to the discovery of a new material, so much the better. When we began this work some nine years ago, the theoretical basis for the scintillation phenomenon was in disarray. The initial and final steps were reasonably well characterized, but there was no consensus on the crucial intermediate, the transfer of energy from the lattice to the emitting center. In the over 40 publications that resulted from this program, we demonstrated that despite the highly insulating nature of the hosts and the great magnitude of the band gap, the primary means of transport is through mobile charge carriers and their sequential capture by the emitting center. Although radical at the time, this picture is now generally accepted throughout the field. Subsequently, we also recognized the critical role that trapping centers localized at lattice defects can play in the process, not merely as passive sources of loss but as active participants in the kinetics. In this sense shallow traps can wreak more havoc than deep ones, impeding the rate by which carriers can reach the emitting centers and seriously slowing the resulting decay. And we established low-temperature thermoluminescence as a comprehensive tool for quantizing these effects. As for new and better materials, our work also had an impact. We were among the first to recognize the potential of LuAlO 3 (lutetium aluminum perovskite, or LuAP) as a detector for PET applications. Although this material has not supplanted LuSiO 5 (lutetium oxysilicate, or LSO) in terms of light output or absence of afterglow, LuAP still exhibits by far the highest figure of merit (light output divided by decay time) of any scintillator material currently known. Our work has also bought into stark view the dismaying realization of just how improbable it is that a material will ever be found

Separation device of radio lanthanides (DISER)

International Nuclear Information System (INIS)

Vera T, A.L.; Monroy G, F.; Vazquez M, J.C.; Jimenez B, F.

2008-01-01

At the present time the cancer is one of the main causes of mortality in our country, therefore, its prevention, diagnostic and treatment is of vital importance for those health systems. The treatment of the cancer and other illnesses, starting from monoclonal antibodies, peptides, macro aggregates or marked aminoacids with beta particles emitting radioisotopes, it is an extremely promising field. The radioactive lanthanides: Promethium 149, Terbium 161, Holmium 166 and Lutetium 177 are beta emitting (β), which possess nuclear and chemical properties that have shown their feasibility like radioisotopes of radiotherapeutic use. However, these radioisotopes are not commercially available; to this respect, the Radioactive Materials Research Laboratory (LIMR) of the National Institute of Nuclear Research (ININ), it has developed the methodology of production of these radioisotopes and based on these works, there is designed, built and mounted the Radio lanthanides Separation Device (DISER) able to carry out the radioisotopes production in a routine way. This device is content in a cell that has an auxiliary air service, an extraction system and it is protected with a lead armor-plating of 10 cm. The DISER it is manual and easy of managing. The main function of this equipment is the radio lanthanides separation starting from the extractive chromatography by means of packed columns with a commercial resin (LnSPS) and recovered in the superior and inferior part by fiber glass. The DISER is composed by a main carrousel where the separation columns and the elution recipients are mounted. Also counts with an opening system of irradiation vials, port samples for columns and glass material. The present work presents a detailed description of the DISER, as well as its handling that allows to produce the radioisotopes Promethium-149, Terbium-161, Holmium-166 and Lutetium-177 starting from the separation of its parent elements Neodymium-149, Gadolinium-161, Dysprosium-166 and

Separation device of radio lanthanides (DISER); Dispositivo de separacion de radiolantanidos (DISER)

Energy Technology Data Exchange (ETDEWEB)

Vera T, A.L. [FES-Zaragoza, UNAM, 09000 Mexico D.F. (Mexico); Monroy G, F.; Vazquez M, J.C.; Jimenez B, F. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail: veratrevino@hotmail.com

2008-07-01

At the present time the cancer is one of the main causes of mortality in our country, therefore, its prevention, diagnostic and treatment is of vital importance for those health systems. The treatment of the cancer and other illnesses, starting from monoclonal antibodies, peptides, macro aggregates or marked aminoacids with beta particles emitting radioisotopes, it is an extremely promising field. The radioactive lanthanides: Promethium 149, Terbium 161, Holmium 166 and Lutetium 177 are beta emitting ({beta}), which possess nuclear and chemical properties that have shown their feasibility like radioisotopes of radiotherapeutic use. However, these radioisotopes are not commercially available; to this respect, the Radioactive Materials Research Laboratory (LIMR) of the National Institute of Nuclear Research (ININ), it has developed the methodology of production of these radioisotopes and based on these works, there is designed, built and mounted the Radio lanthanides Separation Device (DISER) able to carry out the radioisotopes production in a routine way. This device is content in a cell that has an auxiliary air service, an extraction system and it is protected with a lead armor-plating of 10 cm. The DISER it is manual and easy of managing. The main function of this equipment is the radio lanthanides separation starting from the extractive chromatography by means of packed columns with a commercial resin (LnSPS) and recovered in the superior and inferior part by fiber glass. The DISER is composed by a main carrousel where the separation columns and the elution recipients are mounted. Also counts with an opening system of irradiation vials, port samples for columns and glass material. The present work presents a detailed description of the DISER, as well as its handling that allows to produce the radioisotopes Promethium-149, Terbium-161, Holmium-166 and Lutetium-177 starting from the separation of its parent elements Neodymium-149, Gadolinium-161, Dysprosium-166

Screening for impaired renal function in outpatients before iodinated contrast injection: Comparing the Choyke questionnaire with a rapid point-of-care-test

International Nuclear Information System (INIS)

Too, C.W.; Ng, W.Y.; Tan, C.C.; Mahmood, M.I.; Tay, K.H.

2015-01-01

Highlights: • Iodinated intravenous contrast carries a low risk of contrast induced nephropathy (CIN). • Patients with eGFR less than 45 mL/min/1.73 m 2 are particularly at risk for CIN. • The Choyke questionnaire is used to screen for impaired renal function in outpatients. • Choyke questionnaire is a good screening tool for eGFR less than 45 mL/min/1.73 m 2 . • Point of care test (POCT) for serum creatinine can reduce waiting time. - Abstract: Rationale and purpose: To determine the usefulness of the Choyke questionnaire with a creatinine point-of-care test (POCT) to detect impaired renal function amongst outpatients receiving intravenous iodinated contrast in a tertiary centre. Materials and methods: Between July and December 2012, 1361 outpatients had their serum creatinine determined by POCT and answered the Chokye questionnaire just before their examination. Results: Four hundred and eighty (35.2%) patients had at least one ‘Yes’ response. Forty-four patients (3.2%) had estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m 2 and 14 patients (1.0%) have eGFR <45 mL/min/1.73 m 2 . Sensitivity, specificity, positive predictive value and negative predictive value of the Choyke criteria in detecting patients with eGFR <60 mL/min/1.73 m 2 are respectively: 65.9%, 65.8%, 6.0% and 98.3% and to detect eGFR <45 mL/min/1.73 m 2 : 92.9%, 65.3%, 2.7% and 99.9%. Only ‘Yes’ responses to ‘Have you ever been told you have renal problems?’ and ‘Do you have diabetes mellitus?’ were statistically significant in predicting eGFR <45 mL/min/1.73 m 2 , with odds ratio 98.7 and 4.4 respectively. Conclusion: The Choyke questionnaire has excellent sensitivity and moderate-to-good specificity in detecting patients with <45 mL/min/1.73 m 2 , below this level it has been shown that risk of contrast induced nephropathy increases significantly, making it an effective screening tool. Also the use of POCT can potentially reduce waiting time

Screening for impaired renal function in outpatients before iodinated contrast injection: Comparing the Choyke questionnaire with a rapid point-of-care-test

Energy Technology Data Exchange (ETDEWEB)

Too, C.W., E-mail: toochowwei@gmail.com [Department of Diagnostic Radiology, Singapore General Hospital, Outram Road, Singapore 169608 (Singapore); Ng, W.Y., E-mail: ng.wai.yoong@sgh.com.sg [Department of Pathology, Singapore General Hospital, 20 College Road, Academia, Singapore 169856 (Singapore); Tan, C.C., E-mail: tan.chin.chong@sgh.com.sg [Department of Diagnostic Radiology, Singapore General Hospital, Outram Road, Singapore 169608 (Singapore); Mahmood, M.I., E-mail: muhd.illyyas.mahmood@sgh.com.sg [Department of Diagnostic Radiology, Singapore General Hospital, Outram Road, Singapore 169608 (Singapore); Tay, K.H., E-mail: tay.kiang.hiong@sgh.com.sg [Department of Diagnostic Radiology, Singapore General Hospital, Outram Road, Singapore 169608 (Singapore)

2015-07-15

Highlights: • Iodinated intravenous contrast carries a low risk of contrast induced nephropathy (CIN). • Patients with eGFR less than 45 mL/min/1.73 m{sup 2} are particularly at risk for CIN. • The Choyke questionnaire is used to screen for impaired renal function in outpatients. • Choyke questionnaire is a good screening tool for eGFR less than 45 mL/min/1.73 m{sup 2}. • Point of care test (POCT) for serum creatinine can reduce waiting time. - Abstract: Rationale and purpose: To determine the usefulness of the Choyke questionnaire with a creatinine point-of-care test (POCT) to detect impaired renal function amongst outpatients receiving intravenous iodinated contrast in a tertiary centre. Materials and methods: Between July and December 2012, 1361 outpatients had their serum creatinine determined by POCT and answered the Chokye questionnaire just before their examination. Results: Four hundred and eighty (35.2%) patients had at least one ‘Yes’ response. Forty-four patients (3.2%) had estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m{sup 2} and 14 patients (1.0%) have eGFR <45 mL/min/1.73 m{sup 2}. Sensitivity, specificity, positive predictive value and negative predictive value of the Choyke criteria in detecting patients with eGFR <60 mL/min/1.73 m{sup 2} are respectively: 65.9%, 65.8%, 6.0% and 98.3% and to detect eGFR <45 mL/min/1.73 m{sup 2}: 92.9%, 65.3%, 2.7% and 99.9%. Only ‘Yes’ responses to ‘Have you ever been told you have renal problems?’ and ‘Do you have diabetes mellitus?’ were statistically significant in predicting eGFR <45 mL/min/1.73 m{sup 2}, with odds ratio 98.7 and 4.4 respectively. Conclusion: The Choyke questionnaire has excellent sensitivity and moderate-to-good specificity in detecting patients with <45 mL/min/1.73 m{sup 2}, below this level it has been shown that risk of contrast induced nephropathy increases significantly, making it an effective screening tool. Also the use of POCT can potentially

Single-shot positron annihilation lifetime spectroscopy with LYSO scintillators

Science.gov (United States)

Alonso, A. M.; Cooper, B. S.; Deller, A.; Cassidy, D. B.

2016-08-01

We have evaluated the application of a lutetium yttrium oxyorthosilicate (LYSO) based detector to single-shot positron annihilation lifetime spectroscopy. We compare this detector directly with a similarly configured PbWO4 scintillator, which is the usual choice for such measurements. We find that the signal to noise ratio obtained using LYSO is around three times higher than that obtained using PbWO4 for measurements of Ps excited to longer-lived (Rydberg) levels, or when they are ionized soon after production. This is due to the much higher light output for LYSO (75% and 1% of NaI for LYSO and PbWO4 respectively). We conclude that LYSO is an ideal scintillator for single-shot measurements of positronium production and excitation performed using a low-intensity pulsed positron beam.

Single-shot positron annihilation lifetime spectroscopy with LYSO scintillators

Energy Technology Data Exchange (ETDEWEB)

Alonso, A.M., E-mail: a.alonso@ucl.ac.uk; Cooper, B.S.; Deller, A.; Cassidy, D.B.

2016-08-21

We have evaluated the application of a lutetium yttrium oxyorthosilicate (LYSO) based detector to single-shot positron annihilation lifetime spectroscopy. We compare this detector directly with a similarly configured PbWO{sub 4} scintillator, which is the usual choice for such measurements. We find that the signal to noise ratio obtained using LYSO is around three times higher than that obtained using PbWO{sub 4} for measurements of Ps excited to longer-lived (Rydberg) levels, or when they are ionized soon after production. This is due to the much higher light output for LYSO (75% and 1% of NaI for LYSO and PbWO{sub 4} respectively). We conclude that LYSO is an ideal scintillator for single-shot measurements of positronium production and excitation performed using a low-intensity pulsed positron beam.

Simultaneous Patterning of Independent Metal/Metal Oxide Multi-Layer Films Using Two-Tone Photo-Acid Generating Compound Systems

Directory of Open Access Journals (Sweden)

Hideo Honma

2012-10-01

Full Text Available (1 The photo-induced solubility and positive-tone direct photo-patterning of iron, copper and lanthanides chelated with 4-(2-nitrobenzyloxycarbonylcatechol (NBOC or 4-(6-nitroveratryloxycarbonylcatechol (NVOC was investigated. Photo-patterning of iron, copper, cerium, samarium, europium, terbium, dysprosium, holmium, erbium and lutetium complexes was accomplished. Continuous films were formed by the pyrolysis of metal complex films at 500 °C. (2 Based on the difference in the photo-reaction excitation wavelength profile of NBOC and NVOC complexes, a short and simple method for simultaneous micro-patterning of two independent films on each side of a transparent glass substrate was developed. Using the developed procedure, indium tin oxide and/or titanium oxide films were formed on each side of a quartz substrate without use of resist or etching.

Dicty_cDB: SSH817 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 307748 |pid:none) Tn10 delivery vector pHV1249 trans... 173 7e-42 EF120459_1( EF120459 |pid:none) Enterobact...CU928144 |pid:none) Escherichia fergusonii str. ATCC ... 173 7e-42 AF307748_1( AF

Lutetium-177 and iodine-131 loaded chelating polymer microparticles intended for radioembolization of liver malignancies

Czech Academy of Sciences Publication Activity Database

Hrubý, Martin; Škodová, Michaela; Macková, Hana; Skopal, Jan; Tomeš, Marek; Kropáček, Martin; Zimová, Jana; Kučka, Jan

2011-01-01

Roč. 71, č. 12 (2011), s. 1155-1159 ISSN 1381-5148 R&D Projects: GA ČR GPP207/10/P054; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z10480505 Keywords : macroporous chelating beads * radioembolization * quinoline-8-ol Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.479, year: 2011

Precision top-quark mass measurement in the lepton+jets topology in p p collisions at square root s=1.96 TeV.

Science.gov (United States)

Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; DaRonco, S; D'Auria, S; D'onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J; DiTuro, P; Dörr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Lee, Y J; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Papikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitin, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; van Remortel, N; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sanchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Sill, A; Sinervo, P; Sisakyan, A; Sjolin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Worm, S; Wright, T; Wu, X; Wynne, S M; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, Y; Yang, C; Yang, U K; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

2006-01-20

We report two measurements of the top-quark mass M(top) using the CDF II detector at the Fermilab Tevatron in a 318 pb(-1) data sample of tt events in the lepton+jets final state. One method uses an event-based likelihood technique resulting in M(top) = 173.2(-2.4)(+2.6)(stat) +/- 3.2(syst) GeV/c2 or 173.2(-4.0)(+4.1) GeV/c2. The second method reconstructs a top-quark mass in each event using the measured invariant mass of the hadronically decaying W boson to constrain the jet energy scale to obtain a value for M(top)of 173.5(-3.6)(+3.7)(stat) +/- 1.3(syst) GeV/c2 or 173.5(-3.8)(+3.9) GeV/c2 . We take the latter, which is more precise, as our result.

Petrofyzikální charakteristika kontaminované svrchní zvodně v podloží závodu PAL INTERNATIONAL, a. s., v Praze-Kbelích

Czech Academy of Sciences Publication Activity Database

Novák, Jiří Karel; Svobodová, Marcela; Minařík, Luděk

2003-01-01

Roč. 2002, - (2003), s. 173-175 ISSN 0514-8057 Institutional research plan: CEZ:AV0Z3013912 Keywords : petrophysical properties * contamination * Cretaceous Bohemian Basin Subject RIV: DB - Geology ; Mineralogy http://www.geology.cz/zpravy/obsah/2002/zpravy-o-vyzkumech-2002-str-173-175.pdf

Better management of alien species

Czech Academy of Sciences Publication Activity Database

Pergl, Jan; Genovesi, P.; Pyšek, Petr

2016-01-01

Roč. 531, č. 7593 (2016), s. 173-173 ISSN 0028-0836 Grant - others:AV ČR(CZ) AP1002 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985939 Keywords : invasions * EU * policy Subject RIV: EH - Ecology, Behaviour Impact factor: 40.137, year: 2016

EST Table: BP117517 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP117517 ce--0464 10/09/28 63 %/173 aa ref|XP_002092422.1| GE14184 [Drosophila yakuba] gb|EDW92134.1| GE14...184 [Drosophila yakuba] 10/08/28 63 %/173 aa FBpp0259194|DyakGE14184-PA 10/08/28 35 %

Hexone Storage and Treatment Facility closure plan

International Nuclear Information System (INIS)

1992-11-01

The HSTF is a storage and treatment unit subject to the requirements for the storage and treatment of dangerous waste. Closure is being conducted under interim status and will be completed pursuant to the requirements of Washington State Department of Ecology (Ecology) Dangerous Waste Regulations, Washington Administrative Code (WAC) 173-303-610 and WAC 173-303-640. Because dangerous waste does not include the source, special nuclear, and by-product material components of mixed waste, radionuclides are not within the scope of WAC 173-303 or of this closure plan. The information on radionuclides is provided only for general knowledge where appropriate. The known hazardous/dangerous waste remaining at the site before commencing other closure activities consists of the still vessels, a tarry sludge in the storage tanks, and residual contamination in equipment, piping, filters, etc. The treatment and removal of waste at the HSTF are closure activities as defined in the Resource Conservation and Recovery Act (RCRA) of 1976 and WAC 173-303

Effect of High-Dose Atorvastatin on Renal Function in Subjects With Stroke or Transient Ischemic Attack in the SPARCL Trial

DEFF Research Database (Denmark)

Amarenco, Pierre; Callahan, Alfred, III; Campese, Vito M.

2014-01-01

/L (100-190 mg/dL). METHODS: We explored the effect of randomization to atorvastatin 80 mg/d or placebo on the change in estimated glomerular filtration rate (eGFR; using the 4-component Modification of Diet in Renal Disease Study equation) in SPARCL subjects (n=4731) with (eGFR, ...=3119) and without (eGFR, ≥60 mL/min per 1.73 m2; n=1600) chronic kidney disease overall and by glycemic status at baseline. RESULTS: Mean baseline eGFR was similar between treatment groups (65.5±0.26 versus 65.6±0.26 mL/min per 1.73 m2 atorvastatin versus placebo; 33% versus 34% had chronic kidney...... disease, respectively; P=0.55). After 60 months, eGFR increased 3.46±0.33 mL/min per 1.73 m2 in those randomized to atorvastatin versus 1.42±0.34 mL/min per 1.73 m2 in those randomized to placebo (P

Kidney volume in type 1 (insulin-dependent) diabetic patients with normal or increased urinary albumin excretion

DEFF Research Database (Denmark)

Feldt-Rasmussen, B; Hegedüs, L; Mathiesen, E R

1991-01-01

Forty-seven patients with type 1 (insulin-dependent) diabetes mellitus and 14 normal subjects had renal volume determined by an ultrasonic technique. Renal volume of 299 +/- 49 ml/1.73 m2 (mean +/- SD) in type 1 diabetic patients with normal urinary albumin excretion exceeded that in the normal...... subjects (245 +/- 53 ml/1.73 m2, p less than 0.05). Compared with diabetic patients with normal urinary albumin excretion, renal volume was significantly higher in patients with microalbuminuria (372 +/- 24 ml/1.73 m2, p less than 0.05) and patients with clinical nephropathy (352 +/- 48 ml/1.73 m2, p less...... than 0.05). In a multiple linear regression with HbA1c, urinary albumin excretion, age, diabetes duration and mean blood pressure as independent variables, variations in HbA1c could account for 33% of the variations in kidney volume (n = 47, r = 0.57, p less than 0.01). The other variables played...

Vascular calcification and cardiac function according to residual renal function in patients on hemodialysis with urination.

Directory of Open Access Journals (Sweden)

Dong Ho Shin

Full Text Available Vascular calcification is common and may affect cardiac function in patients with end-stage renal disease (ESRD. However, little is known about the effect of residual renal function on vascular calcification and cardiac function in patients on hemodialysis.This study was conducted between January 2014 and January 2017. One hundred six patients with residual renal function on maintenance hemodialysis for 3 months were recruited. We used residual renal urea clearance (KRU to measure residual renal function. First, abdominal aortic calcification score (AACS and brachial-ankle pulse wave velocity (baPWV were measured in patients on hemodialysis. Second, we performed echocardiography and investigated new cardiovascular events after study enrollment.The median KRU was 0.9 (0.3-2.5 mL/min/1.73m2. AACS (4.0 [1.0-10.0] vs. 3.0 [0.0-8.0], p = 0.05 and baPWV (1836.1 ± 250.4 vs. 1676.8 ± 311.0 cm/s, p = 0.01 were significantly higher in patients with a KRU < 0.9 mL/min/1.73m2 than a KRU ≥ 0.9 mL/min/1.73m2. Log-KRU significantly negatively correlated with log-AACS (ß = -0.29, p = 0.002 and baPWV (ß = -0.19, P = 0.05 after factor adjustment. The proportion of left ventricular diastolic dysfunction was significantly higher in patients with a KRU < 0.9 mL/min/1.73m2 than with a KRU ≥ 0.9 mL/min/1.73m2 (67.9% vs. 49.1%, p = 0.05. Patients with a KRU < 0.9 mL/min/1.73m2 showed a higher tendency of cumulative cardiovascular events compared to those with a KRU ≥ 0.9 ml/min/1.73m2 (P = 0.08.Residual renal function was significantly associated with vascular calcification and left ventricular diastolic dysfunction in patients on hemodialysis.

76 FR 9868 - Office of Hazardous Materials Safety; Notice of Application for Special Permits

Science.gov (United States)

2011-02-22

... intermediate bulk containers for use as the outer packaging for certain Class waste paints and waste paint.... commerce of certain Anchorage, AK. flammable and combustible liquids in alternative packaging having a... Structural 49 CFR 173.302a and To authorize the Composites 173.304a. manufacture, marking, Industries, (SCI...

An assessment of the intercarbon stretching phenomenon in C-substituted "pseudocloso" {3,1,2-RuC2B9} metalladicarbaboranes

Czech Academy of Sciences Publication Activity Database

Bould, Jonathan; Kennedy, John David

2014-01-01

Roč. 749, JAN (2014), s. 163-173 ISSN 0022-328X R&D Projects: GA ČR(CZ) GAP207/11/1577 Institutional support: RVO:61388980 Keywords : Pseudocloso * Semipseudocloso * Ruthenacarborane * Metallacarborane * Electron-counting * Anomalous cluster opening Subject RIV: CA - Inorganic Chemistry Impact factor: 2.173, year: 2014

21 CFR 173.25 - Ion-exchange resins.

Science.gov (United States)

2010-04-01

..., distilled water and 10 percent ethanol, when, following washing and pretreatment of the resin in accordance... paragraph (a)(18) of this section is used to treat aqueous sugar solutions subject to the condition that the temperature of the sugar solution passing through the resin bed is maintained at 82 °C (179.6 °F) or less and...

21 CFR 173.310 - Boiler water additives.

Science.gov (United States)

2010-04-01

...-sodium acrylate resin Contains not more than 0.05 percent by weight of acrylamide monomer. Acrylic acid/2...-hydroxyethylidene-1,1-diphosphonic acid (CAS Reg. No. 2809-21-4) and its sodium and potassium salts Lignosulfonic.... Potassium carbonate Potassium tripolyphosphate Sodium acetate Sodium alginate Sodium aluminate Sodium...

21 CFR 173.20 - Ion-exchange membranes.

Science.gov (United States)

2010-04-01

... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... centimeters of the following solvents: Distilled water, 5 percent acetic acid, and 50 percent alcohol...

21 CFR 173.40 - Molecular sieve resins.

Science.gov (United States)

2010-04-01

... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... gram of dry resin (expressed in terms of water regain), and a particle size of 10 to 300 microns. (b...

49 CFR 173.197 - Regulated medical waste.

Science.gov (United States)

2010-10-01

... requirements of § 178.801(j) and record retention requirements of § 178.801(l) of this subchapter. Inner... constructed of metal or fiberglass and have a capacity of at least 3.5 cubic meters (123.6 cubic feet) and not... welded or seamless construction and a rigid, weatherproof top to prevent the intrusion of water (e.g...

Search Results | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

As currently foreseen, neither the two-state nor the one-state solution offers much hope of resolving the Israeli-Palestinian conflict. Project ... The first phase of the project was funded after qualifying in a competition for projects featuring an ecosystem approach to human health in West Africa (100772). Project.

49 CFR 173.181 - Pyrophoric materials (liquids).

Science.gov (United States)

2010-10-01

... inner receptacles of glass or metal, not over 1 L (0.3 gallon) capacity each, having positive screwcap... be closed by positive means, not by friction. (c) Steel drums (1A2) or fiber drums (1G) not exceeding... each, closed by positive means, not friction. (1) Inner packagings must have no opening exceeding 25 mm...

RT-173: Helix, 2017 Helix Technical Report

Science.gov (United States)

2018-01-16

and to coordinate across the problem domain and solution domain. Categories include: communication; listening and comprehension ; working in a...proficiency set as a useful and comprehensive model. The forces identified in Figure 1 – experiences, mentoring, education and training – are linked

21 CFR 173.350 - Combustion product gas.

Science.gov (United States)

2010-04-01

.... Caution. The various parts of the absorption train must be connected by gas-tight tubing and joints... gas source is connected in series to the flow-rate device, the flow meter, and the absorption.... Maintain the coolant bath at 0 °C throughout. Remove the absorption vessel from the bath, disconnect, and...

33 CFR 173.57 - Contents of report.

Science.gov (United States)

2010-07-01

... contributed to causing the casualty. (w) The make, model, type (open, cabin, house, or other), beam width at... outdrive, sail, or other), fuel (gas, diesel, or other), construction (wood, steel, aluminum, plastic...

49 CFR 173.4a - Excepted quantities.

Science.gov (United States)

2010-10-01

... onto a solid unyielding surface from a height of 1.8 m (5.9 feet): (i) Where the sample is in the shape... sample is in the shape of a drum, it must be dropped in each of the following orientations: (A) One drop...

24 CFR 248.173 - Resident homeownership program.

Science.gov (United States)

2010-04-01

..., consistent with paragraph (f) of this section; (x) How the marketing of currently vacant units and units... 50 percent of such proceeds shall be returned to the Commissioner for use under §§ 248.157 and 248... homeowner under the homeownership program approved under this section shall be paid to the HOME Investment...

21 CFR 173.5 - Acrylate-acrylamide resins.

Science.gov (United States)

2010-04-01

... produced by the polymerization of acrylamide with partial hydrolysis, or by copolymerization of acrylamide... polyacrylate-acrylamide resin is produced by the polymerization and subsequent hydrolysis of acrylonitrile in a... or cane sugar juice and liquor or corn starch hydrolyzate in an amount not to exceed 5 parts per...

32 CFR 173.2 - Competitive Information Certification.

Science.gov (United States)

2010-07-01

... Procurement Task Force. (2) The requirement to provide the Certificate may be further limited to certain... Business Ethics and Integrity complying with the Interim rule in lieu of Competitive Information...

49 CFR 173.50 - Class 1-Definitions.

Science.gov (United States)

2010-10-01

.... (a) Explosive. For the purposes of this subchapter, an explosive means any substance or article... minor explosion hazard. The explosive effects are largely confined to the package and no projection of fragments of appreciable size or range is to be expected. An external fire must not cause virtually...

The impairment of true glomerular filtration rate in long-term cyclosporine-treated pediatric allograft recipients

International Nuclear Information System (INIS)

McDiarmid, S.V.; Ettenger, R.B.; Hawkins, R.A.; Senguttvan, P.; Busuttil, R.W.; Vargas, J.; Berquist, W.E.; Ament, M.E.

1990-01-01

We performed indium-111-DTPA plasma clearance studies in 61 pediatric kidney and liver recipients treated with cyclosporine to compare true glomerular filtration rate with calculated GFR (cGFR). The mean true GFR of 61.9 +/- 36.6 ml/min/1.73 m2 indicated renal impairment. The mean cGFR of 85.2 +/- 22.4 ml/min/1.73 m2 was significantly higher (P less than 0.001), and overestimated GFR by 38%. cGFR alone did not accurately reflect the degree of renal dysfunction. A group of 48 pediatric orthotopic liver transplant recipients was studied in more detail: 73% of these patients had a true GFR less than 70 ml/min/1.73 m2, while 85% had a true GFR below 90 ml/min/1.73 m2, the lower limit for normal GFR in children. The mean true GFR for patients treated more than 24 months with CsA was lower (P = 0.02) than patients treated with CsA for 12 to 24 months. OLT patients with normal true GFR (greater than 90 ml/min/1.73 m2) had significantly lower plasma CsA levels, and 50% of patients with a true GFR less than or equal to 50 ml/min/1.73 m2 had hypertension. There was no effect on true GFR of age, liver function, azathioprine use, or peritransplant treatment with other nephrotoxic drugs. We conclude that true GFR is significantly impaired in long-term CsA-treated allograft pediatric recipients. Calculations of GFR underestimate the degree of renal dysfunction. As patients treated greater than 24 months had the lowest true GFRs, the fall in GFR may be progressive

The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

Directory of Open Access Journals (Sweden)

Juan S Ruiz-Moreno

2018-01-01

Full Text Available The cyclic GMP-AMP synthase (cGAS-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs. In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection.ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

Science.gov (United States)

Ruiz-Moreno, Juan S; Hamann, Lutz; Shah, Javeed A; Verbon, Annelies; Mockenhaupt, Frank P; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E; Witzenrath, Martin; Cambier, John C; Suttorp, Norbert; Schumann, Ralf R; Jin, Lei; Hawn, Thomas R; Opitz, Bastian

2018-01-01

The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires’ disease in humans

Science.gov (United States)

Hamann, Lutz; Verbon, Annelies; Mockenhaupt, Frank P.; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E.; Witzenrath, Martin; Schumann, Ralf R.; Hawn, Thomas R.

2018-01-01

The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires’ disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires’ disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. Trial registration ClinicalTrials.gov DRKS00005274, German Clinical Trials Register PMID:29298342

Certification of packagings: compliance with DOT specification 7A packaging requirements

International Nuclear Information System (INIS)

Edling, D.A.

1976-01-01

A study was conducted to determine which of the packagings currently listed in CFR 49 Section 173.395 a.1-5, meet the Specification 7A requirements (CFR 49 Section 173.350). According to DOT HM-111 the present listing of various authorized DOT specifications in Section 173.394 and Section 173.395 (Type A containers) of ICC Tariff No. 27 would be deleted with complete reliance being placed on the use of DOT 7A, Type A general packaging specification. Each user of a Specification 7A package would be required to document and maintain on file for one year a written record of his determination of compliance with the DOT Specification 7A performance requirements. All the specification packagings listed in CFR 49 Section 173.395a.1-5 were tested and shown to meet the Specification 7A criteria; however, in many cases qualifications were placed on their use. Forty-nine specification packagings were tested and shown to meet the DOT Specification 7A performance requirements and since there were several styles of some specific packagings, this amounts to greater than 80 packagings. The extensive testing generally indicated a high degree of containment integrity in the packagings tested and the documentation discussed is a valuable tool for shippers of Type A quantities of radioactive materials

Macrophage Migration Inhibitory Factor Polymorphism Is Associated with Susceptibility to Inflammatory Coronary Heart Disease

Directory of Open Access Journals (Sweden)

Kangting Ji

2015-01-01

Full Text Available Background. Macrophage migration inhibitory factor (MIF is a proinflammatory cytokine. This study explored the association of 173G/C polymorphism of the MIF gene with coronary heart disease (CHD. Methods. Sequencing was carried out after polymerase chain reaction with DNA specimens from 186 volunteers without CHD and 70 patients with CHD. Plasma MIF levels on admission were measured by ELISA. Patients were classified into either stable angina pectoris (SAP or unstable angina pectoris (UAP. Genotype distribution between cases and controls and the association of patients’ genotypes with MIF level and plaque stability were statistically evaluated (ethical approval number: 2012-01. Results. The frequency of the C genotype was higher in CHD patients than in the control (P=0.014. The frequency of the 173*CC genotype was higher in CHD patients than in the control (P=0.005. The plasma MIF level was higher in MIF173*C carriers than in MIF173*G carriers (P=0.033. CHD patients had higher plasma MIF levels than the control (P=0.000. Patients with UAP had higher plasma MIF levels than patients with SAP (P=0.014. Conclusions. These data suggest that MIF −173G/C polymorphism may be related to the development of CHD in a Chinese population. Plasma MIF level is a predictor of plaque stability. This trial is registered with NCT01750502 .

A new DOI detector design using discrete crystal array with depth-dependent reflector patterns and single-ended readout

Energy Technology Data Exchange (ETDEWEB)

Lee, Seung-Jae; Lee, Chaeyeong [Department of Radiological Science, Yonsei University, Wonju 26493 (Korea, Republic of); Kang, Jihoon, E-mail: ray.jihoon.kang@gmail.com [Department of Biomedical Engineering, Chonnam National University, 50 Daehak-ro, Yeosu, Jeonnam 59626 (Korea, Republic of); Chung, Yong Hyun, E-mail: ychung@yonsei.ac.kr [Department of Radiological Science, Yonsei University, Wonju 26493 (Korea, Republic of)

2017-01-21

We developed a depth of interaction (DOI) positron emission tomography (PET) detector using depth-dependent reflector patterns in a discrete crystal array. Due to the different reflector patterns at depth, light distribution was changed relative to depth. As a preliminary experiment, we measured DOI detector module crystal identification performance. The crystal consisted of a 9×9 array of 2 mmx2 mmx20 mm lutetium-yttrium oxyorthosilicate (LYSO) crystals. The crystal array was optically coupled to a 64-channel position-sensitive photomultiplier tube with a 2 mmx2 mm anode size and an 18.1 mmx18.1 mm effective area. We obtained the flood image with an Anger-type calculation. DOI layers and 9×9 pixels were well distinguished in the obtained images. Preclinical PET scanners based on this detector design offer the prospect of high and uniform spatial resolution.

SensL B-Series and C-Series silicon photomultipliers for time-of-flight positron emission tomography

Energy Technology Data Exchange (ETDEWEB)

O' Neill, K., E-mail: koneill@sensl.com; Jackson, C., E-mail: cjackson@sensl.com

2015-07-01

Silicon photomultipliers from SensL are designed for high performance, uniformity and low cost. They demonstrate peak photon detection efficiency of 41% at 420 nm, which is matched to the output spectrum of cerium doped lutetium orthosilicate. Coincidence resolving time of less than 220 ps is demonstrated. New process improvements have lead to the development of C-Series SiPM which reduces the dark noise by over an order of magnitude. In this paper we will show characterization test results which include photon detection efficiency, dark count rate, crosstalk probability, afterpulse probability and coincidence resolving time comparing B-Series to the newest pre-production C-Series. Additionally we will discuss the effect of silicon photomultiplier microcell size on coincidence resolving time allowing the optimal microcell size choice to be made for time of flight positron emission tomography systems.

A new DOI detector design using discrete crystal array with depth-dependent reflector patterns and single-ended readout

International Nuclear Information System (INIS)

Lee, Seung-Jae; Lee, Chaeyeong; Kang, Jihoon; Chung, Yong Hyun

2017-01-01

We developed a depth of interaction (DOI) positron emission tomography (PET) detector using depth-dependent reflector patterns in a discrete crystal array. Due to the different reflector patterns at depth, light distribution was changed relative to depth. As a preliminary experiment, we measured DOI detector module crystal identification performance. The crystal consisted of a 9×9 array of 2 mmx2 mmx20 mm lutetium-yttrium oxyorthosilicate (LYSO) crystals. The crystal array was optically coupled to a 64-channel position-sensitive photomultiplier tube with a 2 mmx2 mm anode size and an 18.1 mmx18.1 mm effective area. We obtained the flood image with an Anger-type calculation. DOI layers and 9×9 pixels were well distinguished in the obtained images. Preclinical PET scanners based on this detector design offer the prospect of high and uniform spatial resolution.

Spectrophotometric determination of neodymium in mixture with lanthanum by eosin and 2,2'-dipyridyl

International Nuclear Information System (INIS)

Ovchar, L.A.; Poluehktov, N.S.

1980-01-01

The possibility of using rare earth complexes with eosin (EO) and 2.2-dipyridyl (DP) for spectrophotometric determination of some rare earths in the presence of the others. It has been out that the complexes are not extracted by organic solvents. The PH region of complex existence (approximately 6) and the relation of components in them (rare earths:DP:EO=1:2:3) are determined. The possibility has been shown of determining all the rare earts from praseodymium to lutetium and yttrium in a binary mixture with lanthanum based on different stability of the studied complexes. The method has been tested on the example of determining Nd 2 O 3 in a mixture with La 2 O 3 . The low limit of determined contents is 1-2%. The relative standard deviation is 0.035-0.17 [ru

Current trends in scintillator detectors and materials

International Nuclear Information System (INIS)

Moses, W.W.

2002-01-01

The last decade has seen a renaissance in inorganic scintillator development for gamma ray detection. Lead tungstate (PbWO 4 ) has been developed for high-energy physics experiments, and possesses exceptionally high density and radiation hardness, albeit with low luminous efficiency. Lutetium orthosilicate or LSO (Lu 2 SiO 5 :Ce) possesses a unique combination of high luminous efficiency, high density, and reasonably short decay time, and is now incorporated in commercial positron emission tomography cameras. There have been advances in understanding the fundamental mechanisms that limit energy resolution, and several recently discovered materials (such as LaBr 3 :Ce) possess energy resolution that approaches that of direct solid state detectors. Finally, there are indications that a neglected class of scintillator materials that exhibit near band-edge fluorescence could provide scintillators with sub-nanosecond decay times and high luminescent efficiency

Determination of trace elements in eyeshadow, face powder and rouge make-up cosmetics by neutron activation analysis

International Nuclear Information System (INIS)

Kanias, G.D.

1985-01-01

Some trace elements exist in cosmetics due to the mineral origin of their raw materials and there is no information about their concentration levels in these products. Instrumental neutron activation analysis was applied to determine the elements: cerium, cesium, europium, hafnium, lanthanum, lutetium, potassium, rubidium, samarium, scandium, sodium, tantalum, terbium, tungsten and ytterbium in eyeshadow, face powder and rouge make-up cosmetic products from the Greek market. According to the results, a wide range of values was found between the three examined cosmetics as well as between the different samples belonging to the same kind of cosmetics. This probably could be attributed to the various manufacturers of the analyzed samples. Moreover, the use of neutron activation analysis as a suitable routine method is discussed for the control of some elements which must not be contained in cosmetics. (author)

75 FR 34522 - Office of Hazardous Materials Safety; Notice of Applications for Modification of Special Permit

Science.gov (United States)

2010-06-17

...), Sugar ``Type V'' cylinder Land, TX. under paragraph 7.a.(vi) as an alternative to Helium- 3 and in... Batteries, 173.159(e)(4). permit originally Dallas, TX. issued on an emergency basis to authorize transportation in commerce of lead batteries from more than one shipper without voiding the exception in Sec. 173...

A Thermally Stable Form of Bacterial Cocaine Esterase: A Potential Therapeutic Agent for Treatment of Cocaine Abuse

Energy Technology Data Exchange (ETDEWEB)

Brim, Remy L.; Nance, Mark R.; Youngstrom, Daniel W.; Narasimhan, Diwahar; Zhan, Chang-Guo; Tesmer, John J.G.; Sunahara, Roger K.; Woods, James H. (Michigan); (Michigan-Med); (Kentucky)

2010-09-03

Rhodococcal cocaine esterase (CocE) is an attractive potential treatment for both cocaine overdose and cocaine addiction. CocE directly degrades cocaine into inactive products, whereas traditional small-molecule approaches require blockade of the inhibitory action of cocaine on a diverse array of monoamine transporters and ion channels. The usefulness of wild-type (wt) cocaine esterase is hampered by its inactivation at 37 C. Herein, we characterize the most thermostable form of this enzyme to date, CocE-L169K/G173Q. In vitro kinetic analyses reveal that CocE-L169K/G173Q displays a half-life of 2.9 days at 37 C, which represents a 340-fold improvement over wt and is 15-fold greater than previously reported mutants. Crystallographic analyses of CocE-L169K/G173Q, determined at 1.6-{angstrom} resolution, suggest that stabilization involves enhanced domain-domain interactions involving van der Waals interactions and hydrogen bonding. In vivo rodent studies reveal that intravenous pretreatment with CocE-L169K/G173Q in mice provides protection from cocaine-induced lethality for longer time periods before cocaine administration than wt CocE. Furthermore, intravenous administration (pretreatment) of CocE-L169K/G173Q prevents self-administration of cocaine in a time-dependent manner. Termination of the in vivo effects of CoCE seems to be dependent on, but not proportional to, its clearance from plasma as its half-life is approximately 2.3 h and similar to that of wt CocE (2.2 h). Taken together these data suggest that CocE-L169K/G173Q possesses many of the properties of a biological therapeutic for treating cocaine abuse but requires additional development to improve its serum half-life.

Cystatin C-Based Equation Does Not Accurately Estimate the Glomerular Filtration in Japanese Living Kidney Donors.

Science.gov (United States)

Tsujimura, Kazuma; Ota, Morihito; Chinen, Kiyoshi; Adachi, Takayuki; Nagayama, Kiyomitsu; Oroku, Masato; Nishihira, Morikuni; Shiohira, Yoshiki; Iseki, Kunitoshi; Ishida, Hideki; Tanabe, Kazunari

2017-06-23

BACKGROUND Precise evaluation of a living donor's renal function is necessary to ensure adequate residual kidney function after donor nephrectomy. Our aim was to evaluate the feasibility of estimating glomerular filtration rate (GFR) using serum cystatin-C prior to kidney transplantation. MATERIAL AND METHODS Using the equations of the Japanese Society of Nephrology, we calculated the GFR using serum creatinine (eGFRcre) and cystatin C levels (eGFRcys) for 83 living kidney donors evaluated between March 2010 and March 2016. We compared eGFRcys and eGFRcre values against the creatinine clearance rate (CCr). RESULTS The study population included 27 males and 56 females. The mean eGFRcys, eGFRcre, and CCr were, 91.4±16.3 mL/min/1.73 m² (range, 59.9-128.9 mL/min/1.73 m²), 81.5±14.2 mL/min/1.73 m² (range, 55.4-117.5 mL/min/1.73 m²) and 108.4±21.6 mL/min/1.73 m² (range, 63.7-168.7 mL/min/1.73 m²), respectively. eGFRcys was significantly lower than CCr (p<0.001). The correlation coefficient between eGFRcys and CCr values was 0.466, and the mean difference between the two values was -17.0 (15.7%), with a root mean square error of 19.2. Thus, eGFRcre was significantly lower than CCr (p<0.001). The correlation coefficient between eGFRcre and CCr values was 0.445, and the mean difference between the two values was -26.9 (24.8%), with a root mean square error of 19.5. CONCLUSIONS Although eGFRcys provided a better estimation of GFR than eGFRcre, eGFRcys still did not provide an accurate measure of kidney function in Japanese living kidney donors.

Discrepancies among consensus documents, guidelines, clinical practice and the legal framework for the treatment of type 2 diabetes mellitus patients.

Science.gov (United States)

del Pozo-Fernández, Carlos; Pardo-Ruiz, Carlos; Sánchez-Botella, Concepción; Blanes-Castañer, Vanesa; López-Menchero, Ramón; Gisbert-Sellés, Cristina; Sánchez-Jodar, Carmen; Alvarez-Avellán, Luis

2012-05-14

In this paper we analyse the discrepancies that exist in the widespread prescription of metformin in patients with type 2 diabetes and the lack of guidelines concerning its prescription in the different stages of renal failure. This cross-sectional study includes 304 patients with type 2 diabetes treated with oral antidiabetic drugs (ADOs) and a glomerular filtration rate (estimated GFR) <60ml/min/1.73m2. Patients were attended in consecutive visits to primary health centres or in hospital departments of endocrinology or nephrology during 2010. We studied the frequency of metformin and other ADO prescriptions according to renal function and the department in which the patient was treated. The ADO most frequently prescribed was metformin (54.9%), followed by repaglinide (47.7%), DPP4 inhibitors (28.6%), and sulfonylureas (18.4%). However, in nephrology departments, repaglinide was more frequently prescribed than metformin (P<.001), whereas in primary health centres, the prescription of DPP4 inhibitors increased. In patients with an estimated GFR of 15-29ml/min/1.73m2, metformin (13.3%) and sulfonylureas were the least prescribed, whereas metformin was much more frequently prescribed (70.0%) when estimated GFR was 45-59ml/min/1.73m2 (P<.001). In contrast, patients with an estimated GFR of 15-29ml/min/1.73m2 were mainly prescribed repaglinide (76.7%), as opposed to patients with an estimated GFR of 45-59ml/min/1.73m2 (38.9%) (P<.001). Substantial evidence suggests that the recommendations for the use of ADO should be modified. This would lead to safely prescribing ADO in patients with an estimated GFR<60ml/min/1.73m2, and more importantly in medical practice, according to the law.

78 FR 18420 - Special Permit Applications Actions

Science.gov (United States)

2013-03-26

... of Energy, 49 CFR, 49 CFR Sec. To authorize the Washington, DC. 173.310. transportation in commerce..., attached to or 173.302(f)(3) and Sec. suspended from an aircraft, 175.75. in remote areas of the US without... transportation in Agency Region II, commerce of certain Edison, NJ. hazardous materials in support of the...

Pramana – Journal of Physics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Pramana – Journal of Physics; Volume 79; Issue 2. Issue front cover thumbnail. Volume 79, Issue 2. August 2012, pages 173-335. pp 173-183. Complex dynamical invariants for two-dimensional complex potentials · J S Virdi F Chand C N Kumar S C Mishra · More Details Abstract Fulltext PDF. Complex ...

78 FR 43268 - Special Permit Applications

Science.gov (United States)

2013-07-19

... an amount qualifying as hazardous material. (modes 1, 2, 3, 4) 15860-N......... Apple Inc. 49 CFR To... strength stiffness. 13581-M......... Bengal Products 49 CFR To modify the Inc. Baton 173.306(a)(3). special............ Carleton 49 CFR 173.302a To modify the Technologies special permit to Inc. (Former change a drawing Grantee...

Effect of metabolic regulation on renal leakiness to dextran molecules in short-term insulin-dependent diabetics

DEFF Research Database (Denmark)

Parving, H H; Rutili, F; Granath, K

1979-01-01

Renal clearance of dextran of two ranges of molecular size and glomerular filtration rate (GFR, 51Cr-EDTA) were measured in seven short-term insulin-dependent diabetics (mean age 25 years). Measurements were carried out in the same patient during good and poor metabolic regulation (plasma glucose......, mean +/- SEM, 6.5 +/- 0.9 and 14.8 +/- 1.5 mmol/l, respectively). GFR was elevated in all patients during poor metabolic regulation (119 +/- 6 ml/min/1.73 m2, versus 99 +/- 2 ml/min/1.73 m2 during good control, p less than 0.01). The average renal clearance of dextran with molecular weights ranging...... from 25,000 to 35,000 and 35,000 to 45,000 increased during poor metabolic regulation from 14.8 +/- 0.8 to 19.8 +/- 1.8 ml/min/1.73 m2, and 5.2 +/- 0.3 to 6.8 +/- 0.6 ml/min/1.73 m2, respectively (p less than 0.05). The elevated GFR and renal dextran clearance found during poor metabolic regulation...

190-C Facility <90 Day Storage Pad training plan

International Nuclear Information System (INIS)

Little, N.C.

1996-12-01

This is the Environmental Restoration Contractor (ERC) team training plan for the 190-C Facility <90 Day Storage Pad of Hazardous Waste. It is intended to meet the requirements of Washington Administrative Code (WAC) 173-303-330 and the Hanford Dangerous Waste Permit. Training unrelated to compliance with WAC 173-303-330 is not addressed in this training plan. WAC 173-303-330(1)(d)(ii, v, vi) requires that personnel be familiarized, where applicable, with waste feed cut-off systems, response to ground-water contamination incidents, and shutdown of operations. These are not applicable to 190-C Facility <90 Day Storage Pad, and are therefore not covered in this training plan

Electron-phonon interaction in the binary superconductor lutetium carbide LuC2 via first-principles calculations

Science.gov (United States)

Dilmi, S.; Saib, S.; Bouarissa, N.

2018-06-01

Structural, electronic, electron-phonon coupling and superconducting properties of the intermetallic compound LuC2 are investigated by means of ab initio pseudopotential plane wave method within the generalized gradient approximation. The calculated equilibrium lattice parameters yielded a very good accord with experiment. There is no imaginary phonon frequency in the whole Brillouin zone supporting thus the dynamical stability in the material of interest. The average electron-phonon coupling parameter is found to be 0.59 indicating thus a weak-coupling BCS superconductor. Using a reasonable value of μ* = 0.12 for the effective Coulomb repulsion parameter, the superconducting critical temperature Tc is found to be 3.324 which is in excellent agreement with the experimental value of 3.33 K. The effect of the spin-orbit coupling on the superconducting properties of the material of interest has been examined and found to be weak.

Magnetic susceptibility of scandium-hydrogen and lutetium-hydrogen solid-solution alloys from 2 to 3000K

International Nuclear Information System (INIS)

Stierman, R.J.

1982-12-01

Results for pure Sc show that the maximum and minimum in the susceptibility discovered earlier are enhanced as the impurity level of iron in scandium decreases. The Stoner enhancement factor, calculated from low-temperature heat capacity data, susceptibility data, and band-structure calculations show Sc to be a strongly enhanced paramagnet. Below 2 0 K, the magnetic anisotropy between the hard and easy directions of scandium decreases linearly with decreasing temperature, tending toward zero at 0 K. The large increase in the susceptibility of Sc at lower temperatures indicates magnetic ordering. Pure Lu and Lu-H alloys showed an anisotropy in susceptibility vs orientation; thus the samples were not random polycrystalline samples. Pure Lu shows the shallow maximum and minimum, but the increase in susceptibility at low temperatures is larger than previously observed. The susceptibility-composition dependence of the Lu-H alloys also did not match other data. The susceptibility-composition dependence does not match the composition dependence of the electronic specific heat constant below 150 K, showing the electronic specific heat is being affected by terms other than phonon-electron and pure electron-electron interactions

Analysis of survival for patients with chronic kidney disease primarily related to renal cancer surgery.

Science.gov (United States)

Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C

2018-01-01

To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing

Normal values of glomerular filtration rate in geriatrics in Bandung and its correlation with serum cystatin-C levels

International Nuclear Information System (INIS)

Resnaldi, A.; Yuliani, A.; Hidayat, B.; Kartamihardja, A.H.S.

2007-01-01

Full text: Determination of the normal values of glomerular filtration rate (GFR) is an essential part of the evaluation of patient with kidney disease. GFR almost linearly decreases with age at a mean annual rate of 0.8 ml/min/1.73 m2 over the age of 30 years old. According to NHANES III mean GFR for population with age > 60 years was 80 mL/min/1.73 m2. It is recommended for each centre to determine their own normal values of GFR for different age groups particularly in geriatric population. Recently, serum cystatin-C has been proposed as a new endogenous marker of glomerular filtration rate. Aim of the study was to determination of normal values of glomerular filtration rate (GFR) in geriatrics in Bandung and its correlation with serum Cystatin-C levels. Subjects were 24 males and 36 females (mean age 66.71 ± 6.7 years; range 60-87 yrs), without any renal and/or systemic disease. Creatinine clearance was estimated by using Cockroft-Gault formula and serum cystatin-C level were determined by using particle enhanced immunonephelometric method, while GFR values were determined by external body counting methods using Tc-99m DTPA ( Gates' methods ). Pearson correlation was used to determine correlation between variables and a P value < 0.05 is considered significant. Results and Discussion. Mean total GFR was 67.57 ml/min/1.73 m2 (SD ± 16.02), range from 45 to 100 ml/min/1.73 m2. Mean total GFR for male was 69.46 ml/min/1.73 m2, and female was 66.31 ml/min/1.73 m2, the difference was statistically significant (p < 0.05). The results were lower than NHANES III values. There was a better correlation between total GFR and cystatin-C level (r = -0.522 and p < 0.001) compared to total GFR and creatinine clearance (r 0.306 and p < 0.005). Mean creatinine clearance was 57.93 ml/min and serum cystatin-C was 0.97 mg/dl, the correlation was statistically significant (r -0.414 and p < 0.005). Conclusions: The normal values of GFR in geriatric population in Bandung were 69

Effectiveness and side-effects of peptide receptor radionuclide therapy for neuroendocrine neoplasms in Germany: A multi-institutional registry study with prospective follow-up.

Science.gov (United States)

Hörsch, Dieter; Ezziddin, Samer; Haug, Alexander; Gratz, Klaus Friedrich; Dunkelmann, Simone; Miederer, Matthias; Schreckenberger, Mathias; Krause, Bernd Joachim; Bengel, Frank M; Bartenstein, Peter; Biersack, Hans-Jürgen; Pöpperl, Gabriele; Baum, R P

2016-05-01

Monocentric and retrospective studies indicate effectiveness of peptide receptor radionuclide therapy targeting somatostatin receptors of neuroendocrine neoplasms. We assessed overall and progression-free survival and adverse events of peptide receptor radionuclide therapy by a multi-institutional, board certified registry with prospective follow-up in five centres in Germany. A total of 450 patients were included and followed for a mean of 24.4 months. Most patients had progressive low- or intermediate grade neuroendocrine neoplasms and 73% were pretreated with at least one therapy. Primary neuroendocrine neoplasms were mainly derived of pancreas (38%), small bowel (30%), unknown primary (19%) or bronchial system (4%). Patients were treated with Lutetium-177 in 54%, with Yttrium-90 in 17% and with both radionuclides in 29%. Overall and progression-free survival was determined with Kaplan-Meier curves and uni-variate log rank test Cox models. Median overall survival of all patients was 59 (95% confidence interval [CI] 49-68.9) months. Overall survival was significantly inferior in the patients treated with Yttrium-90 solely (hazard ratio, 3.22; 95% CI, 1.83-5.64) compared to any peptide receptor radionuclide therapy with Lutetium-177. Grade II (hazard ratio, 2.06; 95% CI, 0.79-5.32) and grade III (hazard ratio, 4.22; 95% CI, 1.41-12.06) neuroendocrine neoplasms had significantly worse overall survival than grade I neuroendocrine neoplasms. Patients with small neuroendocrine neoplasms of small bowel had significantly increased survival (hazard ratio, 0.39; 95% CI, 0.18-0.87) compared to neuroendocrine neoplasms of other locations. Median progression-free survival was 41 (35.9-46.1) months and significantly inferior in patients treated with Yttrium solely (hazard ratio, 2.7; 95% CI, 1.71-4.55). Complete remission was observed in 5.6% of patients, 22.4% had a partial remission, 47.3% were stable and 4% were progressive as best response. Adverse events of bone marrow

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Sustainability of rare earth elements chain: from production to food - a review.

Science.gov (United States)

Turra, Christian

2018-02-01

Rare earth elements (REE) are a group of chemical elements that include lanthanoids (lanthanum to lutetium), scandium and yttrium. In the last decades, the REE demand in the industry and other areas has increased significantly. In general, REE have shown low concentrations in soils, plants, water and atmosphere, but they may accumulate in such environments due to anthropogenic inputs. In areas where there is REE contamination, the slow accumulation of these elements in the environment could become problematic. Many studies have shown environmental areas contaminated with REE and their toxic effects. Thus, it is important to review, in order to improve the current understanding of these elements in the environment, showing the effects of REE exposure in mining, soil, water, plants and food. Besides, there are few suppliers and a limited quantity of these elements in the world. This paper suggests options to improve the sustainability management of REE chain.

Comparison of the scintillation and luminescence properties of the (Lu1−xGdx)2SiO5:Ce single crystal scintillators

International Nuclear Information System (INIS)

Jarý, V; Mihóková, E; Mareš, J A; Beitlerová, A; Nikl, M; Kurtsev, D; Sidletskiy, O

2014-01-01

We provide a systematic comparison of the scintillation and luminescence properties, including emission mechanisms, of the highly efficient cerium-doped scintillators lutetium-(gadolinium) orthosilicates Lu 2 (SiO 4 )O (LSO), (Lu 1−x Gd x ) 2 (SiO) 4 O(LGSO) and Gd 2 (SiO 4 )O (GSO). Determined characteristics manifest an advantage of LGSO:Ce with respect to both LSO:Ce and GSO:Ce for scintillator applications around room temperature. This is thanks to combined fast decay (faster than both limit compositions) high light yield, similar to that of LSO:Ce (twice higher than GSO:Ce) and low afterglow, similar to that of GSO:Ce (almost two orders of magnitude lower than LSO:Ce). High temperature applications do not, however, seem to be a suitable option for LGSO:Ce due to evidenced thermal ionization of both Ce1 and Ce2 centres above room temperature. (paper)

Phase formation in the K2MoO4-Lu2(MoO4)3-Hf(MoO4)2 system and the structural study of triple molybdate K5LuHf(MoO4)6

International Nuclear Information System (INIS)

Romanova, E.Yu.; Bazarov, B.G.; Tushinova, Yu.L.; Fedorov, K.N.; Bazarova, Zh.G.; Klevtsova, R.F.; Glinskaya, L.A.

2007-01-01

Interactions in the ternary system K 2 MoO 4 -Lu 2 (MoO 4 ) 3 -Hf(MoO 4 ) 2 have been studied by X-ray powder diffraction and differential thermal analysis. A new triple (potassium lutetium hafnium) molybdate with the 5 : 1 : 2 stoichiometry has been found. Monocrystals of this molybdate have been grown. Its X-ray diffraction structure has been refined (an X8 APEX automated diffractometer, MoK α radiation, 1960 F(hkl), R = 0.0166). The trigonal unit cell has the following parameters: a = 10.6536(1) A, c = 37.8434(8) A, V=3719.75(9) A, Z = 6, space group R3-bar c. The mixed 3D framework of the structure is built of Mo tetrahedra sharing corners with two independent (Lu,Hf)O 6 octahedra. Two sorts of potassium atoms occupy large framework voids [ru

Nuclear and radiochemical techniques in chemical analysis. Progress report, June 1, 1975--July 31, 1976

International Nuclear Information System (INIS)

Finston, H.L.; Williams, E.T.

1976-01-01

There has been significant progress on the project to measure the neutron-capture cross sections of reactor produced radionuclides, in particular, centering on the problems with nuclides such as 22 Na which may have a resonance for thermal-neutron capture. The thermal capture cross section of less than 40 b has been verified for 54 Mn, and cadmium ratios have been determined for 184 Re in the V-11 and V-14 positions in the HFBR. Lutetium has been used as a neutron temperature monitor for the Brookhaven reactors. Preliminary results on the project to determine the effect of chemical state on the branching ratio in 58 Co are reported. Procedures for aerosol collection and analysis by proton-induced x-ray emission (PIXE) are reported. A program to analyze aerosols for polycyclic aromatic hydrocarbons has been initiated. Progress is reported on the experimental verification of the proposed acid-base hypothesis

Characterization of potassic materials of Pocos de Caldas alkaline massif, Southeastern Brazil

International Nuclear Information System (INIS)

Goncalves, P.; Navarro, F.C.; Roveri, C.D.; Bergerman, M.G.

2016-01-01

Potassium, which has featured in Brazil's agricultural sector and in the world's in the application of fertilizers, is present in magmatic rocks, such as nepheline syenite and phonolite, found in the Alkaline Massif of Pocos de Caldas (AMPC). The rare earth elements (REE), in turn, also occur in this region and have important uses in various industrial fields. The aim of this study was to investigate the potential of potassic rocks of AMPC in the fertilizer and rare earths industry. Five samples were collected and characterized. It was observed that there was no preferential concentration by granulometric range of potassium oxide, alumina, silica and iron oxide. Feldspathic mass, potash feldspar, and muscovite were found in all samples. The samples show REE with amounts greater than those found in the earth's crust, except for lutetium and scandium and possessed average content of potassium oxide from 8.70 to 14.40%. (author)

Enzymatic creatinine assays allow estimation of glomerular filtration rate in stages 1 and 2 chronic kidney disease using CKD-EPI equation.

Science.gov (United States)

Kuster, Nils; Cristol, Jean-Paul; Cavalier, Etienne; Bargnoux, Anne-Sophie; Halimi, Jean-Michel; Froissart, Marc; Piéroni, Laurence; Delanaye, Pierre

2014-01-20

The National Kidney Disease Education Program group demonstrated that MDRD equation is sensitive to creatinine measurement error, particularly at higher glomerular filtration rates. Thus, MDRD-based eGFR above 60 mL/min/1.73 m² should not be reported numerically. However, little is known about the impact of analytical error on CKD-EPI-based estimates. This study aimed at assessing the impact of analytical characteristics (bias and imprecision) of 12 enzymatic and 4 compensated Jaffe previously characterized creatinine assays on MDRD and CKD-EPI eGFR. In a simulation study, the impact of analytical error was assessed on a hospital population of 24084 patients. Ability using each assay to correctly classify patients according to chronic kidney disease (CKD) stages was evaluated. For eGFR between 60 and 90 mL/min/1.73 m², both equations were sensitive to analytical error. Compensated Jaffe assays displayed high bias in this range and led to poorer sensitivity/specificity for classification according to CKD stages than enzymatic assays. As compared to MDRD equation, CKD-EPI equation decreases impact of analytical error in creatinine measurement above 90 mL/min/1.73 m². Compensated Jaffe creatinine assays lead to important errors in eGFR and should be avoided. Accurate enzymatic assays allow estimation of eGFR until 90 mL/min/1.73 m² with MDRD and 120 mL/min/1.73 m² with CKD-EPI equation. Copyright © 2013 Elsevier B.V. All rights reserved.

Disease-associated mutations identify a novel region in human STING necessary for the control of type I interferon signaling

OpenAIRE

Melki, Isabelle; Rose, Yoann; Uggenti, Carolina; Van Eyck, Lien; Frémond, Marie-Louise; Kitabayashi, Naoki; Rice, Gillian I; Jenkinson, Emma M; Boulai, Anaïs; Jeremiah, Nadia; Gattorno, Marco; Volpi, Sefano; Sacco, Olivero; Terheggen-Lagro, Suzanne W J; Tiddens, Harm A W M

2017-01-01

BACKGROUND: Gain-of-function mutations in transmembrane protein 173 (TMEM173) encoding stimulator of interferon genes (STING) underlie a recently described type I interferonopathy called STING-associated vasculopathy with onset in infancy (SAVI).OBJECTIVES: We sought to define the molecular and cellular pathology relating to 3 individuals variably exhibiting the core features of the SAVI phenotype including systemic inflammation, destructive skin lesions, and interstitial lung disease.METHODS...

Why do physicians prescribe dialysis?

DEFF Research Database (Denmark)

Heaf, James; Petersons, Aivars; Vernere, Baiba

2017-01-01

but was a primary or contributing reason in 69%. The eGFR at DI was 7.2 ±3.4 ml/min/1.73 m2, but varied according to comorbidity and cause of DI. Patients with cachexia, anorexia and pulmonary stasis (34% with heart failure) had the highest eGFR (8.2-9.8 ml/min/1.73 m2), and those with edema, "low GFR...

Measured glomerular filtration rate at dialysis initiation and clinical outcomes of Indian peritoneal dialysis patients

Directory of Open Access Journals (Sweden)

N Prasad

2017-01-01

Full Text Available The optimal time for dialysis initiation remains controversial. Studies have failed to show better outcomes with early initiation of hemodialysis; even a few had shown increased adverse outcomes including poorer survival. Few studies have examined the same in patients on peritoneal dialysis (PD. Measured glomerular filtration rate (mGFR not creatinine-based estimated GFR is recommended as the measure of kidney function in end-stage renal disease (ESRD patients. The objective of this observational study was to compare the outcomes of Indian patients initiated on PD with different residual renal function (RRF as measured by 24-h urinary clearance method. A total of 352 incident patients starting on chronic ambulatory PD as the first modality of renal replacement therapy were followed prospectively. Patients were categorized into three groups as per mGFR at the initiation of PD (≤5, >5–10, and> 10 ml/min/1.73 m2. Patient survival and technique survival were compared among the three groups. Patients with GFR of ≤5 ml/min/1.73 m2 (hazard ratio [HR] - 3.42, 95% confidence interval [CI] - 1.85–6.30, P = 0.000 and> 5–10 ml/min/1.73 m2 (HR - 2.16, 95% CI - 1.26–3.71, P = 0.005 had higher risk of mortality as compared to those with GFR of> 10 ml/min/1.73 m2. Each increment of 1 ml/min/1.73 m2 in baseline GFR was associated with 10% reduced risk of death (HR - 0.90, 95% CI - 0.85–0.96, P = 0.002. Technique survival was poor in those with an initial mGFR of ≤5 ml/min/1.73 m2 as compared to other categories. RRF at the initiation was also an important factor predicting nutritional status at 1 year of follow-up. To conclude, initiation of PD at a lower baseline mGFR is associated with poorer patient and technique survival in Indian ESRD patients.

Contrast-induced nephropathy in patients with chronic kidney disease and peripheral arterial disease

International Nuclear Information System (INIS)

Kroneberger, Christian; Enzweiler, Christian N; Schmidt-Lucke, Andre; Rückert, Ralph-Ingo; Teichgräber, Ulf; Franiel, Tobias

2015-01-01

The risk for contrast-induced nephropathy (CIN) after intra-arterial application of an iodine-based contrast material is unknown for patients with chronic kidney disease (CKD) and peripheral arterial disease (PAD). To investigate the incidence of CIN in patients with CKD and PAD. This retrospective study was approved by the local ethics committee. One hundred and twenty patients with 128 procedures (73 with baseline eGFR in the range of 45–60 mL/min/1.73m 2 , 55 with eGFR < 45 mL/min/1.73m 2 ) were evaluated. All patients received intra-arterially an iodine-based low-osmolar contrast material (CM) after adequate intravenous hydration with isotonic NaCl 0.9% solution. CIN was defined as an increase in serum creatinine of more than 44 μmol/L within 4 days. The influence of patient-related risk factors (age, weight, body mass index, eGFR, serum creatinine, hypertension, diabetes mellitus, coronary heart disease, heart failure) and therapy-related risk factors (amount of CM, nephrotoxic drugs, number of CM applications) on CIN were examined. CIN developed in 0% (0/73) of procedures in patients with PAD and an eGFR in the range of 45–60 mL/min/1.73m 2 and in 10.9% (6/55) of procedures in patients with an eGFR <45 mL/min/1.73m 2 . No risk factor significantly influenced the development of CIN, although baseline serum creatinine (P = 0.06) and baseline eGFR (P = 0.10) showed a considerable dependency. Patients with an eGFR in the range of 45–60 mL/min/1.73m 2 and PAD seem not at risk for CIN after intra-arterial CM application and adequate hydration. Whereas, an eGFR < 45 mL/min/1.73m 2 correlated with a risk of 10.9% for a CIN

Literature survey on epidemiology and pathology of gangliocytic paraganglioma

International Nuclear Information System (INIS)

Okubo, Yoichiro; Sasai, Daisuke; Ishiwatari, Takao; Tsuchiya, Masaru; Hiruta, Nobuyuki; Wakayama, Megumi; Nemoto, Tetsuo; Kitahara, Kanako; Nakayama, Haruo; Shibuya, Kazutoshi; Yokose, Tomoyuki; Yamada, Manabu; Shimodaira, Kayoko

2011-01-01

Although gangliocytic paraganglioma (GP) has generally been regarded as a neuroendocrine tumor, its origin remains unclear. We therefore aimed to investigate the details of this disease by carefully analyzing and extracting common features of the disease as presented in selected publications. We searched for English and Japanese cases of GP using the PubMed and IgakuChuoZasshi databases on August 2010. We then extracted and sampled raw data from the selected publications and performed appropriate statistical analyses. Additionally, we evaluated the expression of hormone receptors based on our previously reported case. 192 patients with GP were retrieved from the databases. Patient ages ranged from 15 y to 84 y (mean: 52.3 y). The gender ratio was 114:76 (male to female, 2 not reported). Maximum diameter of the tumors ranged from 5.5 mm to 100 mm (mean: 25.0 mm). The duodenum (90.1%, 173/192) was found to be the most common site of the disease. In 173 patients with duodenal GP, gastrointestinal bleeding (45.1%, 78/173) was found to be the most common symptom of the disease, followed by abdominal pain (42.8%, 74/173), and anemia (14.5%, 25/173). Rate of lymph node metastasis was 6.9% (12/173). Our statistical analysis indicated that significant differences were found for gender between GP within the submucosal layer and exceeding the submucosal layer. Furthermore, our immunohistochemical evaluation showed that both epithelioid and pancreatic islet cells showed positive reactivity for progesterone receptors. Our literature survey revealed that there were many more cases of GP exceeding the submucosal layer than were expected. Meanwhile, our statistical analyses and immunohistochemical evaluation supported the following two hypotheses. First, vertical growth of GP might be affected by progesterone exposure. Second, the origin of GP might be pancreatic islet cells. However, it is strongly suspected that our data have been affected by publication bias and to confirm

Correlation and clinical significance between glomerular filtration rate and age in living-related kidney donors

International Nuclear Information System (INIS)

Zhao Xiuyi; Shao Yahui; Wang Yanming; Zhang Aimin; Hao Junwen; Tian Jun; Sun Ben; Han Jiankui

2010-01-01

Objective: To quantitatively investigate the effect of age on the glomerular filtration rate (GFR) in living-related kidney donors. to analyze the clinical value and the dependence of GFR on age and to provide an objective basis for the selection of the living kidney donor. Methods: One hundred and sixty-one living-related kidney donors were divided into four age groups, namely 20-29 years (n=52), 30-39 years (n=44), 40-49 years (n=38) and ≥50 years (n=27). On the other hand, the total donors were divided into the groups older than 55 years (n=24) and younger than 55 years (n=137). To quantify GFR in all the subjects using the 99 Tc m -diethylenetriamine pentaacetic acid ( 99 Tc m -DTPA) renography according to standard procedure and to evaluate the effects of age on renal function. Results: The total GFR in living-related kidney donors was calculated as (89.55±12.87) ml·min -1 ·(1.73 m 2 ) -1 . The GFR in the first to the four age groups were (88.27±12.29) ml·min -1 ·(1.73 m 2 ) -1 , (91.85±14.51) ml·min -1 ·(1.73 m 2 ) -1 , (98.25±11.26) ml·min -1 ·(1.73 m 2 ) -1 and (88.24±13.20) ml·min -1 ·(1.73 m 2 ) -1 . The difference of GFR were not significant between the four age groups (F=2.09, P=0.10). The GFR in the donors older than 55 years and younger than 55 years were (88.57±13.14) ml·min -1 ·(1.73 m 2 ) -1 and (89.44±10.34) ml·min -1 ·(1.73 m 2 ) -1 , there no significant difference in GFR between the two groups (F=1.31, P=0.25). When relating GFR to age in all the living-related kidney donors, there was no significant correlation (r=-0.033, P=0.69). No serious complications occurred after living kidney transplantation, serum creatinine values and blood urea nitrogen recovered to the normal levels in a short period, hepatic and renal functions were normal. Conclusion: This study indicated that the GFR values were not correlated with the change of age in living-related kidney donors, and the results were helpful for the selection of living

Predictors of estimated glomerular filtration rate progression, stabilization or improvement after chronic renal impairment in HIV-positive individuals

DEFF Research Database (Denmark)

Ryom, Lene; Mocroft, Amanda; Kirk, Ole

2017-01-01

OBJECTIVES: The objectives of this analysis were to investigate predictors of progression, stabilization or improvement in estimated glomerular filtration rate (eGFR) after development of chronic renal impairment (CRI) in HIV-positive individuals. DESIGN: Prospective observational study. METHODS......: The Data Collection on Adverse events of Anti-HIV Drugs (D:A:D) study participants progressing to CRI defined as confirmed, at least 3 months apart, and eGFR 70 ml/min per 1.73 m or less were included in the analysis. The median of all eGFRs measured 24-36 months post-CRI was compared with the median e......GFR defining CRI, and changes were grouped into improvement (>+10 ml/min per 1.73 m), stabilization (-10 to +10 ml/min per 1.73 m) and progression (

Prediction of two-sample 99mTc-diethylene triamine pentaacetic acid plasma clearance from single-sample method

International Nuclear Information System (INIS)

Zuo Li; Ma Ying-Chun; Wang Mei; Zhang Chun-Li; Wang Rong-Fu; Wang Hai-Yan

2005-01-01

The objective of this study was to develop an equation to predict dual plasma sample method (DPSM) 99m Tc-diethylene triamine pentaacetic acid ( 99m Tc-DTPA) plasma clearance from single plasma sample method (SPSM), and to clarify the condition in which DPSM can be substituted by SPSM in measurement of glomerular filtration rate (GFR). Patients with chronic kidney disease (CKD) were selected. Watson modified Christensen and Groth equation was used to calculate 99m Tc-DTPA plasma clearance by SPSM (sGFR). The equation recommended by the Nephrourology Committee of the Society of Nuclear Medicine was used to calculate 99m Tc-DTPA plasma clearance by DPSM (tGFR) in each patient. The difference between sGFR and tGFR was expressed as percent of the average of these two methods, and tGFR was predicted from sGFR. Plasma creatinine was measured by the kinetic picrate method, and GFR estimated by abbreviated modification of diet in renal disease (MDRD) equation (aGFR) and Cockcroft-Gault equation (cGFR) were evaluated as criteria in selection of DPSM and SPSM. Three hundred and sixty-nine patients with CKD were selected (208 male and 161 female). The average age and body weight were 51.4±15.5 years and 67.2±12.5 kg, respectively. The causes of CKD were glomerular disease, renal arterial stenosis, chronic tubulointerstitial disease, and other causes or causes unknown. The average tGFR was 62.9±36.5 ml/min/1.73 m 2 , ranging from 1-180 ml/min/1.73 m 2 . sGFR was significantly correlated with tGFR (r=0.9194, p 2 ; in contrast, then tGFR was±30 ml/min/1.73 m 2 , the difference was constant (-1.1%, 95% confidence interval -18.3%, 16.1%), and tGFR could be predicted from sGFR using the equation: predicted tGFR (ml/min/1.73 m 2 )=7 4244+0.7318 x sGFR+0.0022 x sGFR 2 (n=299, r 2 =0.9428, p 2 , the diagnostic sensitivity of a cut off value of aGFR=45 ml/min/1.73 m 2 was 91.8%, and recommended as a criterion in the selection of DPSM and SPSM. When GFR ≥30 ml/min/1.73 m 2 , t

Dicty_cDB: AFI173 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available cDNA clone:pph30f12, 3' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration... sequence. 74 3e-09 1 CN206834 |CN206834.1 Tor7258 Gametophyte rehydration Librar

49 CFR 173.199 - Category B infectious substances.

Science.gov (United States)

2010-10-01

... this section; (ii) Anticoagulants used to stabilize blood or plasma; or (iii) Small quantities of Class... copy or electronic image of these instructions must be retained by the manufacturer and subsequent...

173 original article glycated haemoglobin levels in patients

African Journals Online (AJOL)

boaz

therapy, two patients had pre-diabetes with HbA1c values of 6.0% and 5.8% while the HbA1c values of the remaining patients were less than .... determined by the blood glucose levels in the .... treatment of MDR-TB on glycaemic homeostasis.

21 CFR 173.325 - Acidified sodium chlorite solutions.

Science.gov (United States)

2010-04-01

... processing of red meat, red meat parts, and organs as a component of a spray or in the processing of red meat... rinse prior to consumption. (2) The additive is used as a single application in processing facilities as... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR...

49 CFR 173.21 - Forbidden materials and packages.

Science.gov (United States)

2010-10-01

... stabilized or inhibited in a manner to preclude such evolution. The SADT may be determined by any of the test... generate a dangerous evolution of heat, unless packaged in a manner which precludes such an occurrence. (d... container, or overpack with another material, the mixing of which is likely to cause a dangerous evolution...

What we do | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

IDRC supports research in developing countries to create real and lasting change. ... Community Based Governance of Wetlands in the Sand River Catchment Area (South Africa) ... Sri Lanka, Central Asia, Far East Asia, South Asia. PROJECT ...

40 CFR 180.173 - Ethion; tolerances for residues.

Science.gov (United States)

2010-07-01

..., meat 0.2 10/1/08 Hog, meat byproducts 0.2 10/1/08 Horse, fat 0.2 10/1/08 Horse, meat 0.2 10/1/08 Horse...: Commodity Parts per million Expiration/Revocation Date Cattle, fat 0.2 10/1/08 Cattle, meat 0.2 10/1/08 Cattle, meat byproducts 0.2 10/1/08 Citrus, dried pulp 25.0 10/1/08 Fruit, citrus, group 10 5.0 10/1/08...

21 CFR 173.150 - Milk-clotting enzymes, microbial.

Science.gov (United States)

2010-04-01

...; family, Bacillaceae; genus, Bacillus; species, cereus (Frankland and Frankland). (3) Mucor pusillus Lindt...; genus, Mucor; species, pusillus; variety, Lindt. (4) Mucor miehei Cooney et Emerson classified as follows: Class, Phycomycetes; subclass, Zygomycetes; order, Mucorales; family, Mucoraceae; genus, Mucor...

Dicty_cDB: VSF173 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

49 CFR 173.196 - Category A infectious substances.

Science.gov (United States)

2010-10-01

... temperatures and pressures of transport by aircraft to which they could be subjected if refrigeration were lost... pressure producing a pressure differential of not less than 95 kPa (0.95 bar, 14 psi). (7) The primary... well as the temperatures and pressures of transport by aircraft to which they could be subjected if...

173 Christian Missionaries and Civilization in Southern Nigeria ...

African Journals Online (AJOL)

NGOZI

and Christianity into the interiors of West Africa during their civilizing mission in 1841” (p. 87). ... record that civilization in Nigeria started around the mission houses. .... the advent of the missionaries slavery was rampant among the people of ...

34 CFR 403.173 - What expenses are allowable?

Science.gov (United States)

2010-07-01

... ADULT EDUCATION, DEPARTMENT OF EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What... coordination between vocational education programs, business, and industry, including advisory council meetings...

What we do | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Learning Initiatives for Network Economies in Asia (LIRNEasia) : Building Capacity in ICT Policy. It is now generally accepted that affordable, effective telecommunication services play an integral role in development. Central Asia, Far East Asia, South Asia, Cambodia, Sri Lanka, Indonesia, Laos, Pakistan, Philippines.

49 CFR 173.417 - Authorized fissile materials packages.

Science.gov (United States)

2010-10-01

... for export and import shipments. (2) A residual “heel” of enriched solid uranium hexafluoride may be... made in accordance with Table 2, as follows: Table 2—Allowable Content of Uranium Hexafluoride (UF6... Liters Cubic feet Maximum Uranium 235-enrichment (weight)percent Maximum “Heel” weight per cylinder UF6...

South of Sahara | Page 173 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Language French. Read more about Le partenariat mondial sur les données ouvertes pour le développement. Language French. Read more about Renforcement des capacités de recherche en agriculture visant le développement en Afrique subsaharienne. Language French. Read more about Soutien organisationnel de ...

Road Materials and Pavement Design, Volume 17(3)

CSIR Research Space (South Africa)

De Beer, Morris

2016-03-01

Full Text Available Environment, Pretoria, South Africa Jo Sias Daniel - University of New Hampshire, USA Zhongyin Guo - Tongji University, Shanghai, P.R. of China Kwang W. Kim - Kangwon National University, Republic of Korea Niki Kringos - KTH Royal Institute of Technology...

Levee Setbacks: An Innovative, Cost Effective, and Sustainable Solution for Improved Flood Risk management

Science.gov (United States)

2017-06-30

ER D C/ EL S R- 17 -3 Levee Setbacks: An Innovative , Cost-Effective, and Sustainable Solution for Improved Flood Risk Management En vi...EL SR-17-3 June 2017 Levee Setbacks: An Innovative , Cost-Effective, and Sustainable Solution for Improved Flood Risk Management David L. Smith...alternative view point is necessary. ERDC/EL SR-17-3 4 Levee setbacks are a relatively recent innovation in Corps flood risk management practice

Glomerular filtration rate estimation from plasma creatinine after inhibition of tubular secretion: relevance of the creatinine assay.

Science.gov (United States)

Kemperman, F A; Silberbusch, J; Slaats, E H; van Zanten, A P; Weber, J A; Krediet, R T; Arisz, L

1999-05-01

Estimation of glomerular filtration rate (GFR) from plasma creatinine concentration after inhibition of tubular creatinine secretion with cimetidine provides a good assessment in patients with various nephropathies and with non-insulin-dependent diabetes mellitus (NIDDM). The aim of this study was to compare cimetidine-aided GFR estimations using various creatinine assays. In 30 outpatients with NIDDM GFR was measured as the urinary clearance of continuously infused [125I]iothalamate. Plasma creatinine concentration was analysed after oral cimetidine with an alkaline picrate (AP) method, with an enzymatic (PAP) assay and with HPLC. GFR estimations were calculated with the Cockcroft Gault formula (CG). AP creatinine concentrations were significantly higher than PAP or HPLC values. GFR estimations by AP (CG(AP) 66 +/- 19 ml/min/1.73 m2, mean SD) were significantly lower than GFR (89 +/- 30), whereas CG(PAP) (85 +/- 30) and CG(HPLC) (84 +/- 34 ml/min/1.73 m2) were not. Bland and Altman analysis showed a difference between CG(AP) and GFR of -22.4 +/- 17.7 ml/min/1.73 m2; this difference becomes larger when the GFR increases. The difference between CG and GFR was only -3.8 +/- 14.8 ml/min/1.73 m2 for PAP and -4.4 +/- 17.5 ml/min/1.73 m2 for HPLC, without any systematic difference. A good assessment of the GFR from plasma creatinine after cimetidine administration is possible when creatinine is measured with an enzymatic assay or with the less convenient HPLC method. The more widespread and cheaper alkaline picrate assay is not suitable for GFR-estimation.

Assorted Processing of Synthetic Trans-Acting siRNAs and Its Activity in Antiviral Resistance.

Science.gov (United States)

Zhao, Mingmin; San León, David; Mesel, Frida; García, Juan Antonio; Simón-Mateo, Carmen

2015-01-01

The use of syn-tasiRNAs has been proposed as an RNA interference technique alternative to those previously described: hairpin based, virus induced gene silencing or artificial miRNAs. In this study we engineered the TAS1c locus to impair Plum pox virus (PPV) infection by replacing the five native siRNAs with two 210-bp fragments from the CP and the 3´NCR regions of the PPV genome. Deep sequencing analysis of the small RNA species produced by both constructs in planta has shown that phased processing of the syn-tasiRNAs is construct-specific. While in syn-tasiR-CP construct the processing was as predicted 21-nt phased in register with miR173-guided cleavage, the processing of syn-tasiR-3NCR is far from what was expected. A 22-nt species from the miR173-guided cleavage was a guide of two series of phased small RNAs, one of them in an exact 21-nt register, and the other one in a mixed of 21-/22-nt frame. In addition, both constructs produced abundant PPV-derived small RNAs in the absence of miR173 as a consequence of a strong sense post-transcriptional gene silencing induction. The antiviral effect of both constructs was also evaluated in the presence or absence of miR173 and showed that the impairment of PPV infection was not significantly higher when miR173 was present. The results show that syn-tasiRNAs processing depends on construct-specific factors that should be further studied before the so-called MIGS (miRNA-induced gene silencing) technology can be used reliably.

Assorted Processing of Synthetic Trans-Acting siRNAs and Its Activity in Antiviral Resistance.

Directory of Open Access Journals (Sweden)

Mingmin Zhao

Full Text Available The use of syn-tasiRNAs has been proposed as an RNA interference technique alternative to those previously described: hairpin based, virus induced gene silencing or artificial miRNAs. In this study we engineered the TAS1c locus to impair Plum pox virus (PPV infection by replacing the five native siRNAs with two 210-bp fragments from the CP and the 3´NCR regions of the PPV genome. Deep sequencing analysis of the small RNA species produced by both constructs in planta has shown that phased processing of the syn-tasiRNAs is construct-specific. While in syn-tasiR-CP construct the processing was as predicted 21-nt phased in register with miR173-guided cleavage, the processing of syn-tasiR-3NCR is far from what was expected. A 22-nt species from the miR173-guided cleavage was a guide of two series of phased small RNAs, one of them in an exact 21-nt register, and the other one in a mixed of 21-/22-nt frame. In addition, both constructs produced abundant PPV-derived small RNAs in the absence of miR173 as a consequence of a strong sense post-transcriptional gene silencing induction. The antiviral effect of both constructs was also evaluated in the presence or absence of miR173 and showed that the impairment of PPV infection was not significantly higher when miR173 was present. The results show that syn-tasiRNAs processing depends on construct-specific factors that should be further studied before the so-called MIGS (miRNA-induced gene silencing technology can be used reliably.

Chronic kidney disease, 24-h blood pressure and small vessel diseases are independently associated with cognitive impairment in lacunar infarct patients

International Nuclear Information System (INIS)

Yamamoto, Yasumasa; Ohara, Tomoyuki; Nagakane, Yoshinari; Tanaka, Eijiro; Morii, Fukiko; Koizumi, Takashi; Akiguchi, Ichiro

2011-01-01

Although the relationships between chronic kidney disease (CKD) and cognitive impairment (CI) have been highlighted, the etiology of CI in CKD remains uncertain. Subjects comprised 224 consecutive patients with symptomatic lacunar infarction who underwent magnetic resonance imaging and ambulatory blood pressure monitoring (ABPM). Diurnal blood pressure (BP) patterns were categorized into three groups: dippers, non-dippers and risers. Lacunar infarcts (LIs), including both symptomatic and silent and diffuse white matter lesions (WMLs), were graded into three grades according to their degree. The results of kidney function were evaluated using estimated glomerular filtration rate (eGFR), categorized into three groups: stage 1, >60; stage 2, 30-60; and stage 3, -1 per 1.73 m 2 . There were 44 patients with CI. Confluent WMLs, including WML 2 and WML 3, were found in 36 patients (81.8%), and multiple lacunae including LI 2 and LI 3 were found in 30 patients (68.1%) with CI. Age >75 years (odds ratio (OR), 5.5; P -1 per 1.73 m 2 (OR, 2.9; P -1 per 1.73 m 2 (OR, 23.8; P 75 years (OR, 4.1; P -1 per 1.73 m 2 (OR, 3.7; P -1 per 1.73 m 2 (OR, 8.7; P<0.05) were independently associated with WML grade 3. Extensive small vessel diseases, CKD and non-dipping status were independently associated with CI. CKD appears to mainly contribute to vascular CI, whereas possibilities of overlapping with other mechanisms such as degenerative CI cannot be excluded. Strict night time BP control and renoprotective treatment may be warranted to prevent CI. (author)

Lanthanum(III) and Lutetium(III) in Nitrate-Based Ionic Liquids: A Theoretical Study of Their Coordination Shell.

Science.gov (United States)

Bodo, Enrico

2015-09-03

By using ab initio molecular dynamics, we investigate the solvent shell structure of La(3+) and Lu(3+) ions immersed in two ionic liquids, ethylammonium nitrate (EAN) and its hydroxy derivative (2-ethanolammonium nitrate, HOEAN). We provide the first study of the coordination properties of these heavy metal ions in such a highly charged nonacqueous environment. We find, as expected, that the coordination in the liquid is mainly due to nitrate anions and that, due to the bidentate nature of the ligand, the complexation shell of the central ion has a nontrivial geometry and a coordination number in terms of nitrate molecules that apparently violates the decrease of ionic radii along the lanthanides series, since the smaller Lu(3+) ion seems to coordinate six nitrate molecules and the La(3+) ion only five. A closer inspection of the structural features obtained from our calculations shows, instead, that the first shell of oxygen atoms is more compact for Lu(3+) than for La(3+) and that the former coordinates 8 oxygen atoms while the latter 10 in accord with the typical lanthanide's trend along the series and that their first solvation shells have a slight irregular and complex geometrical pattern. When moving to the HOEAN solutions, we have found that the solvation of the central ion is possibly also due to the cation itself through the oxygen atom on the side chain. Also, in this liquid, the coordination numbers in terms of oxygen atoms in both solvents is 10 for La(3+) and 8 for Lu(3+).

Controllable synthesis of Eu{sup 3+}/Tb{sup 3+} activated lutetium fluorides nanocrystals and their photophysical properties

Energy Technology Data Exchange (ETDEWEB)

Lin, Jintai; Huo, Jiansheng [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Cai, Yuepeng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangdong Technology Research Center for Ecological Management and Remediation of Urban Water System, Guangzhou 510006 (China)

2013-12-15

In this paper, phosphors of LuF{sub 3}:Eu{sup 3+}/Tb{sup 3+} have been successfully synthesized with small chelator ethylenediaminetetra acetic acid (EDTA) or amphiphilic polymer (polyethylene glycol, PEG-1000) as templates via a hydrothermal method. X-ray powder diffraction (XRD), scanning electronic microscope (SEM), and photo-luminescent spectra techniques (PL) were used to characterize the as-prepared samples. XRD patterns showed that well crystallized lanthanide fluorides with hexagonal phase were achieved. SEM images revealed that different regular microstructures were achieved. The photo-luminescent properties of LuF{sub 3}:Eu{sup 3+} demonstrated that there are significant energy transfers from fluorides to Eu{sup 3+}. The results presented that EDTA as the template will lead to the highest emission intensities. -- Highlights: • Various templates were used to synthesize LuF{sub 3}:Eu{sup 3+}/Tb{sup 3+}. • All the phosphors were red or green emissive. • Different morphologies were acquired and controllable.

Hanford Patrol Academy Demolition Sites Closure Plan

International Nuclear Information System (INIS)

1992-11-01

From 1975 to 1991 the Hanford Patrol Academy Demolition Sites (HPADS) were used for demolition events. These demolition events were a form of thermal treatment for spent or abandoned chemical waste. Because the HPADS will no longer be used for this thermal activity, the sites will be closed. Closure will be conducted pursuant to the requirements of the Washington State Department of Ecology (Ecology) Dangerous Waste Regulations, Washington Administrative Code (WAC) 173-303-610 and 40 CFR 270.1. Closure also will satisfy closure requirements of WAC 173-303-680 and for the thermal treatment closure requirements of 40 CFR 265.381. This closure plan presents a description of the HPADS, the history of the waste treated, and the approach that will be followed to close the HPADS. Because dangerous waste does not include the source, special nuclear, and by-product material components of mixed waste, radionuclides are not within the scope of WAC 173-303 or of this closure plan. The information on radionuclides is provided only for general knowledge where appropriate. Only dangerous constituents derived from HPADS operations will be addressed in this closure plan in accordance with WAC 173-303-610(2)(b)(i). The HPADS are actually two distinct soil closure areas within the Hanford Patrol Academy training area

. Chronic kidney disease in patients with chronic back pain taking non-steroidal anti-inflammatory drugs

Directory of Open Access Journals (Sweden)

Gaydukova I.Z.

2016-03-01

in patients with ax-SpA, DDS and controls were comparable. The activity of pain was evaluated according to the accepted recommendations. The index of NSAID intake as calculated for the preceding year. Results. GFR in patients with ax-SpAwas 87,0 [77,25; 102,0] ml/min/1,73 m2, 11 (18% patients showed a reduction in GFR of less than 60 ml/ min/1,73m2. In patients with DDS GFR was 87,5 [65,5; 97,0] ml/min / 1,73 m 2 (p=0,27, decreased GFR of less than 60 ml/min / 1,73 m2 was detected in 3 (15% patients. The ratio of albumin / creatinine urine in patients with ax-SpA was 35,8 [25,46; 43,4] mg/g, in patients DDS —207,1 [91,66; 244,59] mg/g (p<0,0001, in healthy individuals —25,45 [17,34; 33,65] mg/g. Conclusions. Patients with chronic back pain taking NSAIDs for a long time have revealed GFR, comparable with healthy people, and increased urine albumin. Patients with degenerative diseases of the spine have a greater index of albumin in urine than patients with ax-SpA.

Effect of enalapril on the progression of chronic renal failure. A randomized controlled trial

DEFF Research Database (Denmark)

Kamper, A L; Strandgaard, S; Leyssac, P P

1992-01-01

In order to study the influence of angiotensin converting enzyme (ACE) inhibition on the progression of chronic nephropathy, 70 patients with a median glomerular filtration rate (GFR) of 15 (range, 6 to 54) mL/min/1.73 m2 were randomized in an open study to basic treatment with enalapril or conve......In order to study the influence of angiotensin converting enzyme (ACE) inhibition on the progression of chronic nephropathy, 70 patients with a median glomerular filtration rate (GFR) of 15 (range, 6 to 54) mL/min/1.73 m2 were randomized in an open study to basic treatment with enalapril...... or conventional antihypertensive treatment. The patients were followed for at least 2 years or until they needed dialysis. The groups were comparable with respect to age and sex distribution, etiology of renal diseases, initial levels of renal function and arterial blood pressure (BP), and protein intake.......18 to -7.11) mL/min/1.73 m2/month and in the control group it was -0.31 (+0.01 to -1.97) mL/min/1.73 m2/month (P less than .05). There was no significant difference in blood pressure or plasma lipid levels between the groups. Thus, the progression of moderate to severe chronic nephropathy was slower...

Comparison of Cockcroft-Gault and modification of diet in renal disease formulas as predictors of cardiovascular outcomes in patients with myocardial infarction treated with primary percutaneous coronary intervention.

Science.gov (United States)

Ekmekci, Ahmet; Uluganyan, Mahmut; Gungor, Baris; Tufan, Fatih; Cekirdekci, Elif Iclal; Ozcan, Kazim Serhan; Erer, Hatice Betul; Orhan, Ahmet; Osmanov, Damir; Bozbay, Mehmet; Cicek, Gokhan; Sayar, Nurten; Eren, Mehmet

2014-10-01

We prospectively assessed the value of estimated glomerular filtration rate (eGFR) by the Modification of Diet in Renal Disease (MDRD) and Cockcroft-Gault (C-G) equations in predicting inhospital adverse outcomes after primary coronary intervention for acute ST-segment elevation myocardial infarction. We classified 647 patients into 3 categories according to eGFR, 90 mL/min/1.73 m(2). The eGFRC-G classified 17 patients in the >90 mL/min/1.73 m(2) subgroup and 6 and 11 patients in the 60 to 90 and 90 mL/min/1.73 m(2) (P = .01 and P = .01, respectively); the eGFRMDRD was not predictive. Although the MDRD equation more accurately estimates GFR in certain populations, the CG formula may be a better predictor of adverse events. © The Author(s) 2013.

Surface of Ti-Ni alloys after their preparation

International Nuclear Information System (INIS)

Saldan, I.; Frenzel, J.; Shekhah, O.; Chelmowski, R.; Birkner, A.; Woell, Ch.

2009-01-01

The Ti 3.87 Ni 1.73 Fe 0.7 O 0.3, Ti 3.87 Ni 1.73 Fe 0.4 N 0.3 and Ti 3.87 Ni 1.73 Fe 0.4 C 0.3 alloys were investigated regarding their surface characteristics. The scanning electron microscopy (SEM) equipped with energy dispersive X-ray spectroscopy (EDS) was used for phase characterization. The X-ray photoelectron spectroscopy (XPS) was used to analyze the chemical composition of alloy surface. The atomic force microscopy (AFM) to observe alloy surface topography after cutting and electrochemical polishing separately has been done. The transmission electron microscopy (TEM) with X-ray diffraction was carried out to get a high contrast images and the diffraction pattern from alloy surface. The results clearly shown, that all alloys were multiphase, and their surface was totally oxidized with no pure metals

Effect of high temperatures on cement composite materials in concrete structures

Czech Academy of Sciences Publication Activity Database

Bodnárová, L.; Válek, J.; Sitek, Libor; Foldyna, Josef

2013-01-01

Roč. 10, č. 2 (2013), s. 173-180 ISSN 1214-9705 R&D Projects: GA MŠk ED2.1.00/03.0082; GA ČR GAP104/12/1988 Institutional support: RVO:68145535 Keywords : high temperature * load resistance * concrete * reinforcing of mine works * fiber reinforcement Subject RIV: JJ - Other Materials Impact factor: 0.667, year: 2013 http://www.irsm.cas.cz/materialy/acta_content/2013_02/acta_170_06_Bodnirovi_173-180.pdf

Characterization of potassic materials of Pocos de Caldas alkaline massif, Southeastern Brazil; Caracterizacao de materiais potassicos do macico alcalino de Pocos de Caldas (MG)

Energy Technology Data Exchange (ETDEWEB)

Goncalves, P.; Navarro, F.C.; Roveri, C.D. [Universidade Federal de Alfenas (UNIFAL), MG (Brazil); Bergerman, M.G., E-mail: pattypgpatty@gmail.com [Universidade de Sao Paulo (USP), SP (Brazil)

2016-07-01

Potassium, which has featured in Brazil's agricultural sector and in the world's in the application of fertilizers, is present in magmatic rocks, such as nepheline syenite and phonolite, found in the Alkaline Massif of Pocos de Caldas (AMPC). The rare earth elements (REE), in turn, also occur in this region and have important uses in various industrial fields. The aim of this study was to investigate the potential of potassic rocks of AMPC in the fertilizer and rare earths industry. Five samples were collected and characterized. It was observed that there was no preferential concentration by granulometric range of potassium oxide, alumina, silica and iron oxide. Feldspathic mass, potash feldspar, and muscovite were found in all samples. The samples show REE with amounts greater than those found in the earth's crust, except for lutetium and scandium and possessed average content of potassium oxide from 8.70 to 14.40%. (author)

Structural, mechanical and light yield characterisation of heat treated LYSO:Ce single crystals for medical imaging applications

CERN Document Server

Mengucci, P; Auffray, E; Barucca, G; Cecchi, C; Chipaux, R; Cousson, A; Davì, F; Di Vara, N; Rinaldi, D; Santecchia, E

2015-01-01

Five single crystals of cerium-doped lutetium yttrium oxyorthosilicate (LYSO:Ce) grown by the Czochralski method were submitted to structural characterisation by X-ray (XRD) and neutron (ND) diffraction, scanning (SEM) and transmission (TEM) electron microscopy and energy dispersive microanalysis (EDS). The Ultimate Tensile Strength (UTS), the Young Modulus (YM) and the Light Yield (LY) of the samples were also measured in order to correlate the mechanical and the optical behaviour of the crystals with the characteristics of their microstructure. Two of the samples analysed were also heat treated at 300 °C for 10 h to evidence possible variations induced by the temperature in the optical and mechanical response of the crystals. Results showed that the mean compositional variations evidenced by the structural analyses do not affect the mechanical and optical behaviour of the samples. On the contrary, the thermal treatment could induce the formation of coherent spherical particles (size 10 to 15 nm), not unifo...

Uranium hydrogeochemical and stream sediment reconnaissance of the Bozeman NTMS quadrangle, Montana, including concentrations of forty-two additional elements

International Nuclear Information System (INIS)

Bolivar, S.L.; Hensley, W.K.; Van Haaften, I.J.; Pirtle, J.; George, W.E.; Gallimore, D.; Apel, C.; Hansel, J.

1980-07-01

This report contains uranium analyses for 1251 water samples and multielement analyses for 1536 sediment samples. Sediments were analyzed for uranium and thorium as well as aluminum, antimony, barium, beryllium, bismuth, cadmium, calcium, cerium, cesium, chlorine, chromium, cobalt, copper, dysprosium, europium, gold, hafnium, iron, lanthanum, lead, lithium, lutetium, magnesium, manganese, nickel, niobium, potassium, rubidium, samarium, scandium, silver, sodium, strontium, tantalum, terbium, tin, titanium, tungsten, vanadium, ytterbium, and zinc. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than 40 ppB uranium were reanalyzed by delayed-neutron counting (DNC). All sediments were analyzed for uranium by DNC. Other elemental concentrations in sediments were determined by neutron activation analysis for 31 elements, by x-ray fluorescence for 9 elements, and by arc-source emission spectrography for 2 elements. Analytical results for sediments are reported as parts per million. Descriptions of procedures used for analysis of water and sediment samples as well as analytical precisions and detection limits are given

Performance study of Philips digital silicon photomultiplier coupled to scintillating crystals

CERN Document Server

Liu, Z.; Auffray, E.; Lecoq, P.; Paganoni, M.

2016-01-01

Silicon photomultipliers (SiPMs) and scintillators are often arranged in the shape of arrays in Positron Emission Tomography (PET) systems. Digital SiPMs provide signal readout in single photon avalanche diode (SPAD) level. From the photon count rate measurement of each SPAD cell of digital SiPM, we found that the output scintillating photons distribute in an area larger than the scintillator physical coupling area. Taking advantage of the possibility to enable/disable individual cells of the digital SiPM, a group of Lutetium-yttrium oxyorthosilicate (LYSO) crystals with different dimensions coupled to a digital SiPM was used to study the influence of using different SiPM active area on the number of photons detected, energy resolution and coincidence time resolution (CTR). For the same crystal coupled to the digital SiPM, the larger the active area of digital SiPM, the higher the number of photons detected. The larger active area of the digital SiPM also results in a better energy resolution after saturation...

Investigation of microscopic radiation damage in waste forms using ODNMR and AEM techniques. (EMSP Project Final Report)

International Nuclear Information System (INIS)

Liu, G.; Luo, J.; Beitz, J.; Li, S.; Williams, C.; Zhorin, V.

2000-01-01

This project seeks to understand the microscopic effects of radiation damage in nuclear waste forms. The authors' approach to this challenge encompasses studies of ceramics and glasses containing short-lived alpha- and beta-emitting actinides with electron microscopy, laser and X-ray spectroscopic techniques, and computational modeling and simulations. In order to obtain information on long-term radiation effects on waste forms, much of the effort is to investigate α-decay induced microscopic damage in 18-year old samples of crystalline yttrium and lutetium orthophosphates that initially contained ∼ 1(wt)% of the alpha-emitting isotope 244 Cm (18.1 y half life). Studies also are conducted on borosilicate glasses that contain 244 Cm, 241 Am, or 249 Bk, respectively. The authors attempt to gain clear insights into the properties of radiation-induced structure defects and the consequences of collective defect-environment interactions, which are critical factors in assessing the long-term performance of high-level nuclear waste forms

Scandium, yttrium and the lanthanide metals

International Nuclear Information System (INIS)

Brown, Paul L.; Ekberg, Christian

2016-01-01

The hydroxide and oxide phases that exist for scandium(III) include scandium hydroxide, which likely has both amorphous and crystalline forms, ScOOH(s), and scandium oxide. This chapter presents the data selected for the stability constants of the polymeric hydrolysis species of scandium at zero ionic strength. The behaviour of yttrium, and the lanthanide metals, in the environment is largely dependent on their solution equilibria. Hydrolysis and other complexation reactions of yttrium and the lanthanide metals are important in the disposal of nuclear waste. The trivalent lanthanide metals include lanthanum(III) through lutetium(III). A number of studies have reported a tetrad effect for the geochemical behaviour of the lanthanide series, including stability constants and distribution coefficients. The solubility of many of the lanthanide hydroxide phases has been studied at fixed ionic strength. In studying the hydrolysis of cerium(IV), a number of studies have utilised oxidation-reduction reactions in determining the relevant stability constants.

First ionization potential of the heaviest actinide lawrencium, element 103

Directory of Open Access Journals (Sweden)

Sato Tetsuya K.

2016-01-01

Full Text Available The first ionization potential (IP1 of element 103, lawrencium (Lr, has been successfully determined for the first time by using a newly developed method based on a surface ionization process. The measured IP1 value is 4.9630.080.07 eV. This value is the smallest among those of actinide elements and is in excellent agreement with the value of 4.963(15 eV predicted by state-of-the-art relativistic calculations also performed in this work. Our results strongly support that the Lr atom has an electronic configuration of [Rn]7s25f147p11/2, which is influenced by strong relativistic effects. The present work provides a reliable benchmark for theoretical calculations and also opens the way for studies on atomic properties of heavy elements with atomic number Z > 100. Moreover, the present achievement has triggered a controversy on the position of lutetium (Lu and Lr in the Periodic Table of Elements.

Labeling of DOTA-conjugated HPMA-based polymers with trivalent metallic radionuclides for molecular imaging.

Science.gov (United States)

Eppard, Elisabeth; de la Fuente, Ana; Mohr, Nicole; Allmeroth, Mareli; Zentel, Rudolf; Miederer, Matthias; Pektor, Stefanie; Rösch, Frank

2018-02-27

In this work, the in vitro and in vivo stabilities and the pharmacology of HPMA-made homopolymers were studied by means of radiometal-labeled derivatives. Aiming to identify the fewer amount and the optimal DOTA-linker structure that provides quantitative labeling yields, diverse DOTA-linker systems were conjugated in different amounts to HPMA homopolymers to coordinate trivalent radiometals Me(III)* = gallium-68, scandium-44, and lutetium-177. Short linkers and as low as 1.6% DOTA were enough to obtain labeling yields > 90%. Alkoxy linkers generally exhibited lower labeling yields than alkane analogues despite of similar chain length and DOTA incorporation rate. High stability of the radiolabel in all examined solutions was observed for all conjugates. Labeling with scandium-44 allowed for in vivo PET imaging and ex vivo measurements of organ distribution for up to 24 h. This study confirms the principle applicability of DOTA-HPMA conjugates for labeling with different trivalent metallic radionuclides allowing for diagnosis and therapy.

Studies on sampling and homogeneous dual readout calorimetry with meta-crystals

CERN Document Server

Mavromanolakis, G; Lecoq, P

2011-01-01

The meta-crystals concept is an approach that consists of using both undoped and properly doped heavy crystal fibers of identical material as the active medium of a calorimeter. The undoped fibers behave as Cherenkov radiators while the doped ones behave as scintillators. A dual readout calorimeter can be built with its sensitive volume composed of a mixture of both types of crystals. In addition if the calorimeter is adequately finely segmented it can also function as a particle flow calorimeter at the same time. In this way one could possibly combine the advantages of both the particle flow concept and the dual readout scheme. We discuss the approach of dual readout calorimetry with meta-crystals made of Lutetium Aluminium Garnet (LuAG). We brie fly present studies on the material development and first testbeam activities and then focus on performance expectation studies based on simulation. We discuss in more detail the results from generic systematic scannings of the design parameters of a dual readout ca...

Luminescent lanthanide reporters: new concepts for use in bioanalytical applications

International Nuclear Information System (INIS)

Vuojola, Johanna; Soukka, Tero

2014-01-01

Lanthanides represent the chemical elements from lanthanum to lutetium. They intrinsically exhibit some very exciting photophysical properties, which can be further enhanced by incorporating the lanthanide ion into organic or inorganic sensitizing structures. A very popular approach is to conjugate the lanthanide ion to an organic chromophore structure forming lanthanide chelates. Another approach, which has quickly gained interest, is to incorporate the lanthanide ions into nanoparticle structures, thus attaining improved specific activity and a large surface area for biomolecule immobilization. Lanthanide-based reporters, when properly shielded from the quenching effects of water, usually express strong luminescence emission, multiple narrow emission lines covering a wide wavelength range, and exceptionally long excited state lifetimes enabling time-gated luminescence detection. Because of these properties, lanthanide-based reporters have found widespread applications in various fields of life. This review focuses on the field of bioanalytical applications. Luminescent lanthanide reporters and assay formats utilizing these reporters pave the way for increasingly sensitive, simple, and easily automated bioanalytical applications. (topical review)

Investigation of microscopic radiation damage in waste forms using ODNMR and AEM techniques. (EMSP Project Final Report)

Energy Technology Data Exchange (ETDEWEB)

Liu, G.; Luo, J.; Beitz, J.; Li, S.; Williams, C.; Zhorin, V.

2000-04-21

This project seeks to understand the microscopic effects of radiation damage in nuclear waste forms. The authors' approach to this challenge encompasses studies of ceramics and glasses containing short-lived alpha- and beta-emitting actinides with electron microscopy, laser and X-ray spectroscopic techniques, and computational modeling and simulations. In order to obtain information on long-term radiation effects on waste forms, much of the effort is to investigate {alpha}-decay induced microscopic damage in 18-year old samples of crystalline yttrium and lutetium orthophosphates that initially contained {approximately} 1(wt)% of the alpha-emitting isotope {sup 244}Cm (18.1 y half life). Studies also are conducted on borosilicate glasses that contain {sup 244}Cm, {sup 241}Am, or {sup 249}Bk, respectively. The authors attempt to gain clear insights into the properties of radiation-induced structure defects and the consequences of collective defect-environment interactions, which are critical factors in assessing the long-term performance of high-level nuclear waste forms.

Faktor Risiko Penyakit Ginjal Kronik Berdasarkan Analisis Cross-sectional Data Awal Studi Kohort Penyakit Tidak Menular Penduduk Usia 25-65 Tahun di Kelurahan Kebon Kalapa, Kota Bogor Tahun 2011

Directory of Open Access Journals (Sweden)

Eva Sulistiowati

2015-11-01

Full Text Available AbstractGlomerular Filtration Rate (GFR is associated with renal function and used to diagnose Chronic Kidney Disease (CKD. CKD is considered a serious worldwide public health problem, and the prevalence is increasing dramatically. The aim of the analisis is to explore of the factors associated with estimated Glomerular Filtration Rate (eGFR. This analysis used subset baseline data Cohort Study Non-Communicable Diseases (NCD 2011 with a cross-sectional design. CKD was defined as those withan estimated glomerular filtration rate (eGFR <60 mL/min/1.73 m2. We analyzed of 1932 subjects (820 males and 1112 females aged 25-65 years old. GFR was estimated by using calibrated serum creatinine level with a formula CKD-epi, devided into ≥60 mL/min/1.73 m2 and <60 mL/min/1.73 m2. Subject with e-GFR <60 mL/min/1.73 m2 was 2,3%, and increased remarkably with age. Multivariate logistic regression analysis demonstrated that age of 49-65 years (OR=13.57; 95% CI: 4.73-38.97,economic status quintile 1 (OR=4.44; 95% CI: 1.14-17.39, hipertension (OR=3.71;95% CI: 1.82-7.59, male gender (OR=2.97; 95% CI: 1.49-5.92, diabetes mellitus (OR=2.54; 95% CI=1.24-5.20, obesity(OR=2.51; 95% CI: 1.20-5.25, were significant factors that were independently associated with CKD.Keywords : risk factors; glomerular filtration rate; CKDAbstrakLaju filtrasi glomerulus (LFG berhubungan dengan kondisi fungsi ginjal dan digunakan sebagai penentu diagnosis Penyakit Ginjal Kronik (PGK. PGK merupakan masalah kesehatan yang serius dan prevalensinya meningkat secara drastis. Tujuan analisis ini untuk mengetahui faktor yang berhubungan dengan PGK. Data diambil dari subset data Studi Kohor Penyakit Tidak Menular (PTM di Kota Bogor Tahun 2011, menggunakan disain analisis potong lintang. Subjek yang dianalis berjumlah 1932 orang(1112 perempuan dan 820 laki-laki berumur 25-65 tahun. LFG diklasifikasikan menurut estimasi LFG (e-LFG berdasarkan kriteria CKD-epi, dengan kategori ≥60 mL/min/1,73 m2

Compensatory Structural and Functional Adaptation after Radical Nephrectomy for Renal Cell Carcinoma According to Preoperative Stage of Chronic Kidney Disease.

Science.gov (United States)

Choi, Don Kyoung; Jung, Se Bin; Park, Bong Hee; Jeong, Byong Chang; Seo, Seong Il; Jeon, Seong Soo; Lee, Hyun Moo; Choi, Han-Yong; Jeon, Hwang Gyun

2015-10-01

We investigated structural hypertrophy and functional hyperfiltration as compensatory adaptations after radical nephrectomy in patients with renal cell carcinoma according to the preoperative chronic kidney disease stage. We retrospectively identified 543 patients who underwent radical nephrectomy for renal cell carcinoma between 1997 and 2012. Patients were classified according to preoperative glomerular filtration rate as no chronic kidney disease--glomerular filtration rate 90 ml/minute/1.73 m(2) or greater (230, 42.4%), chronic kidney disease stage II--glomerular filtration rate 60 to less than 90 ml/minute/1.73 m(2) (227, 41.8%) and chronic kidney disease stage III--glomerular filtration rate 30 to less than 60 ml/minute/1.73 m(2) (86, 15.8%). Computerized tomography performed within 2 months before surgery and 1 year after surgery was used to assess functional renal volume for measuring the degree of hypertrophy of the remnant kidney, and the preoperative and postoperative glomerular filtration rate per unit volume of functional renal volume was used to calculate the degree of hyperfiltration. Among all patients (mean age 56.0 years) mean preoperative glomerular filtration rate, functional renal volume and glomerular filtration rate/functional renal volume were 83.2 ml/minute/1.73 m(2), 340.6 cm(3) and 0.25 ml/minute/1.73 m(2)/cm(3), respectively. The percent reduction in glomerular filtration rate was statistically significant according to chronic kidney disease stage (no chronic kidney disease 31.2% vs stage II 26.5% vs stage III 12.8%, p kidney was not statistically significant (no chronic kidney disease 18.5% vs stage II 17.3% vs stage III 16.5%, p=0.250). The change in glomerular filtration rate/functional renal volume was statistically significant (no chronic kidney disease 18.5% vs stage II 20.1% vs stage III 45.9%, p chronic kidney disease stage (p <0.001). Patients with a lower preoperative glomerular filtration rate had a smaller reduction in

Aging and decreased glomerular filtration rate: An elderly population-based study.

Directory of Open Access Journals (Sweden)

Regina C R M Abdulkader

Full Text Available Although a reduced glomerular filtration rate (GFR in old people has been attributed to physiologic aging, it may be associated with kidney disease or superimposed comorbidities. This study aims to assess the prevalence of decreased GFR in a geriatric population in a developing country and its prevalence in the absence of simultaneous diseases.This is a cross-sectional study of data from the Saúde, Bem-Estar e Envelhecimento cohort study (SABE study[Health, Well-Being and Aging], a multiple cohorts study. A multistage cluster sample composed of 1,253 individuals representative of 1,249,388 inhabitants of São Paulo city aged ≥60 years in 2010 was analyzed. The participants answered a survey on socio-demographic factors and health, had blood pressure measured and urine and blood samples collected. GFR was estimated and defined as decreased when 0.20 g/g.The prevalence of GFR <60 mL/min/1.73m2 was 19.3%. Individuals with GFR <60 mL/min/1.73m2 were older (75±1 versus 69±1 years, p<0.001, had lower schooling (18 versus 30% with complete 8-year basic cycle, p = 0.010, and higher prevalence of hypertension (82 versus 63%, p<0.001, diabetes (34 versus 26%, p = 0.021, cardiovascular disease (43 versus 24%, p<0.001 and kidney damage (35% versus 15%, p<0.001. Only 0.7% of the entire studied population had GFR <60 mL/min/1.73m2 without simultaneous diseases or kidney damage. Among the individuals with GFR <60 mL/min/1.73m2, 3.5% had neither renal damage nor associated comorbidities, whereas among those with GFR ≥60 mL/min/1.73m2, 11.0% had none of these conditions. Logistic regression showed that older age, cardiovascular disease and hypertension were associated with GFR<60 mL/min/1.73m2.Decreased GFR was highly prevalent among the geriatric population in a megalopolis of a developing country. It was rarely present without simultaneous chronic comorbidities or kidney damage.

Longitudinal change in estimated GFR among CKD patients: A 10-year follow-up study of an integrated kidney disease care program in Taiwan.

Directory of Open Access Journals (Sweden)

Ching-Wei Tsai

Full Text Available This study examined the progression of chronic kidney disease (CKD by using average annual decline in estimated GFR (eGFR and its risk factors in a 10-year follow-up CKD cohort.A prospective, observational cohort study, 4600 individuals fulfilled the definition of CKD, with or without proteinuria, were followed for 10 years. The eGFR was estimated by the MDRD equation. Linear regression was used to estimate participants' annual decline rate in eGFR. We defined subjects with annual eGFR decline rate <1 ml/min/1.73 m2 as non-progression and the decline rate over 3 ml/min/1.73 m2 as rapid progression.During the follow-up period, 2870 (62.4% individuals had annual eGFR decline rate greater than 1 ml/min/1.73 m2. The eGFR decline rate was slower in individuals with CKD diagnosed over the age of 60 years than those with onset at a younger age. Comparing to subjects with decline rate <1 ml/min/1.73 m2/year, the odds ratio (OR of developing rapid CKD progression for diabetes, proteinuria and late onset of CKD was 1.72 (95% CI: 1.48-2.00, 1.89(1.63-2.20 and 0.68 (0.56-0.81, respectively. When the model was adjusted for the latest CKD stage, comparing to those with CKD stage 1, patients with stage 4 and stage 5 have significantly higher risks for rapid progression (OR, 5.17 (2.60-10.25, 19.83 (10.05-39.10, respectively. However, such risk was not observed among patients with the latest CKD stage 2 and 3. The risk for incident ESRD was 17% higher for each 1 ml/min/1.73 m2 increasing in annual decline rate.Not everyone with CKD develops ESRD after a 10-year follow-up. Absolute annual eGFR decline rate can help clinicians to better predict the progression of CKD. Individuals with renal function decline rate over 3 ml/min/1.73 m2/year require intensive CKD care.

First-order phase transitions in CaFe2As2 single crystal: a local probe study

International Nuclear Information System (INIS)

Alzamora, M; Munevar, J; Baggio-Saitovitch, E; Bud'ko, S L; Ni Ni; Canfield, P C; Sanchez, D R

2011-01-01

57 Fe Moessbauer spectroscopy has been used to investigate the structural and magnetic phase transitions of CaFe 2 As 2 (T N = 173 K) single crystals. For this compound we found that V ZZ is positive and parallel to the c-axis of the tetragonal structure. For CaFe 2 As 2 a magnetic hyperfine field B hf was observed at the 57 Fe nucleus below T N ∼ 173 K. Analysis of the temperature dependence of B hf data using the Bean-Rodbell model shows that the Fe spins undergo a first-order magnetic transition at ∼ 173 K. A collinear antiferromagnetic structure is established below this temperature with the Fe spin lying in the (a, b) plane. Below T N the paramagnetic fraction of Fe decreases down to 150 K and for lower temperatures all the Fe spins are magnetically ordered.

Progression of Renal Impairment and Chronic Kidney Disease in Chronic Heart Failure: An Analysis From GISSI-HF.

Science.gov (United States)

Damman, Kevin; Masson, Serge; Lucci, Donata; Gorini, Marco; Urso, Renato; Maggioni, Aldo P; Tavazzi, Luigi; Tarantini, Luigi; Tognoni, Gianni; Voors, Adriaan; Latini, Roberto

2017-01-01

Data on the natural change in renal function in patients with chronic heart failure (HF) are limited. Estimated glomerular filtration rate (eGFR) was assessed over 36 months in 6934 patients included in the GISSI-HF study. Associations from baseline, changes in renal function, and occurrence of cardiovascular death or HF hospitalization were assessed. Mean age was 67 years, mainly men (78%), and mean eGFR was 68 mL • min -1  • 1.73 m -2 . Change in eGFR in the 1st year was -1.5 ± 16 mL • min -1  • 1.73 m -2 , and over 36 months it was -3.7 ± 18 mL • min -1  • 1.73 m -2 . Over the latter period, only 25% deteriorated ≥1 Kidney Disease Outcomes Quality Initiatives (KDOQI) class of chronic kidney disease (CKD). Fifteen percent of patients had >15 mL • min -1  • 1.73 m -2 decrease in eGFR in the 1st 12 months. Lower eGFR was associated with outcome: hazard ratio (HR) 1.10, 95% confidence interval (CI) 1.08-1.10 (P 15 mL • min -1  • 1.73 m -2 in the 1st year showed the highest risk of events (HR 1.22, 95% CI 1.10-1.36; P renal function over time in patients with chronic HF was modest. Only 25% deteriorated ≥1 KDOQI class of CKD after 3 years. Any decrease in eGFR over time was associated with strongly increased event rates. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

An alkali-metal ion extracted layered compound as a template for a metastable phase synthesis in a low-temperature solid-state reaction: preparation of brookite from K0.8Ti1.73Li0.27O4.

Science.gov (United States)

Ozawa, Tadashi C; Sasaki, Takayoshi

2010-03-15

We have designed a new approach to synthesize brookite, i.e., to extract alkali-metal ions from K(0.8)Ti(1.73)Li(0.27)O(4) (KTLO) and to apply simultaneous heat treatment to the remaining lepidocrocite-type layers of TiO(6) octahedra. For the alkali-metal ion extraction and the simultaneous heat treatment, KTLO was heated at 400 degrees C with polytetrafluoroethylene (PTFE) in flowing Ar. PTFE has been found to be an effective agent to extract strongly electropositive alkali-metal ions from KTLO because of the strong electronegativity of F as its component. The product of this reaction consists of a mixture of brookite, K(2)CO(3), LiF, and PTFE derivatives, indicating the complete extraction of K(+) and Li(+) from KTLO and formation of brookite from the lepidocrocite-type layer of TiO(6) octahedra as a template. This brookite has a partial replacement of O(2-) with F(-) and/or slight oxygen deficiency; thus, its color is light-bluish gray. Fully oxidized brookite formation and complete decomposition of PTFE derivatives have been achieved by further heating in flowing air, and coproduced alkali-metal salts have been removed by washing in water. Powder X-ray diffraction, Raman spectroscopy, and chemical analysis results have confirmed that the final brookite product treated at 600 degrees C is single phase, and it is white. The method to extract alkali-metal ions from a crystalline material using PTFE is drastically different from the common methods such as soft-chemical and electrochemical reactions. It is likely that this new synthetic approach is applicable to other layered systems to prepare a diverse family of compounds, including novel metastable ones.

Intraoperative panoramic image using alignment grid, is it accurate?

Science.gov (United States)

Apivatthakakul, T; Duanghakrung, M; Luevitoonvechkit, S; Patumasutra, S

2013-07-01

Minimally invasive orthopedic trauma surgery relies heavily on intraoperative fluoroscopic images to evaluate the quality of fracture reduction and fixation. However, fluoroscopic images have a narrow field of view and often cannot visualize the entire long bone axis. To compare the coronal femoral alignment between conventional X-rays to that achieved with a new method of acquiring a panoramic intraoperative image. Twenty-four cadaveric femurs with simple diaphyseal fractures were fixed with an angulated broad DCP to create coronal plane malalignment. An intraoperative alignment grid was used to help stitch different fluoroscopic images together to produce a panoramic image. A conventional X-ray of the entire femur was then performed. The coronal plane angulation in the panoramic images was then compared to the conventional X-rays using a Wilcoxon signed rank test. The mean angle measured from the panoramic view was 173.9° (range 169.3°-178.0°) with median of 173.2°. The mean angle measured from the conventional X-ray was 173.4° (range 167.7°-178.7°) with a median angle of 173.5°. There was no significant difference between both methods of measurement (P = 0.48). Panoramic images produced by stitching fluoroscopic images together with help of an alignment grid demonstrated the same accuracy at evaluating the coronal plane alignment of femur fractures as conventional X-rays.

Allopurinol Against Progression of Chronic Kidney Disease.

Science.gov (United States)

Golmohammadi, Sima; Almasi, Afshin; Manouchehri, M; Omrani, Hamid Reza; Zandkarimi, Mohammad Reza

2017-07-01

Hyperuricemia is common in approximately 50% of patients with kidney failure due to decreased uric acid excretion, and it has been recently known as an independent factor in the progression of renal insufficiency. Allopurinol inhibits the production of uric acid. The aim of this study was to evaluate the effect of allopurinol on chronic kidney disease progression. In a clinical trial, patients with stages 3 and 4 of chronic kidney disease were divided into two groups to receive allopurinol, 100 mg, daily and placebo for 12 months. Patients' kidney function and serum uric acid levels were assessed at baseline and 3, 6, and 12 months after initial administration. Subgroups of patients with severe and mild glomerular filtration rate (GFR) impairment (GFR, 15 mL/min/1.73 m2 to 30 mL/min/1.73 m2 and 30 mL/min/1.73 m2 to 60 mL/min/1.73 m2, respectively), were compared between the groups. Serum uric acid levels decreased significantly during after 12 months of allopurinol administration (P = .004). In patients with severe GFR impairment, serum creatinine levels did not decrease significantly and there was no significant increase in GFR, but in those with mild GFR impairment, serum creatinine levels decreased and GFR increase significantly (P kidney disease progression and could be administered with other effective medications for controlling the kidney disease.

Factores socioeconómicos que influyeron en los casos de violación sexual de menores de edad del primer y segundo juzgado colegiado de la corte superior de justicia de la libertad. 2012

OpenAIRE

Quispe Nuñez, Santos Yanet

2016-01-01

In this research the overall objective was to determine the socio-economic factors influencing cases of rape of minors (art. 173 PC) First and Second Collegiate Court of the Superior Court of Justice of La Libertad in the year 2012. The hypothesis was that socio-economic factors influencing cases of rape of minors (Article 173 of the CP.) First and Second Collegiate Court of the Superior Court of Justice of La Libertad, in 2012 were: Regular degree of instruction or education, occupation unst...