
Sample records for lutetium 173

  1. Lutetium pyrophosphates

    International Nuclear Information System (INIS)

    Dzhabishvili, N.A.; Davitashvili, E.G.; Orlovskij, V.P.; Kargareteli, L.N.


    Reaction between lutetium nitrate and pyrophosphates of sodium, potassium and ammonium in aqueous solution is studied, using the method of residual concentrations. New compounds are isolated, their composition and physicochemical properties are considered. Data on solubility in the systems at 25 deg C are given. All the hydrate pyrophosphates are roentgenoamorphous, they are crystallized only when heated. Thermal decomposition of lutetium pyrophosphate is investigated

  2. Low temperature heat capacity of lutetium and lutetium hydrogen alloys

    International Nuclear Information System (INIS)

    Thome, D.K.


    The heat capacity of high purity electrotransport refined lutetium was measured between 1 and 20 0 K. Results for theta/sub D/ were in excellent agreement with theta values determined from elastic constant measurements. The heat capacity of a series of lutetium-hydrogen solid solution alloys was determined and results showed an increase in γ from 8.2 to about 11.3 mJ/g-atom-K 2 for hydrogen content increasing from zero to about one atomic percent. Above one percent hydrogen γ decreased with increasing hydrogen contents. The C/T data showed an increase with temperature decreasing below about 2.5 0 K for samples with 0.1 to 1.5 atomic percent hydrogen. This accounts for a large amount of scatter in theta/sub D/ versus hydrogen content in this range. The heat capacity of a bulk sample of lutetium dihydride was measured between 1 and 20 0 K and showed a large increase in theta/sub D/ and a large decrease in γ compared to pure lutetium

  3. Thermal decomposition of lutetium propionate

    DEFF Research Database (Denmark)

    Grivel, Jean-Claude


    The thermal decomposition of lutetium(III) propionate monohydrate (Lu(C2H5CO2)3·H2O) in argon was studied by means of thermogravimetry, differential thermal analysis, IR-spectroscopy and X-ray diffraction. Dehydration takes place around 90 °C. It is followed by the decomposition of the anhydrous...... °C. Full conversion to Lu2O3 is achieved at about 1000 °C. Whereas the temperatures and solid reaction products of the first two decomposition steps are similar to those previously reported for the thermal decomposition of lanthanum(III) propionate monohydrate, the final decomposition...... of the oxycarbonate to the rare-earth oxide proceeds in a different way, which is here reminiscent of the thermal decomposition path of Lu(C3H5O2)·2CO(NH2)2·2H2O...

  4. Neutron capture cross section measurements: case of lutetium isotopes

    International Nuclear Information System (INIS)

    Roig, O.; Meot, V.; Belier, G.


    The neutron radiative capture is a nuclear reaction that occurs in the presence of neutrons on all isotopes and on a wide energy range. The neutron capture range on Lutetium isotopes, presented here, illustrates the variety of measurements leading to the determination of cross sections. These measurements provide valuable fundamental data needed for the stockpile stewardship program, as well as for nuclear astrophysics and nuclear structure. Measurements, made in France or in United-States, involving complex detectors associated with very rare targets have significantly improved the international databases and validated models of nuclear reactions. We present results concerning the measurement of neutron radiative capture on Lu 173 , Lu 175 , Lu 176 and Lu 177m , the measurement of the probability of gamma emission in the substitution reaction Yb 174 (He 3 ,pγ)Lu 176 . The measurement of neutron cross sections on Lu 177m have permitted to highlight the process of super-elastic scattering

  5. Lutetium oxide-based transparent ceramic scintillators (United States)

    Seeley, Zachary; Cherepy, Nerine; Kuntz, Joshua; Payne, Stephen A.


    In one embodiment, a transparent ceramic of sintered nanoparticles includes gadolinium lutetium oxide doped with europium having a chemical composition (Lu.sub.1-xGd.sub.x).sub.2-YEu.sub.YO.sub.3, where X is any value within a range from about 0.05 to about 0.45 and Y is any value within a range from about 0.01 to about 0.2, and where the transparent ceramic exhibits a transparency characterized by a scatter coefficient of less than about 10%/cm. In another embodiment, a transparent ceramic scintillator of sintered nanoparticles, includes a body of sintered nanoparticles including gadolinium lutetium oxide doped with a rare earth activator (RE) having a chemical composition (Lu.sub.1-xGd.sub.x).sub.2-YRE.sub.YO.sub.3, where RE is selected from the group consisting of: Sm, Eu, Tb, and Dy, where the transparent ceramic exhibits a transparency characterized by a scatter coefficient of less than about 10%/cm.

  6. Saturated vapor pressure of lutetium tris-acetylacetonate

    Energy Technology Data Exchange (ETDEWEB)

    Trembovetskij, G.V.; Berdonosov, S.S.; Murav' eva, I.A.; Martynenko, L.I. (Moskovskij Gosudarstvennyj Univ. (USSR))


    By the statical method using /sup 177/Lu radioactive isotope the saturated vapor pressure of anhydrous lutetium acetylacetonate at 130 to 160 deg is determined. The calculations are carried out assuming the vapor to be monomolecular. The equation of lgP versus 1/T takes the form: lg Psub((mmHg))=(8.7+-1.6)-(4110+-690)/T. The thermodynamical characteristics of LuA/sub 3/ sublimation are calculated to be kJ/mol; J/kxmol.

  7. Separation of thulium, ytterbium and lutetium from uranium

    International Nuclear Information System (INIS)

    Lopez, G.H.


    The behaviour at different temperatures, shaking times and hydrochloric acid concentrations on the solvent extraction system UO 2 2+ - (Tm 3+ , Yb 3+ , Lu 3+ ) - H 2 O - HCl - TBP was studied. Quantitative determinations of the elements were performed by visible spectrophotometry and X-ray fluorescence. The uranyl ion was efficiently extracted by TBP from an aqueous hydrochloric acid solution (4-7M) shaken during 10 minutes at room temperature. On these conditions the separation factors for uranium from thulium and ytterbium were found to be 3000 and from lutetium 140. (author)

  8. Laser resonance ionization spectroscopy on lutetium for the MEDICIS project

    Energy Technology Data Exchange (ETDEWEB)

    Gadelshin, V., E-mail: [University of Mainz, Institute of Physics (Germany); Cocolios, T. [KU Leuven, Institute for Nuclear and Radiation Physics (Belgium); Fedoseev, V. [CERN, EN Department (Switzerland); Heinke, R.; Kieck, T. [University of Mainz, Institute of Physics (Germany); Marsh, B. [CERN, EN Department (Switzerland); Naubereit, P. [University of Mainz, Institute of Physics (Germany); Rothe, S.; Stora, T. [CERN, EN Department (Switzerland); Studer, D. [University of Mainz, Institute of Physics (Germany); Duppen, P. Van [KU Leuven, Institute for Nuclear and Radiation Physics (Belgium); Wendt, K. [University of Mainz, Institute of Physics (Germany)


    The MEDICIS-PROMED Innovative Training Network under the Horizon 2020 EU program aims to establish a network of early stage researchers, involving scientific exchange and active cooperation between leading European research institutions, universities, hospitals, and industry. Primary scientific goal is the purpose of providing and testing novel radioisotopes for nuclear medical imaging and radionuclide therapy. Within a closely linked project at CERN, a dedicated electromagnetic mass separator system is presently under installation for production of innovative radiopharmaceutical isotopes at the new CERN-MEDICIS laboratory, directly adjacent to the existing CERN-ISOLDE radioactive ion beam facility. It is planned to implement a resonance ionization laser ion source (RILIS) to ensure high efficiency and unrivaled purity in the production of radioactive ions. To provide a highly efficient ionization process, identification and characterization of a specific multi-step laser ionization scheme for each individual element with isotopes of interest is required. The element lutetium is of primary relevance, and therefore was considered as first candidate. Three two-step excitation schemes for lutetium atoms are presented in this work, and spectroscopic results are compared with data of other authors.

  9. Laser resonance ionization spectroscopy on lutetium for the MEDICIS project (United States)

    Gadelshin, V.; Cocolios, T.; Fedoseev, V.; Heinke, R.; Kieck, T.; Marsh, B.; Naubereit, P.; Rothe, S.; Stora, T.; Studer, D.; Van Duppen, P.; Wendt, K.


    The MEDICIS-PROMED Innovative Training Network under the Horizon 2020 EU program aims to establish a network of early stage researchers, involving scientific exchange and active cooperation between leading European research institutions, universities, hospitals, and industry. Primary scientific goal is the purpose of providing and testing novel radioisotopes for nuclear medical imaging and radionuclide therapy. Within a closely linked project at CERN, a dedicated electromagnetic mass separator system is presently under installation for production of innovative radiopharmaceutical isotopes at the new CERN-MEDICIS laboratory, directly adjacent to the existing CERN-ISOLDE radioactive ion beam facility. It is planned to implement a resonance ionization laser ion source (RILIS) to ensure high efficiency and unrivaled purity in the production of radioactive ions. To provide a highly efficient ionization process, identification and characterization of a specific multi-step laser ionization scheme for each individual element with isotopes of interest is required. The element lutetium is of primary relevance, and therefore was considered as first candidate. Three two-step excitation schemes for lutetium atoms are presented in this work, and spectroscopic results are compared with data of other authors.

  10. Hyperfine interactions in 111Cd-doped lutetium sesquioxide

    International Nuclear Information System (INIS)

    Errico, L.A.; Renteria, M.; Bibiloni, A.G.; Requejo, F.G.


    We report here first Perturbed Angular Correlation (PAC) results of the electric field gradient (EFG) characterisation at 111 Cd impurities located at both non-equivalent cation sites of the bixbyite structure of Lutetium sesquioxide, between room temperature (RT) and 1273 K. The comparison with results coming from a systematic 111 Cd PAC study in bixbyites and with point-charge model (PCM) predictions shows the presence of a trapped defect at RT in the neighbourhood of the asymmetric cation site, which is completely removed at T > 623 K. The anomalous EFG temperature dependence in Lu 2 O 3 can be described in the frame of a 'two-state' model with fluctuating interactions, which enables the experimental determination of the acceptor energy level introduced by the Cd impurity in the band-gap of the semiconductor and the estimation of the oxygen vacancy density in the sample

  11. Hyperfine interactions in {sup 111}Cd-doped lutetium sesquioxide

    Energy Technology Data Exchange (ETDEWEB)

    Errico, L.A.; Renteria, M.; Bibiloni, A.G.; Requejo, F.G. [Universidad Nacional de La Plata, Programa TENAES (CONICET), Departamento de Fisica, Facultad de Ciencias Exactas (Argentina)


    We report here first Perturbed Angular Correlation (PAC) results of the electric field gradient (EFG) characterisation at {sup 111}Cd impurities located at both non-equivalent cation sites of the bixbyite structure of Lutetium sesquioxide, between room temperature (RT) and 1273 K. The comparison with results coming from a systematic {sup 111}Cd PAC study in bixbyites and with point-charge model (PCM) predictions shows the presence of a trapped defect at RT in the neighbourhood of the asymmetric cation site, which is completely removed at T > 623 K. The anomalous EFG temperature dependence in Lu{sub 2}O{sub 3} can be described in the frame of a 'two-state' model with fluctuating interactions, which enables the experimental determination of the acceptor energy level introduced by the Cd impurity in the band-gap of the semiconductor and the estimation of the oxygen vacancy density in the sample.

  12. DOTA-TATE peptides labelling with Lutetium 177: Preliminary study

    International Nuclear Information System (INIS)

    Aliaga, Eleazar; Robles, Anita; Ramos, Bertha; Martinez, Flor


    he peptide DOTA-TATE was labeled with lutetium 177 according to the methodology provided under the regional project RLA/6/074, sponsored by the IAEA. The labeling was done in 0.26 M gentisic acid solution in 0.8 M sodium acetate buffer, pH 5, at 100 °C for 30 minutes in a dry heating block. The radiochemical purity was assessed by thin layer chromatography, using ITLC SG strips and a mixture of 0.15 M ammonium acetate - methanol (1:1) as solvent. The radiolabeled peptide 177 Lu-DOTA-TATE reached a radiochemical purity of 98 % with a specific activity of 2,8 mCi/µg of peptide. (authors).

  13. Effect of pressure on the bandstructure and superconductivity in lutetium

    International Nuclear Information System (INIS)

    Asokamani, R.; Natarajan, S.; Rajagopalan, M.; Sundararajan, V.; Suvasini, M.B.; Iyakutti, K.


    The detailed bandstructure and superconducting behaviour of lutetium at 230 kbar pressure is reported here. The electronic contribution eta to the electron-phonon mass enhancement lambda is studied within the rigid muffin-tin (RMT) approximation. The pd and df matrix elements are expressed in terms of 'd' bandwidth, Fermi energy and muffin-tin zero. The variations of Grueneisen parameter and Debye temperature with pressure are studied and applied in the calculation of Tsub(c). The calculated Tsub(c) value agrees fairly well with the experimental value. The changes in the conduction bandwidth and the electronic specific heat coefficient with pressure are found to be in agreement with theoretical prediction. (author)

  14. First principles study of electronic, elastic and thermal properties of lutetium intermetallics

    International Nuclear Information System (INIS)

    Pagare, Gitanjali; Chouhan, Sunil Singh; Soni, Pooja; Sanyal, S.P.; Rajagopalan, M.


    In the present work, the electronic, elastic and thermal properties of lutetium intermetallics LuX have been studied theoretically by using first principles calculations based on density functional theory (DFT) with the generalized gradient approximation (GCA)

  15. Labelling of the peptide Dota-Octreotate with Lutetium 177

    International Nuclear Information System (INIS)

    Hernandez B, C.A.


    In this work is described the optimization of the reaction conditions to obtain the complex 177 Lu-Dota-TATE with a radiochemical purity > 95%, even so the studies of stability In vitro to the dilution in saline solution, stability in human serum and challenge to the cystein. The biodistribution studies are presented in mice Balb-C and the tests of biological recognition using one lines cellular of pancreatic adenoma (AR42-J). The obtained results show a high stability of the radio complex in vitro, since it doesn't suffer trans chelation from the Lutetium-177 to plasmatic proteins. The biodistribution tests in mice Balb-C demonstrated an appropriate lipophilly of the complex to be excreted in more proportion by the kidneys without significant accumulation in healthy tissues. It is necessary to mention that the drop activity specifies (3.54 μg / 37 MBq) obtained in the irradiation of 176 Lu 2 O 3 it allowed to verify the union of the 177 Lu-Dota-Tate to membrane receivers but without being able to obtain the saturation curves and competition required to characterize quantitatively the biological recognition. (Author)

  16. Low-temperature thermal properties and features of the phonon spectrum of lutetium tetraboride

    Energy Technology Data Exchange (ETDEWEB)

    Novikov, V.V., E-mail: [Bryansk Petrovsky State University, 14 Bezhitskaya St., Bryansk 241037, Russia, (Russian Federation); Mitroshenkov, N.V., E-mail: [Bryansk Petrovsky State University, 14 Bezhitskaya St., Bryansk 241037, Russia, (Russian Federation); Matovnikov, A.V.; Avdashchenko, D.V. [Bryansk Petrovsky State University, 14 Bezhitskaya St., Bryansk 241037, Russia, (Russian Federation); Morozov, A.V. [Russian Timiryazev State Agrarian University, 49 Timiryazevskaya St., Moscow 127550 (Russian Federation); Pavlova, L.M.; Koltsov, V.B. [National Research University of Electronic Technology “MIET”, Moscow 124498 (Russian Federation)


    Highlights: • The coefficients of thermal expansion (α{sub ‖}, α{sub ⊥}) were measured for lutetium tetraboride. • The simplified Lutetium tetraboride phonon spectrum model is developed. • The Grüneisen parameters Γ, Γ{sub ‖}, Γ{sub ⊥} for lutetium tetraboride is calculated. • The anomalies of Γ{sub ‖}(T), Γ{sub ⊥}(T) at about 25 K are due to Einstein vibrations of boron sublattices. - Abstract: The coefficients of thermal expansion to the c axis (α{sub ‖}, α{sub ⊥}) were measured for lutetium tetraboride over the temperature range 4.2–300 K. The heat capacity data for lutetium tetraboride were used for the calculation of tetraboride phonon spectrum moments and also for the development of a simplified tetraboride spectrum model. The use of the heat capacity and thermal expansion data allowed the temperature changes of the Grüneisen parameters Γ, Γ{sub ‖}, Γ{sub ⊥} for tetraboride to be calculated. As a result of the approximation of Γ{sub ⊥}(T), Γ{sub ‖}(T) temperature dependencies in accordance with the chosen phonon spectrum model have been found: the anomalies of Γ{sub ⊥}(T), Γ{sub ‖}(T) are at about 25 K and then drop at lower temperatures due to the Einstein vibrations of boron sublattices.

  17. Lutetium-177 DOTATATE Production with an Automated Radiopharmaceutical Synthesis System. (United States)

    Aslani, Alireza; Snowdon, Graeme M; Bailey, Dale L; Schembri, Geoffrey P; Bailey, Elizabeth A; Pavlakis, Nick; Roach, Paul J


    Peptide Receptor Radionuclide Therapy (PRRT) with yttrium-90 ((90)Y) and lutetium-177 ((177)Lu)-labelled SST analogues are now therapy option for patients who have failed to respond to conventional medical therapy. In-house production with automated PRRT synthesis systems have clear advantages over manual methods resulting in increasing use in hospital-based radiopharmacies. We report on our one year experience with an automated radiopharmaceutical synthesis system. All syntheses were carried out using the Eckert & Ziegler Eurotope's Modular-Lab Pharm Tracer® automated synthesis system. All materials and methods used were followed as instructed by the manufacturer of the system (Eckert & Ziegler Eurotope, Berlin, Germany). Sterile, GMP-certified, no-carrier added (NCA) (177)Lu was used with GMP-certified peptide. An audit trail was also produced and saved by the system. The quality of the final product was assessed after each synthesis by ITLC-SG and HPLC methods. A total of 17 [(177)Lu]-DOTATATE syntheses were performed between August 2013 and December 2014. The amount of radioactive [(177)Lu]-DOTATATE produced by each synthesis varied between 10-40 GBq and was dependant on the number of patients being treated on a given day. Thirteen individuals received a total of 37 individual treatment administrations in this period. There were no issues and failures with the system or the synthesis cassettes. The average radiochemical purity as determined by ITLC was above 99% (99.8 ± 0.05%) and the average radiochemical purity as determined by HPLC technique was above 97% (97.3 ± 1.5%) for this period. The automated synthesis of [(177)Lu]-DOTATATE using Eckert & Ziegler Eurotope's Modular-Lab Pharm Tracer® system is a robust, convenient and high yield approach to the radiolabelling of DOTATATE peptide benefiting from the use of NCA (177)Lu and almost negligible radiation exposure of the operators.

  18. Lutetium 177-Labeled Cetuximab Evaluation for Radioimmunotherapeutic Applications

    Directory of Open Access Journals (Sweden)

    Kamal Yavari


    Full Text Available Background & Objectives: The monoclonal antibody cetuximab binds to EGFR and thus provides an opportunity to create both imaging and therapeutic modalities that target this receptor. The potential of cetuximab as a radioimmunoconjugate was investigated and quality control tests (in vitro and in vivo were performed as a first step in the production of a new radiopharmaceutical.   Methods : Cetuximab solution was dialyzed and concentrated using an Amicon Ultra-15 filter. Purified antibody was labeled with lutetium-177 using the acyclic bifunctional chelator, DOTA-NHS, and radioimmunoconjugates were purified by PD10 columns. Radiochemical purity and stability in buffer and human blood serum were determined using thin layer chromatography. Integrity of the radiolabeled complex was checked by SDS-PAGE. Preliminary biodistribution studies in normal mice model performed to determine radioimmunoconjugates distribution up to 72h.   Results: The radiochemical purity of the complex was 98±1%. The stabilities in phosphate buffer and in human blood serum at 96 hours post-preparation were 96±2 % and 78±4%, respectively. All of the samples, controls and radiolabeled antibodies, showed a similar pattern of migration in the gel electrophoresis. Biodistribution of Lu177-cetuximab was evaluated in normal mice and the highest ID/g% was observed in the blood (13.2±1.3% at 24 hours and the liver (9.1±1.3% at 24 hours.   Conclusion: Our results show that DOTA-cituximab can be labeled with 177Lu. Lu177-cetuximab has sufficient stability and retains its integrity. The new complex could be considered for further evaluation in animals and possibly in humans as a new radiopharmaceutical for use in radioimmunotherapy of cancers.

  19. Structure and luminescence spectra of lutetium and yttrium borates synthesized from ammonium nitrate melt

    International Nuclear Information System (INIS)

    Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.


    Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100 deg. C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed

  20. Structure and luminescence spectra of lutetium and yttrium borates synthesized from ammonium nitrate melt (United States)

    Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.


    Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100°C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed.

  1. Determination of lutetium (III) hydrolysis constants in the middle of ion force 1M sodium chloride at 303 K

    International Nuclear Information System (INIS)

    Jimenez R, M.; Solache R, M.J.; Ramirez G, J.J.; Rojas H, A.


    With the purpose to complete information about the lutetium (III) hydrolysis constants here is used the potentiometric method to determine those in the middle of ion force 1M sodium chloride at 303 K. (Author)

  2. Apparent molar volumes and compressibilities of lanthanum, gadolinium and lutetium trifluoromethanesulfonates in dimethylsulfoxide

    International Nuclear Information System (INIS)

    Warmińska, Dorota; Wawer, Jarosław


    Highlights: ► Sequence of volumes and compressibilities of Ln 3+ ions in DMSO is: La 3+ > Gd 3+ 3+ . ► Sequence of the partial molar volumes do not change with temperature. ► These results are the consequence of nature of the ion–solvent bonding. - Abstract: Temperature dependencies of the densities of dimethylsulfoxide solutions of lanthanum, gadolinium and lutetium trifluoromethanesulfonates have been determined over a wide range of concentrations. The apparent molar volumes and partial molar volumes of the salts at infinite dilution, as well as the expansibilities of the salts, have been calculated from density data. Additionally, the apparent molar isentropic compressibilities of lanthanum, gadolinium and lutetium trifluoromethanesulfonates have been calculated from sound velocity data at 298.15 K. The data obtained have been interpreted in terms of ion−solvent interactions.

  3. PMR investigation into complexes of lanthanum and lutetium with ethylenediaminediacetic acid

    International Nuclear Information System (INIS)

    Kostromina, N.A.; Novikova, L.B.


    Proton resonance spectra of ethylendiaminediacetic acid (EDDA) and EDDA mixtures with La and Lu as function of pH of solution was studied. Sequence of EDDA (A 2- ) protonation was established; cations H 3 A + and H 4 A 2+ were found; dissociation constants of above mentioned cations were determined. Formation of H 2 LnA 3+ , HLnA 2+ and LnA + complexes in EDDA-Ln (1:1) system was found. Difference in the bonds mobility of lanthanum and lutetium complexes was determined: lanthanum forms complexes with labile, lutetium with non-labile bonds. Information on complexes structure is collected. Acid dissociation constants of protonated complexes of lanthanum with EDDA were determined

  4. Determination of Kps and β1,H in a wide interval of initial concentrations of lutetium

    International Nuclear Information System (INIS)

    Lopez-G, H.; Jimenez R, M.; Solache R, M.; Rojas H, A.


    The solubility product constants and the first of lutetium hydrolysis in the interval of initial concentration of 3.72 X 10 -5 to 2.09 X 10 -3 M of lutetium, in a 2M of NaCIO 4 media, at 303 K and under conditions free of CO 2 its were considered. The solubility diagrams (pLu (ac) -pC H ) by means of a radiochemical method were obtained, and starting from its the pC H values that limit the saturation and no-saturation zones of the solutions were settled down. Those diagrams allowed, also, to calculate the solubility product constants of Lu(OH) 3 . The experimental data to the polynomial solubility equation were adjusted, what allowed to calculate those values of the solubility product constants of Lu(OH) 3 and to determine the first hydrolysis constant. The value of precipitation pC H diminishes when the initial concentration of the lutetium increases, while the values of K ps and β 1,H its remain constant. (Author)

  5. Lutetium(III) aqua ion: On the dynamical structure of the heaviest lanthanoid hydration complex

    Energy Technology Data Exchange (ETDEWEB)

    Sessa, Francesco; D’Angelo, Paola, E-mail: [Dipartimento di Chimica, Università di Roma “La Sapienza,” P. le A. Moro 5, 00185 Roma (Italy); Spezia, Riccardo [CNRS, UMR 8587, Laboratoire Analyse et Modelisation Pour la Biologie et l’Environnement, Université d’Evry Val d’Essonne, Blvd. F. Mitterrand, 91025 Evry Cedex (France)


    The structure and dynamics of the lutetium(III) ion in aqueous solution have been investigated by means of a polarizable force field molecular dynamics (MD). An 8-fold square antiprism (SAP) geometry has been found to be the dominant configuration of the lutetium(III) aqua ion. Nevertheless, a low percentage of 9-fold complexes arranged in a tricapped trigonal prism (TTP) geometry has been also detected. Dynamic properties have been explored by carrying out six independent MD simulations for each of four different temperatures: 277 K, 298 K, 423 K, 632 K. The mean residence time of water molecules in the first hydration shell at room temperature has been found to increase as compared to the central elements of the lanthanoid series in agreement with previous experimental findings. Water exchange kinetic rate constants at each temperature and activation parameters of the process have been determined from the MD simulations. The obtained structural and dynamical results suggest that the water exchange process for the lutetium(III) aqua ion proceeds with an associative mechanism, in which the SAP hydration complex undergoes temporary structural changes passing through a 9-fold TTP intermediate. Such results are consistent with the water exchange mechanism proposed for heavy lanthanoid atoms.

  6. Neutron capture cross section measurements: case of lutetium isotopes; Mesures de donnees de sections efficaces de capture radiative de neutrons: application au cas du lutecium

    Energy Technology Data Exchange (ETDEWEB)

    Roig, O.; Meot, V.; Belier, G. [CEA Bruyeres-le-Chatel, 91 (France)


    The neutron radiative capture is a nuclear reaction that occurs in the presence of neutrons on all isotopes and on a wide energy range. The neutron capture range on Lutetium isotopes, presented here, illustrates the variety of measurements leading to the determination of cross sections. These measurements provide valuable fundamental data needed for the stockpile stewardship program, as well as for nuclear astrophysics and nuclear structure. Measurements, made in France or in United-States, involving complex detectors associated with very rare targets have significantly improved the international databases and validated models of nuclear reactions. We present results concerning the measurement of neutron radiative capture on Lu{sup 173}, Lu{sup 175}, Lu{sup 176} and Lu{sup 177m}, the measurement of the probability of gamma emission in the substitution reaction Yb{sup 174}(He{sup 3},p{gamma})Lu{sup 176}. The measurement of neutron cross sections on Lu{sup 177m} have permitted to highlight the process of super-elastic scattering

  7. Synthesis of Lutetium Phosphate/Apoferritin Core-Shell Nanoparticles for Potential Applications in Radioimmunoimaging and Radioimmunotherapy of Cancers

    International Nuclear Information System (INIS)

    Wu, Hong; Engelhard, Mark H.; Wang, Jun; Fisher, Darrell R.; Lin, Yuehe


    We report a novel approach for synthesizing LuPO4/apoferritin core-shell nanoparticles based on an apoferritin template, conjugated to the protein biotin. To prepare the nanoparticle conjugates, we used non-radioactive lutetium as a model target or surrogate for radiolutetium (177Lu). The central cavity, multi-channel structure, and chemical properties of apoferritin are well-suited for sequentially diffusing lutetium and phosphate ions into the cavity--resulting in a stable core-shell composite. We characterized the synthesized LuPO4/apoferritin nanoparticle using transmission electron microscopy (TEM) and x-ray photoelectron spectroscopy (XPS). We tested the pre-targeting capability of biotin-modified lutetium/apoferritin nanoparticle using streptavidin-modified magnetic beads and streptavidin-modified fluorescein isothiocyanate (FITC) tracer. This paper presents a simple, fast, and efficient method for synthesizing LuPO4/apoferritin nanoparticle conjugates with biotin for potential applications in radioimmunotherapy and radioimmunoimaging of cancer

  8. Study of lutetium nitrate reaction with orthophosphates of alkali metals and ammonium

    International Nuclear Information System (INIS)

    Davitashvili, E.G.; Dzhabishvili, N.A.; Orlovskij, V.P.; Kargareteli, L.N.


    The process of lutetium phosphate precipitation in systems Lu(NO 3 ) 3 - M 3 PO 4 -H 2 O, where M=K + , Na, NH 4 , at 25 deg was studied. Compounds LuPO 4 x2H 2 O, 5LuPO 4 xNa 3 PO 4 x16H 2 O, 2LuPO 4 xK 3 PO 4 x6H 2 O and 2LuPO 4 (NH 4 ) 3 PO 4 x6H 2 O were isolated. The compounds prepared are roentgenoamorphous. Results of thermal decomposition of the compounds are presented

  9. X-ray fluorescence analysis of lutetium oxide/oxalate for rare earth impurities

    International Nuclear Information System (INIS)

    Chandola, L.C.; Khanna, P.P.


    An X-ray fluorescence spectrometric method for the analysis of lutetium oxide is described. The sample in the oxalate form is mixed with boric acid binding material and pressed into a pellet over supporting pellet of boric acid. A Philips PW 1220 wavelength dispersive semiautomatic X-ray fluorescence spectrometer is used for the analysis. The minimum determination limit is 0.002 percent for Y, Er and Yb and 0.005 percent for Tm. Calculations for theoretical minimum detection limits and percent standard deviations at each concentration of the standard are carried out. (author)

  10. Cerium-doped single crystal and transparent ceramic lutetium aluminum garnet scintillators

    International Nuclear Information System (INIS)

    Cherepy, Nerine J.; Kuntz, Joshua D.; Tillotson, Thomas M.; Speaks, Derrick T.; Payne, Stephen A.; Chai, B.H.T.; Porter-Chapman, Yetta; Derenzo, Stephen E.


    For rapid, unambiguous isotope identification, scintillator detectors providing high-resolution gamma ray spectra are required. We have fabricated Lutetium Aluminum Garnet (LuAG) using transparent ceramic processing, and report a 2-mm thick ceramic exhibiting 75% transmission and light yield comparable to single-crystal LuAG:Ce. The LuAG:Ce luminescence peaks at 550 nm, providing an excellent match for Silicon Photodiode readout. LuAG is dense (6.67 g/cm 3 ) and impervious to water, exhibits good proportionality and a fast decay (∼40 ns), and we measure light yields in excess of 20,000 photons/MeV

  11. Independent fissile inventory verification in a large tank employing lutetium double spikes

    International Nuclear Information System (INIS)

    Carter, J.A.; Walker, R.L.; May, M.P.; Smith, D.H.; Hebble, T.L.


    A 3000-liter feed adjustment tank containing over 2400 L of uranium solution was assayed for its contents using the double spiking technique of isotope dilution mass spectrometry. Lutetium was the double spike, with the natural element used as the initial spike and enriched 176-Lu as the second. The ability of a remote sampling system was evaluated for its ability to introduce the lutetium and also to produce homogeneous sample solutions. The system was found to be satisfactory. Volumes of the tank can be measured to a precision of about 0.2%. The concentration of uranium was measured as 154.5 g/L uranium, thus giving a total of 382.3 kg in the tank as compared to the plant's best estimate of 383 kg. Uranium measurements were subjected to internal calibration calculations, with 233-U and 236-U being used as the reference isotopes. A diversion of 5% of the tank contents was simulated to evaluate the method's sensitivity in this regard. The ability of this method to give timely results of good precision makes it a strong candidate for use in material balance and inventory accountability applications; it also has potential use in quality assurance areas

  12. Optical emission spectrographic analysis of lutetium oxide for rare earth impurities

    International Nuclear Information System (INIS)

    Chandola, L.C.; Dixit, V.S.


    An optical emission spectrographic (OES) method has been developed for the analysis of high purity lutetium oxide to determine rare earths Er, Tm, Yb and Y. The spectra are excited by a d.c. arc run at 10 A current after mixing the sample with graphite buffer in the weight ratio 1:1. A 1200 grooves/mm grating blazed at 3300 A is used for dispersion and a Kodak SA-1 plate for recording the spectrum. The detection limit is 0.001 per cent for Tm, Yb and Y while it is 0.005 per cent for Er. The relative standard deviation of the method is ± 13.4 per cent. (author)

  13. Photoelectric conversion and electrochromic properties of lutetium tetrakis(tert-butyl)bisphthalocyaninate

    International Nuclear Information System (INIS)

    Hu, Andrew Teh; Hu Tenyi; Liu Lungchang


    Both photoelectric and electrochromic effects on lutetium tetrakis(tert-butyl)bisphthalocyaninate (Lu(TBPc) 2 ) have been carried out in this study. Lu(TBPc) 2 is known for its electrochromic performance, but its photoelectric effect has not mentioned in the literature. The electrochromic properties of Lu(TBPc) 2 have been measured by cyclic voltammetry (CV) and UV-Vis spectrometer at the same time. It takes less than 1.5 s for the color to change from red to green under 0.9 V. Its cycle life is at least over 500 times. Furthermore, we also investigate its photoelectric conversion properties. Its photoelectric cell exhibits a positive photo-electricity conversion effect with a short-circuit photocurrent (46.4 μA/cm 2 ) under illumination of white light (1.201 mW/cm 2 )

  14. Electrochromism of solid films of blue form of lutetium phthalocyanine complexe

    Energy Technology Data Exchange (ETDEWEB)

    Gavrilov, V I; Konstantinov, A P; Luk' yanets, E A; Shelepin, I V


    Results of spectral-electrochemical study on electrochromic films of blue form of tret-butyl-substituted lutetium diphthalocyanine deposited on the surface of an electrode contacting with electrolyte aqueous solution are presented. In the 0.2-1.15 V potential range sweep of the electrode potential is followed by reversible change of the film colour in the following succession: blue reversible green reversible red. Electrochromic properties of the film confirm the corresponding spectral transitions from the initial state to monoelectron-oxidized and further on to the product of two-electron oxidation. Under potential sweeping towards the anode in the 1.4 V range and irreversible wave arises; potential achievement of this wave brings about complete change in the form of j, E-curves. The consequent electrode processes are followed by change in the film colour green - red that is associated witn mechanical fracture of the film.

  15. Formulation and characterization of lutetium-177-labeled stannous (tin) colloid for radiosynovectomy. (United States)

    Arora, Geetanjali; Singh, Manoranjan; Jha, Pragati; Tripathy, Sarthak; Bal, Chandrasekhar; Mukherjee, Anirban; Shamim, Shamim A


    Easy large-scale production, easy availability, cost-effectiveness, long half-life, and favorable radiation characteristics have made lutetium-177 (Lu) a preferred radionuclide for use in therapy. Lutetium-177-labeled stannous (Lu-Sn) colloid particles were formulated for application in radiosynovectomy, followed by in-vitro and in-vivo characterization. Stannous chloride (SnCl2) solution and Lu were heated together, the pH was adjusted, and the particles were recovered by centrifugation. The heating time and amount of SnCl2 were varied to optimize the labeling protocol. The labeling efficiency (LE) and radiochemical purity (RCP) of the product were determined. The size and shape of the particles were determined by means of electron microscopy. In-vitro stability was tested in PBS and synovial fluid, and in-vivo stability was tested in humans. LE and RCP were greater than 95% and ∼99% (Rf=0-0.1), respectively. Aggregated colloidal particles were spherical (mean size: 241±47 nm). The product was stable in vitro for up to 7 days in PBS as well as in synovial fluid. Injection of the product into the infected knee joint of a patient resulted in its homogenous distribution in the intra-articular space, as seen on the scan. No leakage of activity was seen outside the knee joint even 7 days after injection, indicating good tracer binding and in-vivo stability. Lu-Sn colloid was successfully prepared with a high LE (>95%) and high RCP (99%) under optimized reaction conditions. Because of the numerous benefits of Lu and the ease of preparation of tin colloid particles, Lu-Sn colloid particles are significantly superior to its currently available counterparts for use in radiosynovectomy.

  16. 12 CFR 308.173 - Prevailing party. (United States)


    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Prevailing party. 308.173 Section 308.173 Banks....173 Prevailing party. (a) General rule. An eligible applicant who, following an adversary adjudication has gained victory on the merits in the proceeding is a “prevailing party”. An eligible applicant may...

  17. 49 CFR 173.323 - Ethylene oxide. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethylene oxide. 173.323 Section 173.323... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.323 Ethylene oxide. (a) For packaging ethylene oxide in non-bulk packagings, silver mercury or any of its alloys or copper may not be used in any...

  18. 21 CFR 173.230 - Ethylene dichloride. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ethylene dichloride. 173.230 Section 173.230 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.230 Ethylene dichloride. A tolerance of 30 parts per million is established for ethylene dichloride in spice oleoresins when present therein...

  19. 49 CFR 173.443 - Contamination control. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Contamination control. 173.443 Section 173.443... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.443 Contamination control. (a) The level of non-fixed (removable) radioactive contamination on the external surfaces of each package offered for...

  20. 21 CFR 173.290 - Trichloroethylene. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Trichloroethylene. 173.290 Section 173.290 Food and..., Lubricants, Release Agents and Related Substances § 173.290 Trichloroethylene. Tolerances are established for residues of trichloroethylene resulting from its use as a solvent in the manufacture of foods as follows...

  1. 21 CFR 173.160 - Candida guilliermondii. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Candida guilliermondii. 173.160 Section 173.160... CONSUMPTION Enzyme Preparations and Microorganisms § 173.160 Candida guilliermondii. The food additive Candida... the following conditions: (a) The food additive is the enzyme system of the viable organism Candida...

  2. 21 CFR 173.255 - Methylene chloride. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methylene chloride. 173.255 Section 173.255 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.255 Methylene chloride. Methylene chloride may be present in food under the following conditions: (a) In spice oleoresins as a residue from...

  3. 21 CFR 173.375 - Cetylpyridinium chloride. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cetylpyridinium chloride. 173.375 Section 173.375... CONSUMPTION Specific Usage Additives § 173.375 Cetylpyridinium chloride. Cetylpyridinium chloride (CAS Reg. No....1666 of this chapter, at a concentration of 1.5 times that of cetylpyridinium chloride. (c) The...

  4. 49 CFR 173.322 - Ethyl chloride. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethyl chloride. 173.322 Section 173.322 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.322 Ethyl chloride. Ethyl chloride must be...

  5. 21 CFR 173.210 - Acetone. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

  6. 19 CFR 173.0 - Scope. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Scope. 173.0 Section 173.0 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.0 Scope. This part deals with the general authority of review, the...

  7. 22 CFR 17.3 - Fault. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fault. 17.3 Section 17.3 Foreign Relations...) § 17.3 Fault. A recipient of an overpayment is without fault if he or she performed no act of... agency may have been at fault in initiating an overpayment will not necessarily relieve the individual...

  8. 33 CFR 173.17 - Reciprocity. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reciprocity. 173.17 Section 173.17 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Numbering § 173.17 Reciprocity. (a) Section...

  9. Electrochemistry and spectroelectrochemistry of tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine, Lu2Pc4 and dimeric lutetium(III) phthalocyanine, Lu2Pc2(OAc)2

    International Nuclear Information System (INIS)

    Koca, Atif; Ceyhan, Tanju; Erbil, Mehmet K.; Ozkaya, Ali Riza; Bekaroglu, Ozer


    In this study, electrochemical, electrochromic and spectroelectrochemical properties of a tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine (Lu 2 Pc 4 2) were investigated explicitly as compared with a tert-butylcalix[4]arene bridged dimeric lutetium(III) phthalocyanine [Lu 2 Pc 2 (OAc) 2 1]. Distinctive differences between electrochemical and electrochromic properties of 1 and 2 were detected. Moreover, the properties of 1 and 2 were compared with previously reported S 4 (CH 2 ) 4 bridged Lu 2 Pc 2 (OAc) 2 and Lu 2 Pc 4 . The calixarene bridged phthalocyanine (Pc) compounds, 1 and 2 showed well-defined electrochromic behaviour with green-blue and blue-purple colour transitions. The enhanced electrochromic properties of 2, as compared to 1, were attributed to its double-decker structure, probably allowing the formation of suitable ion channels for the counter ion movement in the solid film

  10. Photodynamic therapy with motexafin lutetium for rectal cancer: a preclinical model in the dog. (United States)

    Ross, H M; Smelstoys, J A; Davis, G J; Kapatkin, A S; Del Piero, F; Reineke, E; Wang, H; Zhu, T C; Busch, T M; Yodh, A G; Hahn, S M


    Local recurrence of rectal cancer remains a significant clinical problem despite multi-modality therapy. Photodynamic Therapy (PDT) is a cancer treatment which generates tumor kill through the production of singlet oxygen in cells containing a photosensitizing drug when exposed to laser light of a specific wavelength. PDT is a promising modality for prevention of local recurrence of rectal cancer for several reasons: tumor cells may selectively retain photosensitizer at higher levels than normal tissues, the pelvis after mesorectal excision is a fixed space amenable to intra-operative illumination, and PDT can generate toxicity in tissues up to 1 cm thick. This study evaluated the safety, tissue penetration of 730 nm light, normal tissue toxicity and surgical outcome in a dog model of rectal resection after motexafin lutetium-mediated photodynamic therapy. Ten mixed breed dogs were used. Eight dogs underwent proctectomy and low rectal end to end stapled anastomosis. Six dogs received the photosensitizing agent motexafin lutetium (MLu, Pharmacyclics, Inc., Sunnyvale, CA) of 2 mg/kg preoperatively and underwent subsequent pelvic illumination of the transected distal rectum of 730 nm light with light doses ranging from 0.5 J/cm(2) to 10 J/cm(2) three hours after drug delivery. Two dogs received light, but no drug, and underwent proctectomy and low-rectal stapled anastomosis. Two dogs underwent midline laparotomy and pelvic illumination. Light penetration in tissues was determined for small bowel, rectum, pelvic sidewall, and skin. Clinical outcomes were recorded. Animals were sacrificed at 14 days and histological evaluation was performed. All dogs recovered uneventfully. No dog suffered an anastomotic leak. Severe tissue toxicity was not seen. Histological findings at necropsy revealed mild enteritis in all dogs. The excitation light penetration depths were 0.46 +/- 0.18, 0.46 +/- 0.15, and 0.69 +/- 0.39 cm, respectively, for rectum, small bowel, and peritoneum in

  11. Enthalpies of mixing in binary liquid alloys of lutetium with 3d metals

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Michael; Berezutski, Vadim [National Academy of Sciences, Kyiv (Ukraine). I. Frantsevich Institute for Problems of Materials Science; Usenko, Natalia; Kotova, Natalia [Taras Shevchenko National Univ., Kyiv (Ukraine). Dept. of Chemistry


    The enthalpies of mixing in binary liquid alloys of lutetium with chromium, cobalt, nickel and copper were determined at 1 773 - 1 947 K by isoperibolic calorimetry. The enthalpies of mixing in the Lu-Cr melts (measured up to 40 at.% Cr) demonstrate endothermic effects (ΔH = 6.88 ± 0.66 kJ . mol{sup -1} at x{sub Lu} = 0.60), whereas significant exothermic enthalpies of mixing have been established within a wide composition region for the Co-Lu, Ni-Lu and Cu-Lu liquid alloys. Minimum values of the integral enthalpy of mixing are as follows: ΔH{sub min} = -23.57 ± 1.41 kJ . mol{sup -1} at x{sub Lu} = 0.38 for the Co-Lu system; ΔH{sub min} = -48.65 ± 2.83 kJ . mol{sup -1} at x{sub Lu} = 0.40 for the Ni-Lu system; ΔH{sub min} = -24.63 ± 1.52 kJ . mol{sup -1} at x{sub Lu} = 0.37 for the Cu-Lu system.

  12. Optical Fibre NO2 Sensor Based on Lutetium Bisphthalocyanine in a Mesoporous Silica Matrix

    Directory of Open Access Journals (Sweden)

    Marc Debliquy


    Full Text Available In this article, we describe a NO2 sensor consisting of a coating based on lutetium bisphthalocyanine (LuPc2 in mesoporous silica. The sensor exploits the absorption spectrum change of this material which strongly and reversibly decreases in contact with NO2. NO2 is measured by following the amplitude change in the reflected spectrum of the coating deposited on the tip of a silica fibre. As diffusion of NO2 in LuPc2 is slow, the response time could be slow. To reduce it, the active molecules are dispersed in a mesoporous silica matrix deposited by a sol-gel process (Evaporation Induced Self Assembly avoiding the formation of large crystals. Doing so, the response is fairly fast. As the recovery is slow at room temperature, the recovery time is reduced by exposure to UV light at 365 nm. This UV light is directly introduced in the fibre yielding a practical sensor sensitive to NO2 in the ppm range suitable for pollution monitoring.

  13. 21 CFR 211.173 - Laboratory animals. (United States)


    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Laboratory animals. 211.173 Section 211.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS... Laboratory animals. Animals used in testing components, in-process materials, or drug products for compliance...

  14. 46 CFR 173.010 - Definitions. (United States)


    ... VESSEL USE Lifting § 173.010 Definitions. As used in this part— (a) Hook load means the weight of the object lifted by the crane. (b) Crane radius means the distance illustrated in Figure 173.010. EC01MR91...

  15. 21 CFR 173.240 - Isopropyl alcohol. (United States)



  16. 40 CFR 173.9 - Judicial review. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Judicial review. 173.9 Section 173.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES GOVERNING... Judicial review. The State may appeal an order rescinding, in whole or in part, its primary enforcement...

  17. 21 CFR 173.355 - Dichlorodifluoromethane. (United States)


    ... with good manufacturing practice, as a direct-contact freezing agent for foods. (c) To assure safe use... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dichlorodifluoromethane. 173.355 Section 173.355 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...

  18. 7 CFR 1150.173 - Confidential treatment. (United States)


    ... reports of the number of persons subject to this subpart or statistical data collected therefrom, which... 7 Agriculture 9 2010-01-01 2009-01-01 true Confidential treatment. 1150.173 Section 1150.173 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing...

  19. 49 CFR 173.174 - Refrigerating machines. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Refrigerating machines. 173.174 Section 173.174 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Refrigerating machines. A refrigerating machine assembled for shipment and containing 7 kg (15 pounds) or less...

  20. 49 CFR 173.159 - Batteries, wet. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries, wet. 173.159 Section 173.159... Batteries, wet. (a) Electric storage batteries, containing electrolyte acid or alkaline corrosive battery fluid (wet batteries), may not be packed with other materials except as provided in paragraphs (g) and...

  1. 49 CFR 173.163 - Hydrogen fluoride. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen fluoride. 173.163 Section 173.163... Hydrogen fluoride. (a) Hydrogen fluoride (hydrofluoric acid, anhydrous) must be packaged as follows: (1) In... filling ratio of 0.84. (b) A cylinder removed from hydrogen fluoride service must be condemned in...

  2. 21 CFR 173.400 - Dimethyldialkylammonium chloride. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dimethyldialkylammonium chloride. 173.400 Section... HUMAN CONSUMPTION Specific Usage Additives § 173.400 Dimethyldialkylammonium chloride. Dimethyldialkylammonium chloride may be safely used in food in accordance with the following prescribed conditions: (a...

  3. 21 CFR 173.55 - Polyvinylpyrrolidone. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Polyvinylpyrrolidone. 173.55 Section 173.55 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... a residual level not to exceed 40 parts per million. Wine As a clarifying agent, at a residual level...

  4. Lutetium-177 - Broad Production Capabilities are Expected to Stimulate Clinical Applications of this Important Therapeutic Radioisotope

    International Nuclear Information System (INIS)

    Knapp, F.F. Jr.


    Lutetium-177 (Lu-177) is of broad interest for therapeutic applications where the deposition of localized radiation can benefit from the limited soft tissue penetration of the 0.497 MeV beta particle (max. = 2.76 mm). Examples of Lu-177 therapeutic strategies include treatment of small SS2/SS5-expressing tumors with targeted peptides and radiosynovectomy. Emission of a 208 keV gamma photon (11 %) allows imaging for evaluation of localization and biokinetics, and for targeting applications, correlation of uptake with therapeutic response. A broad spectrum of research reactors with even modest thermal neutron flux (e.g. > 1 x 10 14 ) can produce carrier-added Lu-177 with sufficient specific activity (SA) > 10 Ci/mg Lu by the 'direct' approach by irradiation of Lu-176. For low SA applications, thermal flux of > 10 13 in low-medium flux reactors provides sufficient SA (> 0.5 mCi Lu-177/mg) for preparation of Lu-EDTMP for synovectomy. Although relative Lu-177m/Lu-177 activity levels from 'direct' production can be very low (> 10 -5 ), the Lu-177m impurity levels can present an issue with radioactive waste storage requirements at some institutions. The alternative 'indirect' approach using decay of reactor produced ytterbium-177 available from by neutron irradiation of enriched Yb-176 targets provides no-carrier-added (nca) Lu-177 (theoretical SA = 109 Ci/mg Lu). Purification of the microscopic levels of nca Lu-177 from macroscopic Yb levels at the high multi Curie production level is a more challenging approach, since production yields are relatively low even at high thermal flux (e.g. 2 x 10 15 neutrons/cm 2 /sec). In addition, high mass Lu/Yb separation is especially time consuming, can generate significant waste, and the relatively expensive Yb-176 target material (> 97%, ∼ $ 20/mg) must be recovered, re-purified and used for subsequent target preparation. However, a number of effective methods for the Lu/Yb separation and Yb recovery have been reported, and even

  5. Displaying of formation of atomic clusters in radioactive lutetium oxide films

    International Nuclear Information System (INIS)

    Kartashov, V.M.; Troitskata, A.G.


    We earlier reported the results of our investigations of electron spectra of radioactive lutetium oxide films on the magnetic β-spectrometer π√2 with momentum resolution 0.04-0.1 %. The researches were conducted many times during ≅15 years, and a lot of the data has resulted us in the conclusion about possible formation of toroidal structures in these films. It is impossible to consider a radioactive oxide layer, deposited on metallic foil support having the electric potential of its foil support on all its depth because of its high dielectric properties. There is the potential gradient (≅10 6 -10 7 V/c) on its depth because of constant outflow of electrons from its surface. Our experiments included in itself also giving a potential, accelerating for electrons, to the metallic foil support. In this case we received a capability to watch the segments of auto emission and low energy Auger electrons. The analysis of the threshold relations and behavior (in time) of the M 4 NN and M 5 NN Auger electron intensities have resulted us in the conclusion that the greatest contribution to structure formations of these oxide films is introduced by electrons of M 4 -, M 5 - and N-sub-shell of ytterbium atoms (being formed as the result of radioactive decay of the lutetium fraction with half-times from 140 to 1200 days). The auto emission electron spectrum testifies to composite scission of M4 and M5 stationary states of the atom. It is possible to offer as the explanation a quantum flat rotator. If the particle orbit un-compresses the solenoid with a magnetic flux Φ, power condition of a rotator E m =h 2 (m-Φ/Φ 0 ) 2 /(8πm e R 0 2 ), where m e - electron mass, R 0 - an electron orbit radius; m - a magnetic quantum number, a Φ 0 =h c/e - a quantum of magnetic flux. At a quantum flow Φ=nΦ 0 (n - integer) and the power spectrum does not differ from a spectrum without the solenoid. The behavior (in time) of the experimental auto emission electron spectrum responds

  6. Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions

    International Nuclear Information System (INIS)

    Fernandez R, E.


    The stability constants of La 3+ , Pr 3+ , Eu 3+ , Er 3+ and Lu 3+ chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl 2+ ) or two chemical species (LnCl 2+ and LnCl 2 + ). The Specific Ion Interaction Theory was applied to the values of log β I Ln , Cl and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log β I Ln , 2Cl , due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log β I Ln , CI , log β I Ln , 2CI values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log β I Ln , Cl data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

  7. On the effect of ammonia and wet atmospheres on the conducting properties of different lutetium bisphthalocyanine thin films

    International Nuclear Information System (INIS)

    Parra, Vicente; Bouvet, Marcel; Brunet, Jerome; Rodriguez-Mendez, Maria Luz; Saja, Jose Antonio de


    In this article, we present new experimental data regarding the influence of ammonia (NH 3 ) and water (from wet atmospheres) in the conducting properties of lutetium bisphthalocyanine (LuPc 2 )-based films in two very different structural features, namely Langmuir-Blodgett (LB) and vacuum evaporated (VE) films, deposited onto interdigitated electrodes. We pay particular attention to the effect of the mass flow rate ratios of the active gases, which certainly influence the mechanism of conduction of the chemiresistors. The particular trends observed are discussed on the basis of two main contributions: the electronic effects and the competition between gases in the adsorption process

  8. On the effect of ammonia and wet atmospheres on the conducting properties of different lutetium bisphthalocyanine thin films

    Energy Technology Data Exchange (ETDEWEB)

    Parra, Vicente [Ecole Superieure de Physique et Chimie Industrielles (ESPCI) and Laboratoire de Chimie Inorganique et Materiaux Moleculaires-CNRS UMR 7071, Universite Pierre et Marie Curie (Paris 6) (France); Bouvet, Marcel [Ecole Superieure de Physique et Chimie Industrielles (ESPCI) and Laboratoire de Chimie Inorganique et Materiaux Moleculaires-CNRS UMR 7071, Universite Pierre et Marie Curie (Paris 6) (France)], E-mail:; Brunet, Jerome [Universite Blaise Pascal, LASMEA-CNRS UMR 6602, Clermont-Ferrand (France); Rodriguez-Mendez, Maria Luz [Dept. Quimica Fisica y Quimica Inorganica, Escuela Tecnica Superior de Ingenieros Industriales (E.T.S.I.I), Universidad de Valladolid (Spain); Saja, Jose Antonio de [Dept. Fisica de la Materia Condensada, Facultad de Ciencias, Universidad de Valladolid (Spain)


    In this article, we present new experimental data regarding the influence of ammonia (NH{sub 3}) and water (from wet atmospheres) in the conducting properties of lutetium bisphthalocyanine (LuPc{sub 2})-based films in two very different structural features, namely Langmuir-Blodgett (LB) and vacuum evaporated (VE) films, deposited onto interdigitated electrodes. We pay particular attention to the effect of the mass flow rate ratios of the active gases, which certainly influence the mechanism of conduction of the chemiresistors. The particular trends observed are discussed on the basis of two main contributions: the electronic effects and the competition between gases in the adsorption process.

  9. The therapeutic threesome, Iodine 131, Lutetium-111 and Rhenium-188 Radionuclide Trifecta

    International Nuclear Information System (INIS)

    Turner, J.H.


    -limited and manageable. In a physician-sponsored Australian Phase II clinical study grade III/IV haematological toxicity occurred (4% platelets, 16% neutrophils). Objective response rate (ORR) was 76% and Complete Remission (CR) was achieved in 53% (3). The majority of our patients now qualify for outpatient radioimmuno-therapy with 131 Irituximab and monitoring of carer radiation exposure demonstrates that the IAEA and ICRP guidelines of less than 5 mSv per episode of treatment were satisfied in all carers, and visitors to the household were exposed to less than 1 mSv. First-line 131 I-rituximab is now given to patients presenting with newly diagnosed indolent stage IIB, III, IV follicular non-Hodgkin's lymphoma who do not wish to be exposed to the toxic effects of induction chemotherapy. In the INITIAL phase II clinical trial at Fremantle Hospital, after first-line 131 I-rituximab radioimmunotherapy, patients also undergo maintenance rituximab therapy to maintain remission. Clinical ORR is 100% with 80% CR in all patients, as evaluated by 18F-FDG PET imaging at 3 months. This is comparable with the reported ORR of first-line radioimmuno-therapy with 131 I-tositumomab (Bexxar) (4) and achieves the same ORR of standard R-CHOP chemotherapy regimens without the associated toxicity, or any requirement for hospital admission. 2. Lutetium-177 Octreotate Neuroendocrine malignancy is not amenable to chemotherapy and if unresectable due to metastases, usually in liver, the only effective treatment with intent-to cure is radiopeptide therapy. Lutetium-177 octreotate has been demonstrated to achieve ORR 45%, CR 2% (5) which is better than the results of the most effective but relatively more toxic chemotherapy regimen of Streptozotocin + 5FU + Doxorubicin. In an attempt to improve response rates we performed a pilot study of 177 Lu octreotate and capecitabine chemotherapy radiosensitizing therapy comprising 4 cycles of 7.4 GBq 177 Lu-octreotate with 2 weeks 1600 mg/m 2 capecitabine, at

  10. On the use of X-ray absorption spectroscopy to elucidate the structure of lutetium adenosine mono- and triphosphate complexes. (United States)

    Mostapha, S; Berthon, C; Fontaine-Vive, F; Gaysinski, M; Guérin, L; Guillaumont, D; Massi, L; Monfardini, I; Solari, P L; Thomas, O P; Charbonnel, M C; Den Auwer, C


    Although the physiological impact of the actinide elements as nuclear toxicants has been widely investigated for half a century, a description of their interactions with biological molecules remains limited. It is however of primary importance to better assess the determinants of actinide speciation in cells and more generally in living organisms to unravel the molecular processes underlying actinide transport and deposition in tissues. The biological pathways of this family of elements in case of accidental contamination or chronic natural exposure (in the case of uranium rich soils for instance) are therefore a crucial issue of public health and of societal impact. Because of the high chemical affinity of those actinide elements for phosphate groups and the ubiquity of such chemical functions in biochemistry, phosphate derivatives are considered as probable targets of these cations. Among them, nucleotides and in particular adenosine mono- (AMP) and triphosphate (ATP) nucleotides occur in more chemical reactions than any other compounds on the earth's surface, except water, and are therefore critical target molecules. In the present study, we are interested in trans-plutonium actinide elements, in particular americium and curium that are more rarely considered in environmental and bioaccumulation studies than early actinides like uranium, neptunium and plutonium. A first step in this strategy is to work with chemical analogues like lanthanides that are not radioactive and therefore allow extended physical chemical characterization to be conducted that are difficult to perform with radioactive materials. We describe herein the interaction of lutetium(III) with adenosine AMP and ATP. With AMP and ATP, insoluble amorphous compounds have been obtained with molar ratios of 1:2 and 1:1, respectively. With an excess of ATP, with 1:2 molar ratio, a soluble complex has been obtained. A combination of spectroscopic techniques (IR, NMR, ESI-MS, EXAFS) together with quantum

  11. 49 CFR 173.173 - Paint, paint-related material, adhesives, ink and resins. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Paint, paint-related material, adhesives, ink and... Than Class 1 and Class 7 § 173.173 Paint, paint-related material, adhesives, ink and resins. (a) When..., paint-related material, adhesives, ink and resins must be packaged as follows: (1) As prescribed in...

  12. Studies of the radiolabeling and biodistribution of substance P using lutetium-177 as a radiotracer

    International Nuclear Information System (INIS)

    Lima, Clarice Maria de


    Malignant gliomas are primary brain tumors, resistant to various treatments, as chemotherapy, radiotherapy, induction of apoptosis and surgery. An alternative for the treatment of malignant gliomas is the radionuclide therapy. This technique apply radiolabeled molecules that selectively bind to tumor cells producing cytotoxic effect by dose irradiation, and resulting in death of tumor cells. Most protocols for radionuclide therapy of malignant brain tumors involve the administration of peptides labeled with β - emitting radioisotopes. The Substance P (SP) is an 11- amino acid neuropeptide, characterized by the C-terminal sequence Phe-X-Gly-Leu-Met-NH 2 . The use of SP labeled with different radionuclides including 177 Lu, have been proposed for in vivo treatment of tumors. SP is the most important target of neurokinin 1 receptors, over expressed in malignant gliomas. The objective of this work was to study conditions of radiolabeling DOTA-SP with 177 Lu, the stability of labeled compound and in vivo and in vitro, to develop a protocol production and evaluate the potential of the radiopharmaceutical in the therapy of gliomas. The labeling conditions were optimized varying the temperature, reaction time, activity of lutetium-177 chloride and mass of DOTA-SP. The radiochemical purity of preparations were analyzed by chromatographic techniques. The stability of 17L u -DOTA- SP radiolabeled with low activity of 177 Lu was evaluated for different time at 2-8 degree C or incubated in human serum. The stability of the labeled with high activity of 177 Lu was also analyzed in the presence of gentisic acid (6 mg / mL) added after the labeling reaction. The labeled conditions in low and high activity were subjected to evaluation for the ability to cause oxidation of methionine residue, adding the D-L- methionine amino acid to the reaction medium (6 mg / mL) and subsequent chromatographic evaluation. In vitro study with 177 Lu-DOTA-SP, radiolabeled in the absence and presence

  13. Physico-chemical study of erbium, thulium ytterbium and lutetium butyrates

    International Nuclear Information System (INIS)

    Loginova, V.E.; Dvornikova, L.M.; Khazov, L.A.; Rubinshtejn, A.S.


    Er-Lu butyrates have been obtained. The crystals of the obtained salts had an identical shape of combinations of hexagonal prisms and pyramids. The values of the refraction index, measured by the method of circular screening and use of immersion liquids, were found to be close to each other in all the salts considered. The densities of the crystallohydrates of rare earth element butyrates, measured by the pycnometric method in isooctane, increases in the order of Er, Tm, Lu: 1.73; 1.74; 1.79 g/cm 3 , respectively. Infrared spectra of rare earth element butyrates were studied, and the main ware frequencies of maximum absorption were determined with a view of finding the character of the bond between the metal and the anion. A thermo-differential and a thermo-gravimetric investigation of rare earth element butyrates was carried out

  14. 40 CFR 141.173 - Filtration. (United States)


    ... PRIMARY DRINKING WATER REGULATIONS Enhanced Filtration and Disinfection-Systems Serving 10,000 or More People § 141.173 Filtration. A public water system subject to the requirements of this subpart that does... treatment, direct filtration, slow sand filtration, or diatomaceous earth filtration. A public water system...

  15. 21 CFR 173.368 - Ozone. (United States)


    ... CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.368 Ozone. Ozone (CAS Reg. No. 10028-15-6) may be safely used in the treatment, storage, and processing of foods, including meat and poultry (unless such use is precluded by standards of identity in 9...

  16. 49 CFR 173.403 - Definitions. (United States)


    ... emitters and low toxicity alpha emitters or 0.04 Bq/cm2 for all other alpha emitters. Contamination exists... containers.” Graphite means, for the purposes of § 173.453, graphite with a boron equivalent content less... A2/g. Low toxicity alpha emitters means natural uranium; depleted uranium; natural thorium; uranium...

  17. Apparent molar volumes and compressibilities of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in N,N-dimethylformamide and N,N-dimethylacetamide

    International Nuclear Information System (INIS)

    Warmińska, Dorota; Fuchs, Anna; Lundberg, Daniel


    Highlights: ► In DMF the sequence values of both volumes and compressibilities of Ln 3+ ions are: La 3+ ≈ Gd 3+ > Lu 3+ . ► In DMA the ionic volumes of lanthanoid(III) metal ions are, within error limits, identical. ► Obtained results are the consequence of an ion–solvent bonding nature. -- Abstract: The concentration and temperature dependencies of density of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in N,N-dimethylformamide (DMF) and N,N-dimethylacetamide (DMA) have been determined. From density data the apparent molar volumes and partial molar volumes of the salts at infinite dilution as well as the expansibilities have been evaluated. The apparent molar isentropic compressibilities of lanthanum, gadolinium, lutetium and sodium trifluoromethanesulfonates in DMF and DMA have been calculated from sound velocity data obtained at 298.15 K. The results have been discussed in terms of ion–solvent interactions

  18. 49 CFR 173.6 - Materials of trade exceptions. (United States)


    ...-reactive (see § 173.124), poisonous by inhalation (see § 173.133), or a hazardous waste. (b) Packaging. (1..., boxes or compartments. (4) For gasoline, a packaging must be made of metal or plastic and conform to the...

  19. 49 CFR 173.465 - Type A packaging tests. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Type A packaging tests. 173.465 Section 173.465 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.465 Type A packaging tests. (a) The packaging...

  20. 49 CFR 173.3 - Packaging and exceptions. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging and exceptions. 173.3 Section 173.3... SHIPMENTS AND PACKAGINGS General § 173.3 Packaging and exceptions. (a) The packaging of hazardous materials.... standard packaging must be open to inspection by a representative of the Department. (b) The regulations...

  1. 46 CFR 173.062 - Drainage of weather deck. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Drainage of weather deck. 173.062 Section 173.062 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.062 Drainage of weather deck. The weather deck of each sailing...

  2. 29 CFR 1915.173 - Drums and containers. (United States)


    ... 29 Labor 7 2010-07-01 2010-07-01 false Drums and containers. 1915.173 Section 1915.173 Labor... Vessels, Drums and Containers, Other Than Ship's Equipment § 1915.173 Drums and containers. (a) Shipping drums and containers shall not be pressurized to remove their contents. (b) A temporarily assembled...

  3. 25 CFR 173.2 - Project engineer's authority. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Project engineer's authority. 173.2 Section 173.2 Indians... LANDS WITHDRAWN OR ACQUIRED IN CONNECTION WITH INDIAN IRRIGATION PROJECTS § 173.2 Project engineer's authority. The project engineer is the official charged with the responsibility for the enforcement of this...

  4. 49 CFR 173.183 - Nitrocellulose base film. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Nitrocellulose base film. 173.183 Section 173.183... Nitrocellulose base film. Films, nitrocellulose base, must be packaged in packagings conforming to the... tape or paper; authorized only for not over 600 m (1969 feet) of film. [Amdt. 173-224, 55 FR 52643 Dec...

  5. 34 CFR 668.173 - Refund reserve standards. (United States)


    ... 34 Education 3 2010-07-01 2010-07-01 false Refund reserve standards. 668.173 Section 668.173 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Financial Responsibility § 668.173...

  6. 13 CFR 120.173 - Lead-based paint. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Lead-based paint. 120.173 Section 120.173 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Policies Applying to All Business Loans Requirements Imposed Under Other Laws and Orders § 120.173 Lead-based paint. If...

  7. 49 CFR 173.185 - Lithium cells and batteries. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Lithium cells and batteries. 173.185 Section 173... Class 7 § 173.185 Lithium cells and batteries. (a) Cells and batteries. A lithium cell or battery, including a lithium polymer cell or battery and a lithium-ion cell or battery, must conform to all of the...

  8. 21 CFR 173.275 - Hydrogenated sperm oil. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Hydrogenated sperm oil. 173.275 Section 173.275... CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.275 Hydrogenated sperm oil. The food additive hydrogenated sperm oil may be safely used in accordance with the following prescribed...

  9. 49 CFR 173.31 - Use of tank cars. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Use of tank cars. 173.31 Section 173.31... SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.31 Use of tank cars. (a) General. (1) No person may offer a hazardous material for transportation in a tank car unless the tank car...

  10. 19 CFR 173.1 - Authority to review for error. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to review for error. 173.1 Section 173.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.1 Authority to review for error. Port directors...

  11. 46 CFR 173.051 - Public nautical school ships. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school ships. 173.051 Section 173.051 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.051 Public nautical school ships. Each public nautical school...

  12. Labelling of the peptide Dota-Octreotate with Lutetium 177; Marcado del peptido Dota-Octreotate con Lutecio 177

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez B, C.A


    In this work is described the optimization of the reaction conditions to obtain the complex {sup 177} Lu-Dota-TATE with a radiochemical purity > 95%, even so the studies of stability In vitro to the dilution in saline solution, stability in human serum and challenge to the cystein. The biodistribution studies are presented in mice Balb-C and the tests of biological recognition using one lines cellular of pancreatic adenoma (AR42-J). The obtained results show a high stability of the radio complex in vitro, since it doesn't suffer trans chelation from the Lutetium-177 to plasmatic proteins. The biodistribution tests in mice Balb-C demonstrated an appropriate lipophilly of the complex to be excreted in more proportion by the kidneys without significant accumulation in healthy tissues. It is necessary to mention that the drop activity specifies (3.54 {mu}g / 37 MBq) obtained in the irradiation of {sup 176} Lu{sub 2}O{sub 3} it allowed to verify the union of the {sup 177}Lu-Dota-Tate to membrane receivers but without being able to obtain the saturation curves and competition required to characterize quantitatively the biological recognition. (Author)

  13. Spectroscopic studies of lutetium pyro-silicates Lu2Si2O7 doped with bismuth and europium

    International Nuclear Information System (INIS)

    Bretheau-Raynal, Francoise


    Single crystals of thortveitite structure pyro-silicates were grown by a floating zone technique associated with an arc image furnace. The samples were systematically characterized by X-Ray diffraction and microprobe analysis. Thanks to oriented single crystals of Lu 2 Si 2 O 7 , Yb 2 Si 2 O 7 and Sc 2 Si 2 O 7 , the recorded infrared and Raman spectra allow complete attribution of internal and external vibration modes, in good agreement with group theory predictions for C 2h factor group. Spectroscopic studies of Eu 3+ doping ion in Lu 2 Si 2 O 7 confirm C 2 point symmetry for the cationic site. Oscillator strengths and Judd-Ofelt parameters for Eu 3+ were calculated. A three level scheme ( 1 S 0 , 3 P 0 , 3 P 1 ) of Bi 3+ ion is used to explain radiative and non radiative mechanisms in Lu 2 Si 2 O 7 doped with bismuth. Finally, the mechanisms of low temperature (T =9 K) energy transfer between Bi 3+ and Eu 3+ in lutetium pyro-silicate was studied. The transfer occurs by non radiative process, without any diffusion of the excitation energy within the donor system and is due to dipole-dipole interactions between Bi 3+ and Eu 3+ ions. (author) [fr

  14. Radiolabeling of substance P with Lutetium-177 and biodistribution study in AR42J pancreatic tumor xenografted Nude mice

    International Nuclear Information System (INIS)

    Araujo, Bortoleti de; Pujatti, Priscilla Brunelli; Barrio, Ofelia; Caldeira, Jose S.; Mengatti, Jair; Suzuki, Miriam F.


    Pancreatic tumor (PT) is a neuroendocrine neoplasm that usually origin metastases in the respiratory and gastrointestinal tract. In recent years, new developments in targeted therapies have emerged and the presence of peptide receptors at the cell membrane of PT constitutes the basis of the clinical use of specific radiolabeled ligands. Substance P, an 11-amino acid peptide which has an important role in modulating pain transmission trough neurokinin 1 and 2 receptors (NKr), may play a role in the pathogenesis of PT, because approximately 10% of these tumors over express NKr. The aim of the present work was to produce a pure and stable SP analog (DOTA-SP) radiolabeled with Lutetium-177 ( 177 Lu), and to evaluate its in vivo target to AR42J pancreatic tumor cells in Nude mice in other to verify if SP can be used in this pancreatic tumor detection and treatment. 177 Lu (half-life 6.7 days) has both β and γ-emissions suitable for radiotherapy and imaging respectively. Substance P was successfully labeled with high yield (>99%) at optimized conditions and kept stable for more than 72 hours at 4 deg C and 24 hours in human plasma. Biodistribution studies showed that SP excretion was mainly performed by renal pathway. In addition, 177 Lu-DOTA-SP showed higher uptake by tumor than normal pancreas, indicating the presence of NK receptors in AR42J pancreatic tumor. (author)

  15. {sup 177}Lutetium-DOTATATE peptide radio-receptor therapy for patients with endocrine neoplasm and the individualized semi-automatic dosimetry. A retrospective analysis; {sup 177}Lutetium-DOTATATE-Peptid-Radio-Rezeptor-Therapie bei Patienten mit neuroendokrinen Neoplasien und die individualisierte, semi-automatische-Dosimetrie. Eine retrospektive Analyse

    Energy Technology Data Exchange (ETDEWEB)

    Loeser, Anastassia


    The {sup 177}lutetium-DOTATATE peptide radio-receptor therapy is a promising approach for the palliative treatment of patients with inoperable endocrine neoplasm. The individually variable biological dispersion and the tumor uptake including the protection of critical organs require a precise and reliable organ and tumor dosimetry. The HERMES Hybrid dosimetry module has appeared as reliable and user-friendly tool for clinical application. The next step is supposed to by the complete integration of 3D SPECT imaging.

  16. Quantifying public radiation exposure related to lutetium-177 octreotate therapy for the development of a safe outpatient treatment protocol. (United States)

    Olmstead, Craig; Cruz, Kyle; Stodilka, Robert; Zabel, Pamela; Wolfson, Robert


    Radionuclide therapies, including treatment of neuroendocrine tumors with lutetium-177 (Lu-177) octreotate, often involve hospital admission to minimize radiation exposure to the public. Overnight admission due to Lu-177 octreotate therapy incurs additional cost for the hospital and is an inconvenience for the patient. This study endeavors to characterize the potential radiation risk to caregivers and the public should Lu-177 octreotate therapies be performed on an outpatient basis. Dose rate measurements of radiation emanating from 10 patients were taken 30 min, 4, and 20 h after initiation of Lu-177 octreotate therapy. Instadose radiation dose measurement monitors were also placed around the patients' rooms to assess the potential cumulative radiation exposure during the initial 30 min-4 h after treatment (simulating the hospital-based component of the outpatient model) as well as 4-20 h after treatment (simulating the discharged outpatient portion). The mean recorded dose rate at 30 min, 4, and 20 h after therapy was 20.4, 14.0, and 6.6 μSv/h, respectively. The majority of the cumulative dose readings were below the minimum recordable threshold of 0.03 mSv, with a maximum dose recorded of 0.18 mSv. Given the low dose rate and cumulative levels of radiation measured, the results support that an outpatient Lu-177 octreotate treatment protocol would not jeopardize public safety. Nevertheless, the concept of ALARA still requires that detailed radiation safety protocols be developed for Lu-177 octreotate outpatients to minimize radiation exposure to family members, caregivers, and the general public.

  17. 49 CFR 173.2 - Hazardous materials classes and index to hazard class definitions. (United States)


    ....50 1 1.6 Extremely insensitive detonating substances 173.50 2 2.1 Flammable gas 173.115 2 2.2 Non-flammable compressed gas 173.115 2 2.3 Poisonous gas 173.115 3 Flammable and combustible liquid 173.120 4 4.1 Flammable solid 173.124 4 4.2 Spontaneously combustible material 173.124 4 4.3 Dangerous when wet...

  18. 7 CFR 993.173 - Reports of accounting. (United States)


    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Reports of accounting. 993.173 Section 993.173... accounting. (a) Independent handler's reports of accounting. Within 10 days (exclusive of Saturdays, Sundays... association, makes an accounting or settlement with a producer or dehydrator for prunes delivered to him, he...

  19. 49 CFR 173.23 - Previously authorized packaging. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Previously authorized packaging. 173.23 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.23 Previously authorized packaging. (a) When the regulations specify a packaging with a specification marking...

  20. 49 CFR 173.206 - Packaging requirements for chlorosilanes. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging requirements for chlorosilanes. 173.206...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Non-bulk Packaging for Hazardous Materials Other Than Class 1 and Class 7 § 173.206 Packaging requirements for chlorosilanes. (a) When § 172.101 of this...

  1. 21 CFR 173.250 - Methyl alcohol residues. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl alcohol residues. 173.250 Section 173.250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD.... Methyl alcohol may be present in the following foods under the conditions specified: (a) In spice...

  2. 1 CFR 17.3 - Criteria for emergency publication. (United States)


    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Criteria for emergency publication. 17.3..., AND PROCESSING OF DOCUMENTS FILING FOR PUBLIC INSPECTION AND PUBLICATION SCHEDULES Emergency Schedule § 17.3 Criteria for emergency publication. The emergency schedule is designed to provide the fastest...

  3. 27 CFR 25.173 - Brewer in default. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Brewer in default. 25.173... OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.173 Brewer in default. (a) When a... the brewer is otherwise in default in payment of tax under § 25.164, beer may not be removed for...

  4. 9 CFR 381.173 - Mechanically Separated (Kind of Poultry). (United States)



  5. 40 CFR 265.173 - Management of containers. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 265.173... DISPOSAL FACILITIES Use and Management of Containers § 265.173 Management of containers. (a) A container... waste. (b) A container holding hazardous waste must not be opened, handled, or stored in a manner which...

  6. 40 CFR 264.173 - Management of containers. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 264.173... Use and Management of Containers § 264.173 Management of containers. (a) A container holding hazardous... container holding hazardous waste must not be opened, handled, or stored in a manner which may rupture the...

  7. 14 CFR 25.173 - Static longitudinal stability. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 25.173... AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Flight Stability § 25.173 Static... forces (including friction) must be as follows: (a) A pull must be required to obtain and maintain speeds...

  8. 14 CFR 23.173 - Static longitudinal stability. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 23.173... Stability § 23.173 Static longitudinal stability. Under the conditions specified in § 23.175 and with the airplane trimmed as indicated, the characteristics of the elevator control forces and the friction within...

  9. 49 CFR 173.316 - Cryogenic liquids in cylinders. (United States)


    ... filling density for hydrogen, cryogenic liquid is defined as the percent ratio of the weight of lading in... 49 Transportation 2 2010-10-01 2010-10-01 false Cryogenic liquids in cylinders. 173.316 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.316 Cryogenic liquids in...

  10. 49 CFR 173.194 - Gas identification sets. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Gas identification sets. 173.194 Section 173.194... Gas identification sets. Gas identification sets containing poisonous material must be packaged in... silical gel, gas identification sets may be shipped as follows: (1) If the poisonous material does not...

  11. 21 CFR 133.173 - Pasteurized process cheese food. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese food. 133.173 Section 133.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  12. 49 CFR 173.219 - Life-saving appliances. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Life-saving appliances. 173.219 Section 173.219... Life-saving appliances. (a) A life-saving appliance, self-inflating or non-self-inflating, containing small quantities of hazardous materials that are required as part of the life-saving appliance must...

  13. Development of lutetium-labeled bombesin derivates: relationship between structure and diagnostic-therapeutic activity for prostate tumor

    International Nuclear Information System (INIS)

    Pujatti, Priscilla Brunelli


    Bombesin (BBN) receptors - in particular, the gastrin-releasing peptide (GRP) receptor peptide - have been shown to be massively over expressed in several human tumors types, including prostate cancer, and could be an alternative as target for its treatment by radionuclide therapy (RNT). A large number of BBN analogs had already been synthesized for this purpose and have shown to reduce tumor growth in mice. Nevertheless, most of the studied analogs exhibit high abdominal accumulation, especially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. The goal of the present work was to radiolabel a novel series of bombesin derivatives with lutetium-177 and to evaluate the relationship between their structure and diagnostic-therapeutic activity for prostate tumor. The generic structure of studied peptides is DOTA-Phe-(Gly) n -BBN(6-14), where DOTA is the chelator, n is the number of glycine amino acids of Phe-(Gly) n spacer and BBN(6-14) is the bombesin sequence from the amino acid 6 to the amino acid 14. Preliminary studies were done to establish the ideal labeling conditions for obtaining the highest yield of labeled bombesin derivatives, determined by instant thin layer chromatography (ITLC-SG) and high performance liquid chromatography (HPLC). The stability of the preparations was evaluated either after storing at 2-8 degree C or incubation in human serum at 37 degree C and the partition coefficient was determined in n:octanol:water. In vivo studies were performed in both healthy Balb-c and Nude mice bearing PC-3 xenografts, in order to characterize the biological properties of labeled peptides. In vitro studies involved the evaluation of cold bombesin derivatives effect in PC-3 cells proliferation. Bombesin derivatives were successfully labeled with high yield at optimized conditions and exhibited high stability at 4 degree C. The analysis of the

  14. 46 CFR 173.058 - Double bottom requirements. (United States)


    ... PERTAINING TO VESSEL USE School Ships § 173.058 Double bottom requirements. Each new sailing school vessel... service must comply with the double bottom requirements in §§ 171.105 through 171.109, inclusive, of this...

  15. 46 CFR 173.007 - Location of the hook load. (United States)


    ... PERTAINING TO VESSEL USE Lifting § 173.007 Location of the hook load. When doing the calculations required in this subpart, the hook load must be considered to be located at the head of the crane. ...

  16. 49 CFR 173.218 - Fish meal or fish scrap. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Fish meal or fish scrap. 173.218 Section 173.218... Fish meal or fish scrap. (a) Except as provided in Column (7) of the HMT in § 172.101 of this subchapter, fish meal or fish scrap, containing at least 6%, but not more than 12% water, is authorized for...

  17. 32 CFR 173.3 - Profit reduction clause. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Profit reduction clause. 173.3 Section 173.3... violating 18 U.S.C. 201-224 (bribery, graft, and conflicts of interest), 18 U.S.C. 371 (conspiracy), 18 U.S.... 1341 (fraud), 18 U.S.C. 1343 (fraud by wire) for any act in connection with or related to the obtaining...

  18. Study of the viability of the production of lutetium - 177 in the nuclear reactor IEA-R1 at IPEN/CNEN-SP

    International Nuclear Information System (INIS)

    Silva, Giovana Pasqualini da


    The - emitter 177 Lu is a promising therapeutic radioisotope for the curative treatment of cancer using labelled proteins. It has a half - life of 6.71 day and maximum and average (3 energies of 421 and 133 keV, respectively, resulting in a short range of irradiation of tissue. The decay is accompanied by the emission of low energy -radiation of 208.3 keV (11%) and 113 keV (6.4%), suitable for simultaneous imaging. Lu can be produced by two different routes, namely, by irradiation of natural Lu 2 O 3 target ( 176 Lu, 2.6%) or enriched (in 176 Lu) Lu 2 O 3 target, and also by irradiation of Yb target (Yb 2 O 3 ) followed by radiochemical separation of Lu from Yb isotopes. The objective of this work is the development of a method of the production of 177 Lu through of the (n, gamma) nuclear reaction, by the direct and indirect method of production. Targets of lutetium oxide and ytterbium oxide were irradiated for evaluation of the activity produced and the chemical separation of lutetium and ytterbium was studied using different ion exchange resins. For the direct method, the best results were obtained using the target Lu 2 O 3 enriched in 39.6%. The best results for the indirect method were achieved with the process of separation using 0.25M - HlBA as eluent. The results showed that it is possible to produce 177 Lu of low specific activity for labeling molecules used for bone pain relief and in radiosynoviortesy. (author)

  19. Electrochemistry and spectroelectrochemistry of tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine, Lu{sub 2}Pc{sub 4} and dimeric lutetium(III) phthalocyanine, Lu{sub 2}Pc{sub 2}(OAc){sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Koca, Atif [Chemical Engineering Department, Engineering Faculty, Marmara University, TR34722 Goeztepe, Istanbul (Turkey); Ceyhan, Tanju; Erbil, Mehmet K. [Department of Biochemistry, Division of Organic Chemistry, Guelhane Medical Academy (GATA), Ankara (Turkey); Ozkaya, Ali Riza [Department of Chemistry, Marmara University, TR34722 Goeztepe, Istanbul (Turkey)], E-mail:; Bekaroglu, Ozer [Department of Chemistry, Technical University of Istanbul, TR34469 Maslak, Istanbul (Turkey)], E-mail:


    In this study, electrochemical, electrochromic and spectroelectrochemical properties of a tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine (Lu{sub 2}Pc{sub 4}2) were investigated explicitly as compared with a tert-butylcalix[4]arene bridged dimeric lutetium(III) phthalocyanine [Lu{sub 2}Pc{sub 2}(OAc){sub 2}1]. Distinctive differences between electrochemical and electrochromic properties of 1 and 2 were detected. Moreover, the properties of 1 and 2 were compared with previously reported S{sub 4}(CH{sub 2}){sub 4} bridged Lu{sub 2}Pc{sub 2}(OAc){sub 2} and Lu{sub 2}Pc{sub 4}. The calixarene bridged phthalocyanine (Pc) compounds, 1 and 2 showed well-defined electrochromic behaviour with green-blue and blue-purple colour transitions. The enhanced electrochromic properties of 2, as compared to 1, were attributed to its double-decker structure, probably allowing the formation of suitable ion channels for the counter ion movement in the solid film.

  20. 49 CFR 173.340 - Tear gas devices. (United States)


    ... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.340 Tear gas devices. (a) Packagings for...) Tear gas devices may not be assembled with, or packed in the same packaging with, mechanically- or manually-operated firing, igniting, bursting, or other functioning elements unless of a type and design...

  1. 40 CFR 98.173 - Calculating GHG emissions. (United States)


    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Iron and Steel Production § 98.173 Calculating GHG emissions... for the process as specified in paragraphs (b)(1)(i) through (b)(1)(vii) of this section. The... the gaseous fuel (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf per kg-mole at standard...

  2. 33 CFR 173.27 - Numbers: Display; size; color. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Numbers: Display; size; color...: Display; size; color. (a) Each number required by § 173.15 must: (1) Be painted on or permanently attached...; (3) Contrast with the color of the background and be distinctly visible and legible; (4) Have spaces...

  3. 21 CFR 173.21 - Perfluorinated ion exchange membranes. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Perfluorinated ion exchange membranes. 173.21... ion exchange membranes. Substances identified in paragraph (a) of this section may be safely used as ion exchange membranes intended for use in the treatment of bulk quantities of liquid food under the...

  4. 49 CFR 173.60 - General packaging requirements for explosives. (United States)


    ... explosives contained in the package, so that neither interaction between the explosives and the packaging... 49 Transportation 2 2010-10-01 2010-10-01 false General packaging requirements for explosives. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1...

  5. 21 CFR 173.395 - Trifluoromethane sulfonic acid. (United States)


    ...) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.395 Trifluoromethane sulfonic acid. Trifluoromethane sulfonic acid... acid) may safely be used in the production of cocoa butter substitute from palm oil (1-palmitoyl-2...

  6. 14 CFR 135.173 - Airborne thunderstorm detection equipment requirements. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airborne thunderstorm detection equipment... Aircraft and Equipment § 135.173 Airborne thunderstorm detection equipment requirements. (a) No person may... the aircraft is equipped with either approved thunderstorm detection equipment or approved airborne...

  7. 49 CFR 173.306 - Limited quantities of compressed gases. (United States)


    ... container must be weighed and leak tested. The leak detection equipment must be sufficiently sensitive to... Section 173.306 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... softening provided that it does not leak. (vi) As an alternative to the hot water bath test in paragraph (a...

  8. 49 CFR 173.312 - Requirements for shipment of MEGCs. (United States)


    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.312 Requirements... MEGC's structural or service equipment may be affected. (4) No person may fill or offer for... requalification due date. (5) Prior to filling and offering a MEGC for transportation, the MEGC's structural and...

  9. 49 CFR 173.7 - Government operations and materials. (United States)


    ...) Determining the airworthiness and directing maintenance of the aircraft; and (3) Dispatching the aircraft... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.7 Government operations and materials. (a) Hazardous... regulations in this subchapter or in packagings of equal or greater strength and efficiency as certified by...

  10. 49 CFR 173.189 - Batteries containing sodium or cells containing sodium. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries containing sodium or cells containing sodium. 173.189 Section 173.189 Transportation Other Regulations Relating to Transportation PIPELINE AND... Than Class 1 and Class 7 § 173.189 Batteries containing sodium or cells containing sodium. (a...

  11. 36 CFR 1192.173 - Automated guideway transit vehicles and systems. (United States)


    .... Vertical alignment may be accomplished by vehicle air suspension or other suitable means of meeting the... vehicles and systems. 1192.173 Section 1192.173 Parks, Forests, and Public Property ARCHITECTURAL AND... TRANSPORTATION VEHICLES Other Vehicles and Systems § 1192.173 Automated guideway transit vehicles and systems. (a...

  12. 49 CFR 173.182 - Barium azide-50 percent or more water wet. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Barium azide-50 percent or more water wet. 173.182 Section 173.182 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... Class 1 and Class 7 § 173.182 Barium azide—50 percent or more water wet. Barium azide—50 percent or more...

  13. 19 CFR 191.173 - Imported duty-paid derivatives (no manufacture). (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Imported duty-paid derivatives (no manufacture). 191.173 Section 191.173 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... § 191.173 Imported duty-paid derivatives (no manufacture). When the basis for drawback under 19 U.S.C...

  14. Synthesis and up-conversion white light emission of RE{sup 3+}-doped lutetium oxide nanocubes as a single compound

    Energy Technology Data Exchange (ETDEWEB)

    Hu Shanshan [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Yang Jun, E-mail: [School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li Chunxia [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Lin Jun, E-mail: [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)


    Highlights: Black-Right-Pointing-Pointer Uniform and dispersive cubic precursor can be synthesized by sample hydrothermal process. Black-Right-Pointing-Pointer Hydrothermal precursor could transform to Lu{sub 2}O{sub 3}:RE{sup 3+} with its original cubic morphology. Black-Right-Pointing-Pointer Nearly equal intensities of blue, green, and red emissions under single 980 nm laser. Black-Right-Pointing-Pointer Lu{sub 2}O{sub 3}:RE{sup 3+} show bright white light emission, clearly visible to the naked eyes. Black-Right-Pointing-Pointer Chromaticity coordinate is very close to the standard equal energy white light illuminate. - Abstract: Uniform and dispersive Lu{sub 2}O{sub 3}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} nanocubes have been successfully synthesized by hydrothermal process with subsequent calcination at 900 Degree-Sign C. The as-formed RE{sup 3+}-doped lutetium oxide precursor via the hydrothermal process, as a template, could transform to RE{sup 3+}-doped Lu{sub 2}O{sub 3} with their original cubic morphology and slight shrinkage in the size after post-annealing process. The formation mechanism for the lutetium oxide precursor cubes has been proposed. Under single wavelength diode laser excitation of 980 nm, the as-obtained Lu{sub 2}O{sub 3}:3%Yb{sup 3+}/0.5%Er{sup 3+}/0.3%Tm{sup 3+} nanocubes show nearly equal intensities of blue (Tm{sup 3+}: {sup 1}G{sub 4} {yields} {sup 3}H{sub 6}), green (Er{sup 3+}: ({sup 2}H{sub 11/2}, {sup 4}S{sub 3/2}) {yields} {sup 4}I{sub 15/2}), and red (Er{sup 3+}: {sup 4}F{sub 9/2} {yields} {sup 4}I{sub 15/2}) emissions, which produces bright white light emission, clearly visible to the naked eyes. The main pathways to populate the upper emitting states come from the energy-transfer processes from Yb{sup 3+} to Tm{sup 3+}/Er{sup 3+}, respectively. The chromaticity coordinate of the Lu{sub 2}O{sub 3}:3%Yb{sup 3+}/0.5%Er{sup 3+}/0.3%Tm{sup 3+} sample is calculated to be about x = 0.3403 and y = 0.3169, which falls exactly within the

  15. Development of a novel bombesin analog radiolabeled with Lutetium-177: in vivo evaluation of the biological properties in Balb-C mice

    International Nuclear Information System (INIS)

    Pujatti, Priscilla Brunelli; Barrio, Ofelia; Santos, Josefina da Silva; Mengatti, Jair; Araujo, Elaine Bortoleti de


    Bombesin (BBN), a 14-aminoacid amphibian peptide homologue of mammalian gastrin-releasing peptide (GRP), has demonstrated the ability to bind with high affinity and specificity to GRP receptor, which are overexpressed on a variety of human cancers. A large number of BBN analogs were synthesized for this purpose and have shown to reduce tumor growth in mice. However, most of the studied analogs exhibit high abdominal accumulation, specially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. In this study we describe the results of radiolabeling with lutetium-177 ( 177 Lu) and in vivo biodistribution and pharmacokinetics studies in normal Balb-C mice of a novel bombesin analog (BBNp4) - DOTA-X-BBN(6-14), where X is a spacer of four aminoacids. This spacer was inserted between the chelator and the binding sequence in order to improve bombesin in vivo properties. BBNp4 was successfully labeled with high yield and kept stable for more than 96 hours at 4 deg C and 4 hours in human plasma. Data analysis obtained from the in vivo studies showed that the amount of BBNp4 present in plasma decreased rapidly and became almost undetectable at 60 min p.i., indicating rapid peptide excretion, which is performed mainly by renal pathway. In addition, biodistribution and single photon emission tomography showed low abdominal accumulation of 177 Lu-DOTA-X-BBN(6-14), indicating that this analog is a potential candidate for tumors target therapy. (author)

  16. Solvent extraction of anionic chelate complexes of lanthanum(III), europium(III), lutetium(III), scandium(III), and indium(III) with 2-thenoyltrifluoroacetone as ion-pairs with tetrabutylammonium ions

    International Nuclear Information System (INIS)

    Noro, Junji; Sekine, Tatsuya.


    The solvent extraction of lanthanum(III), europium(III), lutetium(III), scandium(III), and indium(III) in 0.1 mol dm -3 sodium nitrate solutions with 2-thenoyltrifluoroacetone (Htta) in the absence and presence of tetrabutylammonium ions (tba + ) into carbon tetrachloride was measured. The extraction of lanthanum(III), europium(III), and lutetium(III) was greatly enhanced by the addition of tba + ; this could be explained in terms of the extraction of a ternary complex, M(tta) 4 - tba + . However, the extractions of scandium(III) and indium(III) were nearly the same when tba + was added. The data were treated on the basis of the formation equilibrium of the ternary complex from the neutral chelate, M(tta) 3 , with the extracted ion-pairs of the reagents, tta - tba + , in the organic phase. It was concluded that the degree of association of M(tta) 3 with the ion-pair, tta - tba + , is greater in the order La(tta) 3 ≅ Eu(tta) 3 > Lu(tta) 3 , or that the stability of the ternary complex in the organic phase is higher in the order La(tta) 4 - tba + ≅ Eu(tta) 4 - tba + > Lu(tta) 4 - tba + . This is similar to those of adduct metal chelates of Htta with tributylphosphate (TBP) in synergistic extraction systems. (author)

  17. Lithium perbromate monohydrate at 296 and 173 K

    International Nuclear Information System (INIS)

    Blackburn, A.C.; Gerkin, R.E.


    Lithium tetraoxobromate(1-) monohydrate, LiBrO 4 .H 2 O, whose perchlorate analog has not yet been described, is found to be isomorphic with NaBrO 4 .H 2 O and NaClO 4 .H 2 O. Each of the two inequivalent Li ions is coordinated by six O atoms, thus forming distorted octahedra, each of which has three inequivalent Li-O distances. At room temperature, the average Li(1)-O and Li(2)-O distances are 2.150 and 2.164 A, respectively. The perbromate ion displays very nearly regular tetrahedral geometry, although it is not subject to symmetry constraints. At 296 K the average observed Br-O distance is 1.610 (4) A and the average O-Br-O angle is 109.5 (6) , while at 173 K the corresponding values are 1.613 (4) A and 109.5 (7) . The perbromate ion shows rigid-body behavior but the lithium coordination polyhedra do not. At 296 K, the average rigid-body corrected Br-O distance in the perbromate ion is 1.624 (3) A, in excellent agreement with the corresponding value reported for NaBrO 4 .H 2 O. Refinement of the two inequivalent H atoms allowed detailed analysis of the hydrogen bonding, which is more extensive than in NaBrO 4 .H 2 O or in NaClO 4 .H 2 O. The average observed B values for the H atoms [2.9 (3) A 2 at 296 K and 2.8 (3) A 2 at 173 K] are sufficiently small to suggest that dynamic disordering of the H atoms (determined by magnetic resonance methods for NaClO 4 .H 2 O) is not significant in the title salt. (orig.)

  18. Studies of the radiolabeling and biodistribution of substance P using lutetium-177 as a radiotracer; Estudo da marcacao e biodistribuicao da substancia P utilizando lutecio-177 como radiotracador

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Clarice Maria de


    Malignant gliomas are primary brain tumors, resistant to various treatments, as chemotherapy, radiotherapy, induction of apoptosis and surgery. An alternative for the treatment of malignant gliomas is the radionuclide therapy. This technique apply radiolabeled molecules that selectively bind to tumor cells producing cytotoxic effect by dose irradiation, and resulting in death of tumor cells. Most protocols for radionuclide therapy of malignant brain tumors involve the administration of peptides labeled with {beta}{sup -} emitting radioisotopes. The Substance P (SP) is an 11- amino acid neuropeptide, characterized by the C-terminal sequence Phe-X-Gly-Leu-Met-NH{sub 2}. The use of SP labeled with different radionuclides including {sup 177}Lu, have been proposed for in vivo treatment of tumors. SP is the most important target of neurokinin 1 receptors, over expressed in malignant gliomas. The objective of this work was to study conditions of radiolabeling DOTA-SP with {sup 177}Lu, the stability of labeled compound and in vivo and in vitro, to develop a protocol production and evaluate the potential of the radiopharmaceutical in the therapy of gliomas. The labeling conditions were optimized varying the temperature, reaction time, activity of lutetium-177 chloride and mass of DOTA-SP. The radiochemical purity of preparations were analyzed by chromatographic techniques. The stability of {sup 17L}u -DOTA- SP radiolabeled with low activity of {sup 177}Lu was evaluated for different time at 2-8 degree C or incubated in human serum. The stability of the labeled with high activity of {sup 177}Lu was also analyzed in the presence of gentisic acid (6 mg / mL) added after the labeling reaction. The labeled conditions in low and high activity were subjected to evaluation for the ability to cause oxidation of methionine residue, adding the D-L- methionine amino acid to the reaction medium (6 mg / mL) and subsequent chromatographic evaluation. In vitro study with {sup 177}Lu

  19. 49 CFR 173.474 - Quality control for construction of packaging. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Quality control for construction of packaging. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.474 Quality control for construction of packaging. Prior to the first use of any packaging for the shipment of Class 7...

  20. 49 CFR 173.466 - Additional tests for Type A packagings designed for liquids and gases. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Additional tests for Type A packagings designed...) Materials § 173.466 Additional tests for Type A packagings designed for liquids and gases. (a) In addition to the tests prescribed in § 173.465, Type A packagings designed for liquids and gases must be...

  1. 49 CFR 173.161 - Chemical kits and first aid kits. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  2. 30 CFR 206.173 - How do I calculate the alternative methodology for dual accounting? (United States)


    ... measured at facility measurement points whose quality exceeds 1,000 Btu/cf are subject to dual accounting... for dual accounting? 206.173 Section 206.173 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... the alternative methodology for dual accounting? (a) Electing a dual accounting method. (1) If you are...

  3. 49 CFR 173.172 - Aircraft hydraulic power unit fuel tank. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Aircraft hydraulic power unit fuel tank. 173.172... Class 1 and Class 7 § 173.172 Aircraft hydraulic power unit fuel tank. Aircraft hydraulic power unit fuel tanks containing a mixture of anhydrous hydrazine and monomethyl hydrazine (M86 fuel) and designed...

  4. 49 CFR 173.159a - Exceptions for non-spillable batteries. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Exceptions for non-spillable batteries. 173.159a... Class 1 and Class 7 § 173.159a Exceptions for non-spillable batteries. (a) Exceptions for hazardous...-spillable batteries offered for transportation or transported in accordance with this section are subject to...

  5. 21 CFR 173.140 - Esterase-lipase derived from Mucor miehei. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Esterase-lipase derived from Mucor miehei. 173.140... HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.140 Esterase-lipase derived from Mucor miehei. Esterase-lipase enzyme, consisting of enzyme derived from Mucor miehei var. Cooney et Emerson by...

  6. 19 CFR 173.5 - Review of entry covering household or personal effects. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Review of entry covering household or personal effects. 173.5 Section 173.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... authority to grant. Where the port director has no authority to grant the waiver, the application shall be...

  7. 21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. (United States)


    ... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...

  8. 33 CFR 173.85 - Fees levied by the Coast Guard. (United States)


    .... 173.85 Section 173.85 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Issue of Certificate of.... (b) Fees are payable by check or money-order made payable to the “U.S. Coast Guard”; by major credit...

  9. 21 CFR 173.280 - Solvent extraction process for citric acid. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Solvent extraction process for citric acid. 173.280... HUMAN CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.280 Solvent extraction process for citric acid. A solvent extraction process for recovery of citric acid from...

  10. 21 CFR 173.70 - Chloromethylated aminated styrene-divinylbenzene resin. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Chloromethylated aminated styrene-divinylbenzene resin. 173.70 Section 173.70 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Polymer...

  11. 49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium. (United States)


    ... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

  12. Multi-quasi-particle states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.


    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd( 18 O, 5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 13/2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3qp states are the previously known K π =19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π =(13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5qp state with K π =(29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. (orig.)

  13. Multi-quasi-particles states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.


    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd ( 18 O,5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 1 3 /2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3 qp states are the previously known K π 19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π = (13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5 qp state with K π = (29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. 28 refs., 2 tabs., 9 figs

  14. 49 CFR 17.3 - What programs and activities of the Department are subject to these regulations? (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false What programs and activities of the Department are subject to these regulations? 17.3 Section 17.3 Transportation Office of the Secretary of Transportation INTERGOVERNMENTAL REVIEW OF DEPARTMENT OF TRANSPORTATION PROGRAMS AND ACTIVITIES § 17.3 What programs and activities...

  15. 49 CFR 173.418 - Authorized packages-pyrophoric Class 7 (radioactive) materials. (United States)


    ... must not be fissile unless excepted by § 173.453; (b) Contained in sealed and corrosion resistant receptacles with positive closures (friction or slip-fit covers or stoppers are not authorized); (c) Free of...

  16. Determination of K{sub ps} and {beta}{sub 1,H} in a wide interval of initial concentrations of lutetium; Determinacion de K{sub ps} y {beta}{sub 1,H} en un amplio intervalo de concentraciones iniciales del lutecio

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-G, H.; Jimenez R, M.; Solache R, M. [ININ. Apdo. Postal 18-1027, Mexico D.F. (Mexico); Rojas H, A. [UAM-I, A.P. 55-534, 09340, Mexico. D.F. (Mexico)


    solubility product constants and the first of lutetium hydrolysis in the interval of initial concentration of 3.72 X 10{sup -5} to 2.09 X 10{sup -3} M of lutetium, in a 2M of NaCIO{sub 4} media, at 303 K and under conditions free of CO{sub 2} its were considered. The solubility diagrams (pLu{sub (ac)}-pC{sub H}) by means of a radiochemical method were obtained, and starting from its the pC{sub H} values that limit the saturation and no-saturation zones of the solutions were settled down. Those diagrams allowed, also, to calculate the solubility product constants of Lu(OH){sub 3}. The experimental data to the polynomial solubility equation were adjusted, what allowed to calculate those values of the solubility product constants of Lu(OH){sub 3} and to determine the first hydrolysis constant. The value of precipitation pC{sub H} diminishes when the initial concentration of the lutetium increases, while the values of K{sub ps} and {beta}{sub 1,H} its remain constant. (Author)

  17. Solvent extraction of lanthanum (III), europium (III), and lutetium (III) with 5,7-dichloro-8-quinolinol into chloroform in the absence and presence of tetrabutylammonium ions or trioctylphosphine oxide

    International Nuclear Information System (INIS)

    Noro, Junji; Sekine, Tatsuya.


    The solvent extractions of lanthanum(III), europium(III), and lutetium(III) (M 3+ ) in 0.1 moldm -3 sodium nitrate solutions with 5,7-dichloro-8-quinolinol (HA) into chloroform were studied in both the absence and presence of tetrabutylammonium ions (tba + ) or trioctylphosphine oxide (TOPO). In the absence of tba + or TOPO, the extracted species were the MA 3 and MA H A (self-adduct), though MA 4 - tba + was found when tba + was added; MA 3 TOPO and MA 3 (TOPO) 2 were found when TOPO was added in addition to the above mentioned two species. The anionic complex or TOPO adducts greatly enhanced the extraction. The data were statistically analyzed and the equilibrium constants for the extraction of these species, as well as the constants for the association of the HA, the A - tba + , or the TOPO on the MA 3 in the organic phase, were determined. The extraction of the MA 3 is better in the order LaA 3 3 3 . Although the values of the association constant of the HA or the TOPO on the MA 3 are rather similar for the three metal chelates, the constants for A - tba + are larger in the same order as mentioned above. Thus, the separation of these three metal ions by solvent extraction with this chelating extractant is not much affected by the addition of TOPO, but is greatly improved by the addition of tba + . (author)

  18. 49 CFR 173.428 - Empty Class 7 (radioactive) materials packaging. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Empty Class 7 (radioactive) materials packaging... SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.428 Empty Class 7 (radioactive) materials packaging. A packaging which previously contained Class 7 (radioactive...

  19. 49 CFR 173.220 - Internal combustion engines, self-propelled vehicles, mechanical equipment containing internal... (United States)


    ... and vehicles with certain electronic equipment when transported by aircraft or vessel. When an... vehicles, mechanical equipment containing internal combustion engines, and battery powered vehicles or... Than Class 1 and Class 7 § 173.220 Internal combustion engines, self-propelled vehicles, mechanical...

  20. 49 CFR 173.134 - Class 6, Division 6.2-Definitions and exceptions. (United States)


    ... transportation and also capable of cutting or penetrating skin or a packaging material. Sharps includes needles... § 173.199, as appropriate. (9) Dried blood spots or specimens for fecal occult blood detection placed on... cutting or penetrating skin or packaging material, the primary container must be capable of retaining the...

  1. 46 CFR 173.020 - Intact stability standards: Counterballasted and non-counterballasted vessels. (United States)


    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.020 Intact stability standards... vessel that is not equipped to counter-ballast while lifting must be shown by design calculations to... and crane radius. (b) Each vessel must have a righting arm curve with the following characteristics...

  2. 46 CFR 173.025 - Additional intact stability standards: Counterballasted vessels. (United States)


    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.025 Additional intact stability standards: Counterballasted vessels. (a) Each vessel equipped to counterballast while lifting must be shown... loading and operation and at each combination of hook load and crane radius. (b) When doing the...

  3. 49 CFR 173.150 - Exceptions for Class 3 (flammable and combustible liquids). (United States)


    ... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS... § 173.156. (d) Alcoholic beverages. An alcoholic beverage (wine and distilled spirits as defined in 27...-on baggage; or (3) Is a Packing Group III alcoholic beverage in a packaging of 250 L (66 gallons) or...

  4. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  5. 49 CFR 173.195 - Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution). (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen cyanide, anhydrous, stabilized... Hazardous Materials Other Than Class 1 and Class 7 § 173.195 Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution). (a) Hydrogen cyanide, anhydrous, stabilized, must be packed in...

  6. Development of the common law in view of Sections 39(2) and 173 ...

    African Journals Online (AJOL)

    The common (or non-statutory) law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the ...

  7. 49 CFR 173.476 - Approval of special form Class 7 (radioactive) materials. (United States)


    ... (radioactive) materials must maintain on file for at least one year after the latest shipment, and provide to... evidence based on calculative methods to show that the material is able to pass the tests; or other... shipping papers as “Radioactive Material, Special Form, n.o.s.” [Amdt. 173-244, 60 FR 50307, Sept. 28, 1995...

  8. Tank 241-B-108, cores 172 and 173 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Nuzum, J.L., Fluoro Daniel Hanford


    The Data Summary Table (Table 3) included in this report compiles analytical results in compliance with all applicable DQOS. Liquid subsamples that were prepared for analysis by an acid adjustment of the direct subsample are indicated by a `D` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a fusion digest are indicated by an `F` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a water digest are indicated by a I.wl. or an `I` in the A column of Table 3. Due to poor precision and accuracy in original analysis of both Lower Half Segment 2 of Core 173 and the core composite of Core 173, fusion and water digests were performed for a second time. Precision and accuracy improved with the repreparation of Core 173 Composite. Analyses with the repreparation of Lower Half Segment 2 of Core 173 did not show improvement and suggest sample heterogeneity. Results from both preparations are included in Table 3.

  9. 49 CFR 173.9 - Transport vehicles or freight containers containing lading which has been fumigated. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport vehicles or freight containers... MATERIALS REGULATIONS SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.9 Transport... hazardous material. (b) No person may offer for transportation or transport a rail car, freight container...

  10. 49 CFR 173.164 - Mercury (metallic and articles containing mercury). (United States)


    ... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

  11. 49 CFR 173.33 - Hazardous materials in cargo tank motor vehicles. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hazardous materials in cargo tank motor vehicles... Transportation § 173.33 Hazardous materials in cargo tank motor vehicles. (a) General requirements. (1) No person may offer or accept a hazardous material for transportation in a cargo tank motor vehicle except as...

  12. Are there non-statistical effects in /sup 173/Yb(n,gamma)/sup 174/Yb?

    International Nuclear Information System (INIS)

    Pospisil, S.; Becvar, F.; Chrien, R.E.; Kopecky, J.


    The resonance-averaged capture of neutrons in 173 Yb has been studied at energy of 2 keV. With a statistical significance of 99.5% an enhancement of E1-transition to the neutron 2QP levels in 174 Yb is observed. 8 refs

  13. Classroom Materials for Teaching "The Particle Nature of Matter." Practical Paper No. 173. (United States)

    Pella, Milton O.; And Others

    This document presents the lesson plans and tests used in the research study reported in Technical Report 173 (ED 070 658), together with descriptions of models and films developed for the teaching program. Thirty-one lessons are included, covering the topics of matter and energy; making interferences; particles; a model for matter; particles and…

  14. 25 CFR 1000.173 - How does a newly selected Tribe/Consortium initiate the negotiation phase? (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false How does a newly selected Tribe/Consortium initiate the negotiation phase? 1000.173 Section 1000.173 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN SELF-DETERMINATION AND EDUCATIO...

  15. 21 CFR 173.320 - Chemicals for controlling microorganisms in cane-sugar and beet-sugar mills. (United States)


    ...-sugar and beet-sugar mills. 173.320 Section 173.320 Food and Drugs FOOD AND DRUG ADMINISTRATION... controlling microorganisms in cane-sugar and beet-sugar mills. Agents for controlling microorganisms in cane-sugar and beet-sugar mills may be safely used in accordance with the following conditions: (a) They are...

  16. 21 CFR 173.315 - Chemicals used in washing or to assist in the peeling of fruits and vegetables. (United States)


    ... peeling of fruits and vegetables. 173.315 Section 173.315 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in washing or to assist in the peeling of fruits and vegetables. Chemicals may be safely used to wash or to assist in the peeling of fruits and vegetables in accordance with the following conditions...

  17. Tumor vessel normalization by the PI3K inhibitor HS-173 enhances drug delivery. (United States)

    Kim, Soo Jung; Jung, Kyung Hee; Son, Mi Kwon; Park, Jung Hee; Yan, Hong Hua; Fang, Zhenghuan; Kang, Yeo Wool; Han, Boreum; Lim, Joo Han; Hong, Soon-Sun


    Tumor vessels are leaky and immature, which causes poor oxygen and nutrient supply to tumor vessels and results in cancer cell metastasis to distant organs. This instability of tumor blood vessels also makes it difficult for anticancer drugs to penetrate and reach tumors. Numerous tumor vessel normalization approaches have been investigated for improving drug delivery into tumors. In this study, we investigated whether phosphoinositide 3-kinase (PI3K) inhibitors are able to improve vascular structure and function over the prolonged period necessary to achieve effective vessel normalization. The PI3K inhibitors, HS-173 and BEZ235 potently suppressed tumor growth and hypoxia, and increased tumor apoptosis in animal models. PI3K inhibitors also induced a regular, flat monolayer of endothelial cells (ECs) in vessels, improving stability of vessel structure, and normalized tumor vessels by increasing vascular maturity, pericyte coverage, basement membrane thickness, and tight-junctions. These effects resulted in a decrease in tumor vessel tortuosity and vessel thinning, and improved vessel function and blood flow. The tumor vessel stabilization effect of the PI3K inhibitor HS-173 also decreased the number of metastatic lung nodules in vivo metastasis model. Furthermore, HS-173 improved the delivery of doxorubicin into the tumor region, enhancing its anticancer effects. Mechanistic studies suggested that PI3K inhibitor HS-173-induced vessel normalization reflected changes in endothelial Notch signaling. Taken together, our findings indicate that vessel normalization by PI3K inhibitors restrained tumor growth and metastasis while improving chemotherapy by enhancing drug delivery into the tumor, suggesting that HS-173 may have a therapeutic value as an enhancer or an anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. 173 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    Again, individuals and non-governmental organization (NGO's) suffer great restraint in .... by individuals or non-governmental organizations (NGOs) with observer status before the African. Commission on Human and ..... Innovations and Prospect of the African Court on Human and Peoples' Rights. In furtherance of effective ...

  19. Determination of the constants of the solubility product of Ln(OH)3 and the effect of the chloride ions on the lanthanum hydrolysis, praseodymium and lutetium in aqueous solutions of ion force 2 Molar

    International Nuclear Information System (INIS)

    Lopez G, H.D.


    The behavior of lanthanum (III), praseodymium (III), and lutetium (III) was studied in 2 M NaClO 4 (aq) and 2 M NaCl (aq) at 303 K and free -CO 2 conditions. Solubility diagrams (p Ln(aq)-pC H ) were obtained by means of a radiochemical method. The pC H borderlines of saturation and unsaturation zones of the solutions and solubility product constants for Ln(OH) 3 were determined from these diagrams. The fitting of the solubility equation to the experimental values of p Ln(aq)-pC H diagrams allowed the calculation of the first hydrolysis and solubility product constants. Independently, the stability constants for the first species of hydrolysis were determined by means of pH titrations, the data were treated with the program SUPERQUAD and fitted to the mean ligand number equation. The stability constants for the species LnCl 2+ were as well calculated in 2M ionic strength and 303 K from the hydrolysis constant values obtained in both perchlorate and chloride media. The values obtained for La, Pr and Lu were: logK ps : 21.11 ± 0.09, 19.81 ± 0.11 and 18.10 ± 0.13 in 2M NaClO 4 ; logK ps : 22.22 ± 0.09, 21.45 ± 0.14 and 18.52 ± 0.29 in 2M NaCl; log β 1 : - 8.64 ± 0.02, - 8.37 ± 0.01 and - 7.95 ± 0.11 in 2M NaClO 4 ; log β 1 / : - 9.02 ± 0.11, - 8.75 ± 0.01 and - 8.12 ± 0.03 in 2M NaCl and the values for log β 1,Cl were - 0.0255, - 0.155 and - 0.758, respectively. (Author)

  20. Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions; Determinacion de las constantes de estabilidad de los complejos de lantano, praseodimio, europio, erbio y lutecio con iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)


    The stability constants of La{sup 3+}, Pr{sup 3+}, Eu{sup 3+}, Er{sup 3+} and Lu{sup 3+} chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl{sup 2+}) or two chemical species (LnCl{sup 2+} and LnCl{sub 2}{sup +}). The Specific Ion Interaction Theory was applied to the values of log {beta}{sup I}{sub Ln},{sub Cl} and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log {beta}{sup I}{sub Ln},{sub 2Cl}, due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log {beta}{sup I}{sub Ln},{sub CI}, log {beta}{sup I}{sub Ln},{sub 2CI} values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log {beta}{sup I}{sub Ln},{sub Cl} data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

  1. Development of lutetium-labeled bombesin derivates: relationship between structure and diagnostic-therapeutic activity for prostate tumor; Desenvolvimento de derivados da bombesina radiomarcados com lutecio-177: relacao estrutura e potencial diagnostico-terapeutico para tumor de prostata

    Energy Technology Data Exchange (ETDEWEB)

    Pujatti, Priscilla Brunelli


    Bombesin (BBN) receptors - in particular, the gastrin-releasing peptide (GRP) receptor peptide - have been shown to be massively over expressed in several human tumors types, including prostate cancer, and could be an alternative as target for its treatment by radionuclide therapy (RNT). A large number of BBN analogs had already been synthesized for this purpose and have shown to reduce tumor growth in mice. Nevertheless, most of the studied analogs exhibit high abdominal accumulation, especially in pancreas. This abdominal accumulation may represent a problem in clinical use of radiolabeled bombesin analogs probably due to serious side effects to patients. The goal of the present work was to radiolabel a novel series of bombesin derivatives with lutetium-177 and to evaluate the relationship between their structure and diagnostic-therapeutic activity for prostate tumor. The generic structure of studied peptides is DOTA-Phe-(Gly){sub n}-BBN(6-14), where DOTA is the chelator, n is the number of glycine amino acids of Phe-(Gly){sub n} spacer and BBN(6-14) is the bombesin sequence from the amino acid 6 to the amino acid 14. Preliminary studies were done to establish the ideal labeling conditions for obtaining the highest yield of labeled bombesin derivatives, determined by instant thin layer chromatography (ITLC-SG) and high performance liquid chromatography (HPLC). The stability of the preparations was evaluated either after storing at 2-8 degree C or incubation in human serum at 37 degree C and the partition coefficient was determined in n:octanol:water. In vivo studies were performed in both healthy Balb-c and Nude mice bearing PC-3 xenografts, in order to characterize the biological properties of labeled peptides. In vitro studies involved the evaluation of cold bombesin derivatives effect in PC-3 cells proliferation. Bombesin derivatives were successfully labeled with high yield at optimized conditions and exhibited high stability at 4 degree C. The analysis of


    Directory of Open Access Journals (Sweden)

    Mihaela BOTNARENCO


    Full Text Available În cadrul prezentului articol analizei este supus obiectul infracţiunii de hărţuire sexuală. Inter alia, autorul formulează definiţia conceptelor de inviolabilitate sexuală şi de libertate sexuală şi stabileşte situaţiile particulare în care aceste valori sociale şi relaţiile sociale aferente sunt proteguite prin incriminarea faptei infracţionale prevăzute la art.173 CP RM. Concomitent este studiat obiectul juridic secundar al infracţiunii de hărţuire sexuală în corelaţie cu acţiunea principală, dar şi cu acţiunea secundară din conţinutul laturii obiective a componenţei de infracţiune analizate.OBJECT OF CRIME PROVIDED BY ART.173 CRIMINAL CODE OF MOLDOVA The purpose of this article is to analyze the object of the sexual harassment. Inter alia, the author defines the notions of sexual inviolability and sexual freedom as well as identifies the specific situations when these social values and related social relationships are protected by the criminal law. Moreover, the author makes a thorough analysis of the secondary legal object of this crime in connection with main and secondary acts included in the objective side of sexual harassment.

  3. Study of the viability of the production of lutetium - 177 in the nuclear reactor IEA-R1 at IPEN/CNEN-SP; Estudo da viabilidade de producao do lutecio - 177 no reator nuclear IEA-R1 do IPEN/CNEN-SP

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Giovana Pasqualini da


    The {sup -} emitter {sup 177} Lu is a promising therapeutic radioisotope for the curative treatment of cancer using labelled proteins. It has a half - life of 6.71 day and maximum and average (3 energies of 421 and 133 keV, respectively, resulting in a short range of irradiation of tissue. The decay is accompanied by the emission of low energy -radiation of 208.3 keV (11%) and 113 keV (6.4%), suitable for simultaneous imaging. Lu can be produced by two different routes, namely, by irradiation of natural Lu{sub 2}O{sub 3} target ({sup 176}Lu, 2.6%) or enriched (in {sup 176}Lu) Lu{sub 2}O{sub 3} target, and also by irradiation of Yb target (Yb{sub 2}O{sub 3}) followed by radiochemical separation of Lu from Yb isotopes. The objective of this work is the development of a method of the production of {sup 177} Lu through of the (n, gamma) nuclear reaction, by the direct and indirect method of production. Targets of lutetium oxide and ytterbium oxide were irradiated for evaluation of the activity produced and the chemical separation of lutetium and ytterbium was studied using different ion exchange resins. For the direct method, the best results were obtained using the target Lu{sub 2}O{sub 3} enriched in 39.6%. The best results for the indirect method were achieved with the process of separation using 0.25M - HlBA as eluent. The results showed that it is possible to produce {sup 177} Lu of low specific activity for labeling molecules used for bone pain relief and in radiosynoviortesy. (author)

  4. Three-quasiparticle isomer in 173Ta and the excitation energy dependence of K -forbidden transition rates


    Wood, RT; Walker, PM; Lane, G J; Carroll, R. J.; Cullen, David; Dracoulis, G D; Hota, S. S.; Kibédi, T.; Palalani, N; Podolyak, Zs.; Reed, MW; Schiffl, K; Wright, A.M


    Using the 168Er(10B,5n) reaction at a beam energy of 68 MeV, new data have been obtained for the population and decay of a T1/2=148ns, Kπ=21/2− three-quasiparticle isomer at 1717 keV in 173Ta. Revised decay energies and intensities have been determined, together with newly observed members of a rotational band associated with the isomer. By comparison with other isomers in the A≈180 deformed region, the 173Ta isomer properties help to specify the key degrees of freedom that determine K-forbid...

  5. The human story of Crew 173- capturing a Mars analog mission (United States)

    Shaw, Niamh; Musilova, Michaela; Pons Lorente, Arnau; Sisaid, Idriss; Naor, Roy; Blake, Richard


    An international crew of six scientists, engineers, artists and entrepreneurs with different space specialisations were selected by the Mars Society to take part in a Martian simulation in January 2017. An ambitious outreach and media strategy was developed, aimed at communicating the benefits of missions to Mars to the public and to capture the public's interest by telling the human story of the crew's mission. Entitled Crew 173 Team PRIMA, they entered the Mars Desert Research Station in the Utah Desert and conducted research in 3D printing, hydroponics, geology and astronomy. Both the scientific and community experience of this mission was documented through still image, video, audio, diary and daily journalling by the resident artist of the mission, Niamh Shaw. The full experience of the crew was documented (before, during and after the expedition), to capture each individual experience of the crew and the human experience of isolation of future human space missions.

  6. Revisão radiológica de 173 casos consecutivos de paracoccidioidomicose Radiological review of 173 consecutive cases of paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Henrique Simão Trad


    Full Text Available OBJETIVO: Revisar e determinar a incidência dos achados radiológicos mais importantes da paracoccidioidomicose, e verificar as possíveis variantes de suas apresentações. MATERIAIS E MÉTODOS: Foram revistos 173 casos consecutivos de paracoccidioidomicose, atendidos no período de 1970 a 1980. Os estudos radiológicos direcionados a cada caso foram reanalisados por no mínimo dois radiologistas experientes. RESULTADOS: Foram encontrados 94 casos de acometimento pulmonar isolado e 38 de acometimento pulmonar associado a lesões ganglionares, viscerais, ósseas e à tuberculose. Sem envolvimento pulmonar foram encontrados 41 casos, com lesões intestinais, viscerais, ósseas ou combinadas. Os principais achados radiológicos da forma pulmonar foram opacidade intersticial reticular e nodular bilateral, seguida por consolidação, também bilateral. As formas visceral e intestinal apresentaram lesões predominantes no fígado, jejuno e íleo. Na forma ganglionar houve predominância do comprometimento difuso abdominal e periférico, e no ósseo, áreas de lise principalmente em ossos longos e clavícula. CONCLUSÃO: A paracoccidioidomicose é doença granulomatosa comum no Brasil, acometendo principalmente o pulmão, tendo como porta de entrada a inalação dos esporos do fungo. Outras formas desta doença, menos freqüentes ou raras, devem ser permanentemente lembradas no diagnóstico diferencial.OBJECTIVE: To determine the incidence of most significant radiological findings of paracoccidioidomycosis and to verify its possible variants. MATERIALS AND METHODS: One hundred and seventy-three cases of paracoccidioidomycosis presented between 1970 and 1980 were reviewed, including their radiological workup reanalysis by at least two experienced radiologists. RESULTS: Ninety-four cases were pulmonary only and 38 were pulmonary associated with ganglial, visceral and osseous lesions or in association with tuberculosis. There was no pulmonary

  7. Study on gamma rays from the 173Ybsub (n,γ) 174Yb reaction with resonance neutrons

    International Nuclear Information System (INIS)

    Aldea, L.; Bechvarzh, F.; Gonzatko, Ya.; Pospishil, S; Telezhnikov, S.A.


    Relative intensities of primary transitions from individual 173 Yb + n resonances were measured. For 9 resonances with Jsub (π) = 2 - and for 8 transitions an experimental correlation coefficient Rsub(exp) = 0.40 between GITAsub(n lambda) 0 deg and Isub(*g lambda f) / Esub(*g) 5 deg was found to have a significance level 99.8 %

  8. HS-173, a Novel PI3K Inhibitor, Attenuates the Activation of Hepatic Stellate Cells in Liver Fibrosis (United States)

    Son, Mi Kwon; Ryu, Ye-Lim; Jung, Kyung Hee; Lee, Hyunseung; Lee, Hee Seung; Yan, Hong Hua; Park, Heon Joo; Ryu, Ji-Kan; Suh, Jun–Kyu; Hong, Sungwoo; Hong, Soon-Sun


    Hepatic stellate cells (HSCs) are the primary source of matrix components in liver disease such as fibrosis. Phosphatidylinositol 3-kinase (PI3K) signaling in HSCs has been shown to induce fibrogenesis. In this study, we evaluated the anti-fibrotic activity of a novel imidazopyridine analogue (HS-173) in human HSCs as well as mouse liver fibrosis. HS-173 strongly suppressed the growth and proliferation of HSCs and induced the arrest at the G2/M phase and apoptosis in HSCs. Furthermore, it reduced the expression of extracellular matrix components such as collagen type I, which was confirmed by an in vivo study. We also observed that HS-173 blocked the PI3K/Akt signaling pathway in vitro and in vivo. Taken together, HS-173 suppressed fibrotic responses such as cell proliferation and collagen synthesis by blocking PI3K/Akt signaling. Therefore, we suggest that this compound may be an effective therapeutic agent for ameliorating liver fibrosis through the inhibition of PI3K signaling. PMID:24326778

  9. 49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and... (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport requirements for low specific activity... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.427 Transport requirements for low specific... must be transported in accordance with the following conditions: (1) The external dose rate may not...

  10. 49 CFR Appendix B to Part 173 - Procedure for Testing Chemical Compatibility and Rate of Permeation in Plastic Packaging and... (United States)


    ... Rate of Permeation in Plastic Packaging and Receptacles B Appendix B to Part 173 Transportation Other... Plastic Packaging and Receptacles 1. The purpose of this procedure is to determine the chemical compatibility and permeability of liquid hazardous materials packaged in plastic packaging and receptacles...

  11. Fermented Milk Containing Bifidobacterium lactis DN-173 010 in Childhood Constipation: A Randomized, Double-Blind, Controlled Trial

    NARCIS (Netherlands)

    Tabbers, Merit M.; Chmielewska, Ania; Roseboom, Maaike G.; Crastes, Nolwenn; Perrin, Catherine; Reitsma, Johannes B.; Norbruis, Obbe; Szajewska, Hania; Benninga, Marc A.


    BACKGROUND: Constipation is a frustrating symptom affecting 3% of children worldwide. A fermented dairy product containing Bifidobacterium lactis strain DN-173 010 was effective in increasing stool frequency in constipated women. Our aim was to assess the effects of this product in constipated

  12. 49 CFR 173.477 - Approval of packagings containing greater than 0.1 kg of non-fissile or fissile-excepted uranium... (United States)


    ... kg of non-fissile or fissile-excepted uranium hexafluoride. 173.477 Section 173.477 Transportation... non-fissile or fissile-excepted uranium hexafluoride. (a) Each offeror of a package containing more than 0.1 kg of uranium hexafluoride must maintain on file for at least one year after the latest...

  13. Laparoscopic Heller-Dor for primary esophageal achalasia: outcomes in 173 patients. (United States)

    Rosati, Riccardo; Fumagalli Romario, Uberto; Ceolin, Martina; Massaron, Simonetta; Peracchia, Alberto


    Laparoscopic Heller myotomy combined with anterior (Dor) fundoplication is the most widely-used surgical procedure for treating esophageal achalasia in Europe From November 1992 through May 2010 we performed laparoscopic Heller-Dor on 173 patients Conversion to laparotomy was required in three cases (1.7%) at the beginning of the experience (for mucosal) perforation which was the most frequent intraoperative complication, managed laparoscopically with the increasing experience. Five (2.9%) cases had minor postoperative complications. Clinical results were satisfactory in 99.4% of cases. One patient (0.6%) had severe persistent dysphagia. Mean esophageal diameter decreased from 50 mm ± 12 (range 20- 90) to 25 mm ± 7 (range 15-80). Lower esophageal sphincter pressure decreased from 32 mmHg (median, range 10- 93) pre-operatively to 11 mmHg (median, range 5-21) at one year follow up and residual pressure from 12 mmHg (median, range 3-30) to 4 mmHg (median, range 1-8). Impedance and pH monitoring showed normal levels in 39/47 (83%) patients who agreed to testing. The good outcomes of this experience, in part due to careful adherence to technical aspects of the operation, confirm that the laparoscopic Heller-Dor is the gold standard surgical treatment for esophageal achalasia.

  14. Study of CPO resonances on the intercombination line in 173Yb (United States)

    Kumar, Pushpander; Singh, Alok K.; Bharti, Vineet; Natarajan, Vasant; Pandey, Kanhaiya


    We study coherent population oscillations in an odd isotope of the two-electron atom Yb. The experiments are done using magnetic sublevels of the {F}g=5/2\\to {F}e=3/2 hyperfine transition in 173Yb of the {}1{{{S}}}0\\to {}3{{{P}}}1 intercombination line. The experiments are done both with and without an applied magnetic field. In the absence of an applied field, the complicated sublevel structure along with the saturated fluorescence effect causes the linewidth to be larger than the 190 kHz natural linewidth of the transition. In the presence of a field (of magnitude 330 mG), a well-defined quantization axis is present which results in the formation of two M-type systems. The total fluorescence is then limited by spin coherence among the ground sublevels. In addition, the pump beam gets detuned from resonance which results in a reduced scattering rate from the {}3{{{P}}}1 state. Both of these effects result in a reduction of the linewidth to a subnatural value of about 100 kHz.

  15. A new topical hemostatic agent TT-173 reduces blood loss in a sheep model of total knee arthroplasty. (United States)

    Centeno, Alberto; Rojas, Santiago; Arias, Belén; Miquel, Ignasi; Sánchez, Pilar; Ureta, Claudia; Rincón, Esther; López, Ramón; Murat, Jesús


    Total knee arthroplasty is associated with blood loss during the intervention and may require allogenic blood transfusion. Treatments such as tranexamic acid and fibrin sealants improved the bleeding control in several clinical trials, but the hemorrhage associated with the intervention is still significant. Thus far, very few studies have evaluated hemostatic treatments in animal models of total knee arthroplasty. This work describes a sheep model of bleeding associated with total knee arthroplasty and investigates a new class of hemostatic treatment based on recombinant tissue factor. Sheep were treated with the anticoagulant heparin, and the joint was accessed by a paramedial incision. Ligaments and menisci were eliminated and femoral condyles and tibia plateau were sectioned exposing the trabecular bone. An intra-articular drain was used to recover and quantify the blood loss during the 90-min period after treatment. The efficacy of one milligram and three milligrams of TT-173 was evaluated and compared with tranexamic acid. The occurrence of analytical alterations and systemic absorption was also investigated. Treatment with TT-173 reduced the blood loss in comparison with control or tranexamic acid. No significant differences were observed between the two doses evaluated. Moreover, a dose of six milligrams of TT-173 did not induce any clinical or analytical alteration, and significant systemic absorption was not observed. Data obtained strongly suggest that TT-173 could be useful in reducing the blood loss associated with total knee arthroplasty and without safety concerns derived from the systemic absorption of the product. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. 49 CFR 173.301 - General requirements for shipment of compressed gases and other hazardous materials in cylinders... (United States)


    ... less; (vi) A fire extinguisher; or (vii) A “B” style cylinder with a capacity of 40 ft 3 (1.13 m3) or an “MC” style cylinder with a capacity of 10 ft 3 (0.28m3) containing acetylene. (2) For cylinders... citations affecting § 173.301, see the List of CFR Sections Affected, which appears in the Finding Aids...

  17. The kinase domain residue serine 173 of Schizosaccharomyces pombe Chk1 kinase is critical for the response to DNA replication stress

    Directory of Open Access Journals (Sweden)

    Naomi Coulton


    Full Text Available While mammalian Chk1 kinase regulates replication origins, safeguards fork integrity and promotes fork progression, yeast Chk1 acts only in G1 and G2. We report here that the mutation of serine 173 (S173A in the kinase domain of fission yeast Chk1 abolishes the G1-M and S-M checkpoints with little impact on the G2-M arrest. This separation-of-function mutation strongly reduces the Rad3-dependent phosphorylation of Chk1 at serine 345 during logarithmic growth, but not when cells experience exogenous DNA damage. Loss of S173 lowers the restrictive temperature of a catalytic DNA polymerase epsilon mutant (cdc20.M10 and is epistatic with a mutation in DNA polymerase delta (cdc6.23 when DNA is alkylated by methyl-methanesulfate (MMS. The chk1-S173A allele is uniquely sensitive to high MMS concentrations where it displays a partial checkpoint defect. A complete checkpoint defect occurs only when DNA replication forks break in cells without the intra-S phase checkpoint kinase Cds1. Chk1-S173A is also unable to block mitosis when the G1 transcription factor Cdc10 (cdc10.V50 is impaired. We conclude that serine 173, which is equivalent to lysine 166 in the activation loop of human Chk1, is only critical in DNA polymerase mutants or when forks collapse in the absence of Cds1.

  18. Ontwikkeling van die gemenereg in die lig van artikel 39(2 en 173 van die Grondwet

    Directory of Open Access Journals (Sweden)

    LTC Harms


    Full Text Available DEVELOPMENT OF THE COMMON LAW IN VIEW OF SECTIONS 39(2 AND 173 OF THE CONSTITUTIONThe point of departure in the Constitution is that the existing legal order should largely be kept intact, despite the fact that this is disliked by some. The common (or non-statutory law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the common law with reference to especially the boni mores, moral standards and the common notion of what is right and fair. The Bill of Rights now is a source and summation of such notion.At times there had been an exaggerated call for petere fontes. The Courts however still have the competence to adapt the law to serve commercial and other needs, even without reference to the Bill of Rights. The underlying principles of the common law are largely, though not in all respects, consistent with the Bill of Rights. There is an essential distinction between the development of a rule of the common law in accordance with constitutional norms, and the invalidation of a rule which is inconsistent with the Constitution. Courts tend not to make this distinction and this leads to inconsistencies. Some believe that the common law is perfect and unaffected by the Bill of Rights. Others consider the Bill of Rights to have granted the judiciary a hunting license on the common law, making the positive law a matter of judicial discretion and allowing the courts to infringe upon the domain of the legislature and to ignore precedents. The common law consists of a myriad rules developed over many centuries involving great minds. It represents a fine web, the disturbance of which at one point may have severe unexpected consequences elsewhere. The new era makes extraordinary demands on judicial officers. The

  19. 3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3. (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki


    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

  20. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.


    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  1. [Acute ethanol intoxication among children and adolescents. A retrospective analysis of 173 patients admitted to a university children hospital]. (United States)

    Schöberl, S; Nickel, P; Schmutzer, G; Siekmeyer, W; Kiess, W


    In the last time the alcohol consumption among children and adolescents is a big theme in all kind of media. The ethanol consumption among children and adolescents has risen during the last years, but also new hazardous drinking patterns like "binge-drinking" are increasing. These drinking episodes are responsible for many hospital presentations of children and adolescents with acute ethanol intoxication. This study is a retrospective analysis of 173 patients admitted to the university children hospital of Leipzig due to acute ethanol intoxication during the period 1998-2004. Investigated parameters were: socio-demographic factors, clinical presentation and management as well as quantity and type of alcohol. During the years 1998-2004 the rate of alcohol intoxicated patients in this study increased, from 1998-2003 at about 171.4%. Totally 173 patients with an average age of 14.5 years were admitted to the university children hospital. There were significantly more boys than girls. The mean blood alcohol concentration of these patients was 1.77%. Some of the patients had severe symptoms. 62 were unconscious, 2 were in coma and at least 3 patients had to be ventilated. A difference between socioeconomic groups could be observed by comparing the different school types. 44.8% of the patients went to the middle school. Furthermore 17 patients of this study had mental disorders or psychosocial problems and were therefore in psychological or psychiatric treatment. In this study a significant influence of social classes or psychosocial problems on alcohol consumption such as binge-drinking leading to acute ethanol intoxication could not be found. Alarming is the increasing number of ethanol intoxicated patients, the young age, the high measured blood ethanol concentrations and the severe symptoms of these patients. This is the reason why early and intensive prevention strategies are required.

  2. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.; Peyvandi, F.; Pagliari, M.; Cairo, A.; Abdel-Azeim, Safwat; Chermak, Edrisse; Lazzareschi, I.; Mastrangelo, S.; Cavallo, Luigi; Oliva, R.; De Cristofaro, R.


    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  3. 41 CFR 302-9.173 - How many replacement POV's may my agency authorize me to transport to my post of duty at... (United States)


    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false How many replacement POV's may my agency authorize me to transport to my post of duty at Government expense? 302-9.173... How many replacement POV's may my agency authorize me to transport to my post of duty at Government...

  4. Abnormal glomerular filtration rate in children, adolescents and young adults starts below 75 mL/min/1.73 m(2). (United States)

    Pottel, Hans; Hoste, Liesbeth; Delanaye, Pierre


    The chronic kidney disease (CKD) classification system for children is similar to that for adults, with both mainly based on estimated glomerular filtration rate (eGFR) combined with fixed cut-off values. The main cut-off eGFR value used to define CKD is 60 mL/min/1.73 m(2), a value that is also applied for children older than 2 years of age, adolescents and young adults. Based on a literature search, we evaluated inclusion criteria for eGFR in clinical trials or research studies on CKD for children. We also collected information on direct measurements of GFR (mGFR) in children and adolescents, with the aim to estimate the normal reference range for GFR. Using serum creatinine (Scr) normal reference values and Scr-based eGFR-equations, we also evaluated the correspondence between Scr normal reference values and (e)GFR normal reference values. Based on our literature search, the inclusion of children in published CKD studies has been based on cut-off values for eGFR of >60 mL/min/1.73 m(2). The lower reference limits for mGFR far exceed this adult threshold. Using eGFR values calculated using Scr-based formulas, we found that abnormal Scr levels in children already correspond to eGFR values that are below a cut-off of 75 mL/min/1.73 m(2). Abnormal GFR in children, adolescents and young adults starts below 75 mL/min/1.73 m(2), and as abnormality is a sign of disease, we recommend referring children, adolescents and young adults with an (e)GFR of <75 mL/min/1.73 m(2) for further clinical assessment.

  5. Nutritional determinants of worldwide diabetes: an econometric study of food markets and diabetes prevalence in 173 countries. (United States)

    Basu, Sanjay; Stuckler, David; McKee, Martin; Galea, Gauden


    Ageing and urbanization leading to sedentary lifestyles have been the major explanations proposed for a dramatic rise in diabetes worldwide and have been the variables used to predict future diabetes rates. However, a transition to Western diets has been suggested as an alternative driver. We sought to determine what socio-economic and dietary factors are the most significant population-level contributors to diabetes prevalence rates internationally. Multivariate regression models were used to study how market sizes of major food products (sugars, cereals, vegetable oils, meats, total joules) corresponded to diabetes prevalence, incorporating lagged and cumulative effects. The underlying social determinants of food market sizes and diabetes prevalence rates were also studied, including ageing, income, urbanization, overweight prevalence and imports of foodstuffs. Data were obtained from 173 countries. Population-based survey recipients were the basis for diabetes prevalence and food market data. We found that increased income tends to increase overall food market size among low- and middle-income countries, but the level of food importation significantly shifts the content of markets such that a greater proportion of available joules is composed of sugar and related sweeteners. Sugar exposure statistically explained why urbanization and income have been correlated with diabetes rates. Current diabetes projection methods may estimate future diabetes rates poorly if they fail to incorporate the impact of nutritional factors. Imported sugars deserve further investigation as a potential population-level driver of global diabetes.

  6. 3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3 (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki


    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

  7. Low-temperature thermal properties of yttrium and lutetium dodecaborides

    International Nuclear Information System (INIS)

    Czopnik, A; Shitsevalova, N; Pluzhnikov, V; Krivchikov, A; Paderno, Yu; Onuki, Y


    The heat capacity (C p ) and dilatation (α) of YB 12 and LuB 12 are studied. C p of the zone-melted YB 12 tricrystal is measured in the range 2.5-70 K, of the zone-melted LuB 12 single crystal in the range 0.6-70 K, and of the LuB 12 powder sample in the range 4.3-300 K; α of the zone-melted YB 12 tricrystal and LuB 12 single crystals is measured in the range 5-200 K. At low temperatures a negative thermal expansion (NTE) is revealed for both compounds: for YB 12 at 50-70 K, for LuB 12 at 10-20 K and 60-130 K. Their high-temperature NTE is a consequence of nearly non-interacting freely oscillating metal ions (Einstein oscillators) in cavities of a simple cubic rigid Debye lattice formed by B 12 cage units. The Einstein temperatures are ∼254 and ∼164 K, and the Debye temperatures are ∼1040 K and ∼1190 K for YB 12 and LuB 12 respectively. The LuB 12 low-temperature NTE is connected with an induced low-energy defect mode. The YB 12 superconducting transition has not been detected up to 2.5 K

  8. Magnetic structures of holmium-lutetium alloys and superlattices

    DEFF Research Database (Denmark)

    Swaddling, P.P.; Cowley, R.A.; Ward, R.C.C.


    Alloys and superlattices of Ho and Lu have been grown using molecular beam epitaxy and their magnetic structures determined using neutron-scattering techniques. The 4f moments in the alloys form a helix at all compositions with the moments aligned in the basal plane perpendicular to the wave vector...... of the helix remaining coherent through the nonmagnetic Lu blocks. The neutron scattering from the superlattices is consistent with a model in which there are different phase advances of the helix turn angle through the Ho and Lu blocks, but with a localized moment on the Ho sites only. A comparison...... of Ho and Lu. At low temperatures, for superlattices with fewer than approximately twenty atomic planes of Ho, the Ho moments within a block undergo a phase transition from helical to ferromagnetic order, with the coupling between successive blocks dependent on the thickness of the Lu spacer....

  9. Lutetium-177-EDTMP for pain palliation in bone metastases

    International Nuclear Information System (INIS)

    Rutty Sola, Gisela A.; Arguelles, Maria G.; Bottazzini, Debora L.; Furnari, Juan C.; Vera Ruiz, H.


    Experiences with the new palliative agent Lu-177 EDTMP are summarized. The production of primary 177 Lu by the 176 Lu(n,γ) 177 Lu reaction and the synthesis of the radioactive complex are described as well as the procedures used for the control of the radionuclidic and the radiochemical purity. The stability of the compound has been also studied. The in vivo essays with rats and the use of the radiopharmaceutical, after a careful dose evaluation, in a patient with bone metastases from a breast cancer, show that the behaviour of Lu-177 EDTMP is similar to that of the analogue Sm-153 EDTMP. (author)

  10. Evaluation of the performance of national health systems in 2004-2011: An analysis of 173 countries. (United States)

    Sun, Daxin; Ahn, Haksoon; Lievens, Tomas; Zeng, Wu


    In an effort to improve health service delivery and achieve better health outcomes, the World Health Organization (WHO) has called for improved efficiency of health care systems to better use the available funding. This study aims to examine the efficiency of national health systems using longitudinal country-level data. Data on health spending per capita, infant mortality rate (IMR), under 5 mortality rate (U5MR), and life expectancy (LE) were collected from or imputed for 173 countries from 2004 through 2011. Data envelopment analyses were used to evaluate the efficiency and regression models were constructed to examine the determinants of efficiency. The average efficiency of the national health system, when examined yearly, was 78.9%, indicating a potential saving of 21.1% of health spending per capita to achieve the same level of health status for children and the entire population, if all countries performed as well as their peers. Additionally, the efficiency of the national health system varied widely among countries. On average, Africa had the lowest efficiency of 67%, while West Pacific countries had the highest efficiency of 86%. National economic status, HIV/AIDS prevalence, health financing mechanisms and governance were found to be statistically associated with the efficiency of national health systems. Taking health financing as an example, a 1% point increase of social security expenses as a percentage of total health expenditure correlated to a 1.9% increase in national health system efficiency. The study underscores the need to enhance efficiency of national health systems to meet population health needs, and highlights the importance of health financing and governance in improving the efficiency of health systems, to ultimately improve health outcomes.

  11. 173 - 177 Falodun J

    African Journals Online (AJOL)

    DR. AMIN

    palm oil mill effluent and NPK 15:15:15 fertilizer on the growth and yield of soyabean genotype ... growing maize and reported a significant effect on yield. Organic fertilizers supply the ... (1984) and significant differences among treatment.

  12. Pages 166- 173.pmd

    African Journals Online (AJOL)


    The logistic regression model to predict neonatal mortality had a good fit (AUC: 0.8507, misclassification rate: 13.6%) ... intensive care units, principal component analysis, logistic regression, ... between cost of neonatal care and length of stay.

  13. Phase equilibria in the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K

    Energy Technology Data Exchange (ETDEWEB)

    Han, Feng; Luo, Hao [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Zhan, Yongzhong [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Guangxi Univ., Nanning (China). Center of Ecological Collaborative Innovation for Aluminum Industry


    The isothermal section of the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K has been experimentally determined. All equilibrated alloys were characterized via X-ray powder diffraction and scanning electron microscopy equipped with energy-dispersive X-ray analysis. A ternary phase Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} was found at 1 173 K. The experimental results show that the isothermal section consists of 11 single-phase regions, 26 two-phase regions and 13 three-phase regions. The existence of eight compounds, i.e. ZrSi{sub 2}, ZrSi, Zr{sub 5}Si{sub 4}, Zr{sub 3}Si{sub 2}, Zr{sub 2}Si, ZrB, ZrB{sub 2} and Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} in this system has been confirmed in the Zr-Si-ZrB{sub 2} region at 1 173 K.

  14. Comparative performance of the CKD Epidemiology Collaboration (CKD-EPI) and the Modification of Diet in Renal Disease (MDRD) Study equations for estimating GFR levels above 60 mL/min/1.73 m2. (United States)

    Stevens, Lesley A; Schmid, Christopher H; Greene, Tom; Zhang, Yaping Lucy; Beck, Gerald J; Froissart, Marc; Hamm, Lee L; Lewis, Julia B; Mauer, Michael; Navis, Gerjan J; Steffes, Michael W; Eggers, Paul W; Coresh, Josef; Levey, Andrew S


    The Modification of Diet in Renal Disease (MDRD) Study equation underestimates measured glomerular filtration rate (GFR) at levels>60 mL/min/1.73 m2, with variable accuracy among subgroups; consequently, estimated GFR (eGFR)>or=60 mL/min/1.73 m2 is not reported by clinical laboratories. Here, performance of a more accurate GFR-estimating equation, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation, is reported by level of GFR and clinical characteristics. Test of diagnostic accuracy. Pooled data set of 3,896 people from 16 studies with measured GFR (not used for the development of either equation). Subgroups were defined by eGFR, age, sex, race, diabetes, prior solid-organ transplant, and body mass index. eGFR from the CKD-EPI and MDRD Study equations and standardized serum creatinine. Measured GFR using urinary or plasma clearance of exogenous filtration markers. Mean measured GFR was 68+/-36 (SD) mL/min/1.73 m2. For eGFR73 m2, both equations have similar bias (median difference compared with measured GFR). For eGFR of 30-59 mL/min/1.73 m2, bias was decreased from 4.9 to 2.1 mL/min/1.73 m2 (57% improvement). For eGFR of 60-89 mL/min/1.73 m2, bias was decreased from 11.9 to 4.2 mL/min/1.73 m2 (61% improvement). For eGFR of 90-119 mL/min/1.73 m2, bias was decreased from 10.0 to 1.9 mL/min/1.73 m2 (75% improvement). Similar or improved performance was noted for most subgroups with eGFR73 m2, other than body mass indexor=90 mL/min/1.73 m2. Limited number of elderly people and racial and ethnic minorities with measured GFR. The CKD-EPI equation is more accurate than the MDRD Study equation overall and across most subgroups. In contrast to the MDRD Study equation, eGFR>or=60 mL/min/1.73 m2 can be reported using the CKD-EPI equation. Copyright (c) 2010 National Kidney Foundation, Inc. All rights reserved.

  15. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571). (United States)

    Tabbers, Merit M; Chmielewska, Ania; Roseboom, Maaike G; Boudet, Claire; Perrin, Catherine; Szajewska, Hania; Benninga, Marc A


    Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30-50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency fermented dairy product is effective in the treatment of constipated children with a defecation frequency fermented dairy product containing Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5-10 minutes after each meal (3 times a day) and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence), adverse effects (nausea, diarrhoea, bad taste) and intake of rescue medication (Bisacodyl). Rate of success and rate of responders are also evaluated, with success defined as > or = 3 bowel movements per week and or = 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary) will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. This study is aimed to show that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency after 3 weeks of product consumption in children with functional constipation and a defecation

  16. Determination of the constants of the solubility product of Ln(OH){sub 3} and the effect of the chloride ions on the lanthanum hydrolysis, praseodymium and lutetium in aqueous solutions of ion force 2 Molar; Determinacion de las constantes del producto de solubilidad de Ln(OH){sub 3} y el efecto de los iones cloruro sobre la hidrolisis de lantano, praseodimio y lutecio en soluciones acuosas de fuerza ionica 2 Molar

    Energy Technology Data Exchange (ETDEWEB)

    Lopez G, H.D


    The behavior of lanthanum (III), praseodymium (III), and lutetium (III) was studied in 2 M NaClO{sub 4} (aq) and 2 M NaCl (aq) at 303 K and free -CO{sub 2} conditions. Solubility diagrams (p Ln(aq)-pC{sub H}) were obtained by means of a radiochemical method. The pC{sub H} borderlines of saturation and unsaturation zones of the solutions and solubility product constants for Ln(OH){sub 3} were determined from these diagrams. The fitting of the solubility equation to the experimental values of p Ln(aq)-pC{sub H} diagrams allowed the calculation of the first hydrolysis and solubility product constants. Independently, the stability constants for the first species of hydrolysis were determined by means of pH titrations, the data were treated with the program SUPERQUAD and fitted to the mean ligand number equation. The stability constants for the species LnCl{sup 2+} were as well calculated in 2M ionic strength and 303 K from the hydrolysis constant values obtained in both perchlorate and chloride media. The values obtained for La, Pr and Lu were: logK{sub ps}: 21.11 {+-} 0.09, 19.81 {+-} 0.11 and 18.10 {+-} 0.13 in 2M NaClO{sub 4}; logK{sub ps}: 22.22 {+-} 0.09, 21.45 {+-} 0.14 and 18.52 {+-} 0.29 in 2M NaCl; log {beta}{sub 1}: - 8.64 {+-} 0.02, - 8.37 {+-} 0.01 and - 7.95 {+-} 0.11 in 2M NaClO{sub 4}; log {beta}{sub 1}{sup /} : - 9.02 {+-} 0.11, - 8.75 {+-} 0.01 and - 8.12 {+-} 0.03 in 2M NaCl and the values for log {beta}{sub 1,Cl} were - 0.0255, - 0.155 and - 0.758, respectively. (Author)

  17. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571

    Directory of Open Access Journals (Sweden)

    Perrin Catherine


    Full Text Available Abstract Background Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30–50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency Methods/design It is a two nation (The Netherlands and Poland double-blind, placebo-controlled randomised multicentre trial in which 160 constipated children (age 3–16 years with a defecation frequency Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5–10 minutes after each meal (3 times a day and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence, adverse effects (nausea, diarrhoea, bad taste and intake of rescue medication (Bisacodyl. Rate of success and rate of responders are also evaluated, with success defined as ≥ 3 bowel movements per week and ≤1 faecal incontinence episode over the last 2 weeks of product consumption and responder defined as a subject reporting a stool frequency ≥ 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. Conclusion This

  18. Fibroblast Growth Factor-23 and Vitamin D Metabolism in Subjects with eGFR ≥60 ml/min/1.73 m². (United States)

    Nakatani, Shinya; Nakatani, Ayumi; Tsugawa, Naoko; Yamada, Shinsuke; Mori, Katsuhito; Imanishi, Yasuo; Ishimura, Eiji; Okano, Toshio; Inaba, Masaaki


    Fibroblast growth factor (FGF)-23 and parathyroid hormone (PTH) are both potent phosphaturic hormones. Since they exert opposite effects on vitamin D metabolism, the measurement of 3 vitamin D metabolites; 25-hydroxyvitamin D (25-OH-D), 1,25-dihydroxyvitamin D (1,25(OH)2D), and 24,25-dihydroxyvitamin D (24,25(OH)2D), allows the distinction of the effects of FGF-23 from those of PTH. The aim of this study was to elucidate which factor, FGF-23 or PTH, plays a more important role in the regulation of vitamin D metabolites in subjects with estimated glomerular filtration (eGFR) ≥60 ml/min/1.73 m(2). Subjects with eGFR ≥60 ml/min/1.73 m(2) (n = 20) were enrolled and their serum levels of FGF-23, intact PTH, and vitamin D metabolites were determined. Serum FGF-23 correlated inversely with 1,25(OH)2D (r = -0.717, p = 0.0004) and the 1,25(OH)2D/25-OH-D ratio (r = -0.518, p = 0.019), compared with a significant positive correlation between serum intact PTH and the 1,25(OH)2D/25-OH-D ratio (r = 0.562, p = 0.010). Multiple regression analyses revealed serum FGF-23 as a significant factor that was associated with serum 1,25(OH)2D (β = -0.593, p = 0.018), 1,25(OH)2D/25-OH-D ratio (β = -0.521, p = 0.025), and the 24,25(OH)2D/1,25(OH)2D ratio (β = 0.632, p = 0.008), and intact PTH as a significant factor associated with the 1,25(OH)2D/25-OH-D ratio (β = 0.445, p = 0.028). This study demonstrated that, even in subjects with eGFR ≥60 ml/min/1.73 m(2), FGF-23 might play an important role in the regulation of vitamin D metabolism. In addition to the established role of PTH, the association between FGF-23 and indices of vitamin D metabolism suggested the potential role of FGF-23 on phosphate metabolism in such patients. © 2015 S. Karger AG, Basel.

  19. Triangular flow of negative pions emitted in PbAu collisions at $\\sqrt{S_{NN}} = 17.3$ GeV

    CERN Document Server

    Adamová, D.

    Differential triangular flow, $v_3(p_T)$, of negative pions is measured at $\\sqrt{s_{NN}}$= 17.3~GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30\\% with a mean centrality of 5.5\\%. This is the first measurement of the triangular flow at SPS energies. The $p_T$ range extends from about 0.05~GeV/c to more than 2~GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydro calculation combined with an UrQMD cascade model for the late stages.

  20. Study of heat conductivity, electric conductivity and thermo-emf of BiSrCaCu2Ox and Bi1.82Sr1.73Ca1.73Ca1.25Cu2.2Ox systems

    International Nuclear Information System (INIS)

    Zhukova, T.B.; Parfen'eva, L.S.; Popov, V.V.; Melekh, B.T.; Smirnov, I.A.; Khalmedov, Kh.M.


    Phase compositions are determined and temperature dependences are measured of x-heat conductivity, ρ-electric resistance and α-thermo-emf of polycrystal, monophase, highly textured HTSC samples of BiSrCaCu 2 O x and Bi 1.82 Sr 1.73 Ca 1.25 Cu 2.2 O x produced through method of direct induction melting in the air in a cold container. Sample 'aging' after storage in the air and vacuum, leading to decrease in the number of foring phases and increase in the basic phase content as well as to change of x, ρ and α coefficients is identified

  1. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  2. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes. (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong


    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  3. Energy dependence of particle ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{_{NN}}} =$~6.3 to 17.3 GeV

    CERN Document Server

    Alt, C; Baatar, B; Barna, D; Bartke, J; Betev, L; Bialkowska, H; Blume, C; Boimska, B; Botje, M; Bracinik, J; Bramm, R; Bunccic, P; Cerny, V; Christakoglou, P; Chvala, O; Cramer, J G; Csató, P; Dinkelaker, P; Eckardt, V; Flierl, D; Fodor, Z; Foka, P; Friese, V; Gál, J; Gazdzicki, M; Genchev, V; Georgopoulos, G; Gladysz, E; Grebieszkow, K; Hegyi, S; Höhne, C; Kadija, K; Karev, A; Kliemant, M; Kniege, S; Kolesnikov, V I; Kornas, E; Korus, R; Kowalski, M; Kraus, I; Kreps, M; Kresan, D; Van Leeuwen, M; Lévai, P; Litov, L; Lungwitz, B; Makariev, M; Malakhov, A I; Mateev, M; Melkumov, G L; Mischke, A; Mitrovski, M; Molnár, J; Mrówczynski, St; Nicolic, V; Pálla, G; Panagiotou, A D; Panayotov, D; Petridis, A; Pikna, M; Prindle, D; Pühlhofer, F; Renfordt, R; Roland, C; Roland, G; Rybczynski, M; Rybicki, A; Sandoval, A; Schmitz, N; Schuster, T; Seyboth, P; Siklér, F; Sitár, B; Skrzypczak, E; Stefanek, G; Stock, R; Ströbele, H; Susa, T; Szentpétery, I; Sziklai, J; Szymanski, P; Trubnikov, V; Varga, D; Vassiliou, M; Veres, G I; Vesztergombi, G; Vranic, D; Wetzler, A; Wlodarczyk, Z; Yoo, I K


    We present recent measurements of the energy dependence of event-by-event fluctuations in the K/pi and (p + \\bar{p})/pi multiplicity ratios in heavy ion collisions at the CERN SPS. The particle ratio fluctuations were obtained for central Pb+Pb collisions at five collision energies, \\sqrt{s_{_{NN}}}, between 6.3 and 17.3 GeV. After accounting for the effects of finite-number statistics and detector resolution, we extract the strength of non-statistical fluctuations at each energy. For the K/pi ratio, larger fluctuations than expected for independent particle production are found at all collision energies. The fluctuations in the (p + \\bar{p})/pi ratio are smaller than expectations from independent particle production, indicating correlated pion and proton production from resonance decays. For both ratios, the deviation from purely statistical fluctuations shows an increase towards lower collision energies. The results are compared to transport model calculations, which fail to describe the energy dependence o...

  4. A Search for Technosignatures from 14 Planetary Systems in the Kepler Field with the Green Bank Telescope at 1.15–1.73 GHz (United States)

    Margot, Jean-Luc; Greenberg, Adam H.; Pinchuk, Pavlo; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, M. Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, Willow; Miles, Brittany; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse; Lynch, Ryan S.


    Analysis of Kepler mission data suggests that the Milky Way includes billions of Earth-sized planets in the habitable zone of their host stars. Current technology enables the detection of technosignatures emitted from a large fraction of the Galaxy. We describe a search for technosignatures that is sensitive to Arecibo-class transmitters located within ∼420 ly of Earth and transmitters that are 1000 times more effective than Arecibo within ∼13000 ly of Earth. Our observations focused on 14 planetary systems in the Kepler field and used the L-band receiver (1.15–1.73 GHz) of the 100 m diameter Green Bank Telescope. Each source was observed for a total integration time of 5 minutes. We obtained power spectra at a frequency resolution of 3 Hz and examined narrowband signals with Doppler drift rates between ±9 Hz s‑1. We flagged any detection with a signal-to-noise ratio in excess of 10 as a candidate signal and identified approximately 850,000 candidates. Most (99%) of these candidate signals were automatically classified as human-generated radio-frequency interference (RFI). A large fraction (>99%) of the remaining candidate signals were also flagged as anthropogenic RFI because they have frequencies that overlap those used by global navigation satellite systems, satellite downlinks, or other interferers detected in heavily polluted regions of the spectrum. All 19 remaining candidate signals were scrutinized and none were attributable to an extraterrestrial source.


    Directory of Open Access Journals (Sweden)



    Full Text Available La formación de roderas es uno de los mayores deterioros que se producen en los firmes flexibles, lo que ocasiona la pérdida de regularidad superficial que repercute de forma negativa en la calidad del servicio prestado a los usuarios. Existen distintos ensayos de laboratorio que permiten evaluar las deformaciones plásticas producidas en las capas del pavimento, entre ellos podemos destacar los ensayos de simulación. El objetivo de esta investigación es analizar el comportamiento de una mezcla bituminosa en caliente frente a deformaciones plásticas, mediante dos métodos de ensayo diferentes; ensayo en pista de laboratorio de acuerdo a la normativa española NLT-173 y el ensayo de rodadura UNE-EN 12697-22 (ensayo obligatorio tras la entrada en vigor del Marcado CE de mezclas bituminosas en 2008. La finalidad última de este artículo es formular una propuesta de modificación de la normativa española (PG-3 sobre los límites exigibles en éste último ensayo.

  6. New candidates for active asteroids: Main-belt (145) Adeona, (704) Interamnia, (779) Nina, (1474) Beira, and near-Earth (162,173) Ryugu (United States)

    Busarev, Vladimir V.; Makalkin, Andrei B.; Vilas, Faith; Barabanov, Sergey I.; Scherbina, Marina P.


    For the first time, spectral signs of subtle coma activity were observed for four main-belt primitive asteroids (145) Adeona, (704) Interamnia, (779) Nina, and (1474) Beira around their perihelion distances in September 2012, which were interpreted as manifestations of the sublimation of H2O ice in/under the surface matter (Busarev et al., 2015a, 2015b). We confirm the phenomenon for Nina when it approached perihelion in September 2016. At the same time, based on results of spectral observations of near-Earth asteroid (162,173) Ryugu (Vilas, 2008) being a target of Japan's Hayabusa 2 space mission, we suspected a periodic similar transient activity on the Cg-type asteroid. However, unlike the main-belt primitive asteroids demonstrating sublimation of ices close to their perihelion distances, the effect on Ryugu was apparently registered near aphelion. To explain the difference, we calculated the subsolar temperature depending on heliocentric distance of the asteroids, considered qualitative models of internal structure of main-belt and near-Earth primitive asteroids including ice and performed some analytical estimations. Presumed temporal sublimation/degassing activity of Ryugu is a sign of a residual frozen core in its interior. This could be an indication of a relatively recent transition of the asteroid from the main asteroid belt to the near-Earth area.

  7. Triangular flow of negative pions emitted in PbAu collisions at √{sNN} = 17.3 GeV (United States)

    Adamová, D.; Agakichiev, G.; Andronic, A.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Hering, G.; Holeczek, J.; Kalisky, M.; Karpenko, Iu.; Krobath, G.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Miśkowiec, D.; Panebrattsev, Y.; Petchenova, O.; Petráček, V.; Radomski, S.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Schuchmann, S.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Tsiledakis, G.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Yurevich, S.; Yurevich, V.


    Differential triangular flow, v3 (pT), of negative pions is measured at √{sNN} = 17.3 GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30% with a mean centrality of 5.5%. This is the first measurement as a function of transverse momentum of the triangular flow at SPS energies. The pT range extends from about 0.05 GeV/c to more than 2 GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydrodynamic calculation combined with an UrQMD cascade model for the late stages.

  8. Production of lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using soybean flour and rice straw as the substrate. (United States)

    Zhu, Zhen; Zhang, Guoyi; Luo, Yi; Ran, Wei; Shen, Qirong


    This work was aimed to produce lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using agro-industrial byproducts. A central composite design was used to get the highest lipopeptides production. Results revealed that the optimal conditions for maximum lipopeptides production were 1.79% starch and 1.91% yeast extract by employing 5.58 g soybean flour and 3.67 g rice straw as the solid substrate with initial pH 7.5, moisture content 55% and a 10% inoculum level at 30°C for 2 days. Under these conditions, the experimental yield of lipopeptides reached 50.01 mg/gds, which was very close to the predicted value (49.91 mg/gds). At high concentration, the lipopeptides extracted from fermented substrates showed strong antibiotic activity against Rhizoctonia solani and Ralstonia solanacearum and certain emulsification but good emulsion stability. This is the first report on lipopeptides production that uses rice straw as a major substrate. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Finding of 13(2) , 17(3) -cyclopheophorbide a enol as a degradation product of chlorophyll in shrunk zooxanthellae of the coral Montipora digitata. (United States)

    Suzuki, Toshiyuki; Casareto, Beatriz Estela; Shioi, Yuzo; Ishikawa, Yoshio; Suzuki, Yoshimi


    We examined the morphology and pigment composition of zooxanthellae in corals subjected to normal temperature (27°C) and thermal stress (32°C). We observed several normal and abnormal morphological types of zooxanthellar cells. Normal cells were intact and their chloroplasts were unbroken (healthy); abnormal cells were shrunken and had partially degraded or broken chloroplasts, or they were bleached and without chloroplasts. At 27°C, most healthy zooxanthellar cells were retained in the coral tissue, whereas shrunken zooxanthellae were expelled. Under thermal stress, the abundance of healthy zooxanthellae declined and the proportion of shrunken/abnormal cells increased in coral tissues. The rate of algal cell expulsion was reduced under thermal stress. Within the shrunken cells, we detected the presence of a chl-like pigment that is not ordinarily found in healthy zooxanthellae. Analysis of the absorption spectrum, absorption maxima, and retention time (by HPLC) indicated that this pigment was 13(2) , 17(3) -cyclopheophorbide a enol (cPPB-aE), which is frequently found in marine and lacustrine sediments, and in protozoans that graze on phytoplankton. The production of cPPB-aE in shrunken zooxanthellae suggests that the chls have been degraded to cPPB-aE, a compound that is not fluorescent. The lack of a fluorescence function precludes the formation of reactive oxygen species. We therefore consider the formation of cPPB-aE in shrunken zooxanthellae to be a mechanism for avoiding oxidative stress. © 2014 The Authors. Journal of Phycology published by Wiley Periodicals, Inc. on behalf of Phycological Society of America.

  10. Macrophage Migration Inhibitory Factor Promoter Polymorphisms (−794 CATT5–8 and −173 G>C: Relationship with mRNA Expression and Soluble MIF Levels in Young Obese Subjects

    Directory of Open Access Journals (Sweden)

    Inés Matia-García


    Full Text Available We analyzed the relationship of −794 CATT5–8 and −173 G>C MIF polymorphisms with mRNA and soluble MIF in young obese subjects. A total of 250 young subjects, 150 normal-weight and 100 obese subjects, were recruited in the study. Genotyping of −794 CATT5–8 and −173 G>C MIF polymorphisms was performed by PCR and PCR-RFLP, respectively. MIF mRNA expression was determined by real-time PCR and serum MIF levels were measured using an ELISA kit. For both MIF promoter polymorphisms, no significant differences in the genotype and allele frequencies between groups were observed. MIF mRNA expression was slightly higher in obese subjects than in normal-weight subjects (1.38-fold, while soluble MIF levels did not show differences between groups. In addition, we found an increase in MIF mRNA expression in carriers of the 6,6 and C/C genotypes and the 6G haplotype of the −794 CATT5–8 and −173 G>C MIF polymorphisms, although it was not significant. In conclusion, this study found no relationship between obesity and MIF gene promoter polymorphisms with MIF mRNA expression in young obese subjects.

  11. Tuberculosis in Scottish military veterans: evidence from a retrospective cohort study of 57 000 veterans and 173 000 matched non-veterans. (United States)

    Bergman, Beverly P; Mackay, D F; Pell, J P


    Tuberculosis was a major cause of morbidity and manpower loss in the Armed Forces during World War II. Military control programmes commenced in the 1950s but were initially limited in scope by the many recruits who were already tuberculin positive on enlistment. The aim of our study was to examine whether veterans have an increased risk of tuberculosis compared with non-veterans. Retrospective cohort study of 57 000 veterans born 1945-1985, and 173 000 people with no record of military service, resident in Scotland, matched for age, sex and area of residence, using Cox proportional hazard analysis to compare the risk of tuberculosis overall, by birth cohort, length of service and year of diagnosis and to examine comorbidities. Over mean 29 years follow-up, 69 (0.12%) veterans were recorded as having tuberculosis, compared with 267 (0.15%) non-veterans (unadjusted HR 0.90, 95% CIs 0.69 to 1.19, p=0.463). Only the 1945-1949 veterans' birth cohort was at higher risk, unadjusted HR 1.54, 95% CIs 0.98 to 2.45, p=0.061, although the difference in risk did not achieve significance. Veterans born from 1950 were at significantly reduced risk of tuberculosis compared with non-veterans after adjusting for deprivation, HR 0.67, 95% CI 0.47 to 0.95, p=0.026. The most common comorbidities were smoking-related and alcohol-related disease. The risk of comorbid hepatitis B or C was very low, in both veterans and non-veterans. No length of service was associated with an increased risk of tuberculosis in comparison with non-veterans. Scottish veterans born before 1950 are at moderately increased risk of tuberculosis compared with age, sex and geographically matched civilians with no record of service, although the difference is not statistically significant. Scottish veterans born from 1950 show a reduction in risk compared with civilians. Tuberculosis should be considered in the differential diagnosis of respiratory disease in the older veteran. Published by the BMJ Publishing

  12. Analysis of the spectrum of four-times-ionized lutetium (Lu V)

    International Nuclear Information System (INIS)

    Kaufman, V.; Sugar, J.


    Spectra of Lu obtained with a sliding spark discharge at peak currents of 50--500 A were recorded with a 10.7 m normal incidence spectrograph in the range of 500--2100 A. Intercomparison of spectra revealed a distinct separation of Lu III, IV, and V, the first two of which have already been anlayzed. The present work contains an interpretation of Lu V in which 419 lines are classified as transitions among 136 energy levels of the 4f 13 , 4f 12 5d, 4f 12 6s, and 4f 12 6p configurations. Calculated energy levels and eigenvectors, obtained with fitted values for the radial integrals, are given

  13. Lutetium-177 complexation of DOTA and DTPA in the presence of competing metals

    International Nuclear Information System (INIS)

    Watanabe, Satoshi; Ishioka, Noriko S.; Hashimoto, Kazuyuki


    177 Lu complexation of DOTA and DTPA is investigated by the addition of Ca(II), Fe(II) and Zn(II). The 177 Lu complexation yield of DTPA was higher than that of DOTA in the presence of Ca(II), Fe(II) and Zn(II). Therefore, it was found that the 177 Lu complexation of DTPA was more advantageous compared with DOTA in the presence of competing metals, Ca, Fe and Zn. (author)

  14. Lutetium-177 and iodine-131 loaded chelating polymer microparticles intended for radioembolization of liver malignancies

    Czech Academy of Sciences Publication Activity Database

    Hrubý, Martin; Škodová, Michaela; Macková, Hana; Skopal, Jan; Tomeš, Marek; Kropáček, Martin; Zimová, Jana; Kučka, Jan


    Roč. 71, č. 12 (2011), s. 1155-1159 ISSN 1381-5148 R&D Projects: GA ČR GPP207/10/P054; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z10480505 Keywords : macroporous chelating beads * radioembolization * quinoline-8-ol Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.479, year: 2011

  15. Production and evaluation of Lutetium-177 maltolate as a possible therapeutic agent

    International Nuclear Information System (INIS)

    Hakimi, A.; Jalilian, A. R.; Bahrami Samani, A.; Ghannadi Maragheh, M.


    Development of oral therapeutic radiopharmaceuticals is a new concept in radiopharmacy. Due to the interesting therapeutic properties of 177 Lu and oral bioavailability of maltolate (MAL) metal complexes, 177 Lu-maltolate ( 177 Lu-MAL) was developed as a possible therapeutic compound for ultimate oral administration. The specific activity of 2.6-3 GBq/mg was obtained by irradiation of natural Lu 2 O 3 sample with thermal neutron flux of 4x10 13 -2 .s -1 for Lu-177. The product was converted into chloride form which was further used for labeling maltol (MAL). At optimized conditions a radiochemical purity of about >99% was obtained for 177 Lu-MAL shown by ITLC (specific activity, 970-1000 Mbq/mmole). The stability of the labeled compound as well as the partition coefficient was determined in the final solution up to 24h. Biodistribution studies of Lu-177 chloride and 177 Lu-MAL were carried out in wild-type rats for post-oral distribution phase data. Lu-MAL is a possible therapeutic agent in human malignancies for the bone palliation therapy so the efficacy of the compound should be tested in various animal models.

  16. Thermodynamic characteristics of dehydration of hexahydrates of erbium, thulium and lutetium chlorides

    International Nuclear Information System (INIS)

    Ukraintseva, Eh.A.; Sokolova, N.P.; Logvinenko, V.A.


    Temperature dependence of water vapour equilibrium pressure over the compounds of ErCl 3 ·6H-2O, TmCl 3 ·6H 2 O and LuCl 3 ·6H 2 O is studied by membrane method within the temperature range of 309-403 K. Dehydration process stoichiometry is determined thermogravimetrically under quasi-equilibrium conditions. All three compounds split off three molecules at the first stage of dehydration. ErCl 3 ·6H 2 O and TmCl 2 ·6H 2 O are very similar to terbium and disprosium chloride hexahydrates by vapour pressure value and dehydration enthalpy; enthalpy of the first dehydration stage is of the same character as those of nedymium, gadolinium and holmium chloride haxahydrates

  17. Luminescence and defects creation in Ce3+-doped aluminium and lutetium perovskites and garnets

    International Nuclear Information System (INIS)

    Krasnikov, A.; Savikhina, T.; Zazubovich, S.; Nikl, M.; Mares, J.A.; Blazek, K.; Nejezchleb, K.


    Luminescence, scintillation response, energy transfer and defect creation processes were studied at 4.2-300K for Ce 3+ -doped YAlO 3 , Lu x Y 1-x AlO 3 (x=0.3) and Lu 3 Al 5 O 12 crystals under excitation in the 2.5-11.5eV energy range. Influence of the charge and ionic radius of co-doping ions on the efficiency of these processes, the origin of the defects created and possible mechanisms of their formation were discussed

  18. Crystal growth and scintillation properties of Ce-doped sodium calcium lutetium complex fluoride

    Czech Academy of Sciences Publication Activity Database

    Wakahara, S.; Furuya, Y.; Yanagida, T.; Yokota, Y.; Pejchal, Jan; Sugiyama, M.; Kawaguchi, N.; Totsuka, D.; Yoshikawa, A.


    Roč. 34, č. 4 (2012), s. 729-732 ISSN 0925-3467 Institutional research plan: CEZ:AV0Z10100521 Keywords : scintillator * micro-pulling-down method * single crystal * gamma-ray stopping power Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.918, year: 2012

  19. The beta strength function structure in β+ decay of lutetium, thulium and cesium isotopes

    International Nuclear Information System (INIS)

    Alkhazov, G.D.; Bykov, A.A.; Vitman, V.D.; Naumov, Yu.V.; Orlov, S.Yu.


    The spectra of total γ-absorption in the decays of some Lutecium, Thulium and Cesium isotopes have been measured. The probabilities for level population in the decay of the isotopes have been determined. The deduced beta strength functions reveal pronounced structure. Calculations of the strength functions using the Saxon-Woods potential and the residual Gamow-Teller interaction are presented. It is shown that in β + decay of light Thulium and Cesium isotopes the strength function comprises more than 70% of the Gamow-Teller excitations with μsub(tau) = +1. This result is the first direct observation of the Gamow-Teller resonance in β + decay of nuclei with Tsub(z) > O. (orig.)

  20. High pressure and temperature induced structural and elastic properties of lutetium chalcogenides (United States)

    Shriya, S.; Kinge, R.; Khenata, R.; Varshney, Dinesh


    The high-pressure structural phase transition and pressure as well temperature induced elastic properties of rock salt to CsCl structures in semiconducting LuX (X = S, Se, and Te) chalcogenides compound have been performed using effective interionic interaction potential with emphasis on charge transfer interactions and covalent contribution. Estimated values of phase transition pressure and the volume discontinuity in pressure-volume phase diagram indicate the structural phase transition from ZnS to NaCl structure. From the investigations of elastic constants the pressure (temperature) dependent volume collapse/expansion, melting temperature TM, Hardness (HV), and young modulus (E) the LuX lattice infers mechanical stiffening, and thermal softening.

  1. The isolation of lutetium from gadolinium contained in Purex process solutions

    International Nuclear Information System (INIS)

    Bostick, D.T.; Vick, D.O.; May, M.P.; Walker, R.L.


    A chemical separation procedure has been devised to isolate Lu from Purex dissolver solutions containing the neutron poison, Gd. The isolation procedure involves the removal of U and >Pu from a dissolver solution using tributylphosphate solvent extraction. If required, solvent extraction using di-(2-ethylhexyl) phosphoric acid can be employed to further purify the sample be removing alkali and alkali earth elements. Finally, Lu is chromatographically separated from Gd and rare earth fission products on a Dowex 50W-X8 resin column using an alpha-hydroxyisobutyrate eluant. The success of the chemical separation procedure has been demonstrated in the quantitative recovery of as little as 1.4 ng Lu from solutions containing a 5000-fold excess of Gd. Additionally, Lu has been isolated from synthetic dissolver samples containing U, Ba, Cs, and Gd. Thermal emission MS data indicated that the Lu fraction of the synthetic sample was free of Gd interference

  2. Effect of a fermented milk containing Bifidobacterium animalis DN-173 010 on the health-related quality of life and symptoms in irritable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial. (United States)

    Guyonnet, D; Chassany, O; Ducrotte, P; Picard, C; Mouret, M; Mercier, C-H; Matuchansky, C


    Health-related quality of life (HRQoL) has been rarely evaluated as a primary endpoint in the assessment of the effect of probiotics on the irritable bowel syndrome (IBS). To study the effects of fermented milk containing Bifidobacterium animalis DN-173 010 and yoghurt strains on the IBS in a multicentre, double-blind, controlled trial. A total of 274 primary care adults with constipation-predominant IBS (Rome II) were randomized to consume for 6 weeks either the test fermented milk or a heat-treated yoghurt (control). HRQoL and digestive symptoms were assessed after 3 and 6 weeks on an intention-to-treat population of 267 subjects. The HRQoL discomfort score, the primary endpoint, improved (P food on discomfort HRQoL score and bloating in constipation-predominant IBS, and on stool frequency in subjects with <3 stools/week.

  3. MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population. (United States)

    Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Jf, Muñoz-Valle


    Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Luminescence and energy transfer processes in (Lu,Tb).sub.3./sub.Al.sub.5./sub.O.sub.12./sub. single crystalline films doped with Ce.sup.3+./sup.

    Czech Academy of Sciences Publication Activity Database

    Bartosiewicz, Karol; Babin, Vladimir; Nikl, Martin; Mareš, Jiří A.; Zorenko, Yu.; Gorbenko, V.


    Roč. 173, May (2016), s. 141-148 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA ČR GAP204/12/0805 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : lutetium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline films Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.686, year: 2016

  5. Energy dependence of kaon-to-proton ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{NN}}$ = 6.3 to 17.3 GeV

    CERN Document Server

    Anticic, T.; Barna, D.; Bartke, J.; Beck, H.; Betev, L.; Bialkowska, H.; Blume, C.; Bogusz, M.; Boimska, B.; Book, J.; Botje, M.; Buncic, P.; Cetner, T.; Christakoglou, P.; Chung, P.; Chvala, O.; Cramer, J.G.; Eckardt, V.; Fodor, Z.; Foka, P.; Friese, V.; Gazdzicki, M.; Grebieszkow, K.; Hohne, C.; Kadija, K.; Karev, A.; Kolesnikov, V.I.; Kollegger, T.; Kowalski, M.; Kresan, D.; Laszlo, A.; Lacey, R.; van Leeuwen, M.; Mackowiak, M.; Makariev, M.; Malakhov, A.I.; Mateev, M.; Melkumov, G.L.; Mitrovski, M.; Mrowczynski, St.; Nicolic, V.; Palla, G.; Panagiotou, A.D.; Peryt, W.; Pluta, J.; Prindle, D.; Puhlhofer, F.; Renfordt, R.; Roland, C.; Roland, G.; Rybczynski, M.; Rybicki, A.; Sandoval, A.; Schmitz, N.; Schuster, T.; Seyboth, P.; Sikler, F.; Skrzypczak, E.; Slodkowski, M.; Stefanek, G.; Stock, R.; Strobele, H.; Susa, T.; Szuba, M.; Utvic, M.; Varga, D.; Vassiliou, M.; Veres, G.I.; Vesztergombi, G.; Vranic, D.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.


    Kaons and protons carry large parts of two conserved quantities, strangeness and baryon number. It is argued that their correlation and thus also fluctuations are sensitive to conditions prevailing at the anticipated parton-hadron phase boundary. Fluctuations of the $(\\mathrm{K}^+ + \\mathrm{K}^-)/(\\mathrm{p}+\\bar{\\mathrm{p}})$ and $\\mathrm{K}^+/\\mathrm{p}$ ratios have been measured for the first time by NA49 in central Pb+Pb collisions at 5 SPS energies between $\\sqrt{s_{NN}}$= 6.3~GeV and 17.3~GeV. Both ratios exhibit a change of sign in $\\sigma_{\\mathrm{dyn}}$, a measure of non-statistical fluctuations, around $\\sqrt{s_{NN}}$ = 8~GeV. Below this energy, $\\sigma_{\\mathrm{dyn}}$ is positive, indicating higher fluctuation compared to a mixed event background sample, while for higher energies, $\\sigma_{\\mathrm{dyn}}$ is negative, indicating correlated emission of kaons and protons. The results are compared to UrQMD calculations which which give a good description at the higher SPS energies, but fail to reproduc...

  6. Synthesis and silica coating of calcia-doped ceria/plate-like titanate (K0.8Li0.27Ti1.73O4) nanocomposite by seeded polymerization technique

    International Nuclear Information System (INIS)

    El-Toni, Ahmed Mohamed; Yin, Shu; Sato, Tsugio


    Calcia-doped ceria is of potential interest as an ultraviolet (UV) radiation blocking material in personal care products because of the excellent UV light absorption property and low catalytic ability for the oxidation of organic materials superior to undoped ceria. In order to reduce the oxidation catalytic activity further, calcia-doped ceria was coated with amorphous silica by means of seeded polymerization technique. Generally, nanoparticles of inorganic materials do not provide a good coverage for human skin because of the agglomeration of the particles. The plate-like particles are required to enhance the coverage ability of inorganic materials. This can be accomplished by synthesis of calcia-doped ceria/plate-like potassium lithium titanate (K 0.8 Li 0.27 Ti 1.73 O 4 ) nanocomposite with subsequent silica coating to control catalytic activity of calcia-doped ceria. Calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was prepared by soft chemical method followed by silica coating via seeded polymerization technique. Silica coated calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was characterized by X-ray diffraction, SEM, TEM, XPS and FT-IR

  7. Successive composition of two laser channels upon excitation of He-Ar-Xe (2.03 μm) and Ar-Xe (1.73 μm) mixtures by uranium fission fragments

    International Nuclear Information System (INIS)

    Pikulev, A A; Tsvetkov, V M; Sosnin, P V; Sinyanskii, A A


    The operation efficiency of the scheme with successive composition of two laser channels upon excitation of the active medium by uranium-235 fission fragments is studied experimentally and numerically. For the He:Ar:Xe = 380:380:1 mixture (at a pressure of 1 atm and the lasing wavelength λ = 2.03 μm) the maximum lasing power of a double channel (1 kW) is almost twice that of a single channel (540 W). Calculations show that in the case of ideal composition (without losses on mirrors) the lasing power of the double channel can be increased to 1.2 kW. For the Ar:Xe = 380:1 mixture (the pressure is 0.5 atm, λ = 1.73 μm) the maximum lasing power of the double channel (620 W) is slightly above that of the single channel (520 W), which is caused by the losses on aluminum mirrors employed for channel doubling and by a negative effect of optical inhomogeneities. In the case of ideal composition, the lasing power can be increased to 830 W. (lasers)

  8. Evaluation of the 175Lu(n,2n)174Lu, 175Lu(n,2n/sup 174m/Lu, and 175Lu(n,3n)173Lu cross sections from threshold to 20 MeV

    International Nuclear Information System (INIS)

    Philis, C.; Young, P.G.; Arthur, E.D.


    An evaluation of the 175 Lu(n,2n) 174 Lu, 175 Lu(n,2n)/sup 174m/Lu, and 175 Lu(n,3n) 173 Lu reactions from threshold to 20 MeV is presented. Available experimental data were renormalized to a consistent set of standards and were used along with results from statistical-preequilibrium model calculations to produce recommended curves for each of these reactions

  9. Areva at March 31, 2014: Downturn in revenue as anticipated, to euro 1.781 bn (-17.3% like for like), Backlog of euro 40.2 bn

    International Nuclear Information System (INIS)

    Duperray, Julien; Berezowskyj, Katherine; Grange, Aurelie; Rosso, Jerome; Thebault, Alexandre; Scorbiac, Marie de; Repaire, Philippine du


    Following the marked growth of the nuclear operations in 2013, thanks in particular to the strength of recurring activities and the contribution of exceptional items such as significant uranium sales volumes and non-recurring foreign contracts, revenue in the first quarter of the year fell sharply, as Areva had anticipated. A strong seasonal effect will materialize in 2014, with greater activity to be expected in the second half of the year. As indicated when releasing 2013 annual results, the current economic environment is still unfavorable, with market prices deteriorating in the front end of the cycle and lackluster demand from customers for installed base services. AREVA's operations generated consolidated revenue of 1.781 billion euros in the first quarter of 2014, a decrease of 18.1% (-17.3 % like for like) compared with the same period in 2013. The Front End Business Group (BG) reported strong growth of +59.0% (+59.8% like for like). Revenue was down in the Mining, Reactors and Services, Back End and Renewable Energies BGs, at -63.0% (-62.3% like for like), -14.1% (-12.5% like for like), -41.7% (-41.6% like for like) and -38.2% (-34.6% like for like) respectively. Foreign exchange had a negative impact of 18 million euros over the period, while the change in consolidation scope had a negative impact of 3 million euros. The group's backlog reached 40.2 billion euros at March 31, 2014, a decrease of 2.9% compared with December 31, 2013 and of 8.8% year on year

  10. RT-173: Helix, 2017 Helix Technical Report (United States)


    and to coordinate across the problem domain and solution domain. Categories include: communication; listening and comprehension ; working in a...proficiency set as a useful and comprehensive model. The forces identified in Figure 1 – experiences, mentoring, education and training – are linked

  11. 10 CFR 205.173 - Public hearings. (United States)


    ... proposed rule or regulation is likely to have a substantial impact on the Nation's economy or large numbers... hearing, together with the written comments submitted and other relevant information developed during the...

  12. 49 CFR 173.54 - Forbidden explosives. (United States)


    ... dimension of which exceeds 23 mm (0.906 inch), or a toy torpedo containing a mixture of potassium chlorate... subpart. (b) An explosive mixture or device containing a chlorate and also containing: (1) An ammonium...

  13. 21 CFR 173.65 - Divinylbenzene copolymer. (United States)


    ... weight-percent ethyl-vinyl-benzene, and no more than 4 weight-percent nonpolymerizable impurities. (b) In... Archives and Records Administration (NARA). For information on the availability of this material at NARA...

  14. 35_173 - 179_BIO 015 Akhilendra

    African Journals Online (AJOL)


    population live in small and medium ci ... based development projects should focus ... nges of sustainability viz; lack of basic amenities and facilities, heal ... rds sustainable living environment of Damaturu town in Yobe Sta ... rojects should focus on major areas of water, electricity, housi .... Ministry of Lands and Housing.

  15. 21 CFR 173.300 - Chlorine dioxide. (United States)


    ... sodium chlorite by electrolysis. (2) The generator effluent contains at least 90 percent (by weight) of... Health Association, 800 I St. NW., Washington, DC 20001-3750. You may inspect a copy at the Center for...

  16. 14 CFR 17.3 - Definitions. (United States)


    ... issuance of a Contracting Officer final decision. Contract disputes for purposes of ADR only may also... communication or the use of ADR. The Default Adjudicative Process is conducted by a DRO or Special Master... Office of Dispute Resolution for Acquisition. For a post-award protest, the awardee of the contract that...

  17. BDML Metadata: 173 [SSBD[Archive

    Lifescience Database Archive (English)

    Full Text Available NC-SA 0.180 af0395dc-f2a1-4e46-9a3b-28e282ab0526 0.105 x 0.105 x 0.5 (micrometer), 40 (second) ...

  18. 21 CFR 173.340 - Defoaming agents. (United States)


    ... cooking purposes, whereby no more than 10 parts per million is present in the cooked food. Formaldehyde As... alcohol Magnesium stearate As defined in § 172.863 of this chapter. Mineral oil: Conforming with § 172.878... chapter. Soybean oil fatty acids, hydroxylated Tallow, hydrogenated, oxidized or sulfated Tallow alcohol...

  19. 21 CFR 173.370 - Peroxyacids. (United States)


    ... good manufacturing practice (unless precluded by the U.S. Department of Agriculture's standards of... the Division of Petition Review, Center for Food Safety and Applied Nutrition, Food and Drug... National Archives and Records Administration (NARA). For information on the availability of this material...

  20. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Building Capacity for Sustainable Responses to Climate Change in Cities of Portuguese-speaking Small Island Developing States (Cabo Verde and São Tomé e Príncipe) - Final Technical Report (restricted access). Small Island Developing States (SIDS) are highly vulnerable to climate change. In some locations coastal ...

  1. 50 CFR 17.3 - Definitions. (United States)


    ... part; Authentic native articles of handicrafts and clothing means items made by an Indian, Aleut, or... species, or a fire or other natural catastrophic event in areas prone to such events). Conservation plan... captive populations of the affected species: (a) Provision of health care, management of populations by...

  2. 49 CFR 173.158 - Nitric acid. (United States)


    ... as identified by American Iron and Steel Institute type number, and, in addition, the letters “HT” following the steel designation on containers subject to stress relieving or heat treatment during... °F)), (B) Stabilized Type 347 in the as-welded condition, (C) Stabilized Type 347 stress-relieved...

  3. Search Results | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    As currently foreseen, neither the two-state nor the one-state solution offers much hope of resolving the Israeli-Palestinian conflict. Project ... The first phase of the project was funded after qualifying in a competition for projects featuring an ecosystem approach to human health in West Africa (100772). Project.

  4. 40 CFR 763.173 - Exemptions. (United States)


    ... inadequate to allow the Agency to make a reasoned judgment on any of the information required in paragraph (d... the appropriate ban. This letter will be considered a final Agency action for purposes of judicial... notice will be considered a final Agency action for purposes of judicial review. (j) The length of an...

  5. 32 CFR 17.3 - Commission personnel. (United States)


    ... with 32 CFR part 9, the Appointing Authority shall appoint at least three but no more than seven members and one or two alternate members. The Appointing Authority may remove members and alternate... Appointing Authority may replace the member, direct that an alternate member serve in the place of the...

  6. 47 CFR 87.173 - Frequencies. (United States)


    ....000-117.975 MHz Q DGP Differential GPS. 108.050 MHz Q RLT 108.100-111.950 MHz Q RLL ILS Localizer. 108....600-121.925 MHz O, L, Q MA, FAC, MOU, RLT, GCO, RCO, RPC 25 kHz channel spacing. 121.950 MHz K FAS 121.... 122.700 MHz G, L MA, FAU, MOU Unicom at airports with no control tower; Aeronautical utility stations...

  7. 49 CFR 173.308 - Lighters. (United States)


    ... word “sample” must appear on the shipping paper as part of the proper shipping name or in association... lighter design conforms to paragraph (a) of this section and passes or does not pass the required leakage... at least three years thereafter, a copy of each lighter's test report must be maintained by the...

  8. 33 CFR 173.3 - Definitions. (United States)


    ...: (a) [Reserved] (b) Issuing authority means a State that has a numbering system approved by the Coast Guard or the Coast Guard where a number system has not been approved. Issuing authorities are listed in..., firm, partnership, corporation, company, association, joint-stock association, or governmental entity...

  9. 173 Résumé Abstract

    African Journals Online (AJOL)


    1Laboratoire de Physique Appliquée de l'Université de Fianarantsoa - Madagascar. 2 Département de Sciences Exactes ... 3 Laboratoire de Mathématiques Et Physique des Systèmes-Groupes de Mécanique. Énergétique à .... Par définition, la vitesse de séchage est la variation par rapport au temps de l'humidité absolue ...

  10. 7 CFR 989.173 - Reports. (United States)


    ... certified by an organic certification organization currently registered with the California Department of Food and Agriculture or such certifying organization accredited under the National Organic Program... shall provide copies of the organic certificate(s) applicable to the quantity of raisins reported as...

  11. 7 CFR 1.173 - Judges. (United States)


    ... proceeding, (2) is related within the third degree by blood or marriage to any party to the proceeding, or (3... present. Any memorandum or other communication addressed to the Judicial Officer or a Judge, during the... prior to any hearing to be conducted by telephone or audio-visual telecommunication; (8) Require that...

  12. 49 CFR 173.29 - Empty packagings. (United States)


    ... hazardous material shall be offered for transportation and transported in the same manner as when it.... (c) A non-bulk packaging containing only the residue of a hazardous material covered by Table 2 of... in Column 10a of the § 172.101 table for transportation by vessel, an empty drum or cylinder may be...

  13. 49 CFR 173.63 - Packaging exceptions. (United States)


    ... transport personnel to remote work sites, such as offshore drilling units. (b) Cartridges, small arms, and... than 1 g explosive (excluding ignition and delay charges) that are electric blasting caps with leg wires 4 feet long or longer, delay connectors in plastic sheaths, or blasting caps with empty plastic...

  14. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Physico-chemical characteristics and fatty acid profile of desert date kernel oil in ... Learning for an uncertain future : vulnerabilities of agricultural production to ... trends in temperature, rainfall, sunshine, humidity and tidal water level in the ...

  15. 43 CFR 17.3 - Discrimination prohibited. (United States)


    ... participate in the program as an employee but only to the extent set forth in paragraph (c) of this section... impairing accomplishment of the objectives of the program as respect individuals of a particular race, color..., financial aid, or other benefits provided under a program receiving Federal financial assistance shall be...

  16. 21 CFR 173.50 - Polyvinylpolypyrrolidone. (United States)


    ... percent acetic acid, and 50 percent alcohol, no more than 50 parts per million of extractables is obtained with each solvent. (c) It is used or intended for use as a clarifying agent in beverages and vinegar...

  17. WESF (173)Cs gamma ray sources (United States)

    Kenna, B. T.


    The Waste Encapsulation and Storage Facility (WESP) at Hanford, Washington has been separating cesium from stored liquid defense waste since 1945. This is done to alleviate the heat generated by the decay of radioactive Cs137. The cesium is converted to CsCl, doubly encapsulated in 316l stainless steel, and placed in storage. The potential utility of these Cs137 capsules as gamma radiation sources was demonstrated. Registration of the capsule with the NRC as a sealed gamma source would facilitate the licensing of non-DOE irradiation facilities using this source. To grant this registration, the NRC requires characteristics of the capsule. It must also be demonstrated that the capsule will maintain its integrity under both normal circumstances and specified abnormal conditions. The required information is provided through collation of results of studies and tests done previously by other laboratories.

  18. 21 CFR 17.3 - Definitions. (United States)


    ... AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL CIVIL MONEY PENALTIES... giving rise to civil money penalty actions brought under 21 U.S.C. 333(g)(1): (1) Significant departure... has the same definition for civil money penalty actions that may be brought under that act. (e) Any...

  19. 21 CFR 173.165 - Candida lipolytica. (United States)


    ... may be safely used as the organism for fermentation production of citric acid in accordance with the... intended for use as a pure culture in the fermentation process for the production of citric acid from... such as oil, grease, detergent residues, etc. Examine all glassware including stoppers and stopcocks...

  20. Electron-phonon interaction in the binary superconductor lutetium carbide LuC2 via first-principles calculations (United States)

    Dilmi, S.; Saib, S.; Bouarissa, N.


    Structural, electronic, electron-phonon coupling and superconducting properties of the intermetallic compound LuC2 are investigated by means of ab initio pseudopotential plane wave method within the generalized gradient approximation. The calculated equilibrium lattice parameters yielded a very good accord with experiment. There is no imaginary phonon frequency in the whole Brillouin zone supporting thus the dynamical stability in the material of interest. The average electron-phonon coupling parameter is found to be 0.59 indicating thus a weak-coupling BCS superconductor. Using a reasonable value of μ* = 0.12 for the effective Coulomb repulsion parameter, the superconducting critical temperature Tc is found to be 3.324 which is in excellent agreement with the experimental value of 3.33 K. The effect of the spin-orbit coupling on the superconducting properties of the material of interest has been examined and found to be weak.

  1. Lanthanum(III) and Lutetium(III) in Nitrate-Based Ionic Liquids: A Theoretical Study of Their Coordination Shell. (United States)

    Bodo, Enrico


    By using ab initio molecular dynamics, we investigate the solvent shell structure of La(3+) and Lu(3+) ions immersed in two ionic liquids, ethylammonium nitrate (EAN) and its hydroxy derivative (2-ethanolammonium nitrate, HOEAN). We provide the first study of the coordination properties of these heavy metal ions in such a highly charged nonacqueous environment. We find, as expected, that the coordination in the liquid is mainly due to nitrate anions and that, due to the bidentate nature of the ligand, the complexation shell of the central ion has a nontrivial geometry and a coordination number in terms of nitrate molecules that apparently violates the decrease of ionic radii along the lanthanides series, since the smaller Lu(3+) ion seems to coordinate six nitrate molecules and the La(3+) ion only five. A closer inspection of the structural features obtained from our calculations shows, instead, that the first shell of oxygen atoms is more compact for Lu(3+) than for La(3+) and that the former coordinates 8 oxygen atoms while the latter 10 in accord with the typical lanthanide's trend along the series and that their first solvation shells have a slight irregular and complex geometrical pattern. When moving to the HOEAN solutions, we have found that the solvation of the central ion is possibly also due to the cation itself through the oxygen atom on the side chain. Also, in this liquid, the coordination numbers in terms of oxygen atoms in both solvents is 10 for La(3+) and 8 for Lu(3+).

  2. Magnetic susceptibility of scandium-hydrogen and lutetium-hydrogen solid-solution alloys from 2 to 3000K

    International Nuclear Information System (INIS)

    Stierman, R.J.


    Results for pure Sc show that the maximum and minimum in the susceptibility discovered earlier are enhanced as the impurity level of iron in scandium decreases. The Stoner enhancement factor, calculated from low-temperature heat capacity data, susceptibility data, and band-structure calculations show Sc to be a strongly enhanced paramagnet. Below 2 0 K, the magnetic anisotropy between the hard and easy directions of scandium decreases linearly with decreasing temperature, tending toward zero at 0 K. The large increase in the susceptibility of Sc at lower temperatures indicates magnetic ordering. Pure Lu and Lu-H alloys showed an anisotropy in susceptibility vs orientation; thus the samples were not random polycrystalline samples. Pure Lu shows the shallow maximum and minimum, but the increase in susceptibility at low temperatures is larger than previously observed. The susceptibility-composition dependence of the Lu-H alloys also did not match other data. The susceptibility-composition dependence does not match the composition dependence of the electronic specific heat constant below 150 K, showing the electronic specific heat is being affected by terms other than phonon-electron and pure electron-electron interactions

  3. Rare-earth antisites in lutetium aluminum garnets: influence on lattice parameter and Ce.sup.3+./sup. multicenter structure

    Czech Academy of Sciences Publication Activity Database

    Przybylińska, H.; Wittlin, A.; Ma, C.G.; Brik, M.G.; Kamińska, A.; Sybilski, P.; Zorenko, Yu.; Nikl, Martin; Gorbenko, V.; Fedorov, A.; Kučera, M.; Suchocki, A.


    Roč. 36, č. 9 (2014), s. 1515-1519 ISSN 0925-3467 R&D Projects: GA ČR GAP204/12/0805 Institutional support: RVO:68378271 Keywords : garnets * scintillators * laser materials * phosphors Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.981, year: 2014

  4. Controllable synthesis of Eu{sup 3+}/Tb{sup 3+} activated lutetium fluorides nanocrystals and their photophysical properties

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jintai; Huo, Jiansheng [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Cai, Yuepeng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangdong Technology Research Center for Ecological Management and Remediation of Urban Water System, Guangzhou 510006 (China)


    In this paper, phosphors of LuF{sub 3}:Eu{sup 3+}/Tb{sup 3+} have been successfully synthesized with small chelator ethylenediaminetetra acetic acid (EDTA) or amphiphilic polymer (polyethylene glycol, PEG-1000) as templates via a hydrothermal method. X-ray powder diffraction (XRD), scanning electronic microscope (SEM), and photo-luminescent spectra techniques (PL) were used to characterize the as-prepared samples. XRD patterns showed that well crystallized lanthanide fluorides with hexagonal phase were achieved. SEM images revealed that different regular microstructures were achieved. The photo-luminescent properties of LuF{sub 3}:Eu{sup 3+} demonstrated that there are significant energy transfers from fluorides to Eu{sup 3+}. The results presented that EDTA as the template will lead to the highest emission intensities. -- Highlights: • Various templates were used to synthesize LuF{sub 3}:Eu{sup 3+}/Tb{sup 3+}. • All the phosphors were red or green emissive. • Different morphologies were acquired and controllable.

  5. An alkali-metal ion extracted layered compound as a template for a metastable phase synthesis in a low-temperature solid-state reaction: preparation of brookite from K0.8Ti1.73Li0.27O4. (United States)

    Ozawa, Tadashi C; Sasaki, Takayoshi


    We have designed a new approach to synthesize brookite, i.e., to extract alkali-metal ions from K(0.8)Ti(1.73)Li(0.27)O(4) (KTLO) and to apply simultaneous heat treatment to the remaining lepidocrocite-type layers of TiO(6) octahedra. For the alkali-metal ion extraction and the simultaneous heat treatment, KTLO was heated at 400 degrees C with polytetrafluoroethylene (PTFE) in flowing Ar. PTFE has been found to be an effective agent to extract strongly electropositive alkali-metal ions from KTLO because of the strong electronegativity of F as its component. The product of this reaction consists of a mixture of brookite, K(2)CO(3), LiF, and PTFE derivatives, indicating the complete extraction of K(+) and Li(+) from KTLO and formation of brookite from the lepidocrocite-type layer of TiO(6) octahedra as a template. This brookite has a partial replacement of O(2-) with F(-) and/or slight oxygen deficiency; thus, its color is light-bluish gray. Fully oxidized brookite formation and complete decomposition of PTFE derivatives have been achieved by further heating in flowing air, and coproduced alkali-metal salts have been removed by washing in water. Powder X-ray diffraction, Raman spectroscopy, and chemical analysis results have confirmed that the final brookite product treated at 600 degrees C is single phase, and it is white. The method to extract alkali-metal ions from a crystalline material using PTFE is drastically different from the common methods such as soft-chemical and electrochemical reactions. It is likely that this new synthetic approach is applicable to other layered systems to prepare a diverse family of compounds, including novel metastable ones.

  6. 49 CFR 173.59 - Description of terms for explosives. (United States)


    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1... insensitive detonating substances and which demonstrate a negligible probability of accidental initiation or... processes. Charges, propelling. Articles consisting of propellant charge in any physical form, with or...

  7. 24 CFR 17.3 - Administrative claim; who may file. (United States)


    ... representative. (c) A claim based on death may be presented by the executor or administrator of the decedent's... evidence of his authority to present a claim on behalf of the claimant as agent, executor, administrator...

  8. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

  9. 49 CFR 173.21 - Forbidden materials and packages. (United States)


    ... stabilized or inhibited in a manner to preclude such evolution. The SADT may be determined by any of the test... generate a dangerous evolution of heat, unless packaged in a manner which precludes such an occurrence. (d... container, or overpack with another material, the mixing of which is likely to cause a dangerous evolution...

  10. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC supports research in developing countries to create real and lasting change. ... Community Based Governance of Wetlands in the Sand River Catchment Area (South Africa) ... Sri Lanka, Central Asia, Far East Asia, South Asia. PROJECT ...

  11. 21 CFR 173.350 - Combustion product gas. (United States)


    .... Caution. The various parts of the absorption train must be connected by gas-tight tubing and joints... gas source is connected in series to the flow-rate device, the flow meter, and the absorption.... Maintain the coolant bath at 0 °C throughout. Remove the absorption vessel from the bath, disconnect, and...

  12. 49 CFR 173.181 - Pyrophoric materials (liquids). (United States)


    ... inner receptacles of glass or metal, not over 1 L (0.3 gallon) capacity each, having positive screwcap... be closed by positive means, not by friction. (c) Steel drums (1A2) or fiber drums (1G) not exceeding... each, closed by positive means, not friction. (1) Inner packagings must have no opening exceeding 25 mm...

  13. 49 CFR 173.319 - Cryogenic liquids in tank cars. (United States)


    ... Federal Railroad Administration may be made by e-mail to [email protected] or telephone call to (202....113A60W. (e) Special requirements for class DOT 113 tank cars—(1) A class DOT-113 tank car need not be... integrity test. When required by paragraph (e)(1) of this section, either of the following thermal integrity...

  14. 33 CFR 173.57 - Contents of report. (United States)


    ... contributed to causing the casualty. (w) The make, model, type (open, cabin, house, or other), beam width at... outdrive, sail, or other), fuel (gas, diesel, or other), construction (wood, steel, aluminum, plastic...

  15. 21 CFR 173.325 - Acidified sodium chlorite solutions. (United States)


    ... processing of red meat, red meat parts, and organs as a component of a spray or in the processing of red meat... rinse prior to consumption. (2) The additive is used as a single application in processing facilities as... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR...

  16. 173 original article glycated haemoglobin levels in patients

    African Journals Online (AJOL)


    therapy, two patients had pre-diabetes with HbA1c values of 6.0% and 5.8% while the HbA1c values of the remaining patients were less than .... determined by the blood glucose levels in the .... treatment of MDR-TB on glycaemic homeostasis.

  17. 21 CFR 173.5 - Acrylate-acrylamide resins. (United States)


    ... produced by the polymerization of acrylamide with partial hydrolysis, or by copolymerization of acrylamide... polyacrylate-acrylamide resin is produced by the polymerization and subsequent hydrolysis of acrylonitrile in a... or cane sugar juice and liquor or corn starch hydrolyzate in an amount not to exceed 5 parts per...

  18. 49 CFR 173.199 - Category B infectious substances. (United States)


    ... this section; (ii) Anticoagulants used to stabilize blood or plasma; or (iii) Small quantities of Class... copy or electronic image of these instructions must be retained by the manufacturer and subsequent...

  19. 49 CFR 173.197 - Regulated medical waste. (United States)


    ... requirements of § 178.801(j) and record retention requirements of § 178.801(l) of this subchapter. Inner... constructed of metal or fiberglass and have a capacity of at least 3.5 cubic meters (123.6 cubic feet) and not... welded or seamless construction and a rigid, weatherproof top to prevent the intrusion of water (e.g...

  20. 21 CFR 173.25 - Ion-exchange resins. (United States)


    ..., distilled water and 10 percent ethanol, when, following washing and pretreatment of the resin in accordance... paragraph (a)(18) of this section is used to treat aqueous sugar solutions subject to the condition that the temperature of the sugar solution passing through the resin bed is maintained at 82 °C (179.6 °F) or less and...

  1. 21 CFR 173.310 - Boiler water additives. (United States)


    ...-sodium acrylate resin Contains not more than 0.05 percent by weight of acrylamide monomer. Acrylic acid/2...-hydroxyethylidene-1,1-diphosphonic acid (CAS Reg. No. 2809-21-4) and its sodium and potassium salts Lignosulfonic.... Potassium carbonate Potassium tripolyphosphate Sodium acetate Sodium alginate Sodium aluminate Sodium...

  2. 21 CFR 173.20 - Ion-exchange membranes. (United States)



  3. 21 CFR 173.40 - Molecular sieve resins. (United States)



  4. 173 Christian Missionaries and Civilization in Southern Nigeria ...

    African Journals Online (AJOL)


    and Christianity into the interiors of West Africa during their civilizing mission in 1841” (p. 87). ... record that civilization in Nigeria started around the mission houses. .... the advent of the missionaries slavery was rampant among the people of ...

  5. 40 CFR 180.173 - Ethion; tolerances for residues. (United States)


    ..., meat 0.2 10/1/08 Hog, meat byproducts 0.2 10/1/08 Horse, fat 0.2 10/1/08 Horse, meat 0.2 10/1/08 Horse...: Commodity Parts per million Expiration/Revocation Date Cattle, fat 0.2 10/1/08 Cattle, meat 0.2 10/1/08 Cattle, meat byproducts 0.2 10/1/08 Citrus, dried pulp 25.0 10/1/08 Fruit, citrus, group 10 5.0 10/1/08...

  6. Dicty_cDB: AFI173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available cDNA clone:pph30f12, 3' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration... sequence. 74 3e-09 1 CN206834 |CN206834.1 Tor7258 Gametophyte rehydration Librar

  7. 32 CFR 173.2 - Competitive Information Certification. (United States)


    ... Procurement Task Force. (2) The requirement to provide the Certificate may be further limited to certain... Business Ethics and Integrity complying with the Interim rule in lieu of Competitive Information...

  8. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Learning Initiatives for Network Economies in Asia (LIRNEasia) : Building Capacity in ICT Policy. It is now generally accepted that affordable, effective telecommunication services play an integral role in development. Central Asia, Far East Asia, South Asia, Cambodia, Sri Lanka, Indonesia, Laos, Pakistan, Philippines.

  9. 49 CFR 173.62 - Specific packaging requirements for explosives. (United States)


    ...:“Packaging approved by the competent authority of the United States of America (USA)”. PARTICULAR PACKING.... A jet perforating gun, charged, oil well may be transported under the following conditions: a... from every other kind, and from any gun, tool or other supplies, unless approved in accordance with...

  10. 34 CFR 403.173 - What expenses are allowable? (United States)


    ... ADULT EDUCATION, DEPARTMENT OF EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What... coordination between vocational education programs, business, and industry, including advisory council meetings...

  11. 49 CFR 173.4a - Excepted quantities. (United States)


    ... onto a solid unyielding surface from a height of 1.8 m (5.9 feet): (i) Where the sample is in the shape... sample is in the shape of a drum, it must be dropped in each of the following orientations: (A) One drop...

  12. 1935 15' Quad #173 Aerial Photo Mosaic Index - NM (United States)

    Earth Data Analysis Center, University of New Mexico — Aerial Photo Reference Mosaics contain aerial photographs that are retrievable on a frame by frame basis. The inventory contains imagery from various sources that...

  13. 49 CFR 173.196 - Category A infectious substances. (United States)


    ... temperatures and pressures of transport by aircraft to which they could be subjected if refrigeration were lost... pressure producing a pressure differential of not less than 95 kPa (0.95 bar, 14 psi). (7) The primary... well as the temperatures and pressures of transport by aircraft to which they could be subjected if...

  14. All projects related to | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: HEALTH POLICY, DISEASES, LABOUR SHORTAGE, Economic and social development, RESEARCH CAPACITY, RESEARCH FELLOWSHIPS, INSTITUTION BUILDING. Region: Mozambique, Brazil, South Africa. Program: ... Region: Indonesia, Malaysia, Philippines, Viet Nam. Program: Employment and Growth.

  15. 21 CFR 173.150 - Milk-clotting enzymes, microbial. (United States)


    ...; family, Bacillaceae; genus, Bacillus; species, cereus (Frankland and Frankland). (3) Mucor pusillus Lindt...; genus, Mucor; species, pusillus; variety, Lindt. (4) Mucor miehei Cooney et Emerson classified as follows: Class, Phycomycetes; subclass, Zygomycetes; order, Mucorales; family, Mucoraceae; genus, Mucor...

  16. Dicty_cDB: VSF173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

  17. 19 CFR 10.173 - Evidence of country of origin. (United States)


    ... entry—(1) Merchandise not wholly the growth, product, or manufacture of a beneficiary developing country... growth, product, or manufacture of a single beneficiary developing country, the exporter of the... shown. Failure to submit the declaration in a timely fashion will result in a denial of duty-free...

  18. 24 CFR 248.173 - Resident homeownership program. (United States)


    ..., consistent with paragraph (f) of this section; (x) How the marketing of currently vacant units and units... 50 percent of such proceeds shall be returned to the Commissioner for use under §§ 248.157 and 248... homeowner under the homeownership program approved under this section shall be paid to the HOME Investment...

  19. People’s Republic of China Scientific Abstracts, Number 173. (United States)


    method, and the PCA reaction suppressing action of disodium chromoglycate and the sapo - ninum of Shao-nien-hung (Ardisia alyxiacfolia Tsiang.) The...element is its sapo - ninum, which is highly toxic, but the toxicity of its acetylated and hydrolytic product is much less. AUTHOR: CH’EN Ti-hua [7II5

  20. 49 CFR 173.50 - Class 1-Definitions. (United States)


    .... (a) Explosive. For the purposes of this subchapter, an explosive means any substance or article... minor explosion hazard. The explosive effects are largely confined to the package and no projection of fragments of appreciable size or range is to be expected. An external fire must not cause virtually...

  1. Road Materials and Pavement Design, Volume 17(3)

    CSIR Research Space (South Africa)

    De Beer, Morris


    Full Text Available Environment, Pretoria, South Africa Jo Sias Daniel - University of New Hampshire, USA Zhongyin Guo - Tongji University, Shanghai, P.R. of China Kwang W. Kim - Kangwon National University, Republic of Korea Niki Kringos - KTH Royal Institute of Technology...

  2. South of Sahara | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language French. Read more about Le partenariat mondial sur les données ouvertes pour le développement. Language French. Read more about Renforcement des capacités de recherche en agriculture visant le développement en Afrique subsaharienne. Language French. Read more about Soutien organisationnel de ...

  3. 49 CFR 173.417 - Authorized fissile materials packages. (United States)


    ... for export and import shipments. (2) A residual “heel” of enriched solid uranium hexafluoride may be... made in accordance with Table 2, as follows: Table 2—Allowable Content of Uranium Hexafluoride (UF6... Liters Cubic feet Maximum Uranium 235-enrichment (weight)percent Maximum “Heel” weight per cylinder UF6...

  4. Publications | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    E-Commerce in the Asian Context : Selected Case Studies. Le commerce électronique en Asie retient beaucoup l'attention en raison de la prolifération des connexions Internet et des technologies connexes dans la région. Face à cette tendance, le Centre de recherches pour le développement international (.

  5. 46 CFR 108.173 - Class I, Division 2 locations. (United States)


    ... of the mud circulating system from the final degassing discharge to the mud suction connection at the mud pit. (b) A location in the weather that is— (1) Within the boundaries of the drilling derrick up...

  6. 49 CFR 173.318 - Cryogenic liquids in cargo tanks. (United States)


    ... without an intervening shut-off valve, or a check valve permitting flow from the pipe or hose into the... valve, pipe or fitting, external to the jacket that retains lading during transportation may not be... system of one or more pressure relief valves; and (B) A secondary system of one of more frangible discs...

  7. Structural and optical properties of Vernier phase lutetium oxyfluorides doped with lanthanide ions: interesting candidates as scintillators and X-Ray phosphors

    Czech Academy of Sciences Publication Activity Database

    Passuello, T.; Piccinelli, M.; Trevisani, M.; Giarola, M.; Mariotto, G.; Marciniak, L.; Hreniak, D.; Guzik, M.; Fasoli, M.; Vedda, A.; Jarý, Vítězslav; Nikl, Martin; Causin, V.; Bettinelli, M.; Speghini, A.


    Roč. 22, č. 21 (2012), s. 10639-10649 ISSN 0959-9428 R&D Projects: GA AV ČR KAN300100802 Institutional research plan: CEZ:AV0Z10100521 Keywords : oxyfluoride * luminescence * scintillator * phosphor * Eu3+ * Ce3+ * Pr3+ Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.968, year: 2011

  8. Investigations of structural, elastic, electronic and thermodynamic properties of lutetium filled skutterudite LuFe4P12 under pressure effect: FP-LMTO method

    Directory of Open Access Journals (Sweden)

    Boudia Keltouma


    Full Text Available Structural, elastic, electronic and thermodynamic properties of ternary cubic filled skutterudite compound were calculated. We have computed the elastic modulus and its pressure dependence. From the elastic parameter behavior, it is inferred that this compound is elastically stable and ductile in nature. Through the quasi-harmonic Debye model, in which phononic effects are considered, the effect of pressure P (0 to 50 GPa and temperature T (0 to 3000 °C on the lattice constant, elastic parameters, bulk modulus B, heat capacity, thermal expansion coefficient α, internal energy U, entropy S, Debye temperature θD, Helmholtz free energy A, and Gibbs free energy G are investigated.

  9. Aluminum and gallium substitution in yttrium and lutetium aluminum−gallium garnets: investigation by single-crystal NMR and TSL methods

    Czech Academy of Sciences Publication Activity Database

    Laguta, Valentyn; Zorenko, Y.; Gorbenko, V.; Iskalieva, A.; Zagorodniy, Y.; Sidletskiy, O.; Bilski, P.; Twardak, A.; Nikl, Martin


    Roč. 120, č. 42 (2016), s. 24400-24408 ISSN 1932-7447 R&D Projects: GA ČR GA16-15569S Institutional support: RVO:68378271 Keywords : garnets * Ga and Al site occupation * nuclear magnetic resonance * thermoluminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.536, year: 2016

  10. Etudes optiques de nouveaux materiaux laser: Des orthosilicates dopes a l'ytterbium: Le yttrium (lutetium,scandium) pentoxide de silicium (United States)

    Denoyer, Aurelie

    La decouverte et l'elaboration de nouveaux materiaux laser solides suscitent beaucoup d'interet parmi la communaute scientifique. En particulier les lasers dans la gamme de frequence du micron debouchent sur beaucoup d'applications, en telecommunication, en medecine, dans le domaine militaire, pour la, decoupe des metaux (lasers de puissance), en optique non lineaire (doublage de frequence, bistabilite optique). Le plus couramment utilise actuellement est le Nd:YAG dans cette famille de laser, mais des remplacants plus performants sont toujours recherches. Les lasers a base d'Yb3+ possedent beaucoup d'avantages compares aux lasers Nd3+ du fait de leur structure electronique simple et de leur deterioration moins rapide. Parmi les matrices cristallines pouvant accueillir l'ytterbium, les orthosilicates Yb:Y 2SiO5, Yb:Lu2SiO5 et Yb:Sc2SiO 5 se positionnent tres bien, du fait de leur bonne conductivite thermique et du fort eclatement de leur champ cristallin necessaire a l'elaboration de lasers quasi-3 niveaux. De plus l'etude fine et systematique des proprietes microscopiques de nouveaux materiaux s'avere toujours tres interessante du point de vue de la recherche fondamentale, c'est ainsi que de nouveaux modeles sont concus (par exemple pour le champ cristallin) ou que de nouvelles proprietes inhabituelles sont decouvertes, menant a de nouvelles applications. Ainsi d'autres materiaux dopes a l'ytterbium sont connus pour leurs proprietes de couplage electron-phonon, de couplage magnetique, d'emission cooperative ou encore de bistabilite optique, mais ces proprietes n'ont encore jamais ete mises en evidence dans Yb:Y 2SiO5, Yb:Lu2SiO5 et Yb:Sc2SiO 5. Ainsi, cette these a pour but l'etude des proprietes optiques et des interactions microscopiques dans Yb:Y2SiO 5, Yb:Lu2SiO5 et Yb:Sc2SiO5. Nous utilisons principalement les techniques d'absorption IR et de spectroscopie Raman pour determiner les excitations du champ cristallin et les modes de vibration dans le materiau. Des mesures optiques sous champ magnetique ont egalement ete effectuees dans le but de caracteriser le comportement de ces excitations lorsqu'elles sont soumises a l'effet Zeeman. La resonance paramagnetique electronique a permis de completer cette etude de l'eclatement Zeeman suivant toutes les orientations du cristal. Enfin la fluorescence par excitation selective et la fluorescence induite par Raman FT, completent la description des niveaux d'energie et revelent l'existence d'emission cooperative de deux ions Yb3+ et de transferts d'energie. Les resultats de cette these apportent une contribution originale dans le domaine des nouveaux materiaux lasers par l'etude et la comprehension des interactions fines et des proprietes microscopiques d'un materiau en particulier. Ils debouchent a la fois sur des applications possibles dans le domaine de l'optique et des lasers, et sur la comprehension d'aspects fondamentaux. Cette these a prouve l'interet de ces matrices pour leur utilisation comme lasers solides: un fort eclatement du champ cristallin favorable a l'elaboration de laser quasi-3 niveaux, et de larges bandes d'absorption (dues a un fort couplage electron-phonon et a des raies satellites causees par une interaction d'echange entre deux ions Yb3+) qui permettent la generation d'impulsions laser ultra-courtes, l'accordabilite du laser, etc. De plus la miniaturisation des lasers est possible pour l'optique integree grace a des couches minces synthetisees par epitaxie en phase liquide dont nous avons demontre la tres bonne qualite structurale et l'ajustement possible de certains parametres. Nous avons reconstruit le tenseur g du niveau fondamental (qui donne des informations precieuses sur les fonctions d'onde), ceci dans le but d'aider les theoriciens a concevoir un modele de champ cristallin valide. Plusieurs mecanismes de transferts d'energie ont ete mis en evidence: un mecanisme de relaxation d'un site vers l'autre, un mecanisme d'emission cooperative, et un mecanisme d'excitation de l'Yb3+ par le Tm3+ (impurete presente dans le materiau). Ces transferts sont plutot nefastes pour la fabrication d'un laser mais sont interessants pour l'optique non lineaire (doublage de frequence, memoires optiques). Enfin, plusieurs elements (le couplage magnetique de paire, le couplage electron-phonon et l'emission cooperative) nous ont permis de conclure sur le caractere covalent de la matrice. Nous avons d'ailleurs demontre ici le role de la covalence dans l'emission cooperative, transition habituellement attribuee aux interactions multipolaires electriques.

  11. Synthesis, Radiolabelling and In Vitro Characterization of the Gallium-68-, Yttrium-90- and Lutetium-177-Labelled PSMA Ligand, CHX-A''-DTPA-DUPA-Pep. (United States)

    Baur, Benjamin; Solbach, Christoph; Andreolli, Elena; Winter, Gordon; Machulla, Hans-Jürgen; Reske, Sven N


    Since prostate-specific membrane antigen (PSMA) has been identified as a diagnostic target for prostate cancer, many urea-based small PSMA-targeting molecules were developed. First, the clinical application of these Ga-68 labelled compounds in positron emission tomography (PET) showed their diagnostic potential. Besides, the therapy of prostate cancer is a demanding field, and the use of radiometals with PSMA bearing ligands is a valid approach. In this work, we describe the synthesis of a new PSMA ligand, CHX-A''-DTPA-DUPA-Pep, the subsequent labelling with Ga-68, Lu-177 and Y-90 and the first in vitro characterization. In cell investigations with PSMA-positive LNCaP C4-2 cells, KD values of ≤14.67 ± 1.95 nM were determined, indicating high biological activities towards PSMA. Radiosyntheses with Ga-68, Lu-177 and Y-90 were developed under mild reaction conditions (room temperature, moderate pH of 5.5 and 7.4, respectively) and resulted in nearly quantitative radiochemical yields within 5 min.

  12. Synthesis, Radiolabelling and In Vitro Characterization of the Gallium-68-, Yttrium-90- and Lutetium-177-Labelled PSMA Ligand, CHX-A''-DTPA-DUPA-Pep

    Directory of Open Access Journals (Sweden)

    Benjamin Baur


    Full Text Available Since prostate-specific membrane antigen (PSMA has been identified as a diagnostic target for prostate cancer, many urea-based small PSMA-targeting molecules were developed. First, the clinical application of these Ga-68 labelled compounds in positron emission tomography (PET showed their diagnostic potential. Besides, the therapy of prostate cancer is a demanding field, and the use of radiometals with PSMA bearing ligands is a valid approach. In this work, we describe the synthesis of a new PSMA ligand, CHX-A''-DTPA-DUPA-Pep, the subsequent labelling with Ga-68, Lu-177 and Y-90 and the first in vitro characterization. In cell investigations with PSMA-positive LNCaP C4-2 cells, KD values of ≤14.67 ± 1.95 nM were determined, indicating high biological activities towards PSMA. Radiosyntheses with Ga-68, Lu-177 and Y-90 were developed under mild reaction conditions (room temperature, moderate pH of 5.5 and 7.4, respectively and resulted in nearly quantitative radiochemical yields within 5 min.

  13. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.

  14. Manual on the proper use of lutetium-177-labeled somatostatin analogue (Lu-177-DOTA-TATE) injectable in radionuclide therapy (2nd ed.). (United States)

    Hosono, Makoto; Ikebuchi, Hideharu; Nakamura, Yoshihide; Nakamura, Nobutaka; Yamada, Takahiro; Yanagida, Sachiko; Kitaoka, Asami; Kojima, Kiyotaka; Sugano, Hiroyasu; Kinuya, Seigo; Inoue, Tomio; Hatazawa, Jun


    Here we present the guideline for the treatment of neuroendocrine tumors using Lu-177-DOTA-TATE on the basis of radiation safety aspects in Japan. This guideline was prepared by a study supported by Ministry of Health, Labour, and Welfare, and approved by Japanese Society of Nuclear Medicine. Lu-177-DOTA-TATE treatment in Japan should be carried out according to this guideline. Although this guideline is applied in Japan, the issues for radiation protection shown in this guideline are considered internationally useful as well. Only the original Japanese version is the formal document.

  15. Peptide receptor radionuclide therapy of Merkel cell carcinoma using 177lutetium-labeled somatostatin analogs in combination with radiosensitizing chemotherapy. A potential novel treatment based on molecular pathology

    International Nuclear Information System (INIS)

    Salavati, A.; Prasad, V.; Baum, R.P.; Schneider, C.P.; Herbst, R.


    Few studies have been published on the safety and feasibility of synchronous use of peptide receptor radionuclide therapy (PRRNT), as source of internal radiation therapy, in combination with chemotherapy. In this study we reported a 53-year-old man with stage IV Merkel cell carcinoma (MCC), who underwent synchronous internal radiation therapy and chemotherapy. Based on presumable poor prognosis with chemotherapy only, functional similarities of MCC with other neuroendocrine tumors and available evidence of effectiveness and safety of synchronous use of external beam radiation therapy and chemotherapy in treatment of high-risk MCC patients, our interdisciplinary neuroendocrine tumor board recommended him to add PRRNT to his ongoing chemotherapy. He received 2 courses of 177 Lu-DOTATATE(1, 4, 7, 10-Tetraazacyclododecane-1, 4, 7, 10-tetraacetic acid-1-D-Phe1-Tyr3-Thr8-octreotide) in combination with ongoing 8 cycles of liposomal doxorubicin based on standard protocols. Response to therapy was evaluated by 18 F-fluorodeoxyglucose ( 18 F-FDG) and 68 gallium-somatostatin-receptor PET/CT. There was an impressive improvement of the clinical symptoms. However, follow-up positron emission tomography (PET)/CT studies showed mixed pattern of response. Synchronous use of PRRNT and radiosensitizing chemotherapy seems safe and feasible in high risk MCC patients, however, further prospective studies and clinical trials are warranted to provide reliable evidence of possible pitfalls and effectiveness of PRRNT and 68 Ga-somatostatin-receptor PET/CT in the management of MCC. (author)

  16. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    International Nuclear Information System (INIS)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane; Dorrer, Holger; Zhernosekov, Konstantin; Koester, Ulli; Tuerler, Andreas; Schibli, Roger


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with 67 Cu- and 177 Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide 177 Lu and the potential alternative 161 Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched 160 Gd targets. 161 Tb and 177 Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of 177 Lu- and 161 Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. 177 Lu- and 161 Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. 161 Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the 177 Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the 161 Tb-DOTA-chCE7 than the 177 Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM 161 Tb RIT is more effective compared to 177 Lu RIT in ovarian cancer xenografts. These results suggest that 161 Tb is a promising candidate for future clinical applications in combination with internalising antibodies. (orig.)

  17. Effect of the ion force on the stability constants of the complexes LnCl2+ and LnCl2+ of Europium and Lutetium

    International Nuclear Information System (INIS)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.


    A study is presented on the determination of the constants of stability of those complex LnCI 3-n n (where Ln = Eu 3+ and Lu 3+ and n = 1 and 2), by means of a method of extraction with solvent, to constant temperature (303 K) and in means of high ionic force (1- 3M H CI/HCIO 4 ). It is also presented the application of the theory of the specific interaction of ions (SIT) of Bronsted-Guggenheim-Scatchard for the extrapolation of the values to infinite dilution. (Author)

  18. Study of the radiolabeling of substance P with Lutetium-177 and analysis of the stability in vitro: development of new radiopharmaceutical for tumor treatment

    International Nuclear Information System (INIS)

    Lima, Clarice Maria de; Pujatti, Priscilla Brunelli; Mengatti, Jair Mengatti; Araujo, Elaine Bortoleti de


    Substance P (SP) is an 11- amino acid neuropeptide, which is known as an important member of the family of the tachykinins, characterized by the C-terminal sequence Phe-X-Gly-Leu-Met-NH2. Radiolabeled SP has been described and proposal for detection and treatment of diseases such as arthritis and tumors. SP is the most important target of neurokinin 1 (NK-1) receptors, over expressed in malignant gliomas. 177 Lu is commonly used in the production of radiopharmaceuticals for treatment of neuroendocrine tumors and is a radionuclide with favorable properties for endo radiotherapy. The half-life of 177 Lu is 6.75 days and it emits b- particles of 497 keV average energy. Moreover, 177 Lu also emits g radiation of 208 keV average energy, which makes imaging diagnosis possible. There are few studies describing radiolabeled SP analogs in literature and the objective of this work was to study the radiolabeling conditions and the stability of SP complexed to DOTA chelator, using 177 Lu as radionuclide, in order to determine the best radiolabeling methodology. A high radiochemical purity (> 95%) and high specific activity of DOTA-SP was achieved when the reaction time was 30 minutes, the temperature was 90 deg C, the mass of DOTA-SP was 10 mg and 177 Lu activity was 185 MBq. These conditions extrapolate will be used in future experiments with high activity and also in in vitro and in vivo studies involving glioma models. (author)

  19. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts. These results suggest that {sup 161}Tb is a promising candidate for future clinical applications in combination with internalising antibodies. (orig.)

  20. Solvent extraction of lanthanide ions with 1-Phenyl-3-Methyl-4-Benzoyl-Pyrazolone-5 (HPMBP), 2. Extraction of Erbium(III), Ytterbium(III) and Lutetium(III) by HPMBP from aqueous-methanol solutions

    International Nuclear Information System (INIS)

    Czakis-Sulikowska, D.M.; Kuznik, B.; Malinowska, A.


    The solvent extraction of lanthanides(III)(Ln = Er, Yb, Lu) by 1-phenyl-3-methyl-4-benzoyl-pyrazolone-5 (HL) in carbon tetrachloride from aqueous-methanol phase was investigated. The equilibrium constants for the extraction from aqueous-50 % (ν/ν) methanol phase (K ex ), two-phase stability constants of the complexes LnL 3 (β 3 * ) and stability constants of complexes LnL 2+ , LnL 2 + , LnL 3 (β n )(Ln = Yb, Lu) were calculated. It was confirmed that the addition of methanol to the aqueous phase causes a synergistic effect. The influence of methanol on the dissociation constant of HPMBP (K a ) and the distribution constant of HPMBP (p HL ) between carbon tetrachloride and water-methanol solutions was investigated. (Authors)

  1. 49 CFR 173.247 - Bulk packaging for certain elevated temperature materials. (United States)


    ... reference to the axes of the transport vehicle. Each accelerative or decelerative load may be considered... packagings used for transportation of molten metals and molten glass by rail when movement is restricted to...

  2. 49 CFR 173.5b - Portable and mobile refrigeration systems. (United States)


    ... the end of disconnected lines must be tightly closed. (4) The aggregate total volumetric capacity of... permanent and clearly visible manner. The evaporating line must have a pressure gauge with corresponding temperature markings mounted so as to be easily readable when standing on the ground. The gauge must be...

  3. 21 CFR 173.120 - Carbohydrase and cellulase derived from Aspergillus niger. (United States)


    ... cellulase derived from Aspergillus niger. Carbohydrase and cellulase enzyme preparation derived from Aspergillus niger may be safely used in food in accordance with the following prescribed conditions: (a) Aspergillus niger is classified as follows: Class, Deuteromycetes; order, Moniliales; family, Moniliaceae...

  4. 49 CFR 173.32 - Requirements for the use of portable tanks. (United States)


    ... that is significantly reflective, such as a light-reflecting color if painted, or a bright reflective... thickness that the overall thermal conductance is not more than 0.080 Btu per hour per square foot per... square foot per degree Fahrenheit differential in temperature per hour. The conductance must be...

  5. 49 CFR 173.27 - General requirements for transportation by aircraft. (United States)


    ... liquids. (d) Closures. Stoppers, corks or other such friction-type closures must be held securely, tightly..., 4, or 8, or Division 5.1, 5.2 or 6.1 that are packaged and offered for transport in glass... of the § 172.101 table Maximum authorized net capacity of each inner packaging Glass, earthenware or...

  6. 49 CFR 173.471 - Requirements for U.S. Nuclear Regulatory Commission approved packages. (United States)


    ... format may be submitted by facsimile (fax) to (202) 366-3753 or (202) 366-3650, or by electronic mail (e-mail) to “[email protected]” Upon registration, the offeror will be furnished with a copy of the... format may be submitted by facsimile (fax) to (202) 366-3753 or (202) 366-3650, or by electronic mail (e...

  7. 49 CFR 173.473 - Requirements for foreign-made packages. (United States)


    ...-3650, or by electronic mail (e-mail) to “[email protected]” If the offeror is requesting the... Transport of Radioactive Material, No. TS-R-1, ” (IBR, see § 171.7 of this subchapter) shall also comply...) 366-3753 or (202) 366-3650, or by electronic mail to “[email protected]” Each request is considered in...

  8. 49 CFR 173.472 - Requirements for exporting DOT Specification Type B and fissile packages. (United States)


    ... or (202) 366-3650, or by electronic mail (e-mail) to “[email protected]” Each request is considered in... the package identification marking indicated in the U.S. Competent Authority Certificate. (e) Before... into or through which the package will be transported, unless the offeror has documentary evidence that...

  9. 49 CFR 173.420 - Uranium hexafluoride (fissile, fissile excepted and non-fissile). (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Uranium hexafluoride (fissile, fissile excepted....420 Uranium hexafluoride (fissile, fissile excepted and non-fissile). (a) In addition to any other... non-fissile uranium hexafluoride must be offered for transportation as follows: (1) Before initial...

  10. 49 CFR 173.56 - New explosives-definition and procedures for classification and approval. (United States)


    ... agency the ranges of composition of ingredients and compounds, showing the intended manufacturing... was produced to an explosives testing range if— (1) It is not a primary (a 1.1A initiating) explosive...) Ammunition with inert projectile or blank ammunition; and (4) Ammunition not exceeding 50 caliber for rifle...

  11. 49 CFR 173.24 - General requirements for packagings and packages. (United States)


    ... identifiable (without the use of instruments) release of hazardous materials to the environment; (2) The effectiveness of the package will not be substantially reduced; for example, impact resistance, strength... significant chemical or galvanic reaction between the materials and contents of the package. (3) Plastic...

  12. Spin-orbit coupling in ultracold Fermi gases of 173Yb atoms (United States)

    Song, Bo; He, Chengdong; Hajiyev, Elnur; Ren, Zejian; Seo, Bojeong; Cai, Geyue; Amanov, Dovran; Zhang, Shanchao; Jo, Gyu-Boong


    Synthetic spin-orbit coupling (SOC) in cold atoms opens an intriguing new way to probe nontrivial topological orders beyond natural conditions. Here, we report the realization of the SOC physics both in a bulk system and in an optical lattice. First, we demonstrate two hallmarks induced from SOC in a bulk system, spin dephasing in the Rabi oscillation and asymmetric atomic distribution in the momentum space respectively. Then we describe the observation of non-trivial spin textures and the determination of the topological phase transition in a spin-dependent optical lattice dressed by the periodic Raman field. Furthermore, we discuss the quench dynamics between topological and trivial states by suddenly changing the band topology. Our work paves a new way to study non-equilibrium topological states in a controlled manner. Funded by Croucher Foundation and Research Grants Council (RGC) of Hong Kong (Project ECS26300014, GRF16300215, GRF16311516, and Croucher Innovation Grants).

  13. 49 CFR 173.412 - Additional design requirements for Type A packages. (United States)


    ... exclusive use, the cargo compartment, instead of the individual packages, may be sealed. (b) The smallest... device that is independent of any other part of the package. (e) For each component of the containment... event of leakage; or (ii) Have a containment system composed of primary inner and secondary outer...

  14. 49 CFR 173.302a - Additional requirements for shipment of nonliquefied (permanent) compressed gases in... (United States)


    ... analysis and heat treatment specified in spec. 3AA 67,000 73,000 III. Steels of analysis and heat treatment... following formula: S = 1.7EE / KV−0.4P Where: S = wall stress, pounds per square inch; EE = elastic...

  15. Potassium bis(carbonato-O,O')(ethylenediamine-N,N')cobaltate(III) monohydrate at 173 K. (United States)

    Belai, N; Dickman, M H; Pope, M T


    The title salt, K[Co(C2H8N2)(CO3)2].H2O, consists of a distorted octahedral cobalt complex anion and a seven-coordinate potassium cation. Both metal atoms have crystallographic twofold symmetry, one C2 axis passing through the Co atom and C--C bond, and another along a short K--O (water) bond of 2.600 A (corrected for libration). The carbonate is bidentate to both cobalt and potassium and the water forms a hydrogen bond to a carbonate O atom.

  16. 173 Étude des performances épuratoires de la technique du ...

    African Journals Online (AJOL)

    Afrique Sciences

    à la station d'épuration de la ville d'Errachidia - Maroc. Chaouki HAMID1*, Lahcen ELWATIK1, Youssef RAMCHOUN2, Rachid FATH-ALLAH3,. Abdelrhafour AYYACH3, Zhor FATHALLAH4, Azzeddine EL MIDAOUI3 et El Mahdi HBAIZ5. 1Equipe des substances naturelles, synthèse et dynamique moléculaire, Faculté des ...

  17. Neutron scattering from 12C between 15.6 and 17.3 MeV

    International Nuclear Information System (INIS)

    Chen, Z.M.; Baird, K.; Howell, C.R.; Roberts, M.L.; Tornow, W.; Walter, R.L.


    The differential cross section σ(θ) for neutron elastic scattering from 12 C and for inelastic scattering from the 4.44 MeV state was measured at 15.57, 16.75 and 17.29 MeV. The σ(θ) data, together with published analysing power A y (θ) data, were analysed in the framework of the spherical optical model and in the coupled-channels formalism. It was concluded that the present 12 C(n,n) 12 C data and published data at higher energies appear to be well suited for determining properties of valence single-particle excitations in 11 C via an iterative-moment approach or a dispersive optical-model analysis. (author)

  18. 49 CFR 173.315 - Compressed gases in cargo tanks and portable tanks. (United States)


    ..., MC-330, MC-331 225; See Notes 4 and 8. Chlorodifluoroethane (R-142b) (1-Chloro 1,1-difluoroethane.... Difluoroethane (R-152a); (See Note 9) 79 See Note 7 DOT-51, MC-330, MC-331 150. Dimethyl ether (see Note 16) 59.... Chlorine None. Dichlorodifluoromethane Do. Difluoroethane Do. Difluoromonochloroethane Do. Dimethyl ether...

  19. 49 CFR 173.313 - UN Portable Tank Table for Liquefied Compressed Gases. (United States)


    ... Refrigerant gas R 21 7.0 Allowed Normal 1.23 7.0 7.0 7.0 1030 1,1-Difluoroethane or Refrigerant gas R 152a 16....1 Allowed Normal 1.07 20.8 18.6 16.6 2517 1-Chloro-1,1-difluoroethane or Refrigerant gas R 142b 8.9 Allowed Normal 0.99 7.8 7.0 7.0 2602 Dichlorodifluoromethane and difluoroethane azeotropic mixture with...

  20. Advanced Organic Solid States Materials. Volume 173. Materials Research Society Symposium Proceedings (United States)


    from the Comision Interministerial de Ciencia y Tecnologia . The authors thank to the Laboratoire de Physique des Materiaux and to Dr. G. Legal and Dr...related to a high decrease of electron density of the corresponding 3d - orbitals. Table 5 57Fe-Mof6bauer data Compound T 1K] &EQ 1mm/si IS [mm/sla) 1b...for both Kc and Cel, a cross-over temperature T, (expressed in % of Tc ) separates a 3D regime, close to Tc, from a lower-dimensional regime, above

  1. 21 CFR 161.173 - Canned wet pack shrimp in transparent or nontransparent containers. (United States)


    ... HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for...; prepared in one of the styles specified in paragraph (a)(3) of this section, in sufficient water or other...) Acceptable quality level (AQL). The maximum percent of defective sample units permitted in a lot that will be...

  2. 49 CFR 38.173 - Automated guideway transit vehicles and systems. (United States)


    ... accomplished by vehicle air suspension or other suitable means of meeting the requirement. (c) In stations... 49 Transportation 1 2010-10-01 2010-10-01 false Automated guideway transit vehicles and systems... DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Other Vehicles and Systems § 38...

  3. SU-E-T-173: Clinical Comparison of Treatment Plans and Fallback Plans for Machine Downtime

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Cancer Therapy and Research Center, San Antonio, TX (United States); Papanikolaou, P [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Mavroidis, P [University of North Carolina, Chapel Hill, NC (United States); Stathakis, S [Cancer Therapy and Research Center, San Antonio, TX (United States)


    Purpose: The purpose of this study was to determine the clinical effectiveness and dosimetric quality of fallback planning in relation to machine downtime. Methods: Plans for a Varian Novalis TX were mimicked, and fallback plans using an Elekta VersaHD machine were generated using a dual arc template. Plans for thirty (n=30) patients of various treatment sites optimized and calculated using RayStation treatment planning system. For each plan, a fall back plan was created and compared to the original plan. A dosimetric evaluation was conducted using the homogeneity index, conformity index, as well as DVH analysis to determine the quality of the fallback plan on a different treatment machine. Fallback plans were optimized for 60 iterations using the imported dose constraints from the original plan DVH to give fallback plans enough opportunity to achieve the dose objectives. Results: The average conformity index and homogeneity index for the NovalisTX plans were 0.76 and 10.3, respectively, while fallback plan values were 0.73 and 11.4. (Homogeneity =1 and conformity=0 for ideal plan) The values to various organs at risk were lower in the fallback plans as compared to the imported plans across most organs at risk. Isodose difference comparisons between plans were also compared and the average dose difference across all plans was 0.12%. Conclusion: The clinical impact of fallback planning is an important aspect to effective treatment of patients. With the complexity of LINACS increasing every year, an option to continue treating during machine downtime remains an essential tool in streamlined treatment execution. Fallback planning allows the clinic to continue to run efficiently should a treatment machine become offline due to maintenance or repair without degrading the quality of the plan all while reducing strain on members of the radiation oncology team.

  4. 49 CFR 173.28 - Reuse, reconditioning and remanufacture of packagings. (United States)


    ... and limitations: (1) A non-bulk packaging which, upon inspection, shows evidence of a reduction in... than fiberboard), plastic film, or textile are not authorized for reuse; (4) Metal and plastic drums... metal packagings) or minimum (for plastic packagings) thickness of the packaging material, as required...

  5. 49 CFR 173.58 - Assignment of class and division for new explosives. (United States)


    ... Thermal Sensitivity Test at 75 °C (167 °F); (iv) The Small Scale Burning Test; (v) The EIDS Cap Test; (vi... Sensitivity Test, Princess Incendiary Spark Test, DDT Test, and External Fire Test, each as described in the... occurs: (1) Detonation occurs in the Cap Sensitivity Test (Test Method 5(a)); (2) Detonation occurs in...

  6. Sud du Sahara | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... Promoting Women's Economic Empowerment (GrOW). Langue English. Read more about Integrated Intervention for Diabetes Risk After Gestational Diabetes in South Africa. Langue English. Read more about Essais cliniques d'un vaccin expérimental contre le virus Ebola : une intervention canadienne dans la recherche.

  7. 49 CFR 173.436 - Exempt material activity concentrations and exempt consignment activity limits for radionuclides. (United States)


    ... Rh-99 Rhodium (45) 1.0×101 2.7×10−10 1.0×106 2.7×10−5 Rh-101 1.0×102 2.7×10−9 1.0×107 2.7×10−4 Rh-102 1.0×101 2.7×10−10 1.0×106 2.7×10−5 Rh-102m 1.0×102 2.7×10−9 1.0×106 2.7×10−5 Rh-103m 1.0×104 2.7×10−7 1.0×108 2.7×10−3 Rh-105 1.0×102 2.7×10−9 1.0×107 2.7×10−4 Rn-222 (b) Radon (86) 1.0×101 2.7×10−10...

  8. 49 CFR 173.435 - Table of A1 and A2 values for radionuclides. (United States)


    ...×10−8 Rh-99 Rhodium (45) 2.0 5.4×101 2.0 5.4×101 3.0×103 8.2×104 Rh-101 4.0 1.1×102 3.0 8.1×101 4.1×101 1.1×103 Rh-102 5.0×10−1 1.4×101 5.0×10−1 1.4×101 4.5×101 1.2×103 Rh-102m 2.0 5.4×101 2.0 5.4×101 2.3×102 6.2×103 Rh-103m 4.0×101 1.1×103 4.0×101 1.1×103 1.2×106 3.3×107 Rh-105 1.0×101 2.7×102 8.0×10...

  9. 46 CFR 170.173 - Criterion for vessels of unusual proportion and form. (United States)


    ... point to at least 20 degrees; and (iii) At least 15 foot-degrees of energy to the smallest of the... flooding point to at least 15 degrees; and (iii) At least 10 foot-degrees of energy to the smallest of the... free until the trimming moment is zero. (e) For the purpose of demonstrating acceptable stability on...

  10. 49 CFR 173.132 - Class 6, Division 6.1-Definitions. (United States)


    ... Toxicity. A liquid or solid with an LD50 for acute oral toxicity of not more than 300 mg/kg. (ii) Dermal Toxicity. A material with an LD50 for acute dermal toxicity of not more than 1000 mg/kg. (iii) Inhalation Toxicity. (A) A dust or mist with an LC50 for acute toxicity on inhalation of not more than 4 mg/L; or (B...

  11. 49 CFR 173.302 - Filling of cylinders with nonliquefied (permanent) compressed gases. (United States)


    ... containing oxygen continuously fed to tanks containing live fish may be offered for transportation and... breathing apparatus (SCUBA), self-contained breathing apparatus (SCBA) or oxygen service. The cylinder...

  12. 49 CFR 173.441 - Radiation level limitations and exclusive use provisions. (United States)


    ...; or in the case of a flat-bed style vehicle, at any point on the vertical planes projected from the...-bed style vehicle, at any point 2 m (6.6 feet) from the vertical planes projected by the outer edges... included with the shipping paper information. The instructions must be sufficient so that, when followed...

  13. 49 CFR 173.166 - Air bag inflators, air bag modules and seat-belt pretensioners. (United States)


    ... generant and, in some cases, a pressure vessel (cylinder)) is a gas generator used to inflate an air bag in... domestic transportation by highway, rail freight, cargo vessel or cargo aircraft, a serviceable air bag...

  14. 29 CFR 4.173 - Meeting requirements for vacation fringe benefits. (United States)


    ... vacation benefits, it would place the incumbent contractor at a distinct competitive disadvantage as well... service. Rather, as illustrated below, the reason(s) for an employee's absence from work is the primary... the full amount of the employee's vacation benefit. (2) The requirements for furnishing data relative...

  15. 49 CFR 1.73 - Delegation to the Administrator of the Federal Motor Carrier Safety Administration. (United States)


    ... to remove, to the maximum extent practicable, a worst case discharge, the review and approval of... movie production sites; (9) Section 4134 relating to the grant program for persons to train operators of...; section (b)(1) relating to a review of Canadian and Mexican compliance with Federal motor vehicles safety...

  16. 49 CFR 173.225 - Packaging requirements and other provisions for organic peroxides. (United States)


    ... calculated using the following formula: ER20DE04.003 Where: U = K/L = heat transfer coefficient of the... packaging conforms to the requirements of this subchapter: (1) Rail cars. Class DOT 103, 104, 105, 109, 111, 112, 114, 115, or 120 fusion-weld tank car tanks are authorized. DOT 103W, 111A60F1 and 111A60W1 tank...

  17. 21 CFR 173.357 - Materials used as fixing agents in the immobilization of enzyme preparations. (United States)


    ... glucose isomerase enzyme preparations for use in the manufacture of high fructose corn syrup, in... manufacture of high fructose corn syrup, in accordance with § 184.1372 of this chapter. Cellulose triacetate... enzyme preparations for use in the manufacture of high fructose corn syrup, in accordance with § 184.1372...

  18. 76 FR 34273 - National Endowment for the Arts; National Council on the Arts 173rd Meeting (United States)


    ... Commander, 70 Intelligence Surveillance and Reconnaissance Wing, Fort Meade, MD on Blue Star Museums; by... discussion, it becomes necessary for the Council to discuss non-public commercial or financial information of...

  19. 49 CFR 173.5a - Oilfield service vehicles and mechanical displacement meter provers. (United States)


    ... sufficiently long to assure detection of leaks, but in no case less than 5 minutes. (4) In addition to the... PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS...

  20. 49 CFR Appendix H to Part 173 - Method of Testing for Sustained Combustibility (United States)


    ... standard manner sustains combustion. 2. Principle of the method A metal block with a concave depression... consisting of a block of aluminum alloy or other corrosion-resistant metal of high thermal conductivity is... is 2.2 mm (see Figure; (b) Thermometer, mercury in glass, for horizontal operation, with a...

  1. 49 CFR 173.12 - Exceptions for shipment of waste materials. (United States)


    ... blocked and braced in such a manner that they are separated from incompatible materials by a minimum... pallet with shrink-wrap or stretch-wrap except that labels representative of each Hazard Class or...

  2. 49 CFR 173.52 - Classification codes and compatibility groups of explosives. (United States)


    ... containing both an explosive substance and flammable liquid or gel J 1.1J1.2J 1.3J Article containing both an... classification codes for substances and articles described in the first column of table 1. Table 2 shows the... possible classification codes for explosives. Table 1—Classification Codes Description of substances or...

  3. 49 CFR 173.8 - Exceptions for non-specification packagings used in intrastate transportation. (United States)


    ... used to transport a flammable cryogenic liquid, hazardous substance, hazardous waste, or a marine... be used by an intrastate motor carrier for transportation of a flammable liquid petroleum product in... flammable liquid petroleum product in accordance with the provisions of paragraph (d) of this section. (d...

  4. 49 CFR 173.230 - Fuel cell cartridges containing hazardous material. (United States)


    ... integral vent feature) is deemed to pass the fire test if: (A) The internal pressure vents to zero gauge... required to power the equipment, plus two spares; (5) Large robust articles containing fuel cells may be...

  5. 49 CFR 173.121 - Class 3-Assignment of packing group. (United States)


    ... packing group shall be determined by applying the following criteria: Packing group Flash point (closed-cup) Initial boiling point I ≤35°C (95 °F) II 35 °C (95 °F) III ≥23 °C, ≤60 °C (≥73 °F, ≤140 °F) >35...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions Classification, Packing Group Assignments...

  6. Seasonal variation in plasma and corpus luteum oestradiol.17[3and ...

    African Journals Online (AJOL)

    Flemming 1993) and, in males, with circulating sex steroid concentrations ..... biology of the Cape mole-rat, Georychus capensis (Rodentia. Bathycrgidac), j, Zool" ... brain. and behavior: an emerging discipline in herpetology. In: Biology of the ...

  7. 20 CFR 655.173 - Setting meal charges; petition for higher meal charges. (United States)


    ... the 12 month percentage change for the Consumer Price Index for all Urban Consumers for Food between... may begin charging the higher rate upon receipt of a favorable decision from the CO unless the CO sets a later effective date in the decision. (c) Appeal rights. In the event the employer's petition for...

  8. Sexospécificités | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    From increasing access to nutritious food to boosting women's opportunities to lead safe and healthy lives, the most popular content featured on our ... Grâce au Global Entrepreneurship Monitor (GEM), des chercheurs canadiens et étrangers acquièrent et mettent en commun des connaissances sur les motivations des ...

  9. 49 CFR 173.314 - Compressed gases in tank cars and multi-unit tank cars. (United States)


    ... or secondary Division 2.1 (flammable gas) hazard. For single unit tank cars, interior pipes of... lading exceeding 1.52 mm (0.060 inch) diameter must be equipped with excess flow valves. For single unit... inches) glass fiber placed over 5.08 cm (2 inches) of ceramic fiber. Tank cars must have excess flow...

  10. Résultats de recherche | Page 173 | CRDI - Centre de recherches ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Cette recherche s'inscrit dans le contexte d'une superposition de deux faits ... de technologies de l'information et de la communication (TIC), ou télécentre, dans ... Le Centro de Tecnologia e Sociedade (CTS - centre pour la technologie et la ...

  11. Measurement of high energy neutrons via Lu(n,xn) reactions

    International Nuclear Information System (INIS)

    Henry, E.A.; Becker, J.A.; Archer, D.E.; Younes, W.; Stoyer, M.A.; Slaughter, D.


    High energy neutrons can be assayed by the use of the nuclear diagnostic material lutetium. We are measuring the (n,xn) cross sections for natural lutetium in order to develop it as a detector material. We are applying lutetium to diagnose the high energy neutrons produced in test target/blanket systems appropriate for the Accelerator Production of Tritium Project. 3 refs., 5 figs., 1 tab

  12. 49 CFR 40.173 - Who is responsible for paying for the test of a split specimen? (United States)


    ... is responsible for paying for the test of a split specimen? (a) As the employer, you are responsible... 49 Transportation 1 2010-10-01 2010-10-01 false Who is responsible for paying for the test of a.... (b) As the employer, you must not condition your compliance with these requirements on the employee's...

  13. Gas-chromatographic separation of hydrogen isotopes mixtures on capillary molecular sieve 5 A column at 173 K

    International Nuclear Information System (INIS)

    Bidica, N.; Preda, A.; Stanciu, V.


    Analysis of a gas mixture of hydrogen species, is not too easy because the differences in their physical-chemical properties are very small; the most different are their masses, and consequently most common analytical method appear to be the mass-spectrometry. However, the impossibility to distinguish between two ions (atomic or molecular) with the same mass renders this method as unapplicable. Another problem is the decay of tritium with production of 3 He. These disadvantages of mass-spectrometry have made that other analytical methods, like gas chromatography, to be considered and developed. Thus, there are many papers about various chromatographic columns especially prepared for hydrogen species separation but the preparation and treatment of these columns are very difficult to reproduce. Besides these, there are two other main disadvantages: column operating temperature is very low and long retention times for hydrogen species (more than half an hour) are required. However, the gas-chromatography method still remains an appropriate one. The method described in this paper was based on using a capillary molecular sieve 5A column which has been operated for this kind of separation. The retention times were relatively short, about 8-9 minutes. The carrier gas was Ne and the detector - TCD. In the paper chromatograms for various carrier flow rates and various hydrogen isotope mixtures are presented. The results demonstrated a quite good efficiency for H 2 , HD, D 2 and a not very good one for orthoH 2 -paraH 2 . (authors)

  14. 49 CFR 173.304a - Additional requirements for shipment of liquefied compressed gases in specification cylinders. (United States)


    ...-3E1800. Chlorodifluroethane or 1-Chloro-1, 1-difluoroethane (R-142b) 100 DOT-3A150; DOT-3AA150; DOT-3B150...; DOT-3AL225. Dichlorodifluoromethane and difluoroethane mixture (constant boiling mixture) (R-500) (see...; DOT-4BW240; DOT-4E240; DOT-39. 1,1-Difluoroethane (R-152a) (see note 8) 79 DOT-3A150; DOT-3AA150; DOT...

  15. Gausbert de Poicibot, “Be·s cuget venjar Amors” (BdT 173.2

    Directory of Open Access Journals (Sweden)

    Francesca Andolfato


    Full Text Available This paper offers a commentary and a new critical edition of Gausbert de Poicibot’s poem “Be·s cuget venjar Amors”, which apparently belongs to the genre of the ‘mala chanso’, that was particularly popular during the period that the Limousin poet was active. To abandon love enables the poet to recuperate reason and ‘sen’ and to justify, almost in didactic terms, his separation from the lady, thus clearly showing that he had so far sung the praises of a lady who was not worthy of receiving them. The song is also compared to other typical examples of the subgenre to which it belongs, such as “Si be·m partetz, mala dompna, de vos” by Gui d’Uissel (BdT 194.19, considered to be paradigmatic of the ‘mala chanso’ and probably familiar to Gausbert de Poicibot, though it will be pointed out that this poetic mode has roots in the work of troubadours of previous generations, such as Bernart de Ventadorn and Raimbaut d’Aurenga, whom Gausbert seems to use as models.

  16. SU-F-J-173: Online Replanning for Dose Painting Based On Changing ADC Map of Pancreas Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Ates, O; Ahunbay, E; Erickson, B; Li, X [Medical College of Wisconsin, Milwaukee, WI (United States)


    Purpose: The introduction of MR-guided radiation therapy (RT), e.g., MR-Linac, would allow dose painting to adapt spatial RT response revealed from MRI data during the RT delivery. The purpose of this study is to investigate the use of an online replanning method to adapt dose painting from the MRI Apparent Diffusion Coefficient (ADC) map acquired during the delivery of RT for pancreatic cancers. Methods: Original dose painting plans were created based on multi-parametric simulation MRI including T1, T2 and ADC, using a treatment planning system (MONACO, Elekta) equipped with an online replanning algorithm (WSO, warm start optimization). Multiple GTVs, identified based on various ADC levels were prescribed to different doses ranging from 50–70 Gy with simultaneous integrated boost in 28 fractions. The MRI acquired after RT were used to mimic weekly MRI, on which the changing GTVs, pancreatic head and other organs-at-risk (OAR) (duodenum, stomach, small bowel) were delineated. The adaptive plan was generated by applying WSO algorithm starting from the deformed original plan based on the weekly MRI using a deformable image registration (DIR) software (ADMIRE, Elekta). The online replanning method takes <10 min. including DIR, target delineation, WSO execution and final dose calculation. Standard IGRT repositioning and full-blown reoptimization plans were also generated to compare with the adaptive plans. Results: The online replanning method significantly improved the multiple target coverages and OAR sparing for pancreatic cancers. For example, for a case with two GTVs with prescriptions of 60 and 70 Gy in pancreatic head, V100-GTV70 (the volume covered by 100% of prescription dose for GTV with 70 Gy)/V100-GTV60/V100-CTV50/V45-duodenum were (95.1/22.2/69.5/85.7), (95.0/97.0/98.6/34.3), and (95.0/98.1/100.0/38.7) for the IGRT, adaptive and reoptimization plans, respectively. Conclusion: The introduced online adaptive replanning method can effectively account for interfractional changes including tumor spatial response during MR-guided RT delivery, allowing precise delivery of dose painting. This study was partially supported by Elekta Inc.

  17. 49 CFR 173.133 - Assignment of packing group and hazard zones for Division 6.1 materials. (United States)


    ...: Packing group Oral toxicity LD50 (mg/kg) Dermal toxicity LD50 (mg/kg) Inhalation toxicity by dusts and mists LC50 (mg/L) I ≤5.0 ≤50 ≤0.2 II >5.0 and ≤50 >50 and ≤200 >0.2 and ≤2.0 III >50 and ≤300 >200 and... table: Packing Group Vapor concentration and toxicity I (Hazard Zone A) V ≥ 500 LC50 and LC50 ≤ 200 mL...

  18. 40 CFR 63.173 - Standards: Agitators in gas/vapor service and in light liquid service. (United States)


    ... all times greater than the agitator stuffing box pressure; or (ii) Equipped with a barrier fluid... closed-loop system that purges the barrier fluid into a process stream. (2) The barrier fluid is not in...

  19. 40 CFR 429.173 - Effluent limitations representing the degree of effluent reduction attainable by the application... (United States)


    ... degree of effluent reduction attainable by the application of the best available technology economically... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS TIMBER PRODUCTS PROCESSING POINT SOURCE CATEGORY Wood Furniture... best available technology economically achievable (BAT). Except as provided in 40 CFR 125.30 through...

  20. SU-F-T-173: One-Scan Protocol: Verifying the Delivery of Spot-Scanning Proton Beam

    Energy Technology Data Exchange (ETDEWEB)

    Chan, M; Li, J [Memorial Sloan-Kettering Cancer Center, Basking Ridge, NJ (United States); Chen, C; Mah, D [Procure Treatment Center, Somerset, NJ (United States); Tang, X [Memorial Sloan Kettering Cancer Center, West Harrison, NY (United States); Li, X [Memorial Sloan Kettering Cancer Center, Rockville Centre, NY (United States); Tang, G [Memorial Sloan Kettering Cancer Center, New York, NY (United States)


    Purpose: Radiochromic film for spot-scanning QA provides high spatial resolution and efficiency gains from one-shot irradiation for multiple depths. However, calibration can be a tedious procedure which may limit widespread use. Moreover, since there may be an energy dependence, which manifests as a depth dependence, this may require additional measurements for each patient. We present a one-scan protocol to simplify the procedure. Methods: We performed the calibration using an EBT3 film at depths of 18, 20, 24cm of Plastic Water exposed by a 6-level step-wedge plan on a Proteus Plus proton system (IBA, Belgium). The calibration doses ranged 65–250 cGy(RBE) for proton energies of 170–200MeV. A clinical prostate+nodes plan was used for validation. The planar doses at selected depths were measured with EBT3 films and analyzed using one-scan protocol (one-scan digitization of QA film and at least one film exposed to known dose). The Gamma passing rates, dose-difference maps, and profiles of 2D planar doses measured with EBT3 film, IBA MatriXX PT, versus TPS calculations were analyzed and compared. Results: The EBT3 film measurement results matched well with the TPS calculation data with an average passing rate of ∼95% for 2%/2mm and slightly lower passing rates were obtained from an ion chamber array detector. We were able to demonstrate that the use of a proton step-wedge provided clinically acceptable results and minimized variations between film-scanner orientation, inter-scan, and scanning conditions. Furthermore, it could be derived from no more than two films exposed to known doses (one could be zero) for rescaling the master calibration curve at each depth. Conclusion: The use of a proton step-wedge for calibration of EBT3 film increases efficiency. The sensitivity of the calibration to depth variations has been explored. One-scan protocol results appear to be comparable to that of the ion chamber array detector. One author has a research grant from Ashland Inc., the manufacturer of the GafChromic film.

  1. 49 CFR 173.115 - Class 2, Divisions 2.1, 2.2, and 2.3-Definitions. (United States)


    ... substances of Class 8, PG I are forbidden from transportation in an aerosol container. (7) Flammable... 2.1, 2.2, and 2.3—Definitions. (a) Division 2.1 (Flammable gas). For the purpose of this subchapter, a flammable gas (Division 2.1) means any material which is a gas at 20 °C (68 °F) or less and 101.3...

  2. Scintillation properties and X-ray irradiation hardness of Ce3+-doped Gd2O3-based scintillation glass

    International Nuclear Information System (INIS)

    Liu, Liwan; Shao, Chongyun; Zhang, Yu; Liao, Xili; Yang, Qiuhong; Hu, Lili; Chen, Danping


    Ce 3+ -doped Gd 2 O 3 -based scintillation glasses are prepared within an air or CO atmosphere. The effects of fluorine, lutetium, barium, and the melting atmosphere on the optical properties, scintillation properties and irradiation hardness are studied. Absorption spectra, luminescence spectra under UV and X-ray excitation, and the X-ray radiation-induced spectra are presented. The results show that the density can be increased by doping with fluorine, lutetium and barium. The luminescence intensity decreases after X-ray irradiation. Because of charge transfer quenching, fluorine and lutetium enhance the UV-excited and X-ray excited luminescence intensity, but barium decreases. Moreover, fluorine and lutetium are advantageous to irradiation hardness while barium is not. In addition, a non-reducing atmosphere provides a higher irradiation hardness than a reducing atmosphere. Fluorine-doped glass is promising to enhance luminescence intensity, promote irradiation hardness, and increase the density.

  3. Luminescence and scintillation properties of rare-earth-doped LuF.sub.3./sub. scintillation crystals

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.


    Roč. 41, Mar SI (2015), s. 58-62 ISSN 0925-3467 Institutional support: RVO:68378271 Keywords : lutetium fluoride * scintillator * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.183, year: 2015

  4. Structural investigations of Lu.sub.2./sub.O.sub.3./sub. as single crystal and polycrystalline transparent ceramic

    Czech Academy of Sciences Publication Activity Database

    Guzik, M.; Pejchal, Jan; Yoshikawa, A.; Ito, A.; Goto, T.; Siczek, M.; Lis, T.; Boulon, J.


    Roč. 14, č. 7 (2014), 3327 -3334 ISSN 1528-7483 Institutional support: RVO:68378271 Keywords : lutetium oxide * structure * crystal growth * ceramics Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.891, year: 2014

  5. Labeling of peptides and antibodies against different receptor human epidermal growth factors with different radionuclides and chemical and biological evaluation

    International Nuclear Information System (INIS)

    Calzada, V.


    This Master thesis presented at the University of the Oriental Republic of Uruguay, School of Chemistry studies the following topics: quality control in nuclear medicine, radiopharmaceuticals such as technetium and lutetium

  6. High-Performance Low-Cost Portable Radiological and Nuclear Detectors Based on Colloidal Nanocrystals (TOPIC 07-B) (United States)


    The synthesized CNCs were optically very active and demonstrated very bright luminescence even under UV lamp excitation at room...temperature (Fig. 8.15). Fig. 8.16 shows absorption, Fig. 8.15. Visible luminescence from Pb3O2I2 under UV lamp excitation. M. Osiński, High-Performance Low...QCS - low-dimensional quantum confinement system LEDs – light-emitting diodes LuAG – lutetium aluminum garnet LYSO – lutetium yttrium

  7. A DPOC como uma doença de envelhecimento acelerado** Chest Translating Basic Research Into Clinical Practice 2009; 135:173-180

    Directory of Open Access Journals (Sweden)

    Kazuhiro Ito


    Full Text Available Resumo: A DPOC constitui um problema de saúde global de importância crescente, com enorme impacto nos custos directos e indirectos em recursos de saúde. Apesar do seu impacto, pouco se sabe ainda sobre os mecanismos celulares, moleculares e genéticos desta doença, e as te-rapêuticas farmacológicas actualmente disponíveis não influenciam a progressão da doença ou a mortalidade. A limitação do débito aéreo avaliada pela redução do volume expiratório máximo no 1.º segundo (FEV1 progride muito lentamente ao longo de várias décadas, condicionando o aparecimento de sintomas em adultos acima dos 40 anos ou já na terceira idade. Desta forma, a prevalência da DPOC é dependente da idade, sugerindo uma relação íntima entre a pato-génese da DPOC e a do envelhecimento.A senescência ou processo de envelhecimento definese como o declínio progressivo da homeostasia que ocorre após estar completa a fase reprodutiva da vida e conduz a um risco aumentado de doença e de morte. Segundo Kirkwood1, o envelhecimento resulta da interacção entre a lesão e a reparação, como resultado da energia produzida pelo indivíduo para manter a integridade orgânica e proteger o ADN da agressão oxidativa. A falência orgânica ou celular na manutenção ou reparação resulta de uma acção integrada entre genes, ambiente e defeitos intrínsecos do organismo. Subjacente ao processo de envelhecimento, existe uma acumulação progressiva de danos a nível molecular.As alterações a nível celular causam reacções inflamatórias, e estas, por sua vez, exacerbam as lesões celulares existentes. Desta forma, os factores inflamatórios e anti-inflamatórios modulam a evolução do envelhe-cimento. As alterações inflamatórias e estruturais associadas ao envelhecimento resultam da falência em eliminar os radicais de oxigénio (ROS, da falência em reparar o ADN lesado e do encurtamento do teló-mero. Os telómeros protegem as extremidades dos cromossomas, mas, quando se encontram expostos a elevados níveis de stress oxidativo, vão-se encurtando progressivamente à medida que as células se dividem. Com o envelhecimento, a perda e encurtamento dos telómeros condicionam o declínio da capacidade para as células se dividirem – senescência replicativa.O stress oxidativo causa lesão do ADN, o que acelera o processo de envelhecimento e aumenta o risco de cancro (exemplo, a senescência da glândula mamária e o risco elevado de cancro da mama.Os gases ambientais, como o fumo do cigarro ou outros poluentes, podem acelerar o envelhecimento do pulmão ou agravar os eventos relacionados com o en-velhecimento pulmonar através de uma resolução defeituosa da inflamação. A redução das moléculas anti-envelhecimento como as histona desacetilases e as sirtuínas, pode igualmente induzir a progressão acelerada para a DPOC.Ainda não é claro como é que o processo de envelhe-cimento está envolvido no declínio da função pulmonar e na inflamação da DPOC. Contudo, o pulmão do idoso e o pulmão do doente com DPOC apresen-tam muitas semelhanças. A lesão provocada pelo fumo do cigarro e outros pneumopoluentes conduz a um declínio mais acelerado da função pulmonar, com falência dos mecanismos de reparação e de manuten-ção. A presença de inflamação nos dois processos (en-velhecimento e DPOC traduz-se em acumulação de neutrófilos, na activação da NF-kB e na elevação dos níveis plasmáticos de interleucinas IL-6, IL-8 e TNF-α. Também os telómeros das células alveolares tipo II, das células endoteliais e das células mononu-cleares em doentes com enfisema são significativamente mais curtos do que em indivíduos não fumadores da mesma idade.Neste artigo, os autores descrevem ainda estudos recentes sobre os mecanismos de transdução de sinal, como as vias da acetilação das proteínas envolvidas no processo de envelhecimento, identificando assim novas moléculas anti-envelhecimento que poderão constituir abordagens inovadoras na terapêutica da DPOC. Os antioxidantes actualmente disponíveis, como a N-acetilcisteína, não são suficientemente potentes para reduzir o stress oxidativo nos pulmões. Existem vários fármacos em desenvolvimento, como os novos análogos da glutationa e da superoxido dismutase (exemplo, o sulforafano e novas moléculas antienvelhecimento com maior controlo sobre a resis-tência ao stress oxidativo, a reparação do ADN e a inflamação, como os activadores das sirtuínas (exem-plo, o resveratrol, o activador específico da SIRT1 ou o activador da SIRT6.

  8. The effect of irradiation by 173Cs and 60Co on the optical and spectral response properties of lead iodide thin films

    International Nuclear Information System (INIS)

    Jamil, S. S. B.; Ltaif, A. K.; Fadhel, H. M.


    This films of solution grown PbI 2 and of pure material of PbI 2 have been deposited onto glass substrate at 100o C by vacuum thermal evaporation technique. Some physical properties of samples without and with gamma radiation are studied. The irradiation process to the samples were made by applied sample to 1 73 'Cs source with activity 0.635 μci and 6 0C o source with activity 0.62 μci without and with different times of irradiation (3,4,5,6, weeks) to obtain the suitable dose. The x-ray diffraction analysis confirmed that PbI 2 films are polycrystalline, having bollixing structure. Transmission spectra, absorption coefficient and band gap energy are studies were also carried out in the wavelength region of 420-900 nm. The band gap of Pb1 2 at room temperature was found to be 2.37-2.78 eV with direct transition nature using the plots were calculated which were machinating with earlier reported value. The spectral photocurrent of PbI 2 layers deposited in different time were also studied, it is found the maximum photocurrent response always is between the wavelength 490-500 nm. (Author)

  9. Broad and Visionary. Commentary on Allen Kent (1977) Information Science. (Journal of Education for Librarianship, 17(3), 131-139) (United States)

    Bates, Marcia J.


    Allen Kent was a pioneer in many aspects of library and information science (LIS), and yet, as this author reads Kent's 1977 article, there is not much in it that has become ancient, irrelevant history. The questions he discusses are still alive in the discipline in 2014, whether it is called LIS (library and information science), information…

  10. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.88422, Lat: 25.94284 (WGS84); Sensor Depth: 20.42m; Data Range: 20060927-20081004. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  11. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96097, Lat: 26.06337 (WGS84); Sensor Depth: 0.61m; Data Range: 20060925-20081005. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  12. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.91583, Lat: 25.96762 (WGS84); Sensor Depth: 10.36m; Data Range: 20081004-20090910. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  13. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96100, Lat: 26.06368 (WGS84); Sensor Depth: 0.50m; Data Range: 20030726-20041008. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  14. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96100, Lat: 26.06368 (WGS84); Sensor Depth: 0.50m; Data Range: 20020930-20030725. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  15. Corrosion and Nanomechanical Behaviors of 16.3Cr-0.22N-0.43C-1.73Mo Martensitic Stainless Steel

    International Nuclear Information System (INIS)

    Ghosh, Rahul; Krishna, S. Chenna; Venugopal, A.; Narayanan, P. Ramesh; Jha, Abhay K.; Ramkumar, P.; Venkitakrishnan, P. V.


    The effect of nitrogen on the electrochemical corrosion and nanomechanical behaviors of martensitic stainless steel was examined using potentiodynamic polarization and nanoindentation test methods. The results indicate that partial replacement of carbon with nitrogen effectively improved the passivation and pitting corrosion resistance of conventional high-carbon and high- chromium martensitic steels. Post-test observation of the samples after a potentiodynamic test revealed a severe pitting attacks in conventional martensitic steel compared with nitrogen- containing martensitic stainless steel. This was shown to be due to (i) microstructural refinement results in retaining a high-chromium content in the matrix, and (ii) the presence of reversed austenite formed during the tempering process. Since nitrogen addition also resulted in the formation of a Cr_2N phase as a process of secondary hardening, the hardness of the nitrogen- containing steel is slightly higher than the conventional martensitic stainless steel under tempered conditions, even though the carbon content is lowered. The added nitrogen also improved the wear resistance of the steel as the critical load (Lc2) is less, along with a lower scratch friction coefficient (SFC) when compared to conventional martensitic stainless steel such as AISI 440C.

  16. Triangular flow of negative pions emitted in PbAu collisions at root s(NN)=17.3 GeV

    Czech Academy of Sciences Publication Activity Database

    Adamová, Dagmar; Agakichiev, G.; Andronic, A.; Antonczyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, Jana; Kushpil, Vasilij; Petráček, V.; Šumbera, Michal


    Roč. 957, JAN (2017), s. 99-108 ISSN 0375-9474 Institutional support: RVO:61389005 Keywords : Tringular flow * SPS * heavy ion Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders OBOR OECD: Nuclear physics Impact factor: 1.916, year: 2016

  17. Pregnant adolescent self-care in the prevention of risk factors of Hypertensive Disorders in Pregnancy (HDP - doi:10.5020/18061230.2007.p173

    Directory of Open Access Journals (Sweden)

    Zélia Maria de Sousa Araújo Santos


    Full Text Available Adolescent pregnancy is considered a problem for public health, due to the high mortality related to hypertensive disorders in pregnancy – HDP. This was a descriptive study with the aim of analyzing the pregnant adolescent self-care in the prevention of HDP risk factors. It was carried out in the Nucleus of Integrated Medical Attention – NAMI, in Fortaleza – Ceará, with twenty women from the Dendê Community, taken care of in the prenatal ambulatory of that institution, during the months of September and October, 2005. The data were collected by means of interview. The pregnant adolescents informed precarious socio-economic conditions, low schooling and other risk factors for HDP, beyond the age: black color, familiar history, arterial hypertension (AH, diabetes mellitus, renal illness and emotional conflicts. The knowledge on the prevention of risk factors was restricted to five (25% pregnant adolescents; however it was reduced to fragmented information, and the preventive behaviors related to feeding habit, smoke and alcoholism cessation, and physical exercise. Therefore, it was evidenced among the adolescents the unsatisfactory exercise of self-care activities, aiming at preventing HDP risk factors; that beyond the age, they presented other predisposing factors to this disorders; that they were susceptible to preventive behaviors and/or control, as in the case of chronic-degenerative illnesses – AH and diabetes mellitus. Probably, this behavior was associated to the elementary and fragmented knowledge, and the absence or the deficiency of family participation in health promotion actions, mainly in those inherent to the prenatal follow-up.

  18. The methane absorption spectrum near 1.73 μm (5695-5850 cm-1): Empirical line lists at 80 K and 296 K and rovibrational assignments (United States)

    Ghysels, M.; Mondelain, D.; Kassi, S.; Nikitin, A. V.; Rey, M.; Campargue, A.


    The methane absorption spectrum is studied at 297 K and 80 K in the center of the Tetradecad between 5695 and 5850 cm-1. The spectra are recorded by differential absorption spectroscopy (DAS) with a noise equivalent absorption of about αmin≈ 1.5 × 10-7 cm-1. Two empirical line lists are constructed including about 4000 and 2300 lines at 297 K and 80 K, respectively. Lines due to 13CH4 present in natural abundance were identified by comparison with a spectrum of pure 13CH4 recorded in the same temperature conditions. About 1700 empirical values of the lower state energy level, Eemp, were derived from the ratios of the line intensities at 80 K and 296 K. They provide accurate temperature dependence for most of the absorption in the region (93% and 82% at 80 K and 296 K, respectively). The quality of the derived empirical values is illustrated by the clear propensity of the corresponding lower state rotational quantum number, Jemp, to be close to integer values. Using an effective Hamiltonian model derived from a previously published ab initio potential energy surface, about 2060 lines are rovibrationnally assigned, adding about 1660 new assignments to those provided in the HITRAN database for 12CH4 in the region.

  19. TlCu1.73Fe0.27Se2 studied by means of Moessbauer spectroscopy and SQUID magnetometry

    International Nuclear Information System (INIS)

    Kamali-M, S; Ericsson, T; Haeggstroem, L; Berger, R; Ronneteg, S; Felton, S


    TlCu 2-x Fe x Se 2 is a p-type metal for x c is 55(5) K as found from both SQUID and Moessbauer spectra. At T c the magnetic hyperfine fields are distributed with a maximum at about 30 T, which are compared to the measured magnetic moment per iron atom, which is 0.97 μ B /Fe as found from SQUID measurements. The experimental results are compared to results using other methods on isostructural Tl selenides

  20. Comparison of CO2 and Nd:YAG laser welding of grade 250 maraging steel, IIW doc. II-A-173-06

    CSIR Research Space (South Africa)

    Van Rooyen, C


    Full Text Available are the SEM images of the single spot (SS/6), twin spot (TS/4) and pulsed YAG (PY) butt welds after PWHT. More reverted austenite was observed in the twin spot weld compared to the single spot and pulsed Nd:YAG welds. EDS (energy dispersive spectroscopy... line, c) TS/4 near fusion line, d) TS/4 weld centre line, e) PY near fusion line, f) PY weld centre line EDS line scans were performed in the unetched condition. Areas were observed that was enriched in Mo and Ti. Etched samples were analysed...

  1. Corrosion and Nanomechanical Behaviors of 16.3Cr-0.22N-0.43C-1.73Mo Martensitic Stainless Steel

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Rahul; Krishna, S. Chenna; Venugopal, A.; Narayanan, P. Ramesh; Jha, Abhay K.; Ramkumar, P.; Venkitakrishnan, P. V. [Vikram Sarabhai Space Centre (ISRO), Kerala (India)


    The effect of nitrogen on the electrochemical corrosion and nanomechanical behaviors of martensitic stainless steel was examined using potentiodynamic polarization and nanoindentation test methods. The results indicate that partial replacement of carbon with nitrogen effectively improved the passivation and pitting corrosion resistance of conventional high-carbon and high- chromium martensitic steels. Post-test observation of the samples after a potentiodynamic test revealed a severe pitting attacks in conventional martensitic steel compared with nitrogen- containing martensitic stainless steel. This was shown to be due to (i) microstructural refinement results in retaining a high-chromium content in the matrix, and (ii) the presence of reversed austenite formed during the tempering process. Since nitrogen addition also resulted in the formation of a Cr{sub 2}N phase as a process of secondary hardening, the hardness of the nitrogen- containing steel is slightly higher than the conventional martensitic stainless steel under tempered conditions, even though the carbon content is lowered. The added nitrogen also improved the wear resistance of the steel as the critical load (Lc2) is less, along with a lower scratch friction coefficient (SFC) when compared to conventional martensitic stainless steel such as AISI 440C.

  2. Commercial Appropriation of a Person's Image: Wells V Atoll Media (Pty Ltd (Unreported 11961/2006 [2009] ZAWCHC 173 (9 November 2009

    Directory of Open Access Journals (Sweden)

    SJ Cornelius


    Full Text Available Our modern society has become transfixed with celebrity. Business people and marketers also endeavour to cash in on the popularity enjoyed by the stars and realise the value of associating merchandise or trademarks with the rich and famous. This leads to difficulties when the attributes of a person are apparently used without consent, which poses new questions to the law: should the law protect the individual against the unlawful use of his or her image? If so, to what extent should such protection be granted? These were some of the questions which the court had to answer in Wells v Atoll Media (Pty. The judgment in Wells has redefined the right to identity and provided some clarity on what the infringement of that right would amount to. When the attributes of a person are used without consent, the right to identity can be violated in one of four ways. A person's right to identity can be infringed upon if the attributes of that person are used without permission in a way which cannot be reconciled with the true image of the individual concerned, if the use amounts to the commercial exploitation of the individual, if it cannot be reconciled with generally accepted norms of decency, or if it violates the privacy of that person.

  3. Sustainability in the Chemical Industry. By Eric Johnson, Springer, 2012; 173 pages. Price CHF 133.50, ISBN 978-94-007-3834-8

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin


    Full Text Available It’s the new rock and roll. It’s the new black. Sustainability is trendy, and not just among hipsters and pop stars. The uncool chemical sector helped pioneer it, and today, companies inside and outside the sector have embraced it. But what have they embraced? Surely not the Brundtland definition of meeting “the needs of the present without compromising the ability of future generations to meet their own needs.”

  4. Observation of states beyond band termination in 156,157,158Er and strongly deformed structures in 173,174,175Hf

    International Nuclear Information System (INIS)

    Riley, M A; Djongolov, M K; Evans, A O


    High-spin terminating bands in heavy nuclei were first identified in nuclei around 158 Er 90 . While examples of terminating states have been identified in a number of erbium isotopes, almost nothing is known about the states lying beyond band termination. In the present work, the high-spin structure of 156,157,158 Er has been studied using the Gammasphere spectrometer. The subject of triaxial superdeformation and 'wobbling' modes in Lu nuclei has rightly attracted a great deal of attention. Very recently four strongly or superdeformed (SD) sequences have been observed in 174 Hf, and cranking calculations using the Ultimate Cranker code predict that such structures may have significant triaxial deformation. We have performed two experiments in an attempt to verify the possible triaxial nature of these bands. A lifetime measurement was performed to confirm the large (and similar) deformation of the bands. In addition, a high-statistics, thin-target experiment took place to search for linking transitions between the SD bands, possible wobbling modes, and new SD band structures

  5. Study Protocol Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571)

    NARCIS (Netherlands)

    Tabbers, Merit M.; Chmielewska, Ania; Roseboom, Maaike G.; Boudet, Claire; Perrin, Catherine; Szajewska, Hania; Benninga, Marc A.


    ABSTRACT: BACKGROUND: Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30-50%, these children reported

  6. A cobra-cipó Imantodes cenchoa (Linnaeus, 1758 em Minas Gerais, sudeste do Brasil doi: 10.5007/2175-7925.2010v23n4p173

    Directory of Open Access Journals (Sweden)

    Henrique Caldeira Costa


    é registrada da Amazônia ao norte, à Santa Catarina ao sul. No Estado de Minas Gerais, sudeste do Brasil, há apenas dois registros de I. cenchoa na literatura. No presente estudo, foi realizado um levantamento de I. cenchoa provenientes de Minas Gerais, nas principais coleções herpetológicas brasileiras, revelando um total de 13 localidades com registros desta espécie.

  7. 49 CFR 173.244 - Bulk packaging for certain pyrophoric liquids (Division 4.2), dangerous when wet (Division 4.3... (United States)


    ... 105J500I Chloropicrin 105J500I112J500I Chlorosulfonic acid 105J500I112J500I Dimethyl sulfate 105J500I112J500I Ethyl chloroformate 105J500I112J500I Hexachlorocyclopentadiene 105J500I112J500I Hydrocyanic acid... trichloride 105J500I112J500I Sulfur trioxide, stabilized 105J500I112J500I Sulfuric acid, fuming...

  8. Test report dot7A type A liquid packaging

    Energy Technology Data Exchange (ETDEWEB)

    Ketusky, E. T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Brandjes, C. [Ameriphysics LLC, Knoxville, TN (United States); Benoit, T. J. [Argonne National Lab. (ANL), Argonne, IL (United States)


    This section presents a general description of the DOT Specification 7A Type A liquid content packaging (HVYTAL), the liquid content evaluated as its payload, acceptable payload shipping configurations and features special to its use. This test report documents compliance with the regulatory safety requirements of 49 CFR Parts 173.24, 173.24a, 173.27, 173.410, 173.412, 173.461 – 173.466 and 178.350.

  9. Method of isolation of traces of americium by using the +6 oxidation state properties

    International Nuclear Information System (INIS)

    Kwinta, Jean; Michel, Jean-Jacques


    The authors present a method to separate traces of americium from a solution containing fission products and actinides. This method comprises the following steps: firstly, the oxidation of americium at the +6 state by ammonium persulfate and carrying over of actinides and III and IV lanthanides by lanthanum fluoride; secondly, the reduction by hydrazine of the oxidized americium and carrying over of the reduced americium by lutetium fluoride; and thirdly, the americium-lutetium separation by selective extractions either with di 2 ethyl hexyl phosphoric acid, or by fractionated elution on an anionic resin column by a mixture of nitric acid and methanol [fr

  10. Extraction of nitrates of lanthanoids (3) of the yttrium group and yttrium (3) by trialkylbenzylammonium nitrate in toluene

    International Nuclear Information System (INIS)

    Pyartman, A.K.; Kovalev, S.V.; Keskinov, V.A.; Kopyrin, A.A.


    A study was made on extraction of nitrates of lanthanoids (3) of the yttrium group (terbium-lutetium) and yttrium (3) by trialkylbensylammonium nitrate in toluene at T=298.15 K pH 2. Extraction isotherms are described with account of formation of compound of (R 4 N) 2 [Ln(NO 3 ) 5 ] composition in organic phase. Values of extraction constants decreasing in terbium (3)-lutetium (3) series, were calculated. Value of extraction constant for yttrium (3) is close to the value of extraction constant for ytterbium (3). 13 refs., 2 figs., 3 tabs

  11. Luminescence characteristics of the Ce.sup.3+./sup.-doped pyrosilicates: the case of La-admixed Gd.sub.2./sub.Si.sub.2./sub.O.sub.7./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Jarý, Vítězslav; Nikl, Martin; Kurosawa, S.; Shoji, Y.; Mihóková, Eva; Beitlerová, Alena; Pazzi, G.P.; Yoshikawa, A.


    Roč. 118, č. 46 (2014), s. 26521-26529 ISSN 1932-7447 R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : lutetium silicate sci ntillators * floating-zone growth * electronic-structure * yttrium content * lyso crystals Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.772, year: 2014

  12. Para-ter-butyl of calix(4)arene with acetamide-ether as inorganic-organic receiver

    International Nuclear Information System (INIS)

    Ramirez, F.M. de; Scopelliti, R.; Muller, G.; Buenzli J, C.G.; Charbonniere, L.


    A new functionalized calix(4)arene was designed and constructed with predetrmined properties to form lanthanides complexes and to sensibilize its luminescent properties. This, in addition to sensibilize that photophysical property and once formed the complex resulted a good receiver of organic molecules as it is demonstrated the crystal structure of the lutetium complex. (Author)

  13. Ce(III) and Lu(III) metal-organic frameworks with Lewis acid metal sites: Preparation, sorption properties and catalytic activity in Knoevenagel condensation

    Czech Academy of Sciences Publication Activity Database

    Almáši, M.; Zeleňák, V.; Opanasenko, Maksym; Císařová, I.


    Roč. 243, APR 2015 (2015), s. 184-194 ISSN 0920-5861 R&D Projects: GA ČR GA14-07101S Institutional support: RVO:61388955 Keywords : cerium(III) * lutetium(III) * Benzene-1,3,5-tricarboxylate Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.312, year: 2015

  14. Effective atomic number, electron density and kerma of gamma ...

    Indian Academy of Sciences (India)

    rare element optical glass with oxides of tungsten, tantalum and thorium. ... Similarly, gadolinium and lutetium exhibit only +3 oxidation state because .... (σa) and effective molecular cross-section (σm) are related by the following equation: σa =.

  15. Application of the pM'-pCH diagrams in the determination of hydrolysis constants of the lanthanides

    International Nuclear Information System (INIS)

    Lopez G, H.; Jimenez R, M.; Solache R, M.; Rojas H, A.


    The pM ' -pC H diagrams allowed to determine the saturation and non-saturation zones of Lu(OH) 3 in solid phase and those were applied for determining the hydrolysis and lutetium solubility constants, using the radioactive isotope Lu-177. The first constant of hydrolysis was also determined by the potentiometric method in absence of solid phase. (Author)

  16. Thermoluminescent coactivated rare earth oxyhalide phosphors and x-ray image converters utilizing said phosphors

    International Nuclear Information System (INIS)

    Rabatin, J.G.


    Oxyhalides of lanthanum, gadolinium and lutetium coactivated with a first activator selected from bismuth and samarium to provide the color of light emission and a second coactivator (e.g. terbium or praseodymium) which increases the amount of stored energy in a stored radiographic latent image are found to be superior in their conversion efficiency of x-rays to visible light. (author)

  17. Character of changes in the thermodynamic properties of alloyed melts of rare-earth metals with low-melting-point p- and d-metals

    International Nuclear Information System (INIS)

    Yamshchikov, L.F.; Zyapaev, A.A.; Raspopin, S.P.


    Published data on thermodynamic characteristics of lanthanides in liquid-metal melts of gallium, indium and zinc were systematized. The monotonous change from lanthanum to lutetium was ascertained for activity values and activity coefficients of trivalent lanthanides in the melts, which permits calculating the values for the systems of fusible metals, where no experimental data are available [ru

  18. CRED Wave and Tide Recorder (WTR); NWHI, LIS; Long: -173.88414, Lat: 25.94299 (WGS84); Sensor Depth: 21.34m; Data Range: 20081005-20090930. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Wave and Tide Recorders (WTR) provide a time series of...

  19. 173. Carcinoma renal con trombosis de vena cava y extensión a aurícula derecha: Una técnica novedosa sin hipotermia profunda ni parada cardiocirculatoria

    Directory of Open Access Journals (Sweden)

    A.M. Bel Mínguez


    Resultados: No hubo muertes quirúrgicas ni intrahospitalarias. El tiempo medio de circulación extracorpórea (CEC fue de 189 min. La estancia media en la unidad de cuidados intensivos (UCI fue de 7 días (rango 4–33 y la estancia postoperatoria media de 19 días (rango 15–60. Hubo un caso de tromboembolismo pulmonar (TEP intraoperatorio. Un paciente desarrolló una encefalopatía hipoxicoanóxica.

  20. Multibeam collection for KN173L02: Multibeam data collected aboard Knorr from 2003-10-23 to 2003-11-14, Port of Spain, Trinidad and Tobago to Woods Hole, MA (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  1. Multibeam collection for KN173L01: Multibeam data collected aboard Knorr from 2003-09-22 to 2003-10-20, Woods Hole, MA to Port of Spain, Trinidad and Tobago (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  2. CRED Wave and Tide Recorder (WTR); NWHI, LIS; Long: -173.88458, Lat: 25.94313 (WGS84); Sensor Depth: 14.90m; Data Range: 20041011-20060505. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Wave and Tide Recorders (WTR) provide a time series of...

  3. CRED Wave and Tide Recorder (WTR); NWHI, LIS; Long: -173.88455, Lat: 25.94317 (WGS84); Sensor Depth: 14.90m; Data Range: 20030725-20040629. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Wave and Tide Recorders (WTR) provide a time series of...

  4. 77 FR 36607 - Office of Hazardous Materials Safety Notice of Applications for Modification of Special Permit (United States)


    ... modification of special permits (e.g. to provide for additional hazardous materials, packaging design changes... hazardous materials. 12102-M EQ Industrial 49 CFR 173.56(i); To modify the special Services, Inc. 173.56(b... 4.1. 13102-M Robertshaw Industrial 49 CFR 173.150(b); To modify the special Products dba 173.222(c...

  5. Validation of GEANT3 simulation studies with a dual-head PMT ClearPET TM prototype

    CERN Document Server

    Ziemons, K; Streun, M; Pietrzyk, U


    The ClearPET TM project is proposed by working groups of the Crystal Clear Collaboration (CCC) to develop a 2/sup nd/ generation high performance small animal positron emission tomograph (PET). High sensitivity and high spatial resolution is foreseen for the ClearPET TM camera by using a phoswich arrangement combining mixed lutetium yttrium aluminum perovskite (LuYAP:Ce) and lutetium oxyorthosilicate (LSO) scintillating crystals. Design optimizations for the first photomultiplier tube (PMT) based ClearPET camera are done with a Monte-Carlo simulation package implemented on GEANT3 (CERN, Geneva, Switzerland). A dual-head prototype has been built to test the frontend electronics and was used to validate the implementation of the GEANT3 simulation tool. Multiple simulations were performed following the experimental protocols to measure the intrinsic resolution and the sensitivity profile in axial and radial direction. Including a mean energy resolution of about 27.0% the simulated intrinsic resolution is about (...

  6. The joint PNC-ORNL tank calibration experiment of 1991

    International Nuclear Information System (INIS)

    Smith, D.H.; Bostick, D.A.; McBay, E.H.; Carter, J.A.; Ehinger, M.H.


    A tank calibration experiment was carried out using the lutetium double spike technique as part of the joint PNC-DOE effort to establish nuclear safeguards at reprocessing plants. The experiment used a 3000 liter tank containing about 100g/L depleted uranium. Results were less than ideal, but the reasons for this are understood. The discussions between the two organizations were highly beneficial. The experiment served to identify two problems in the procedure that must be solved before anything else is tried: 1. Quantitative mixing of tracer of tank contents has not been achieved at PNC. This must be corrected. 2. A chemical procedure to isolate lutetium in a form compatible with good mass spectrometric analysis must be developed. It must be amenable to use in a hot cell. 6 refs., 6 figs., 2 tabs

  7. Luminescent determination of trace amounts of terbium using diantipyrylmethane and salicylic acid

    Energy Technology Data Exchange (ETDEWEB)

    Tishchenko, M A; Gerasimenko, G I; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Inst. Obshchej i Neorganicheskoj Khimii


    To elucidate the possibility of using pyrazolone-5-diantipyril-methane (DAM) derivative for determination of terbium microimpurities, the conditions have been studied of luminescent determination of terbium in complex compounds containing an ion of rare-earth element, diantipyrilmethane, and salicylic acid (Sal.). The ratio between the components in the complex REE-DAM-Sal is 1:1:3. La, Y, Gd do not affect the luminescence intensity of terbium complex. A luminescent method of determining terbium traces in highly pure oxides of lanthanum, gadolinium, lutetium, and yttrium has been developed in which suspensions of complex precipitation are used. The amount of terbium determined in oxide of lanthanum, gadolinium, and lutetium is (1-5)x10/sup -6/% and (2-3)x10/sup -5/% in yttrium oxide.

  8. Luminescence and scintillation properties of Lu.sub.3./sub.Al.sub.5./sub.O.sub.12./sub. nanoceramics sintered by SPS method

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Babin, Vladimir; Beitlerová, Alena; Kučerková, Romana; Pánek, D.; Barta, J.; Čuba, V.; Yamaji, A.; Kurosawa, S.; Mihóková, Eva; Ito, A.; Goto, T.; Nikl, Martin; Yoshikawa, A.


    Roč. 53, Mar (2016), s. 54-63 ISSN 0925-3467 R&D Projects: GA ČR GA13-09876S; GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : lutetium-aluminium-garnet * spark-plasma-sintering * nanoceramics * scintillator * Ce-doping Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.238, year: 2016

  9. Electron paramagnetic resonance study of exchange coupled Ce.sup.3+./sup. ions in Lu.sub.2./sub.SiO.sub.5./sub. single crystal scintillator

    Czech Academy of Sciences Publication Activity Database

    Buryi, Maksym; Laguta, Valentyn; Rosa, Jan; Nikl, Martin


    Roč. 90, Jul (2016), s. 23-26 ISSN 1350-4487 R&D Projects: GA ČR GAP204/12/0805; GA MŠk(CZ) LM2011029; GA MŠk LO1409 Institutional support: RVO:68378271 Keywords : electron paramagnetic resonance * scintillators * lutetium oxyorthosilicate * exchange coupled ions * cerium ions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.442, year: 2016

  10. Thermophysical Properties of Matter - The TPRC Data Series. Volume 4. Specific Heat - Metallic Elements and Alloys (United States)


    Indium—Indium alloys—Iron—iron alloys— lanthanum — load—lead alloys—lithium—lithium alloya—«agnaslum—magnaalum alloys—manganas^ —naoganasa alloys—marcury...Germanium 21 Gold 22 Hafnium 23 Holmium 24 Indium 25 Iridium 26 Iron 27 Lanthanum 28 Lead 29 Lithium 30 Lutetium 31 Magnesium 32 Manganese 33...hexahydrate (ErC^-eHjO Erbium gallate (see Trierbium pentagallium 1 dodecaoxide) 4 5 65 822 Freon 10 (see Carbon tetrachloride) Freon 11

  11. Laser Spectroscopy Characterization of Materials for Frequency Agile Solid State Laser Systems (United States)


    Received 30 November 1987; revised manuscript received 29 January 1988) Single crystals of lanthanum lutetium gallium garnet (LaLuGaG) were grown may be realized it gar- dleternte itf other materials can be found with spectral nets formed with lanthanum occupying tile dodecaliedrial ,1nl...array-pumped Nd: YAG and Nd: Lu: YAG lasers," Opt. inates and gallates with the malilite structure," in Tunable Lett. 14, 116-118 (1989). Solid State

  12. USSR and Eastern Europe Scientific Abstracts, Physics. Number 46. (United States)


    magnetic field in the area of large fields, the harmonics are due to the resonances of the standing magnetic -plasma waves in the plate; in the area...parameters of cerium, gadolinium and lutetium orthovanadite. Polytherms of heat capacity, magnetization and magnetic susceptibility of these rare...of lasing in mixed ZnxCd^_xS single crystals, and it was found that the model of a simple " Fabry -Perot resonator ," i.e., an inverse layer on the

  13. Addition compounds between lanthanide trifluoromethane sulphonates and N,N,N',N' - tetrametilmalonamida (TMMA)

    International Nuclear Information System (INIS)

    Bellis, V.M. de.


    The preparation and characterization of the addiction compounds between lanthanide trifluoromethanesulphonates with the N,N,N',N' - tetramethylmodomamide (TMMA) are reported. The characterization of the compounds obtained by microanalytical procedures, infrared spectra, conductance measurements, X-ray powder patterns, absorption spectra of the praseodymium, neodymium, holmium and erbium and the emission spectra of the europium and the europium-doped lanthanum and lutetium adducts were made. (M.J.C.) [pt

  14. First principle calculation of structure and lattice dynamics of Lu2Si2O7

    Directory of Open Access Journals (Sweden)

    Nazipov D.V.


    Full Text Available Ab initio calculations of crystal structure and Raman spectra has been performed for single crystal of lutetium pyrosilicate Lu2Si2O7. The types of fundamental vibrations, their frequencies and intensities in the Raman spectrum has been obtained for two polarizations. Calculations were made in the framework of density functional theory (DFT with hybrid functionals. The isotopic substitution was calculated for all inequivalent ions in cell. The results in a good agreement with experimental data.

  15. Abstracts of the 36. Brazilian congress of chemistry; 3. National meeting on thermal analysis and calorimetry; 9. Brazilian journey of chemistry scientific initiation; 2. National meeting on industrial chemistry; 4. Scientific marathon on chemistry; EXPOQUIMICA 96; 1. Workshop on in flow analysis; 1. Workshop on the environment: opportunities for the interdisciplinary research; 1. Workshop on chemical sensors and biosensors

    International Nuclear Information System (INIS)


    The use of ceramic solid electrolytes for chemical sensors and the characterization of lanthanide III p-toluene-sulphonates as well as the chemical preparation of lutetium compounds are discussed. A Brazilian station for monitoring global atmospheric and the impacts on pollutants dispersion in Brazil are analysed. The catalytic liquefaction of sugar cane bagasse is considered as well as the study of higher alcohols reaction on zeolites is presented

  16. Assignment of 4f-5d absorption bands in Ce-doped RAlO.sub.3./sub. (R=La, Gd, Y, Lu) perovskites

    Czech Academy of Sciences Publication Activity Database

    Mihóková, Eva; Nikl, Martin; Bacci, M.; Dušek, Michal; Petříček, Václav


    Roč. 79, č. 19 (2009), 1951309/1-1951309/7 ISSN 1098-0121 R&D Projects: GA MŠk ME 903; GA AV ČR IAA100100810 Institutional research plan: CEZ:AV0Z10100521 Keywords : cerium * EHT calculations * gadolinium compounds * lanthanum compounds * lutetium compounds * ultraviolet spectra * yttrium compounds Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.475, year: 2009

  17. Crystal growth and scintillation properties of selected fluoride crystals for VUV scintillators

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Yamaji, A.; Yokota, Y.; Kurosawa, S.; Král, Robert; Nikl, Martin; Yoshikawa, A.


    Roč. 401, Sep (2014), s. 833-838 ISSN 0022-0248. [International Conference on Crystal Growth and Epitaxy /17./. Warsaw, 11.08.2013-16..08.2013] R&D Projects: GA MŠk LH12150 Institutional support: RVO:68378271 Keywords : vacuum-ultra-violet emission * micro-pulling-down method * barium -lutetium fluoride * erbium fluoride Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.698, year: 2014

  18. Luminescence mechanism in doubly Gd, Nd-codoped fluoride crystals for VUV scintillators

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fukuda, K.; Babin, Vladimir; Kurosawa, S.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin


    Roč. 169, Jan (2016), s. 682-689 ISSN 0022-2313. [International Conference on Luminescence and Optical Spectroscopy of Condensed Matter /17./. Wroclaw, 13.07.2014-18.07.2014] R&D Projects: GA MŠk(CZ) LH14266 Institutional support: RVO:68378271 Keywords : barium –lutetium–yttrium fluoride * lutetium fluoride * scintillator * VUV luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

  19. Modifications of micro-pulling-down method for the growth of selected Li-containing crystals for neutron scintillator and VUV scintillation crystals

    Czech Academy of Sciences Publication Activity Database

    Pejchal, Jan; Fujimoto, Y.; Chani, V.; Yanagida, T.; Yokota, Y.; Yoshikawa, A.; Nikl, Martin; Beitlerová, Alena


    Roč. 360, SI (2012), 127–130 ISSN 0022-0248 R&D Projects: GA MŠk(CZ) 1M06002 Grant - others:AVČR(CZ) M100100910 Institutional research plan: CEZ:AV0Z10100521 Keywords : Ti-doping * micro-pulling-down * barium lutetium fluoride * lithium aluminate * neutron scintillator Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.552, year: 2012

  20. Yttrium and rare earths separation by ion exchange resin

    International Nuclear Information System (INIS)

    Pinatti, D.G.; Ayres, M.J.G.; Ribeiro, S.; Silva, G.L.J.P.; Silva, M.L.C.P.; Martins, A.H.


    The experimental results of yttrium and rare earths separation from Brazilian xenotime are presented. The research consist in five stage: 1) Preparation of yttrium, erbium and lutetium standard solutions, from solubilization of pure oxides 2) yttrium and rare earths separation by ion exchange chromatrography 3) Separation and recovery of EDTA 4) Precipitation and calcination and 4) Analytical control of process. (C.G.C.) [pt

  1. 77 FR 58215 - Notice of Application for Special Permits (United States)


    ... required labelling and placarding. (modes 1, 2, 4, 5) 15707-N Air Products and 49 CFR 173.240; To authorize the Chemicals, Inc., 173.242; 176.83. transportation in Allentown, PA. commerce of a gas purification...

  2. 78 FR 51818 - Notice of Applications for Modification of Special Permits (United States)


    ... provide for additional hazardous materials, packaging design changes, additional mode of transportation... additional packaging. 14188-M IDQ Operating Inc. 49 CFR 173.304(d), To modify the special Tarrytown, NY. 173...

  3. 78 FR 3966 - Notice of Applications for Modification of Special Permit (United States)


    ... hazardous materials, packaging design changes, additional mode of transportation, etc.) are described in...), permit to authorize new 173.13(c)(1)(ii), packaging requirements 173.13(c)(1)(iv), for Division 6.1 PG II...

  4. 75 FR 34523 - Office of Hazardous Materials Safety; Notice of Application for Special Permits (United States)


    ... Manufacturing, 49 CFR To authorize the Incorporated 173.31(e)(2)(ii), manufacture, marking, Alexandria, LA. 173... Administration commerce of non-DOT (NASA) Washington, specification packaging DC. for the transportation in...

  5. ORF Alignment: NT_033778 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. ORF Alignment: NC_003282 [GENIUS II[Archive

    Lifescience Database Archive (English)


  7. ORF Alignment: NC_002967 [GENIUS II[Archive

    Lifescience Database Archive (English)


  8. Bioindikation im Grundwasser funktioniert - Erwiderung zum Kommentar von T. Scheytt zum Beitrag "Grundwasserfauna als Indikator für komplexe hydrogeologische Verhältnisse am westlichen Kaiserstuhl" von Gutjahr, S., Bork, J. & Hahn, H.J. in Grundwasser 18 (3), 173-184 (2013) (United States)

    Hahn, Hans Jürgen; Gutjahr, Simon


    In seinem Kommentar schließt Traugott Scheytt die faunistische Bioindikation über die Nutzung von Grundwassermessstellen aus methodischen Gründen aus. Er postuliert auch, dass die faunistische Indikation hydrogeologischer Zusammenhänge wegen der eingeschränkten Ausbreitungsfähigkeit der Tiere in Porengrundwasserleitern nicht möglich sei und stellt grundsätzlich die Befunde unserer Untersuchungen am Kaiserstuhl in Frage. Dabei überträgt Herr Scheytt seine Erfahrungen aus der unbelebten Hydrogeologie direkt auf den Lebensraum Grundwasser. Seine Argumentation berücksichtigt dabei weder die Prinzipien der Ökologie noch den aktuellen Stand der grundwasserökologischen Forschung. Wir gehen davon aus, dass für die Untersuchungen am Kaiserstuhl sowohl unsere Arbeitshypothese wie auch die angewandten Methoden und die Interpretation der Ergebnisse der Fragestellung angemessen sind und internationalem, wissenschaftlichem Standard entsprechen. Aus den oben benannten Gründen bleiben wir dabei: Biondikation im Grundwasser funktioniert und sie bietet hervorragende Möglichkeiten, gerade auch für die Hydrogeologie.

  9. Una alternativa de diseño y confección de medios auxiliares para el desarrollo de actividades Físico-Recreativas en niños entre 8 y 10 años de la Zona #173 del Consejo Popular Hermanos Cruz del municipio Pinar del Río

    Directory of Open Access Journals (Sweden)

    Abel Castillo López


    Full Text Available La práctica de las actividades físicas-recreativas es tan antigua como el hombre mismo; en nuestros días se le concede vital importancia pues compensan la carga física, intelectual y emocional para evitar desequilibrios en su comportamiento personal y social, mediante la recreación de forma sana y constructiva en sus dimensiones como disciplina y como política de Estado. Hoy en día la intervención comunitaria a través de estas actividades se ha convertido en una necesidad, pues el desarrollo comunitario en gran medida implica un desarrollo social. Es por este sentido que se hace necesaria una alternativa para gestionar aditamentos e implementos deportivos auxiliares que contribuyan al incremento de las actividades físico-recreativas en la comunidad para niños entre 8/10 años, de una manera sana, propiciando estilos de vida saludables, capaces de manifestar en todos los aspectos un mejoramiento de la calidad de vida y provocando cambios en los hábitos, cultura en los niños, atendiendo a sus gustos y preferencias.

  10. Perfil antropométrico e alimentar de pré-escolares de uma escola pública do Alto Paranaíba, MGAnthropometric and dietary profile of preschool children in a public school in Alto Paranaíba, MGdoi:10.12662/2317-3076jhbs.v4i3.864.p166-173.2016

    Directory of Open Access Journals (Sweden)

    Muriele Pereira Mendes Cornélio


    Full Text Available Introdução: a fase pré-escolar é um período de importantes mudanças alimentares a qual tem contribuído para o excesso de peso em crianças de todas as classes econômicas. Objetivo: analisar o perfil antropométrico e alimentar de pré-escolares de uma escola pública municipal de Rio Paranaíba, MG. Métodos: para a realização da pesquisa de caráter transversal e quantitativa, analisou-se o perfil antropométrico e alimentar (frequência alimentar de alguns alimentos e a distribuição percentual de nutrientes da alimentação escolar de crianças. Para avaliar o consumo da alimentação escolar entre os gêneros, utilizou-se o Teste Mann Whitney, e na associação do consumo dos alimentos obesogênicos e o estado nutricional, por gênero, utilizou-se o Teste Qui-quadrado, ambos a 5%. Resultados: das 58 crianças avaliadas, os meninos apresentaram mais excesso de peso. Os pré-escolares apresentaram uma ingestão diária elevada de alimentos obesogênicos (achocolatados, biscoitos recheados e suco em pó, e baixo para aqueles considerados saudáveis (beterraba, cenoura, mamão e os folhosos. Entre os alimentos obesogênicos avaliados, o achocolatado em pó foi o mais consumido, e apenas o consumo de salgadinho (chips, pelos meninos, correlacionou-se com o excesso de peso. As meninas com excesso de peso apresentaram uma maior ingestão de proteínas, carboidratos, lipídios e ferro na alimentação escolar. Conclusão: embora somente o consumo de salgadinho correlacionou-se ao excesso de peso, alguns pré-escolares apresentaram uma ingestão diária elevada de alimentos obesogênicos e baixo para aqueles considerados saudáveis, bem como maiores quantidades de proteínas, carboidratos e lipídios na alimentação escolar, fatos que podem contribuir para o excesso de peso apresentado.l das crianças, elevando o peso das mesmas e ocasionar prejuízos funcionais ao organismo.

  11. Response to the Colloquium "The Organisation for Economic Co-Operation and Development's International Early Learning Study: Opening for Debate and Contestation", by Peter Moss, Gunilla Dahlberg, Susan Grieshaber, Susanna Mantovani, Helen May, Alan Pence, Sylvie Rayna, Beth Blue Swadener and Michel Vandenbroeck, "Contemporary Issues in Early Childhood" 17(3) (United States)

    Mackey, Glynne; Hill, Diti; De Vocht, Lia


    In this article, the authors opine that the introduction of an international assessment of children's early learning, such as proposed by the OECD with its planned International Early Learning Study, will shift the emphasis away from pedagogies which focus on that which is meaningful and relevant in children's lives and their learning, to an…

  12. 78 FR 12415 - Notice of Applications for Modification of Special Permit (United States)


    ... hazardous materials, packaging design changes, additional mode of transportation, etc.) are described in... 173.302(a), permit to authorize Columbus, OH. 173.304(a), a Class 8 packaging 173.304(d), group I... seamless stainless steel type 304 packaging and remove requirements when reoffered for transportation...

  13. 77 FR 23803 - Office of Hazardous Materials Safety; Actions on Special Permit Applications (United States)


    ...-M......... Conference of 49 CFR To modify the Radiation 172.203(d); special permit add Control Part............ Conference of 49 CFR Part To modify the Radiation 172, Subparts, special permit add Control C, D, E, F, G, 49...; additional mode of Berlin 173.345; transportation Packaging 173.346; (cargo vessel). (Former 173.359; Grantee...

  14. 77 FR 29450 - Actions on Special Permit Applications (United States)


    ............ Conference of 49 CFR To modify the Radiation 172.203(d); special permit add Control Part 172, 49 CFR Part 172..., KY. the list of regulations exempted in paragraph 4. 11406-M......... Conference of 49 CFR Part To... mode of Berlin 173.345; transportation Packaging 173.346; (cargo vessel.) (Former 173.359; Grantee All...

  15. 77 FR 64843 - Actions on Special Permit Applications (United States)


    ... modify the Industrial 173.150(b); special permit to Products dba 173.222(c); authorize the Invensys 173... changed from package to packaging would allow the containers to be shipped back to the manufacturer for... Base, IL. 176.84(c)(2); ammunition on and 176.136. United States Navy Container Ships. (mode 3) DENIED...

  16. Single-shot positron annihilation lifetime spectroscopy with LYSO scintillators


    Alonso, A. M.; Cooper, B. S.; Deller, A.; Cassidy, D. B.


    We have evaluated the application of a lutetium yttrium oxyorthosilicate (LYSO) based detector to single-shot positron annihilation lifetime spectroscopy. We compare this detector directly with a similarly configured PbWO4 scintillator, which is the usual choice for such measurements. We find that the signal to noise ratio obtained using LYSO is around three times higher than that obtained using PbWO4 for measurements of Ps excited to longer-lived (Rydberg) levels, or when they are ionized so...

  17. The migrant 152Eu as europium humate

    International Nuclear Information System (INIS)

    Klotz, D.


    Europium was used as a representative of the lanthanide group in the migration experiments in underground water. These 14 elements, with the atomic numbers of 58 (cerium) through 71 (lutetium) are quite similar in their chemical characteristics, and all of them will form metal-humate complexes with humic acids via proton exchange groups. Apart from the concentration, chemical composition and structure, also the particle size of these metal humates will vary strongly as it is dependent on the geochemistry and geophysics of the underground systems [de

  18. Measurement of the half-life of sup 1 sup 7 sup 6 Lu

    CERN Document Server

    Nir-El, Y


    The half-life of sup 1 sup 7 sup 6 Lu was determined by measuring the disintegration rate of a solution of lutetium oxide, using a calibrated HPGe detector, and found to be (3.69+-0.02)x10 sup 1 sup 0 y. It is recommended that the current adopted value be calculated from the grouping of three published values since 1983, including our value, the weighted mean of which is (3.73+-0.01)x10 sup 1 sup 0 y.

  19. Phase extraction equilibria in systems rare earth (3) nitrates-ammonium nitrate-water-trialkylmethylammonium nitrate

    International Nuclear Information System (INIS)

    Pyartman, A.K.; Kopyrin, A.A.; Puzikov, E.A.


    The distribution of rare earth metals (3) between aqueous and organic phases in the systems rare earth metal (3) (praseodymium-lutetium (3), yttrium (3)) nitrate-ammonium nitrate-water-trialkylmethylammonium (kerosene diluent nitrate has been studied. It is shown that in organic phase di- and trisolvates of metals (3) with tralkylmethylammonium nitrate are formed. The influence of concentration of rare earth metal (3) nitrate and ammonium nitrate on the values of extraction concentrational constants has been ascertained: they decrease with increase in the ordinal number of lanthanide (3). 11 refs., 4 figs. 1 tab

  20. Indigenous development of TBq levels of "1"7"7Lu radioisotope production at RPhD for nuclear medicine applications - a successful venture

    International Nuclear Information System (INIS)

    Chakraborty, Sudipta; Vimalnath, K.V.; Dash, Ashutosh


    Lutetium-177 ("1"7"7Lu) has emerged as a potential radionuclide during last decade for the development of radionuclide therapy owing to its favorable nuclear decay characteristics (T_1_/_2=6.65 d, E_β_(_m_a_x) = 0.497 MeV, E_γ = 113 keV (6.4%) and 208 keV (11%)). The long half-life of this promising radioisotope offering distinct logistical advantage and feasibility of its large-scale production in medium flux Dhruva research reactor contributed to its success story

  1. Mutual solubility between hexane and three-n-butyl phosphate solvates of lanthanide(III) and thorium(IV) nitrates at various temperatures

    International Nuclear Information System (INIS)

    Keskinov, V.A.; Lishuk, V.V.; Pyartman, A.K.


    Phase diagrams of binary liquid systems of hexane-rare earth(III) nitrates solvates (rare earth - neodymium, gadolinium, yttrium, ytterbium, lutetium) and thorium(IV) with tri-n-butylphosphate are studied at different temperatures. Phase diagrams of binary systems consist of fields of homogeneous solutions and field of stratification into two liquid phases (I, II): phase I is enriched by hexane, and phase II - [Ln(NO 3 ) 3 (TBP) 3 ] (Ln=Nd, Gd, Y, Yb and Lu) or [Th(NO 3 ) 4 (TBP) 2 ]. Field of stratification into two liquid phases are decreased with growing temperature in binary systems [ru

  2. Kinetic properties of solid yttrium at high temperatures

    International Nuclear Information System (INIS)

    Ivliev, A.D.


    Analysis of results of experimental investigation into temperature-diffusivity, specific electroresistance and heat conductivity of yttrium is carried out. Peculiarities of variation of its kinetic characteristics under high temperatures are shown to result from two-band character of energy spectrum of collectivized electrons. In particular, growth of heat conductivity results from reduction of density of heavy electron states under heating. The suggested model describes kinetic characteristics of lutetium, as well. Usage of this model for the rest heavy rare-earth metals enables to make conclusion about reduction of magnetic scattering effcieincy in the rare-earth metals in proportion to approximation to melting temperature

  3. Development of Scintillators in Nuclear Medicine


    Khoshakhlagh, Mohammad; Islamian, Jalil Pirayesh; Abedi, Seyed Mohammad; Mahmoudian, Babak


    High-quality image is necessary for accurate diagnosis in nuclear medicine. There are many factors in creating a good image and detector is the most important one. In recent years, several detectors are studied to get a better picture. The aim of this paper is comparison of some type of these detectors such as thallium activated sodium iodide bismuth germinate cesium activated yttrium aluminum garnet (YAG: Ce) YAP: Ce “lutetium aluminum garnet activated by cerium” CRY018 “CRY019” lanthanum br...

  4. Development of Scintillators in Nuclear Medicine. (United States)

    Khoshakhlagh, Mohammad; Islamian, Jalil Pirayesh; Abedi, Seyed Mohammad; Mahmoudian, Babak


    High-quality image is necessary for accurate diagnosis in nuclear medicine. There are many factors in creating a good image and detector is the most important one. In recent years, several detectors are studied to get a better picture. The aim of this paper is comparison of some type of these detectors such as thallium activated sodium iodide bismuth germinate cesium activated yttrium aluminum garnet (YAG: Ce) YAP: Ce "lutetium aluminum garnet activated by cerium" CRY018 "CRY019" lanthanum bromide and cadmium zinc telluride. We studied different properties of these crystals including density, energy resolution and decay times that are more important factors affecting the image quality.

  5. Neutron activation analysis of the rare earth elements in Nasu hot springs

    International Nuclear Information System (INIS)

    Ikeda, Nagao; Takahashi, Naruto.


    Eleven rare earth elements (lanthanum, cerium, neodymium, samarium, europium, gadolinium, terbium, holmium, thulium, ytterbium and lutetium) in hot spring waters and sinter deposits in the Nasu area were determined by the neutron activation method. The rare earth elements in hot spring water were preconcentrated in ferric hydroxide precipitate and neutron-irradiated. The rare earth elements were chemically separated into lighter and heavier groups and the activity of each group was measured with a Ge(Li) detector. Distribution of the rare earth elements between the hot spring water and the sinter deposit was also discussed. (auth.)

  6. Status of the lanthanides and actinides in the periodic table

    International Nuclear Information System (INIS)

    Holden, N.E.


    In extended discussions and correspondence with Ekkehard Fluck, the author was made aware of a problem with the Periodic Table, i.e., which element should be shown in the main table as the representative of the lanthanide series and the actinide series. In earlier discussion, he came to the conclusion that lanthanum and actinium are not the elements which should appear, but rather lutetium and lawrencium are more appropriate for inclusion in their place. This paper will attempt to justify the reasons for the above conclusions. 4 refs

  7. Scintillator Evaluation for High-Energy X-Ray Diagnostics

    International Nuclear Information System (INIS)

    Lutz, S. S.; Baker, S. A.


    This report presents results derived from a digital radiography study performed using x-rays from a 2.3 MeV, rod-pinch diode. Detailed is a parameter study of cerium-doped lutetium ortho-silicate (LSO) scintillator thickness, as it relates to system resolution and detection quantum efficiency (DQE). Additionally, the detection statistics of LSO were compared with that of CsI(Tl). As a result of this study we found the LSO scintillator with a thickness of 3 mm to yield the highest system DQE over the range of spatial frequencies from 0.75 to 2.5 mm -1

  8. 4d--4f emission resonances in laser-produced plasmas

    International Nuclear Information System (INIS)

    O'Sullivan, G.; Carroll, P.K.


    Using targets containing compounds of the elements cesium through lutetium, we studied the spectra of laser-produced plasmas in the grazing-incidence region from 40 to 200 A. The spectra are characterized by strong regions of resonancelike emission extending typically over 9--18 eV. With increasing Z, the spectra show certain systematic variations in character and move monotonically toward shorter wavelengths. From a collisional-radiative plasma model, the ion stages responsible for the emision are identified as VIII through XVI. The resonances are attributed to 4-4f transitions that, because Dn = 0, tend to overlap for different ion stages of the same element

  9. Progress report for the Office of Safeguards and Security for FY 1982

    International Nuclear Information System (INIS)

    Smith, D.H.; McKown, H.S.; Walker, R.L.; Sherman, R.L.; Pritchard, C.A.; Carter, J.A.


    Progress in various areas funded by, or of interest to, the Office of Safeguards and Security during FY 1982 is reported. The quadrupole mass spectrometer and its mobile laboratory visited several sites; results were uniformly excellent. We designed, built, and evaluated a new ion source for this instrument; as a result, performance is considerably enhanced. We have completed initial evaluation of lutetium for use as a double spike in calibrating holding tanks or other vessels of indeterminate volume. Precisions and accuracies of about 0.1% were obtained. Two uranium standards have been evaluated using NBS isotopic standards and SALE samples

  10. Successful neoadjuvant peptide receptor radionuclide therapy for an inoperable pancreatic neuroendocrine tumour

    Directory of Open Access Journals (Sweden)

    Tiago Nunes da Silva


    Full Text Available Non-functional pancreatic neuroendocrine tumours (NETs can present with advanced local or distant (metastatic disease limiting the possibility of surgical cure. Several treatment options have been used in experimental neoadjuvant settings to improve the outcomes in such cases. Peptide receptor radionuclide therapy (PPRT using beta emitting radiolabelled somatostatin analogues has been used in progressive pancreatic NETs. We report a 55-year-old female patient with a 12.8 cm pancreatic NET with significant local stomach and superior mesenteric vein compression and liver metastases. The patient underwent treatment with [177Lutetium-DOTA0,Tyr3]octreotate (177Lu-octreotate for the treatment of local and metastatic symptomatic disease. Six months after 4 cycles of 177lutetium-octreotate, resolution of the abdominal complaints was associated with a significant reduction in tumour size and the tumour was rendered operable. Histology of the tumour showed a 90% necrotic tumour with abundant hyalinized fibrosis and haemorrhage compatible with PPRT-induced radiation effects on tumour cells. This report supports that PPRT has a role in unresectable and metastatic pancreatic NET.

  11. An inelastic neutron scattering study of the spin dynamics of Yb1-xLuxAl3

    International Nuclear Information System (INIS)

    Osborn, R.


    We present the results of a systematic inelastic neutron scattering study of the spin dynamics of the mixed valent compound YbAl 3 doped with nonmagnetic lutetium. The aim of the investigation is to clarify the origin of the unusual gap-like magnetic response observed in YbAl 3 , which can be modeled by two inelastic peaks: a narrow peak at 34 meV with HWHM, r = 6.4 ± 0.8 meV and a broad peak at 44 meV with Λ = 30 ± 1 meV. Lutetium substitution leads to a substantial increase in the linewidth (Λ = 9 ± 1 meV at x = 0.1) and a decrease in the intensity (down by 60% at x = 0.1) of the narrow component, with a negligible effect on the broad inelastic peak. This trend is confirmed with higher doping resulting in the complete suppression of the narrow peak at x ≥ 0.35. The results indicate that the narrow component arises from coherent excitation processes within the hybridized 4f-band, which are destroyed by disorder, while the broad component is not so sensitive to the loss of coherence

  12. Novel Electro-Optical Coupling Technique for Magnetic Resonance-Compatible Positron Emission Tomography Detectors

    Directory of Open Access Journals (Sweden)

    Peter D. Olcott


    Full Text Available A new magnetic resonance imaging (MRI-compatible positron emission tomography (PET detector design is being developed that uses electro-optical coupling to bring the amplitude and arrival time information of high-speed PET detector scintillation pulses out of an MRI system. The electro-optical coupling technology consists of a magnetically insensitive photodetector output signal connected to a nonmagnetic vertical cavity surface emitting laser (VCSEL diode that is coupled to a multimode optical fiber. This scheme essentially acts as an optical wire with no influence on the MRI system. To test the feasibility of this approach, a lutetium-yttrium oxyorthosilicate crystal coupled to a single pixel of a solid-state photomultiplier array was placed in coincidence with a lutetium oxyorthosilicate crystal coupled to a fast photomultiplier tube with both the new nonmagnetic VCSEL coupling and the standard coaxial cable signal transmission scheme. No significant change was observed in 511 keV photopeak energy resolution and coincidence time resolution. This electro-optical coupling technology enables an MRI-compatible PET block detector to have a reduced electromagnetic footprint compared with the signal transmission schemes deployed in the current MRI/PET designs.

  13. Novel electro-optical coupling technique for magnetic resonance-compatible positron emission tomography detectors. (United States)

    Olcott, Peter D; Peng, Hao; Levin, Craig S


    A new magnetic resonance imaging (MRI)-compatible positron emission tomography (PET) detector design is being developed that uses electro-optical coupling to bring the amplitude and arrival time information of high-speed PET detector scintillation pulses out of an MRI system. The electro-optical coupling technology consists of a magnetically insensitive photodetector output signal connected to a nonmagnetic vertical cavity surface emitting laser (VCSEL) diode that is coupled to a multimode optical fiber. This scheme essentially acts as an optical wire with no influence on the MRI system. To test the feasibility of this approach, a lutetium-yttrium oxyorthosilicate crystal coupled to a single pixel of a solid-state photomultiplier array was placed in coincidence with a lutetium oxyorthosilicate crystal coupled to a fast photomultiplier tube with both the new nonmagnetic VCSEL coupling and the standard coaxial cable signal transmission scheme. No significant change was observed in 511 keV photopeak energy resolution and coincidence time resolution. This electro-optical coupling technology enables an MRI-compatible PET block detector to have a reduced electromagnetic footprint compared with the signal transmission schemes deployed in the current MRI/PET designs.

  14. Neutron temperature measurements in a cryogenic hydrogenous moderator

    International Nuclear Information System (INIS)

    Ball, R.M.; Hoovler, G.S.; Lewis, R.H.


    Benchmarkings of neutronic calculations are most successful when there is a direct correlation between a measurement and an analytic result. In the thermal neutron energy region, the fluence rate as a function of moderator temperature and position within the moderator is an area of potential correlation. The measurement can be done by activating natural lutetium. The two isotopes of the element lutetium have widely different cross sections and permit the discrimination of flux shape and energy distributions at different reactor conditions. The 175 Lu has a 1/v dependence in the thermal energy region, and 176 Lu has a resonance structure that approximates a constant cross section in the same region. The saturation activation of the two isotopes has been measured in an insulated moderator container at the center of a thermal heterogeneous reactor designed for space nuclear propulsion. The measurements were made in a hydrogenous (polyethylene) moderator at three temperatures (83, 184, and 297 K) and five locations within the moderator. Simultaneously, the reactivity effect of the change in the moderator temperature was determined to be positive with an increase in temperature. The plot of activation shows the variation in neutron fluence rate and current with temperature and explains the positive reactivity coefficient. A neutron temperature can be inferred from a postulated Maxwell-Boltzmann distribution and compared with Monte Carlo or other calculations

  15. Monte Carlo simulation of simultaneous radiation detection in the hybrid tomography system ClearPET-XPAD3/CT

    Energy Technology Data Exchange (ETDEWEB)

    Dávila, H. Olaya, E-mail:; Martínez, S. A. [Physics Department, Universidad Pedagógica y Tecnológica de Colombia, Tunja-Colombia (Colombia); Sevilla, A. C., E-mail:; Castro, H. F. [Physics Department, Universidad Nacional de Colombia, Bogotá D.C - Colombia (Colombia)


    Using the Geant4 based simulation framework SciFW1, a detailed simulation was performed for a detector array in the hybrid tomography prototype for small animals called ClearPET / XPAD, which was built in the Centre de Physique des Particules de Marseille. The detector system consists of an array of phoswich scintillation detectors: LSO (Lutetium Oxy-ortosilicate doped with cerium Lu{sub 2}SiO{sub 5}:Ce) and LuYAP (Lutetium Ortoaluminate of Yttrium doped with cerium Lu{sub 0.7}Y{sub 0.3}AlO{sub 3}:Ce) for Positron Emission Tomography (PET) and hybrid pixel detector XPAD for Computed Tomography (CT). Simultaneous acquisition of deposited energy and the corresponding time - position for each recorded event were analyzed, independently, for both detectors. interference between detection modules for PET and CT. Information about amount of radiation reaching each phoswich crystal and XPAD detector using a phantom in order to study the effectiveness by radiation attenuation and influence the positioning of the radioactive source {sup 22}Na was obtained. The simulation proposed will improve distribution of detectors rings and interference values will be taken into account in the new versions of detectors.

  16. Radiolabeling of trastuzumab with {sup 177}Lu via DOTA, a new radiopharmaceutical for radioimmunotherapy of breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Rasaneh, Samira [Department of Medical Physics, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Rajabi, Hossein [Department of Medical Physics, Tarbiat Modares University, Tehran (Iran, Islamic Republic of)], E-mail:; Babaei, Mohammad Hossein; Daha, Fariba Johari [Department of Radioisotope, Nuclear Science and Technology Research Institute, Tehran (Iran, Islamic Republic of); Salouti, Mojtaba [Department of Biology, School of Sciences, Islamic Azad University - Zanjan Branch, Zanjan (Iran, Islamic Republic of)


    Aim: Trastuzumab is a monoclonal antibody that is used in treating breast cancer. We labeled this monoclonal antibody with lutetium-177 and performed in vitro quality control tests as a first step in the production of a new radiopharmaceutical. Material and Methods: Trastuzumab was labeled with lutetium-177 using DOTA as chelator. Radiochemical purity and stability in buffer and human blood serum were determined using thin layer chromatography. Immunoreactivity and toxicity of the complex were tested on MCF7 breast cancer cell line. Results: The radiochemical purity of the complex was 96{+-}0.9%. The stabilities in phosphate buffer and in human blood serum at 96 h postpreparation were 93{+-}1.2% and 85{+-}3.5%, respectively. The immunoreactivity of the complex was 89{+-}1.4%. At a concentration of 1 nM, the complex killed 70{+-}3% of MCF7 cells. At 1.9 nM, 90{+-}5% of the cells were killed. Conclusions: The results showed that the new complex could be considered for further evaluation in animals and possibly in humans as a new radiopharmaceutical for use in radioimmunotherapy against breast cancer.

  17. Preparation of LuAG Powders with Single Phase and Good Dispersion for Transparent Ceramics Using Co-Precipitation Method (United States)

    Pan, Liangjie; Jiang, Benxue; Fan, Jintai; Yang, Qiuhong; Zhou, Chunlin; Zhang, Pande; Mao, Xiaojian; Zhang, Long


    The synthesis of pure and well dispersed lutetium aluminum garnet (LuAG) powder is crucial and important for the preparation of LuAG transparent ceramics. In this paper, high purity and well dispersed LuAG powders have been synthesized via co-precipitation method with lutetium nitrate and aluminum nitrate as raw materials. Ammonium hydrogen carbonate (AHC) was used as the precipitant. The influence of aging time, pH value, and dripping speed on the prepared LuAG powders were investigated. It showed that long aging duration (>15 h) with high terminal pH value (>7.80) resulted in segregation of rhombus Lu precipitate and Al precipitate. By decreasing the initial pH value or accelerating the dripping speed, rhombus Lu precipitate was eliminated and pure LuAG nano powders were synthesized. High quality LuAG transparent ceramics with transmission >75% at 1064 nm were fabricated using these well dispersed nano LuAG powders. PMID:28793510

  18. Monte Carlo simulation of simultaneous radiation detection in the hybrid tomography system ClearPET-XPAD3/CT (United States)

    Dávila, H. Olaya; Sevilla, A. C.; Castro, H. F.; Martínez, S. A.


    Using the Geant4 based simulation framework SciFW1, a detailed simulation was performed for a detector array in the hybrid tomography prototype for small animals called ClearPET / XPAD, which was built in the Centre de Physique des Particules de Marseille. The detector system consists of an array of phoswich scintillation detectors: LSO (Lutetium Oxy-ortosilicate doped with cerium Lu2SiO5:Ce) and LuYAP (Lutetium Ortoaluminate of Yttrium doped with cerium Lu0.7Y0.3AlO3:Ce) for Positron Emission Tomography (PET) and hybrid pixel detector XPAD for Computed Tomography (CT). Simultaneous acquisition of deposited energy and the corresponding time - position for each recorded event were analyzed, independently, for both detectors. interference between detection modules for PET and CT. Information about amount of radiation reaching each phoswich crystal and XPAD detector using a phantom in order to study the effectiveness by radiation attenuation and influence the positioning of the radioactive source 22Na was obtained. The simulation proposed will improve distribution of detectors rings and interference values will be taken into account in the new versions of detectors.

  19. Preparation of LuAG Powders with Single Phase and Good Dispersion for Transparent Ceramics Using Co-Precipitation Method

    Directory of Open Access Journals (Sweden)

    Liangjie Pan


    Full Text Available The synthesis of pure and well dispersed lutetium aluminum garnet (LuAG powder is crucial and important for the preparation of LuAG transparent ceramics. In this paper, high purity and well dispersed LuAG powders have been synthesized via co-precipitation method with lutetium nitrate and aluminum nitrate as raw materials. Ammonium hydrogen carbonate (AHC was used as the precipitant. The influence of aging time, pH value, and dripping speed on the prepared LuAG powders were investigated. It showed that long aging duration (>15 h with high terminal pH value (>7.80 resulted in segregation of rhombus Lu precipitate and Al precipitate. By decreasing the initial pH value or accelerating the dripping speed, rhombus Lu precipitate was eliminated and pure LuAG nano powders were synthesized. High quality LuAG transparent ceramics with transmission >75% at 1064 nm were fabricated using these well dispersed nano LuAG powders.

  20. Response of Inorganic Scintillators to Neutrons of 3 and 15 MeV Energy

    CERN Document Server

    Lucchini, M; Pizzichemi, M; Chipaux, R; Jacquot, F; Mazue, H; Wolff, H; Lecoq, P; Auffray, E


    In the perspective of the development of future high energy physics experiments, homogeneous calorimeters based on inorganic scintillators can be considered for the detection of hadrons (e.g., calorimeter based on dual-readout technique). Although of high importance in the high energy physics framework as well as for homeland security applications, the response of these inorganic scintillators to neutrons has been only scarcely investigated. This paper presents results obtained using five common scintillating crystals (of size around 2x2x2 cm 3), namely lead tungstate (PbWO4), bismuth germanate (BGO), cerium fluoride (CeF3), Ce-doped lutetium-yttrium orthosilicate (LYSO:Ce) and lutetium aluminum garnet (LuAG:Ce) in a pulsed flux of almost mono-energetic (similar to 3 MeV and similar to 15 MeV) neutrons provided by the Van de Graff accelerator SAMES of CEA Valduc. Energy spectra have been recorded, calibrated and compared with Geant4 simulations computed with different physics models. The neutron detection eff...