Directory of Open Access Journals (Sweden)
Armelle Marais
Full Text Available Double stranded RNAs from Prunus samples gathered from various surveys were analyzed by a deep-sequencing approach. Contig annotations revealed the presence of a potential new viral species in an Azerbaijani almond tree (Prunus amygdalus and its genome sequence was completed. Its genomic organization is similar to that of the recently described Apricot vein clearing associated virus (AVCaV for which two new isolates were also characterized, in a similar fashion, from two Japanese plums (Prunus salicina from a French germplasm collection. The amino acid identity values between the four proteins encoded by the genome of the new virus have identity levels with those of AVCaV which fall clearly outside the species demarcation criteria. The new virus should therefore be considered as a new species for which the name of Caucasus prunus virus (CPrV has been proposed. Phylogenetic relationships and nucleotide comparisons suggested that together with AVCaV, CPrV could define a new genus (proposed name: Prunevirus in the family Betaflexiviridae. A molecular test targeting both members of the new genus was developed, allowing the detection of additional AVCaV isolates, and therefore extending the known geographical distribution and the host range of AVCaV. Moreover, the phylogenetic trees reconstructed with the amino acid sequences of replicase, movement and coat proteins of representative Betaflexiviridae members suggest that Citrus leaf blotch virus (CLBV, type member of the genus Citrivirus may have evolved from a recombination event involving a Prunevirus, further highlighting the importance of recombination as a driving force in Betaflexiviridae evolution. The sequences reported in the present manuscript have been deposited in the GenBank database under accession numbers KM507061-KM504070.
Umar, M; Amer, M A; Al-Saleh, M A; Al-Shahwan, I M; Shakeel, M T; Zakri, A M; Katis, N I
2017-07-01
During 2014 and 2015, 97 lettuce plants that showed big-vein-disease-like symptoms and seven weed plants were collected from the Riyadh region. DAS-ELISA revealed that 25% and 9% of the lettuce plants were singly infected with LBVaV and MiLBVV, respectively, whereas 63% had a mixed infection with both viruses. The results were confirmed by multiplex reverse transcription polymerase chain reaction using primers specific for LBVaV and MiLBVV. LBVaV and MiLBVV were also detected in Sonchus oleraceus and Eruca sativa, respectively. The nucleotide sequence of LBVaV and MiLBVV Saudi isolates ranged from 94.3-100%, and their similarities to isolates with sequences in the GenBank database ranged from 93.9 to 99.6% and 93.8 to 99.3%, respectively. Olpidium sp. was present in the roots of lettuce plants with big-vein disease and it was shown to facilitate transmission of both viruses.
Determination of phomopsin-A in lupin seeds and lupin-derived products
Top, van den H.J.; Mol, J.G.J.
2017-01-01
An interlaboratory study was performed for the determination of phomopsin A in lupin seeds and lupin derived products. This was done in the frame of the 2nd Standardization Mandate (M/520) in the field of methods of analysis for mycotoxins in food, which had been issued by the European Commission in
Sensitization to lupine flour : is it clinically relevant?
de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; van Wijk, R. Gerth
2010-01-01
Background Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. Objective The aim of our
Sensitization to lupine flour: is it clinically relevant?
de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; Gerth van Wijk, R.
2010-01-01
Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. The aim of our study was to
Lupin sensitization and clinical allergy in food allergic children in Norway.
Lindvik, Helene; Holden, Lise; Løvik, Martinus; Cvancarova, Milada; Halvorsen, Ragnhild
2008-01-01
The aim of the present pilot study was to investigate to what extent children in Norway sensitized to lupin had clinical lupin allergy, and to compare sensitization to lupin with sensitization to other legumes. Thirty-five children with food allergy referred to a national referral hospital were evaluated with skin prick test (SPT) and analysis of serum-specific IgE to lupin, peanut, pea and soy. The children with positive SPTs to lupin were offered oral food challenges with lupin flour. Fifteen children (43%) had positive SPT and 17 children (49%) had serum-specific IgE to lupin. Ten SPT-positive children underwent oral food challenges and one experienced an allergic reaction to lupin flour. This child was one of six challenged children with IgE antibodies to peanut >15 kU(A)/L. There was a strong relationship between positive SPT to lupin flour and positive SPT to soy and between positive SPT to lupin and specific IgE to soy, pea and peanut. Children with sensitization to lupin are not likely to have a clinical lupin allergy. Avoidance of lupin on the basis of lupin sensitization or peanut allergy would lead to unnecessarily strict diets. Food challenge is currently necessary to diagnose lupin allergy.
Directory of Open Access Journals (Sweden)
I Dewa Nyoman Nyana
2016-11-01
Full Text Available Yellowing vein banding disease has been reported infecting cucurbit plants in Bali since 2014. Similar vein banding symptom on chilli pepper was observed previously, and early diagnosis indicated infection of Polerovirus. The objective of this research was to confirm the presence of Polerovirus infection on cucumber plant showing yellow vein banding symptom in Bali. Reverse transcription polymerase chain reaction – based detection method was conducted using specific primer pairs PeVYV-CP-F-BamH1/ PeVYV-CP-R-Pst1followed by sequencing and nucleotide sequence analysis. Specific DNA fragments of ± 650 bp was successfully amplified from field samples. Nucleotide sequence analysis showed that the sequence has the highest similarity > 95% with Pepper vein yellow virus (PeVYV infecting chili pepper from Indonesia (Bali, and Rembang, Japan, and Greece.
Molecular strategies towards anthracnose resistance in lupin
2008-01-01
The aim of the project was to develop a strategy towards anthracnose resistance in lupin using molecular techniques. Colletotrichum species are considered to be major plant pathogens of cereals and legumes around the world, causing significant crop losses. Colletotrichum acutatum causes anthracnose disease on lupin. Sweet white lupin (Lupinus albus) is a high protein grain crop that could alleviate protein shortage in South Africa, since it has the highest protein levels (34-45%) compared to ...
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-05-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.
Functionality-driven fractionation of lupin seeds
Berghout, J.A.M.
2015-01-01
Functionality-driven fractionation of lupin seeds
The growth in the world population requires an increase in the production of protein-rich foods from plant-based materials. Lupin seeds have potential to become a novel plant protein source for food products because they are rich
Directory of Open Access Journals (Sweden)
Sri Priatni*
2013-12-01
Full Text Available Tempe is an Indonesian fermented soy bean, produced by using mainly Rhizopus oligosporus. Diversification of tempe raw materials is required for better food security, e.g., using lupin. The potency of lupin bean has been studied as a substitute of soy in tempe production. Nutritionally, lupin bean offers additional advantages over soy bean, i.e., it has a lower level of many anti-nutritional factors (ANFs but contains higher protein (32-36% than most pulses. The objectives of this study were to select the most suitable lupin bean from different particle sizes for tempe production and to characterize the quality of lupin tempe. In this study, the lupin tempe samples were analyzed for moisture content, firmness, aroma, and the total count of colony after 1 and 2 days of fermentation. Sensory evaluation was conducted by 17 Indonesian untrained panelists (hedonic in three different days. The data were evaluated statistically using General Linear Model (GLM and Tukey’s Honest Significant Difference (HSD. Results showed that the moisture content of lupin tempe ranged from 60 to 66%, higher than that of soy tempe (58.90%. Meanwhile, the firmness of lupin tempe was between 21.38-30.89 N. Mostly, tempes which were produced from ≤50% of particles sized ≥5 mm (L3, L5 and L6 exhibited poor quality in terms of firmness and aroma. The mean of total count of colony in lupin tempe were 3.0x104 CFU/g, lower than that of soy tempe (218x103 CFU/g, indicating a slower growth of mycelia on lupin beans. However, the overall acceptability of lupin tempe which was prepared from whole beans (L4 and L7 was not significantly different from that of soy tempe. Based on these quality and sensory tests, lupin tempe using whole lupin beans was recommended for substitute of soy bean in tempe production.
Assessment of Antioxidant Properties of Radiation Processed Lupin Seeds
International Nuclear Information System (INIS)
El-Niely, H.F.G.
2011-01-01
In the present study, the radiation processing of lupin seeds (Lupinus albus spp. Giza 2) were carried out at dose levels of 2.5, 5 and 10 kGy. The chemical composition (protein, fat, total phenolic compounds, total flavonoids and fatty acids) and antioxidant properties of its methanolic extracts were assessed. The result showed that there were non-significant changes observed for protein, fat and ash of processed samples as compared with non-irradiated samples. Meanwhile, the crude fiber was decreased linearly as a function of radiation dose. The total phenolic compounds were increased by 9.92%, 11.75% and 13.82% and flavonoids by 2.5%, 7.1% and 7.5% for the 2.5, 5 and 10 kGy irradiated samples, respectively. Regarding lupin fatty acid contents, the results indicated that gamma irradiation up to 10 kGy did not cause important changes in the percentage of the fatty acids. At 7.5 and 10.0 mg/ml of sample concentration, the antioxidant activities of methanolic extracts for 2.5 to 10 kGy irradiated lupin seeds were significantly higher than those of methanolic extracts of the non-irradiated control. Reducing powers of methanolic extracts from lupin irradiated at 2.5 and 5 kGy were comparable except for 10 kGy irradiated lupin seeds, and had more power than methanolic extracts from non-irradiated lupin. The reducing powers of the methanolic extract from 10 kGy irradiated lupin was decreased at all concentrations (from 0.5 to 10 mg/ml) than of methanolic extracts from non-irradiated or irradiated lupin seeds at 2.5 and 5 kGy. At 2.5 mg/ml, all methanolic extracts showed excellent scavenging abilities of 91.6 to 103.27% against DPPH radicals. The scavenging abilities of methanolic extracts from 2.5 to 10 kGy irradiated lupin were better than that of the non-irradiated control at 10 mg/ml. With irradiation at 2.5-10 kGy, lupin seeds showed higher chelating ability on ferrous ions than did the non-irradiated control. It could be concluded that gamma irradiation of lupin
Evaluation of total polyphenol content and antioxidant capacity of different verity lupin seeds
Directory of Open Access Journals (Sweden)
Ismael Sulaiman Dalaram
2017-01-01
Full Text Available Legumes, including lupins, beans, lentil and chickpea, are one of the most important crops in the world because of their nutritional quality. Lupin seeds have been used as human food and animal feed since ancient times. It was known that antioxidant photochemical in foods have many health benefits including prevention of various diseases associated with oxidative stress such as cancer, cardiovascular disease, neuro-degeneration and diabetes. Lupin grains are rich sources of complex carbohydrates, protein, vitamins and minerals. Antioxidants can be found naturally in foods. Total polyphenols content and antioxidant activity were measured in four varieties of lupin, namely in white lupin, blue lupin, yellow lupin and Mutabilis lupin species. A majority of antioxidants naturally present in foods occur in phenolic structures and especially in flavonoid structures. The content of the total polyphenols was determined by using the Folin-Ciocalteu reagent (FCR. Antioxidant activity was measured by using a compound DPPH˙ (2.2-diphenyl-1-picrylhydrazyl. In the present experiment according to the average contents of total polyphenols (TPC in dry matter of lupin seeds there was the following line: L. Angustifolius (blue lupin (696.212 mg GAE.100g-1 > L. Albus (white lupin (614.13 mg GAE.100g-1 > L. Luteus (yellow lupin (467.78 mg GAE.100g-1 > L. Mutabilis (pearl lupin (367.36 mg GAE.100g-1. Based on the measured values of total antioxidant capacity (TAC of lupin samples can be classified as follows: L. Albus (white lupin (43.44% >L. Angustifolius (blue lupin (38.27% >L. Luteus (yellow lupin (22.29% >L. Mutabilis (Pearl lupin (20.80%. The relationship of antioxidant capacity with total polyphenolic was discussed. According to used statistical analyzes. Correlation between the phenolic contents and antioxidant capacity was significantly positive (r = 0.88. Our results confirmed that legumes can be a good source of bioactive compounds in the human nutrition
The future of lupin as a protein crop in Europe
Directory of Open Access Journals (Sweden)
M. Mercedes eLucas
2015-09-01
Full Text Available Europe has become heavily dependent on soya bean imports, entailing trade agreements and quality standards that do not satisfy the European citizen’s expectations. White, yellow and narrow-leafed lupins are native European legumes that can become true alternatives to soya bean, given their elevated and high-quality protein content, potential health benefits, suitability for sustainable production, and acceptability to consumers. Nevertheless, lupin cultivation in Europe remains largely insufficient to guarantee a steady supply to the food industry, which in turn must innovate to produce attractive lupin-based protein-rich foods. Here, we address different aspects of the food supply chain that should be considered for lupin exploitation as a high-value protein source. Advanced breeding techniques are needed to provide new lupin varieties for socio-economically and environmentally sustainable cultivation. Novel processes should be optimized to obtain high-quality, safe lupin protein ingredients, and marketable foods need to be developed and offered to consumers. With such an integrated strategy, lupins can be established as an alternative protein crop, capable of promoting socio-economic growth and environmental benefits in Europe.
First report of the complete sequence of Sida golden yellow vein virus from Jamaica.
Stewart, Cheryl S; Kon, Tatsuya; Gilbertson, Robert L; Roye, Marcia E
2011-08-01
Begomoviruses are phytopathogens that threaten food security [18]. Sida spp. are ubiquitous weed species found in Jamaica. Sida samples were collected island-wide, DNA was extracted via a modified Dellaporta method, and the viral genome was amplified using degenerate and sequence-specific primers [2, 11]. The amplicons were cloned and sequenced. Sequence analysis revealed that a DNA-A molecule isolated from a plant in Liguanea, St. Andrew, was 90.9% similar to Sida golden yellow vein virus-[United States of America:Homestead:A11], making it a strain of SiGYVV. It was named Sida golden yellow vein virus-[Jamaica:Liguanea 2:2008] (SiGYVV-[JM:Lig2:08]). The cognate DNA-B, previously unreported, was successfully cloned and was most similar to that of Malvastrum yellow mosaic Jamaica virus (MaYMJV). Phylogenetic analysis suggested that this virus was most closely related to begomoviruses that infect malvaceous hosts in Jamaica, Cuba and Florida in the United States.
First report of Squash vein yellowing virus in watermelon in Guatemala
In this study, we report the first detection of Squash vein yellowing virus (SqVYV)-induced watermelon vine decline in Central America. Symptoms including wilt and collapse of plants at harvest, and non-marketable fruits with internal rind necrosis were observed. This report provides an overview o...
Patogenic fungi associated with blue lupine seeds
Directory of Open Access Journals (Sweden)
Bogdan Nowicki
2013-12-01
Full Text Available Over 10% ofseeds harvested in 1991 and 1992 (50 samples, 400 seeds in each sample proved to be infested with various fungi. Fusarium spp. and Botrytis cinerea were the most common pathogens isolated. Fusarium avenaceum was the most common and highIy pathogenic species. Fusarium semitectum and F. tricinctum were highly pathogenic to lupin seedlings but they were the least common Fusarium isolated from seeds. Similarily, Sclerotinia sclerotiorum was isolated only from 0,2% seeds tested but this fungus was highly pathogenic to lupin seedlings. Some other fungi know as lupin pathogens (F. oxysporum, Stemphylium botryosum, Pleiochaeta setosa and Phomopsis leptostromiformis were also noted in tested seeds.
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus)
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-01-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% iden...
Energy Technology Data Exchange (ETDEWEB)
Guillamon, E.; Cuadrado, C.; Pedrosa, M. M.; Varela, A.; Cabellos, B.
2010-07-01
In recent years there has been increased interest in using lupine for human nutrition due to its nutritional properties and health benefits. Moreover, lupine is used as an ingredient in bread making because of its functional and technological properties. However, a higher number of allergic reactions to this legume have recently been reported as a consequence of a more widespread consumption of lupine-based foods. In a previous study, several thermal treatments were applied to lupine seeds and flours resulting in reduced allergenicity. In order to study how this thermal processing (autoclaving and boiling) affects the bread making properties, raw and thermally processed lupine flours were used to replace 10% of wheat flour. The effect of supplementing wheat flour with lupine flour on physical dough properties, bread structure and sensory characteristics were analysed. The results indicated that thermally-treated lupine flours, had similar bread making and sensorial properties as untreated lupine flour. These thermal treatments could increase the potential use of lupine flour as a food ingredient while reducing the risk to provoke allergic reactions. (Author) 36 refs.
Lupine protein enrichment by milling and electrostatic separation
Wang, Jue; Zhao, Jun; Wit, De Martin; Boom, Remko M.; Schutyser, Maarten A.I.
2016-01-01
Lupine seeds are excellent source of plant protein. We here report on dry fractionation by combining milling and electrostatic separation providing an alternative to wet extraction of protein from lupine seeds. Relatively coarse milling was preferred as this provides sufficient detached protein
Directory of Open Access Journals (Sweden)
Márcio Martinello Sanches
2007-12-01
Full Text Available A presença de sintomas de 'big vein' ou engrossamento das nervuras em alface e a associação do Lettuce big-vein associated virus (LBVaV e Mirafiori lettuce big-vein virus (MLBVV foram verificadas por RT-PCR utilizando-se oligonucleotídeos específicos para ambos os vírus. Foram coletadas 366 plantas sintomáticas nas regiões de Bauru, Campinas e Mogi das Cruzes no estado de São Paulo nos meses de junho e setembro de 2004 e abril e julho de 2005, e 18 plantas assintomáticas na região de Mogi das Cruzes no mês de dezembro de 2004. Infecção mista do LBVaV e MLBVV foi detectada em 76,2% das plantas sintomáticas, em 11,5% somente o MLBVV foi detectado e em 6,6% somente o LBVaV. Nas plantas assintomáticas coletadas em dezembro na região de Mogi das Cruzes, em áreas de alta incidência da doença durante o inverno, foi detectada a presença de MLBVV em 9 amostras e LBVaV em 7 amostras. Quatro dessas amostras apresentaram infecção mista, indicando que o desenvolvimento de sintomas depende de fatores abióticos, como temperatura. A inoculação via extrato vegetal a partir de plantas de alface com infecção mista pelo MLBVV e LBVaV foi realizada a 16°C/ 10°C (dia/noite e fotoperíodo de 11 horas, verificando-se que o MLBVV foi transmitido para Nicotiana tabacum TNN, N. rustica, N. occidentalis, Chenopodium quinoa e para as cultivares de alface Trocadero e White Boston, enquanto o LBVaV foi transmitido apenas para a alface White Boston. Entretanto, nenhuma destas plantas apresentou sintomas da doença, com exceção de C. quinoa que apresentou sintomas de lesões locais. Plantio em solo proveniente de áreas com histórico da doença de Mogi das Cruzes permitiu a transmissão do LBVaV para alface cv. White Boston e do MLBVV para alface cv. Trocadero e White Boston, embora apenas a cv. White Boston tenha apresentado sintomas da doença. Em conjunto, estes resultados demonstram a dificuldade de transmissão de ambos os vírus, mesmo em
Clinical relevance of sensitization to peanut and lupine
Peeters, K.A.B.M.
2007-01-01
This thesis demonstrates that the use of purified allergens and techniques such as NMR spectroscopy has the potential to improve current diagnostic capabilities. It also shows that lupine allergy is fairly common in The Netherlands. Characteristics of lupine allergy such as the eliciting dose and
Detection of beet necrotic yellow vein virus in Pakistan using bait ...
African Journals Online (AJOL)
The Northwestern plains of Pakistan are the major sugar beet producing region in the country, providing an important alternative to sugar cane for sugar production when sugar cane is absent in the fields. We surveyed this region for four consecutive years and found that Beet necrotic yellow vein virus (BNYVV) is prevalent ...
First Complete Genome Sequence of Pepper vein yellows virus from Australia
Maina, Solomon; Edwards, Owain R.
2016-01-01
We present here the first complete genomic RNA sequence of the polerovirus Pepper vein yellows virus (PeVYV) obtained from a pepper plant in Australia. We compare it with complete PeVYV genomes from Japan and China. The Australian genome was more closely related to the Japanese than the Chinese genome. PMID:27231375
Lupine Alleviate Hyperglycemia in Streptozotocin Diabetic gamma- Irradiated Rats
International Nuclear Information System (INIS)
El-Sayed, S.M.
2010-01-01
This study was to examine the regulatory effect of lupine on the diabetic profile developed in Streptozotocin (STZ) induced diabetic albino rats. The effectiveness of lupine against diabetes in gamma irradiated rats was purposed in the present study. Rats were received lupine seeds powder suspension (1 g/kg body weight for 14 consecutive days) before whole body exposure to 8 Gy of gamma radiation and /or STZ (55 mg/kg body weight, single dose) injection. The results pointed out that radiation exposure sustained the diabetic profile in rats received STZ comparing with STZ diabetic not irradiated rats. The prolonged administration of lupine suspension before STZ induction of diabetic and/or irradiated rats reduced the changes in the level of blood glucose, insulin concentration, liver glycogen, and the activity of glucose-6-phosphatase associated with significant amelioration in blood antioxidant status (superoxide dismutase, SOD; catalase, CAT; glucose-6-phosphate dehydrogenase, G-6-PD activities and reduced glutathione concentration GSH). Also, the level of blood lipid peroxides (TBARS) were reduced greatly when compared with its matched value in diabetic and /or gamma irradiated rats. It could be postulated that lupine powder suspension might be attenuate the diabetic profile development throughout reducing oxidative damages and modulating the antioxidant status. In addition, lupine could be considered as one of a remarkable radio protective agent owing to its antioxidants property
Rotational and nematicidal effect of lupine (Lupinus albus L ...
African Journals Online (AJOL)
Jane
2011-10-10
Oct 10, 2011 ... Key words: Lupine, lupine seed extract, nematodes, nematicidal effect. INTRODUCTION ... alternative in winter and dry land production systems where other ... effects on germination and seedling growth of lettuce. Yorgancilar ...
Maize-common bean/lupine intercrop productivity and profitability in ...
African Journals Online (AJOL)
Phaseolus vulgaris L.), narrow-leaf lupine (Lupinus angustifolius L.), and white lupine (Lupinus albus L.) with maize (Zea mays L.) were conducted under two intercrop planting arrangements (IPA), single row of legume in between maize rows and ...
Shrestha, Ankita; Khan, Ahamed; Mishra, Dipti Ranjan; Bhuyan, Kashyap; Sahoo, Bhabani; Maiti, Indu B; Dey, Nrisingha
2018-02-01
Caulimoviral promoters have become excellent tools for efficient transgene expression in plants. However, the transcriptional framework controlling their systematic regulation is poorly understood. To understand this regulatory mechanism, we extensively studied a novel caulimoviral promoter, PV8 (-163 to +138, 301 bp), isolated from Petunia vein-clearing virus (PVCV). PVCV was found to be Salicylic acid (SA)-inducible and 2.5-3.0 times stronger than the widely used CaMV35S promoter. In silico analysis of the PV8 sequence revealed a unique clustering of two stress-responsive cis-elements, namely, as-1 1 and W-box 1-2 , located within a span of 31 bp (-74 to -47) that bound to the TGA1a and WRKY71 plant transcription factors (TFs), respectively. We found that as-1 (TTACG) and W-box (TGAC) elements occupied both TGA1a and WRKY71 on the PV8 backbone. Mutational studies demonstrated that the combinatorial influence of as-1 (-57) and W-box 1-2 (-74 and -47) on the PV8 promoter sequence largely modulated its activity. TGA1a and WRKY71 physically interacted and cooperatively enhanced the transcriptional activity of the PV8 promoter. Biotic stress stimuli induced PV8 promoter activity by ~1.5 times. We also established the possible pathogen-elicitor function of AtWRKY71 and NtabWRKY71 TFs. Altogether, this study elucidates the interplay between TFs, biotic stress and caulimoviral promoter function. Copyright © 2018 Elsevier B.V. All rights reserved.
Verbeek, M.; Dullemans, A.M.; Bekkum, van P.J.; Vlugt, van der R.A.A.
2013-01-01
Lettuce big-vein associated virus (LBVaV, genus Varicosavirus) was shown to be responsible for characteristic necrotic symptoms observed in combination with big-vein symptoms in lettuce breeding lines when tested for their susceptibility to lettuce big-vein disease (BVD) using viruliferous Olpidium
Molecular cloning of lupin leghemoglobin cDNA
DEFF Research Database (Denmark)
Konieczny, A; Jensen, E O; Marcker, K A
1987-01-01
Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...
Yorgancilar, Mustafa; Bilgiçli, Nermin
2014-07-01
In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p sweet lupin bulgurs were found as 18.8% and 21.3%, respectively. Generally sweet lupin seeds/bulgurs showed rich essential amino acids composition than that of bitter seeds/bulgurs. Linoleic and linolenic acid content of the lupin was negatively affected by bulgur process. Bitter lupin bulgur received lower scores in terms of taste, odor and overall acceptability than sweet lupin bulgur in sensory evaluation. Sweet lupin bulgur can be used as new legume-based product with high nutritional and sensorial properties.
Shahid, Muhammad Shafiq; Ikegami, Masato; Waheed, Abdul; Briddon, Rob W; Natsuaki, Keiko T
2014-01-14
Samples were collected in 2011 from tomato plants exhibiting typical tomato leaf curl disease symptoms in the vicinity of Komae, Japan. PCR mediated amplification, cloning and sequencing of all begomovirus components from two plants from different fields showed the plants to be infected by Tomato yellow leaf curl virus (TYLCV) and Ageratum yellow vein virus (AYVV). Both viruses have previously been shown to be present in Japan, although this is the first identification of AYVV on mainland Japan; the virus previously having been shown to be present on the Okinawa Islands. The plant harboring AYVV was also shown to contain the betasatellite Tomato leaf curl Java betasatellite (ToLCJaB), a satellite not previously shown to be present in Japan. No betasatellite was associated with the TYLCV infected tomato plants analyzed here, consistent with earlier findings for this virus in Japan. Surprisingly both plants were also found to harbor an alphasatellite; no alphasatellites having previously been reported from Japan. The alphasatellite associated with both viruses was shown to be Sida yellow vein China alphasatellite which has previously only been identified in the Yunnan Province of China and Nepal. The results suggest that further begomoviruses, and their associated satellites, are being introduced to Japan. The significance of these findings is discussed.
Directory of Open Access Journals (Sweden)
Muhammad Shafiq Shahid
2014-01-01
Full Text Available Samples were collected in 2011 from tomato plants exhibiting typical tomato leaf curl disease symptoms in the vicinity of Komae, Japan. PCR mediated amplification, cloning and sequencing of all begomovirus components from two plants from different fields showed the plants to be infected by Tomato yellow leaf curl virus (TYLCV and Ageratum yellow vein virus (AYVV. Both viruses have previously been shown to be present in Japan, although this is the first identification of AYVV on mainland Japan; the virus previously having been shown to be present on the Okinawa Islands. The plant harboring AYVV was also shown to contain the betasatellite Tomato leaf curl Java betasatellite (ToLCJaB, a satellite not previously shown to be present in Japan. No betasatellite was associated with the TYLCV infected tomato plants analyzed here, consistent with earlier findings for this virus in Japan. Surprisingly both plants were also found to harbor an alphasatellite; no alphasatellites having previously been reported from Japan. The alphasatellite associated with both viruses was shown to be Sida yellow vein China alphasatellite which has previously only been identified in the Yunnan Province of China and Nepal. The results suggest that further begomoviruses, and their associated satellites, are being introduced to Japan. The significance of these findings is discussed.
Shahid, Muhammad Shafiq; Ikegami, Masato; Waheed, Abdul; Briddon, Rob W.; Natsuaki, Keiko T.
2014-01-01
Samples were collected in 2011 from tomato plants exhibiting typical tomato leaf curl disease symptoms in the vicinity of Komae, Japan. PCR mediated amplification, cloning and sequencing of all begomovirus components from two plants from different fields showed the plants to be infected by Tomato yellow leaf curl virus (TYLCV) and Ageratum yellow vein virus (AYVV). Both viruses have previously been shown to be present in Japan, although this is the first identification of AYVV on mainland Jap...
Congenital deformity in calves induced by the maternal consumption of lupin
Energy Technology Data Exchange (ETDEWEB)
Shupe, J.L.; Binns, W.; James, L.F.; Keeler, R.F.
1968-01-01
A congenital skeletal deformity called crooked calf syndrome occurs in many of the beef cattle-producing areas of the western United States. This deformity is characterized by arthrogryposis, torticollis, scoliosis, and cleft palate. The condition is non-hereditary, and is due to the consumption of lupin by the dam. The most severe and characteristic deformities are produced between the 40th and 70th days of gestation. Experimental analyses were performed to ascertain the teratogenic effect of lupin plants, lupin and lead, and lead alone upon cattle.
Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice.
Schutkowski, Alexandra; Hirche, Frank; Geissler, Stefanie; Radtke, Juliane; Stangl, Gabriele I
2015-03-01
Lupin proteins have repeatedly been shown to exhibit lipid lowering properties and reduce aortic calcification in atherosclerosis models. Despite many efforts on its identification, the component which is responsible for the observed effects is still under debate. Phytic acid which is generally associated with lupin protein isolates has currently been described as bioactive plant compound. The objective of the study was to determine the role of associated phytic acid for the described lupin protein effects. A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein ( p < 0.05). Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups ( p < 0.05). In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.
An evaluation of fababean ( Vicia faba ) and lupin ( Lupinus albus ...
African Journals Online (AJOL)
The experiment was carried out to compare fababean with lupin crop residues for summer grazing by young Merino wethers. The crude protein (CP) and dry matter (DM) degradability as well as chemical composition of fababean and lupin seed and stalks were also determined. Sheep which utilized both crop residues ...
Villarino, C B J; Jayasena, V; Coorey, R; Chakrabarti-Bell, S; Johnson, S K
2016-01-01
Lupin is an undervalued legume despite its high protein and dietary fiber content and potential health benefits. This review focuses on the nutritional value, health benefits, and technological effects of incorporating lupin flour into wheat-based bread. Results of clinical studies suggest that consuming lupin compared to wheat bread and other baked products reduce chronic disease risk markers; possibly due to increased protein and dietary fiber and bioactive compounds. However, lupin protein allergy has also been recorded. Bread quality has been improved when 10% lupin flour is substituted for refined wheat flour; possibly due to lupin-wheat protein cross-linking assisting bread volume and the high water-binding capacity (WBC) of lupin fiber delaying staling. Above 10% substitution appears to reduce bread quality due to lupin proteins low elasticity and the high WBC of its dietary fiber interrupting gluten network development. Gaps in understanding of the role of lupin flour in bread quality include the optimal formulation and processing conditions to maximize lupin incorporation, role of protein cross-linking, antistaling functionality, and bioactivity of its γ-conglutin protein.
Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice
Directory of Open Access Journals (Sweden)
Alexandra Schutkowski
2015-03-01
A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein (p < 0.05. Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups (p < 0.05. In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.
Nijs, de W.C.M.; Pereboom-de Fauw, D.P.K.H.; Dam, van R.C.J.; Rijk, de T.C.; Egmond, van H.P.; Mol, J.G.J.
2013-01-01
Phomopsins (PHO) are mycotoxins produced by the fungus Diaporthe toxica (also referred to as Phomopsis leptostromiformis). Lupin is the most important host crop for this fungus and PHO are suspected as cause of lupinosis, a deadly liver disease, in sheep. Lupin is currently in use to replace
Lupines, manganese, and devil-sickness: an Anglo-Saxon medical response to epilepsy.
Dendle, P
2001-01-01
The most frequently prescribed herb for "devil-sickness" in the vernacular medical books from Anglo-Saxon England, the lupine, is exceptionally high in manganese. Since manganese depletion has been linked with recurring seizures in both clinical and experimental studies, it is possible that lupine administration responded to the particular pathophysiology of epilepsy. Lupine is not prescribed for seizures in classical Mediterranean medical sources, implying that the Northern European peoples (if not the Anglo-Saxons themselves) discovered whatever anticonvulsive properties the herb may exhibit.
Lupin seed meal (Lupinus albus cv. Buttercup) as a source of ...
African Journals Online (AJOL)
(teen 'n 8%-insluitingspell) as gedeeltelike vervanger vir volvetsojabone, te evalueer. Die ... lupins, digestibility, N retention, growth, alkaloids, pigs. Introduction. Lupin-seed has been used extensively in pig diets ... meal, but at higher levels both growth rate and feed conversion efficiency were significantly depressed. Feed.
Directory of Open Access Journals (Sweden)
Angela Villamil-Garzón
2014-08-01
Full Text Available The Potato yellow vein virus (PYVV, a Crinivirus with an RNA tripartite genome, is the causal agent of the potato yellow vein disease, reported in Colombian since 1950, with yield reductions of up to 50%. Co-infection of two or more viruses is common in nature and can be associated with differences in virus accumulation and symptom expression. No evidence of mixed infection between PYVV and other viruses has been reported. In this study, eight plants showing yellowing PYVV symptoms: four Solanum tuberosum Group Phureja (P and four Group Andigena (A, were collected in Cundinamarca, Colombia to detect mixed infection in the isolates using next generation sequencing (NGS. The Potato virus Y (PVY complete genome (similar to N strain and the Potato virus V (PVV partial genomes were detected using NGS and re-confirmed by RT-PCR. Preliminary field screening in a large sample showed that PYVV and PVY co-infect potato plants with a prevalence of 21% within the P group and 23% within the A group. This is the first report of co-infection of PYVV and potyvirus in Colombia and with the use of NGS. Considering that potyviruses enhance symptom severity and/or yield reductions in mixed infections, our results may be relevant for disease diagnosis, breeding programs and tuber certification.
Introduction of novel legume crops in Serbia: White lupin (Lupinus albus
Directory of Open Access Journals (Sweden)
Mikić Aleksandar
2010-01-01
Full Text Available The renewed interest in introducing white lupin in Serbia is its high crude protein content in grain dry matter of nearly 400 g kg-1, which makes it a potential supplement for soybean meal in animal feeding. The only collection of white and other lupins in Serbia is maintained at Institute of Field and Vegetable Crops in Novi Sad, with about 200 accessions of 10 species, containing about 70 accessions of white lupin. The accessions with high tolerance to alkaline soil reaction of about pH=8 in a carbonated chernozem in Novi Sad regularly formed two orders of pods and grains and produced grain yields of more than 5 t ha-1, 45 t ha-1 of green forage and 8 t ha-1 of forage dry matter. The first Serbian white lupin breeding programme carried out at Institute of Field and Vegetable Crops in Novi Sad has resulted in developing cultivars Vesna and Panorama, registered in 2008. .
Navarro, Jose A; Botella, Francisco; Maruhenda, Antonio; Sastre, Pedro; Sánchez-Pina, M Amelia; Pallas, Vicente
2004-05-01
ABSTRACT Nonisotopic molecular dot blot hybridization technique and multiplex reverse transcription-polymerase chain reaction assay for the specific detection of Lettuce big-vein virus (LBVV) and Mirafiori lettuce virus (MiLV) in lettuce tissue were developed. Both procedures were suitable for the specific detection of both viruses in a range of naturally infected lettuce plants from various Spanish production areas and seven different cultivars. The study of the distribution of both viruses in the plant revealed that the highest concentration of LBVV and MiLV occurred in roots and old leaves, respectively. LBVV infection progress in a lettuce production area was faster than that observed for MiLV. In spite of different rates of virus infection progress, most lettuce plants became infected with both viruses about 100 days posttransplant. The appearance of both viruses in lettuce crops was preceded by a peak in the concentration of resting spores and zoosporangia of the fungus vector Olpidium brassicae in lettuce roots.
Citrus tristeza virus: An increasing trend in the virus occurrence and ...
African Journals Online (AJOL)
ABC
2015-07-29
Jul 29, 2015 ... Citrus tristeza clostervirus (CTV) is one of the most damaging fruit viruses playing havoc in citrus ... diseases of citrus trees reported in Pakistan are tristeza, .... bark. Vein clearing and stem pitting were also observed on sweet orange trees sour ..... disposal of source of inoculum by removing old citrus trees ...
Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.
Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru
2016-10-01
Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.
Awad, Rezik Azab; Salama, Wafaa Mohammed; Farahat, Azza Mahmoud
2014-01-01
Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artificial, extruded, synthetic and/or filled. Processed cheese can be formulated using different types of cheese with different degree of maturation, flavorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). Matured Ras cheese (3 months old) was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fine paste and kept frozen until used. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and firmness of products. Feeding rats a balanced diet containing processed cheese
A first glimpse of wild lupin karyotype variation as revealed by comparative cytogenetic mapping
Directory of Open Access Journals (Sweden)
Karolina Susek
2016-07-01
Full Text Available Insight into plant genomes at the cytomolecular level provides useful information about their karyotype structure, enabling inferences about taxonomic relationships and evolutionary origins. The Old World lupins demonstrate a high level of genomic diversification involving variation in chromosome numbers (2n=32-52, basic chromosome numbers (x=5-7, 9, 13 and in nuclear genome size (2C DNA=0.97-2.68 pg. Lupins comprise both crop and wild species and provide an intriguing system to study karyotype evolution.In order to investigate lupin chromosome structure, heterologous FISH was used. Sixteen BACs that had been generated as chromosome markers for the reference species, Lupinus angustifolius, were used to identify chromosomes in the wild species and explore karyotype variation. While all ‘single-locus’ in L. angustifolius, in the wild lupins these clones proved to be ‘single-locus’, ‘single-locus’ with additional signals, ‘repetitive’ or had no detectable BAC-FISH signal. The diverse distribution of the clones in the targeted genomes suggests a complex evolution history, which possibly involved multiple chromosomal changes such as fusions/fissions and repetitive sequence amplification. Twelve BACs were sequenced and we found numerous transposable elements including DNA transposons as well as LTR and non-LTR retrotransposons with varying quantity and composition among the different lupin species. However, at this preliminary stage, no correlation was observed between the pattern of BAC-FISH signals and the repeat content in particular BACs. Here, we describe the first BAC-based chromosome-specific markers for the wild species: L. cosentinii, L. cryptanthus, L. pilosus, L. micranthus and one New World lupin, L. multiflorus. These BACs could constitute the basis for an assignment of the chromosomal and genetic maps of other lupins, e.g. L. albus and L. luteus. Moreover, we identified karyotype variation that helps illustrate the
Cabello-Hurtado, Francisco; Keller, Jean; Ley, José; Sanchez-Lucas, Rosa; Jorrín-Novo, Jesús V; Aïnouche, Abdelkader
2016-06-30
Lupins have a variety of both traditional and modern uses. In the last decade, reports assessing the benefits of lupin seed proteins have proliferated and, nowadays, the pharmaceutical industry is interested in lupin proteins for human health. Modern genomics and proteomics have hugely contributed to describing the diversity of lupin storage genes and, above all, proteins. Most of these studies have been centered on few edible lupin species. However, Lupinus genus comprises hundreds of species spread throughout the Old and New Worlds, and these resources have been scarcely explored and exploited. We present here a detailed review of the literature on the potential of lupin seed proteins as nutraceuticals, and the use of -omic tools to analyze seed storage polypeptides in main edible lupins and their diversity at the Lupinus inter- and intra-species level. In this sense, proteomics, more than any other, has been a key approach. Proteomics has shown that lupin seed protein diversity, where post-translational modifications yield a large number of peptide variants with a potential concern in bioactivity, goes far beyond gene diversity. The future extended use of second and third generation proteomics should definitely help to go deeper into coverage and characterization of lupin seed proteome. Some important topics concerning storage proteins from lupin seeds are presented and analyzed in an integrated way in this review. Proteomic approaches have been essential in characterizing lupin seed protein diversity, which goes far beyond gene diversity since the protein level adds to the latter differential proteolytic cleavage of conglutin pro-proteins and a diverse array of glycosylation forms and sites. Proteomics has also proved helpful for screening and studying Lupinus germplasm with the future aim of exploiting and improving food production, quality, and nutritional values. Copyright © 2016 Elsevier B.V. All rights reserved.
Transcript and proteomic analysis of developing white lupin (Lupinus albus L. roots
Directory of Open Access Journals (Sweden)
Watson Bonnie
2009-01-01
Full Text Available Abstract Background White lupin (Lupinus albus L. roots efficiently take up and accumulate (heavy metals, adapt to phosphate deficiency by forming cluster roots, and secrete antimicrobial prenylated isoflavones during development. Genomic and proteomic approaches were applied to identify candidate genes and proteins involved in antimicrobial defense and (heavy metal uptake and translocation. Results A cDNA library was constructed from roots of white lupin seedlings. Eight thousand clones were randomly sequenced and assembled into 2,455 unigenes, which were annotated based on homologous matches in the NCBInr protein database. A reference map of developing white lupin root proteins was established through 2-D gel electrophoresis and peptide mass fingerprinting. High quality peptide mass spectra were obtained for 170 proteins. Microsomal membrane proteins were separated by 1-D gel electrophoresis and identified by LC-MS/MS. A total of 74 proteins were putatively identified by the peptide mass fingerprinting and the LC-MS/MS methods. Genomic and proteomic analyses identified candidate genes and proteins encoding metal binding and/or transport proteins, transcription factors, ABC transporters and phenylpropanoid biosynthetic enzymes. Conclusion The combined EST and protein datasets will facilitate the understanding of white lupin's response to biotic and abiotic stresses and its utility for phytoremediation. The root ESTs provided 82 perfect simple sequence repeat (SSR markers with potential utility in breeding white lupin for enhanced agronomic traits.
Lupin seed (Lupinus albus and Lupinus luteus) as a protein source for fermentation use
DEFF Research Database (Denmark)
Jul, L.B.; Flengmark, Poul Kristiansen; Gylling, M.
2003-01-01
and substances known to inhibit or activate fermentation processes. For three chosen varieties (Juno, Borsaja (yellow lupins) and Amiga (white lupin)) fermentation tests were performed each year in laboratory fermentors. Three different fermentation models were applied: production of amylase by Aspergillus...... led to yields similar to those of soybean meal as a protein source though there were minor differences between the model fermentations with regard to the best protein source. The conclusion of the fermentation tests is that dehulled and ground lupin seed is a suitable substitute for soybean meal...... oryzae and by Bacillus amyloliquefaciens, and production of protease by B. amyloliquefaciens. In all cases the fermentation yields were compared with the yields of similar fermentations carried out with soybean meal as the source of protein. The use of lupins as a protein source in fermentation trials...
Lupines, poison-hemlock and Nicotiana spp: toxicity and teratogenicity in livestock.
Panter, K E; James, L F; Gardner, D R
1999-02-01
Many species of lupines contain quinolizidine or piperidine alkaloids known to be toxic or teratogenic to livestock. Poison-hemlock (Conium maculatum) and Nicotiana spp. including N. tabacum and N. glauca contain toxic and teratogenic piperidine alkaloids. The toxic and teratogenic effects from these plant species have distinct similarities including maternal muscular weakness and ataxia and fetal contracture-type skeletal defects and cleft palate. It is believed that the mechanism of action of the piperidine and quinolizidine alkaloid-induced teratogenesis is the same; however, there are some differences in incidence, susceptible gestational periods, and severity between livestock species. Wildlife species have also been poisoned after eating poison-hemlock but no terata have been reported. The most widespread problem for livestock producers in recent times has been lupine-induced "crooked calf disease." Crooked calf disease is characterized as skeletal contracture-type malformations and occasional cleft palate in calves after maternal ingestion of lupines containing the quinolizidine alkaloid anagyrine during gestation days 40-100. Similar malformations have been induced in cattle and goats with lupines containing the piperidine alkaloids ammodendrine, N-methyl ammodendrine, and N-acetyl hystrine and in cattle, sheep, goats, and pigs with poison-hemlock containing predominantly coniine or gamma-coniceine and N. glauca containing anabasine. Toxic and teratogenic effects have been linked to structural aspects of these alkaloids, and the mechanism of action is believed to be associated with an alkaloid-induced inhibition of fetal movement during specific gestational periods. This review presents a historical perspective, description and distribution of lupines, poison-hemlock and Nicotiana spp., toxic and teratogenic effects and management information to reduce losses.
International Nuclear Information System (INIS)
Zabolotnyj, A.I.; Goncharova, N.V.; Domash, V.I.; Sheverdov, V.V.; Akadehmiya Navuk Belarusi, Minsk
1995-01-01
The 134 Cs, 137 Cs and chlorophyll content activity of photochemical reaction in chloroplasts and symbiotic nitrogen fixation in root modules, activity of neutral protease, BAPAse and trypsin inhibitors were investigated for seeds to yellow lupine (Lupines luteus L). The level of radioactive contamination induced a tendency to change the activity of photosynthetic reaction and nitrogen fixation, significant changes in a set of trypsin inhibitors were found in nature lupine seeds
Yorgancilar, Mustafa; Bilgiçli, Nermin
2012-01-01
In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p
Fischer, Kristin; Dieterich, Regine; Nelson, Matthew N; Kamphuis, Lars G; Singh, Karam B; Rotter, Björn; Krezdorn, Nicolas; Winter, Peter; Wehling, Peter; Ruge-Wehling, Brigitte
2015-10-01
A novel and highly effective source of anthracnose resistance in narrow-leafed lupin was identified. Resistance was shown to be governed by a single dominant locus. Molecular markers have been developed, which can be used for selecting resistant genotypes in lupin breeding. A screening for anthracnose resistance of a set of plant genetic resources of narrow-leafed lupin (Lupinus angustifolius L.) identified the breeding line Bo7212 as being highly resistant to anthracnose (Colletotrichum lupini). Segregation analysis indicated that the resistance of Bo7212 is inherited by a single dominant locus. The corresponding resistance gene was given the designation LanrBo. Previously published molecular anchor markers allowed us to locate LanrBo on linkage group NLL-11 of narrow-leafed lupin. Using information from RNAseq data obtained with inoculated resistant vs. susceptible lupin entries as well as EST-sequence information from the model genome Lotus japonicus, additional SNP and EST markers linked to LanrBo were derived. A bracket of two LanrBo-flanking markers allows for precise marker-assisted selection of the novel resistance gene in narrow-leafed lupin breeding programs.
Directory of Open Access Journals (Sweden)
David Zapletal
2017-01-01
Full Text Available The objective of our study was to assess the effect of replacing soybean meal with the meal from whole white lupin seeds (Lupinus albus of the Zulika variety in diets on selected haematological indicators in 40-day-old fattened hybrid mallard ducks. A total of 180 Cherry Valley ducks were divided into three groups (E1, E2, and control. The control group was fed a diet containing soybean meal. Soybean meal replaced with 50% and 100% meal of white lupin seeds were used in group E1 and group E2, respectively. At the end of the fattening, 12 ducks (6 males and 6 females were randomly selected from each group for a haematological examination. From the result of this study, it is clear that the effect of the diet was found only on the slightly varying number of white blood cells and on the proportion of monocytes. Ducks of group E2 showed a slight increase in the total number of leukocytes which was accompanied by a decrease in the percentage share of monocytes (P < 0.05. Based on the results, it can be claimed that the replacement of soybean meal with meal from the Zulika variety of whole white lupin seeds in the diet did not have a negative effect on the determined blood indicators. Therefore, whole white lupin seeds were successfully used as the important protein component of the diet for fattening hybrid mallard ducks.
Wiche, Oliver; Székely, Balazs; Moschner, Christin; Heilmeier, Hermann
2015-04-01
In recent studies root-soil interactions of white lupine (Lupinus albus L.) have drawn special attention to researchers due to its particularly high potential to increase bioavailability of phosphorous (P) and trace nutrients in soils. In mixed cultures, white lupine has the ability to mobilize P and trace nutrients in soil in excess of its own need and make this excess available for other intercropped companion species. While improved acquisition of P and improved yield parameters have mostly been documented in cereal-lupine intercrops, compared to sole crops, only a few recent studies have evidenced similar effects for trace elements e.g. Fe, Zn and Mn. In this preliminary study we tried to obtain more information about the mobilization of trace elements due to intercropping under field conditions. We hypothesize, that processes that lead to a better acquisition of trace nutrients might also affect other trace elements what could be useful for phytoremediation and phytomining research. Here we report the results of a semi-field experiment were we investigated the effects of an intercropping of white lupine with oat (Avena sativa L.) on the concentrations of trace metals in shoots of oat. We investigated the effects on 12 trace elements, including 4 elements with relevance for plant nutrition (P, Fe, Mn, Zn) and 8 trace elements, belonging to the group of metalloids, lanthanides and actinides with high relevance in phytoremediation (Cd, Pb Th, U) and phytomining research (Sc, La, Nd, Ge). The experiment was carried out on a semi-field lysimer at the off-site soil recycling and remediation center in Hirschfeld (Saxony, Germany). To test the intercropping-dependent mobilization of trace metals in soil and enhanced uptake of elements by oat, white lupine and oat were cultivated on 20 plots (4 m² each) in monocultures and mixed cultures and two different white lupin /oat-ratios (11% and 33%, respectively) applying various treatments. The geometrical arrangement of
Directory of Open Access Journals (Sweden)
Bożena Cwalina-Ambroziak
2012-12-01
Full Text Available The object of the experiment were seeds of two traditional cultivars of yellow lupin (Juno and Amulet cultivated in 1999 in two crop-rotation with 20% and 33% yellow lupine contribution. The quantitative and qualitative composition of the fungal community colonizing the seeds were determined in the laboratory conditions after 0.5-, 1.5- and 2.5-year of storage time. In total 1077 fungal colonies were isolated from the lupin seeds. Fungi representing the species of Penicillium - 29.3%, Alternaria alternata - 26.7% and Rhizopus nigricans - 12.7% were isolated most widely. Among the fungi pathogenic to lupin, the species of Colletotrichum gloeosporioides (16.3% isolates was dominant. The crop rotation with 20% lupin reduced the number of fungal colonies colonizing the seeds including the pathogens from the species of C. gloeosporioides. Seed disinfection decreased the total number of fungal colonies isolated from both cultivars. Higher number of C. gloeosporioides isolates was found in the combination with disinfected seeds. More fungal colonies were obtained from seeds of cv. Amulet than from those of cv. Juno. The storage duration had an effect on the population and the composition of species of fungi isolated from seeds of yellow lupine. With longer storage population of Penicillium spp. and Rhizopus spp. increased, whereas the population of C. gloeosporioides decreased.
Yao, Nasser; Martina, Kyalo; Dagne, Kifle; Wegary, Dagne; Tesfaye, Kassahun
2017-01-01
White lupin is one of the four economically important species of the Lupinus genus and is an important grain legume in the Ethiopian farming system. However, there has been limited research effort to characterize the Ethiopian white lupin landraces. Fifteen polymorphic simple sequence repeat (SSR) markers were used to assess the genetic diversity and population structure of 212 Ethiopian white lupin (Lupinus albus) landraces and two genotypes from different species (Lupinus angustifolius and Lupinus mutabilis) were used as out-group. The SSR markers revealed 108 different alleles, 98 of them from 212 landraces and 10 from out-group genotypes, with an average of 6.5 alleles per locus. The average gene diversity was 0.31. Twenty eight landraces harbored one or more private alleles from the total of 28 private alleles identified in the 212 white lupin accessions. Seventy-seven rare alleles with a frequency of less than 5% were identified and accounted for 78.6% of the total alleles detected. Analysis of molecular variance (AMOVA) showed that 92% of allelic diversity was attributed to individual accessions within populations while only 8% was distributed among populations. At 70% similarity level, the UPGMA dendrogram resulted in the formation of 13 clusters comprised of 2 to 136 landraces, with the out-group genotypes and five landraces remaining distinct and ungrouped. Population differentiation and genetic distance were relatively high between Gondar and Ethiopian white lupin populations collected by Australians. A model-based population structure analysis divided the white lupin landraces into two populations. All Ethiopian white lupin landrace populations, except most of the landraces collected by Australians (77%) and about 44% from Awi, were grouped together with significant admixtures. The study also suggested that 34 accessions, as core collections, were sufficient to retain 100% of SSR diversity. These accessions (core G-34) represent 16% of the whole 212
Directory of Open Access Journals (Sweden)
Janusz PRUSIŃSKI
2012-12-01
Full Text Available A strict two-factor field ‘Mister’ yellow lupin experiment was made in a split-plot design in poor rye complex soil (soil valuation class IVb at the Experiment Station of the Faculty of Agriculture and Biotechnology, the University of Technology and Life Sciences at Mochełek over 2008-2011. The experiment design covered 2 factors: growing yellow lupin after intercrops of ‘Bardena’ white mustard and ‘Pastar’ winter rye as well as seed inoculation with Bradyrhizobium lupini with or without genistein added. Growing intercrops in the poor rye complex soil considerably decreased neither the Nmin content in early spring nor the size of nodulation in yellow lupin. After lupin harvest, slightly more Nmin was noted for the treatments where intercrops were applied, especially rye in the 0-30 cm layer. The weather pattern, especially moisture conditions, pointed to a special sensitivity of nodulation to water deficit or excess in the rhizosphere. The method of preparing seeds for sowing did not play a greater role in developing the Nmin content in both soil profile layers analysed. White mustard showed a negative effect on the dry weight of nodules and the total N content in the plants and the seeds of yellow lupin as well as created the least favourable conditions for the survival and the capacity for symbiosis by symbiotic bacteria remaining in soil after lupin harvest. The state of yellow lupin plant nitrogen nutrition did not depend on the experimental factors.
Bartkiene, Elena; Krungleviciute, Vita; Juodeikiene, Grazina; Vidmantiene, Daiva; Maknickiene, Zita
2015-04-01
The ability of bacteriocin-like inhibitory substance (BLIS)-producing lactic acid bacteria (LAB) to degrade biogenic amines as well as to produce L(+) and D(-)-lactic acid during solid state fermentation (SSF) of lupin and soya bean was investigated. In addition, the protein digestibility and formation of organic acids during SSF of legume were investigated. Protein digestibility of fermented lupin and soya bean was found higher on average by 18.3% and 15.9%, respectively, compared to untreated samples. Tested LAB produced mainly L-lactic acid in soya bean and lupin (D/L ratio 0.38-0.42 and 0.35-0.54, respectively), while spontaneous fermentation gave almost equal amounts of both lactic acid isomers (D/L ratio 0.82-0.98 and 0.92, respectively). Tested LAB strains were able to degrade phenylethylamine, spermine and spermidine, whereas they were able to produce putrescine, histamine and tyramine. SSF improved lupin and soya bean protein digestibility. BLIS-producing LAB in lupin and soya bean medium produced a mixture of D- and L-lactic acid with a major excess of the latter isomer. Most toxic histamine and tyramine in fermented lupin and soya bean were found at levels lower those causing adverse health effects. Selection of biogenic amines non-producing bacteria is essential in the food industry to avoid the risk of amine formation. © 2014 Society of Chemical Industry.
Schopen, Kathrin; Ewald, Ann C; Johannes, Bernd W; Bloch, Wilhelm; Rittweger, Jörn; Frings-Meuthen, Petra
2017-01-01
Background: Whey protein is known to reduce postprandial glycaemia in people with type 2 diabetes mellitus. Lupin as a vegetable source of protein could be considered as an alternative, as the percentage of vegetarian and vegan consumers is raising. The present study compares the acute glycemic effects of whey and lupin in healthy volunteers following a carbohydrate-rich reference meal. Methods In cross-over design, three standardized meals (reference meal; reference meal + whey; reference meal + lupin) were provided to 12 healthy male and female volunteers, aged between 23 and 33, in a balanced, randomized order. Volunteers' blood glucose and insulin concentrations were analyzed at baseline and at seven time points following the ingestion of the meals. Results: The supplementation of whey or lupin significantly blunted the postprandial increase in blood glucose concentrations compared to the reference meal ( p AUC whey-lupin = 8%, 0-60 min area under the curve (0-60 min AUC), p = 0.937], with a blunting effect of -46% by whey ( p = 0.005, 0-60 min AUC) and of -54% by lupin ( p AUC). When comparing whey and lupin data only, the insulin increase was found to be more pronounced for whey protein than for lupin supplementation (Δ AUC whey-lupin = 39%, 0-60 min AUC, p = 0.022). However, when comparing the insulin response of each supplementation to the one of the reference meal, no differences could be detected (whey p = 0.259, 0-60 min AUC; lupin p = 0.275, 0-60 min AUC). Conclusions: Results suggest that lupin and whey can both lower the increase of postprandial blood glucose concentrations to a comparable extent, implying the usability of lupin to reduce postprandial glycaemia. However, the insulin response following the supplementations to a carbohydrate-rich meal seems to differ for these two protein sources.
Kaczmarska, Kornelia T; Chandra-Hioe, Maria V; Zabaras, Dimitrios; Frank, Damian; Arcot, Jayashree
2017-11-22
This study investigated the effect of germination and fermentation on the composition of carbohydrates in Australian sweet lupin. Specifically, the amount of sugars (sucrose, fructose, and glucose), starch, oligosaccharides (verbascose, stachyose, and raffinose), and dietary fiber were measured in germinated lupin seeds and fermented lupin flour, and compared with those in soy. High performance liquid chromatography coupled with refractive index was employed for quantitation of sugars, starch, and oligosaccharides, and gas chromatography coupled with a flame ionization detector was used for quantitation of simple sugars in total, and soluble, and insoluble dietary fiber. The enzyme activities of α-amylase and α-glucosidase were compared before and after germination or fermentation. The α-amylase activity in germinated lupin increased to ∼17 nmol/mL/min/0.1 g and in germinated soy∼32; in fermented lupin, the activity increased to ∼52, while in fermented soy it decreased to ∼20. In general, germination or fermentation decreased the oligosaccharide content, and increased the total sugar in samples (p Fermentation with yogurt culture lowered the content of total oligosaccharides due to 94% decrease in stachyose. Total oligosaccharides in soy flour prior to fermentation were 180 mg/g and significantly decreased to ∼124 mg/g in fermented soy. Germination did not affect the starch content. There was no significant change in the amounts of total, soluble, and insoluble dietary fiber after germination or fermentation of lupin except for galactose, which was significantly reduced in germinated lupin seeds. Soluble dietary fiber in germinated soy significantly increased. Germination and fermentation are simple and effective techniques to reduce the oligosaccharides while maintaining the composition of dietary fibers.
Stepkowski, Tomasz; Moulin, Lionel; Krzyzańska, Agnieszka; McInnes, Alison; Law, Ian J; Howieson, John
2005-11-01
We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella.
Afouda, Leonard; Kone, Daouda; Zinsou, Valerien; Dossou, Laurence; Kenyon, Lawrence; Winter, Stephan; Knierim, Dennis
2017-06-01
Surveys were conducted in 2014 and 2015 in Southern and Northern Benin, respectively, to identify the viruses infecting peppers (Capsicum spp.). The samples were screened by ELISA for cucumber mosaic virus (CMV), pepper veinal mottle virus (PVMV), potato virus Y (PVY) and tomato yellow leaf curl virus (TYLCV). A generic reverse transcription PCR (RT-PCR) was used to test for the presence of poleroviruses. ELISA tests confirmed the prevalence of all viruses, while the RT-PCR detected pepper vein yellows virus (PeVYV) which is reported for the first time in Benin. A further, divergent polerovirus isolate was detected from a single pepper sample originating from southern Benin. Screening of samples collected from solanaceous plants during virus surveys in Mali (conducted in 2009) also detected this divergent polerovirus isolate in two samples from African eggplants. The complete genome sequence was obtained from the Mali isolate using transcriptome sequencing and by conventional Sanger sequencing of overlapping RT-PCR products. Based on the sequence characteristics of this isolate we propose a new polerovirus species, African eggplant yellowing virus (AeYV).
Covy D. Jones; Mikel R. Stevens; Von D. Jolley; Bryan G. Hopkins; Scott L. Jensen; Dave Turner; Jason M. Stettler
2016-01-01
Seeds of most Great Basin lupine (Lupinus spp. [Fabaceae]) species are physically dormant and thus, difficult to establish in uniform stands in seed production fields. We designed this study to examine 5 seed scarification techniques, each with 11 levels of application (including a non-scarified control), to reduce the physical seed dormancy of longspur lupine...
The role of acid anion on the inhibition of the acidic corrosion of steel by lupine extract
Energy Technology Data Exchange (ETDEWEB)
Abdel-Gaber, A.M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)], E-mail: ashrafmoustafa@yahoo.com; Abd-El-Nabey, B.A.; Saadawy, M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)
2009-05-15
The inhibitive effect of lupine (Lupinous albus L.) extract on the corrosion of steel in aqueous solution of 1 M sulphuric and 2 M hydrochloric acids was investigated by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques. Potentiodynamic polarization curves indicated that the lupine extract acts as a mixed-type inhibitor. EIS measurements showed that the dissolution process is under activation control. The inhibition efficiency of the extract obtained from impedance and polarization measurements was in a good agreement and was found to increase with increasing concentration of the extract. The obtained results showed that, the lupine extract could serve as an effective inhibitor for the corrosion of steel in acid media and the extract was more effective in case of hydrochloric acid. Theoretical fitting of the corrosion data to the kinetic-thermodynamic model was tested to show the nature of adsorption.
Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin
Energy Technology Data Exchange (ETDEWEB)
Paananen, M.; Ruskeeniemi, T
2003-07-01
The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)
Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin
International Nuclear Information System (INIS)
Paananen, M.; Ruskeeniemi, T.
2003-01-01
The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)
Directory of Open Access Journals (Sweden)
Jiaorong Meng
Full Text Available Mulberry vein banding associated virus (MVBaV that infects mulberry plants with typical vein banding symptoms had been identified as a tentative species of the genus Tospovirus based on the homology of N gene sequence to those of tospoviruses. In this study, the complete sequence of the tripartite RNA genome of MVBaV was determined and analyzed. The L RNA has 8905 nucleotides (nt and encodes the putative RNA-dependent RNA polymerase (RdRp of 2877 aa amino acids (aa in the viral complementary (vc strand. The RdRp of MVBaV shares the highest aa sequence identity (85.9% with that of Watermelon silver mottle virus (WSMoV, and contains conserved motifs shared with those of the species of the genus Tospovirus. The M RNA contains 4731 nt and codes in ambisense arrangement for the NSm protein of 309 aa in the sense strand and the Gn/Gc glycoprotein precursor (GP of 1,124 aa in the vc strand. The NSm and GP of MVBaV share the highest aa sequence identities with those of Capsicum chlorosis virus (CaCV and Groundnut bud necrosis virus (GBNV (83.2% and 84.3%, respectively. The S RNA is 3294 nt in length and contains two open reading frames (ORFs in an ambisense coding strategy, encoding a 439-aa non-structural protein (NSs and the 277-aa nucleocapsid protein (N, respectively. The NSs and N also share the highest aa sequence identity (71.1% and 74.4%, respectively with those of CaCV. Phylogenetic analysis of the RdRp, NSm, GP, NSs, and N proteins showed that MVBaV is most closely related to CaCV and GBNV and that these proteins cluster with those of the WSMoV serogroup, and that MVBaV seems to be a species bridging the two subgroups within the WSMoV serogroup of tospoviruses in evolutionary aspect, suggesting that MVBaV represents a distinct tospovirus. Analysis of S RNA sequence uncovered the highly conserved 5'-/3'-ends and the coding regions, and the variable region of IGR with divergent patterns among MVBaV isolates.
Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.
Sasaya, T; Ishikawa, K; Koganezawa, H
2001-06-01
A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.
Sirtori, Cesare R; Triolo, Michela; Bosisio, Raffaella; Bondioli, Alighiero; Calabresi, Laura; De Vergori, Viviana; Gomaraschi, Monica; Mombelli, Giuliana; Pazzucconi, Franco; Zacherl, Christian; Arnoldi, Anna
2012-04-01
The present study was aimed to evaluate the effect of plant proteins (lupin protein or pea protein) and their combinations with soluble fibres (oat fibre or apple pectin) on plasma total and LDL-cholesterol levels. A randomised, double-blind, parallel group design was followed: after a 4-week run-in period, participants were randomised into seven treatment groups, each consisting of twenty-five participants. Each group consumed two bars containing specific protein/fibre combinations: the reference group consumed casein+cellulose; the second and third groups consumed bars containing lupin or pea proteins+cellulose; the fourth and fifth groups consumed bars containing casein and oat fibre or apple pectin; the sixth group and seventh group received bars containing combinations of pea protein and oat fibre or apple pectin, respectively. Bars containing lupin protein+cellulose ( - 116 mg/l, - 4·2%), casein+apple pectin ( - 152 mg/l, - 5·3%), pea protein+oat fibre ( - 135 mg/l, - 4·7%) or pea protein+apple pectin ( - 168 mg/l, - 6·4%) resulted in significant reductions of total cholesterol levels (Ppea protein+cellulose. The present study shows the hypocholesterolaemic activity and potential clinical benefits of consuming lupin protein or combinations of pea protein and a soluble fibre, such as oat fibre or apple pectin.
Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John
2005-01-01
We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella. PMID:16269740
Directory of Open Access Journals (Sweden)
Böhm, Herwart
2016-02-01
Full Text Available Within the framework of a joint research project for breeding advancement of blue and yellow lupins, which is being conducted in cooperation with the Julius Kühn-Institute, Institute for Breeding Research on Agricultural Crops (coordinator, Saatzucht Steinach and the IPK Gatersleben, in a sub-project at the Thünen-Institute of Organic Farming 1. a test system for detection and assessment of weed-suppressing effect of blue lupins will be developed, and 2. this test system will be tested to pre-breeding lines of blue lupin. In the first year of the project, plot trials were conducted in 3-fold field repetition with two phenological widely differing varieties (cv. Boruta [terminated type], cv. Boregine [branched type] in combination with selected partners with four different seed rates. As partners, monocotyledonous species (e.g., cereals and dicotyledonous species (false flax or resp., a mixture of oil seed rape, phacelia and buckwheat, are used. Twice during the growing season and at harvest, the aboveground biomass, separated by lupin, partners and weeds, were recorded. The results of the first project year show that all the partner plants which should serve as artificial weeds were successfully established. False flax leads to the strongest effect on the development of lupins, which showed the lowest biomass production in these variants. In comparison to the sown partners, the false flax variants also showed the highest biomass production, while the lowest biomass production was recorded for the natural weeds occurring at the site. The species mixture of oil seed rape, phacelia and buckwheat, however, led to the lowest biomass production; contemporaneously the biomass production of lupins in these variants was only affected slightly. Comparing the two cultivated lupin varieties, Boruta showed a better weed suppressive effect.
Microencapsulation by spray drying of nitrogen-fixing bacteria associated with lupin nodules.
Campos, Daniela C; Acevedo, Francisca; Morales, Eduardo; Aravena, Javiera; Amiard, Véronique; Jorquera, Milko A; Inostroza, Nitza G; Rubilar, Mónica
2014-09-01
Plant growth promoting bacteria and nitrogen-fixing bacteria (NFB) used for crop inoculation have important biotechnological potential as a sustainable fertilization tool. However, the main limitation of this technology is the low inoculum survival rate under field conditions. Microencapsulation of bacterial cells in polymer matrices provides a controlled release and greater protection against environmental conditions. In this context, the aim of this study was to isolate and characterize putative NFB associated with lupin nodules and to evaluate their microencapsulation by spray drying. For this purpose, 21 putative NFB were isolated from lupin nodules and characterized (16S rRNA genes). Microencapsulation of bacterial cells by spray drying was studied using a mixture of sodium alginate:maltodextrin at different ratios (0:15, 1:14, 2:13) and concentrations (15 and 30% solids) as the wall material. The microcapsules were observed under scanning electron microscopy to verify their suitable morphology. Results showed the association between lupin nodules of diverse known NFB and nodule-forming bacteria belonging to Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Bacteroidetes. In microencapsulation assays, the 1:14 ratio of sodium alginate:maltodextrin (15% solids) showed the highest cell survival rate (79%), with a microcapsule yield of 27% and spherical microcapsules of 5-50 µm in diameter. In conclusion, diverse putative NFB genera and nodule-forming bacteria are associated with the nodules of lupine plants grown in soils in southern Chile, and their microencapsulation by spray drying using sodium alginate:maltodextrin represents a scalable process to generate a biofertilizer as an alternative to traditional nitrogen fertilization.
Falconi, C.; Visser, R.G.F.; Heusden, van A.W.
2013-01-01
Anthracnose is a serious problem of both Andean lupine and tamarillo in Ecuador. Morphological features, internal transcribed spacer (ITS) sequences, and host specificity were used to characterize Colletotrichum isolates from lupine and tamarillo. Based on phenotypic and molecular characterization,
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Ileal digestibility of sunfl ower meal, pea, rapeseed cake, and lupine in pigs
DEFF Research Database (Denmark)
Nørgaard, Jan Værum; Fernández, José Adalberto; Jørgensen, Henry
2012-01-01
.05) for soybean meal and pea compared to sunfl ower meal, rapeseed cake, and lupine. The SID of Lys and His were lowest (P pea to be a high-digestible protein source relative to sunfl ower......The standardized ileal digestibility (SID) of CP and AA was evaluated in soybean (Glycine max) meal, sunfl ower (Helianthus annuus) meal, rapeseed cake, and fi eld pea (Pisum sativum) using 10 pigs and in lupine (Lupinus angustifolius) using 7 pigs. Pigs were fi tted with either a T...
Yang, Caixia; Han, Tong; Fu, Jingjing; Liao, Yiming; Chen, Sha
2018-02-01
In August 2016, a yellow vein disease was observed on leaves of Euonymus bungeanus Maxim (Euonymus, Celastraceae) in Liaoning, China. Virions measuring 750 × 13 nm were observed in a sample from the diseased plant. A potexvirus was detected in the sample by small-RNA deep sequencing analysis and recovered by traditional cloning. The genome of this potexvirus consists of 7,279 nucleotides, excluding the poly(A) tail at the 3' end, and contains five open reading frames (ORFs). Based on the nucleotide and amino acid sequences of the coat protein gene, the virus shared the highest sequence similarity with white clover mosaic virus (WCMV, X16636) (40.1%) and clover yellow mosaic virus (ClYMV, D00485) (37.1%). Phylogenetic analysis showed that the virus clustered with potexviruses and is most closely related to strawberry mild yellow edge virus. These results indicate that this virus is a distinct member of the genus Potexvirus, for which the name euonymus yellow vein associated virus (EuYVAV) is proposed. To our knowledge, this is the first report of a potexvirus on E. bungeanus.
Leone, G.; Lindner, J.L.; Jongedijk, G.; Meer, van der F.
1995-01-01
The successful back-transmission of the mechanically transmissible virus associated with apple stem pitting and pear vein yellows, from Nicotiana occidentalis to apple seedlings "Golden Delicious" under greenhouse conditions is reported. This result enabled a field experiment where isolates of apple
Preparation of functional lupine protein fractions by dry separation
Pelgrom, P.J.M.; Berghout, J.A.M.; Goot, van der A.J.; Boom, R.M.; Schutyser, M.A.I.
2014-01-01
Lupine protein concentrate is a promising ingredient that can be obtained by a combination of milling and air classification, generally called dry fractionation. This is a more sustainable route than conventional wet extraction and delivers a protein concentrate with native functional properties.
Directory of Open Access Journals (Sweden)
Young Ho Park
2012-10-01
Full Text Available On the basis of the increased emphasis placed on the protection of privacy, biometric recognition systems using physical or behavioural characteristics such as fingerprints, facial characteristics, iris and finger-vein patterns or the voice have been introduced in applications including door access control, personal certification, Internet banking and ATM machines. Among these, finger-vein recognition is advantageous in that it involves the use of inexpensive and small devices that are difficult to counterfeit. In general, finger-vein recognition systems capture images by using near infrared (NIR illumination in conjunction with a camera. However, such systems can face operational difficulties, since the scattering of light from the skin can make capturing a clear image difficult. To solve this problem, we proposed new image quality enhancement method that measures the direction and thickness of vein lines. This effort represents novel research in four respects. First, since vein lines are detected in input images based on eight directional profiles of a grey image instead of binarized images, the detection error owing to the non-uniform illumination of the finger area can be reduced. Second, our method adaptively determines a Gabor filter for the optimal direction and width on the basis of the estimated direction and thickness of a detected vein line. Third, by applying this optimized Gabor filter, a clear vein image can be obtained. Finally, the further processing of the morphological operation is applied in the Gabor filtered image and the resulting image is combined with the original one, through which finger-vein image of a higher quality is obtained. Experimental results from application of our proposed image enhancement method show that the equal error rate (EER of finger-vein recognition decreases to approximately 0.4% in the case of a local binary pattern-based recognition and to approximately 0.3% in the case of a wavelet transform
Wiche, Oliver; Székely, Balazs; Kummer, Nicolai-Alexeji; Moschner, Christin; Heilmeier, Hermann
2016-09-01
This study aims to investigate how intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) affects the mobile fractions of trace metals (Fe, Mn, Pb, Cd, Th, U, Sc, La, Nd, Ge) in soil solution. Oat and white lupin were cultivated in monocultures and mixed cultures with differing oat/white lupin ratios (11% and 33% lupin, respectively). Temporal variation of soil solution chemistry was compared with the mobilization of elements in the rhizosphere of white lupin and concentrations in plant tissues. Relative to the monocrops, intercropping of oat with 11% white lupin significantly increased the concentrations of Fe, Pb, Th, La and Nd in soil solution as well as the concentrations of Fe, Pb, Th, Sc, La and Nd in tissues of oat. Enhanced mobility of the mentioned elements corresponded to a depletion of elements in the rhizosphere soil of white lupin. In mixed cultures with 33% lupin, concentrations in soil solution only slightly increased. We conclude that intercropping with 11% white lupin might be a promising tool for phytoremediation and phytomining research enhancing mobility of essential trace metals as well as elements with relevance for phytoremediation (Pb, Th) and phytomining (La, Nd, Sc) in soil.
Directory of Open Access Journals (Sweden)
Sopková D.
2016-03-01
Full Text Available Vehicle transportation represents acute stress to animals with release of catecholamines and glucocorticoids from the adrenal gland resulting in impaired metabolic state. Such changes in metabolism may be reduced by the application of suitable feed supplement. The aim of this study was to test the effects of lupin supplementation applied after 1-hour transportation. Ewes in the control group (n = 7 were fed on trefoil-grass silage and hay, while the diet of the experimental group (n = 7 was supplemented with lupin groats (Lupinus angustifolius, var. SONET; 500 g per head per day for 8 days. In both groups, blood was collected on the day of transportation and on Days 6 and 11 thereafter. Total blood parameters were assayed using spectrophotometry and fractions of protein, cholesterol, and lactate dehydrogenase using agarose electrophoresis. Lupin increased the albumin: globulin (ALB : GLB ratio and beta-hydroxybutyrate (BHB concentration and reduced serum cholesterol and lactate, however it had no effect on body weight, body condition score (BCS, plasma glucose, serum protein, high-density lipoprotein (HDL, low-density lipoprotein (LDL, and very low-density lipoprotein (VLDL cholesterol, lactate dehydrogenase (LDH or alkaline phosphatise (ALP. Lupin may therefore be used as suitable feed supplement for sheep at times of high nutrient requirement.
Directory of Open Access Journals (Sweden)
R. Tocci
2010-04-01
Full Text Available One of the main principles of organic husbandry is that animal feed must be GMO free, and soya bean is well-known as a high risk GMO alimentary source. About 25 dry dairy cattle of the Italian Holstein breed, from the Cooperativa Emilio Sereni of Borgo S. Lorenzo (FI, were fed in two successive diets: the first with extruded soya bean (A, and the second in which bitter lupin, faba bean and proteinic pea substituted the soya bean (B. We evaluated both the consumption and the apparent digestibility (using acid insoluble ash as internal marker of the two diets, repeating the trial twice. The presence of bitter lupin did not influence either the consumption of other feed, or the faecal water content. The apparent digestibility of the organic matter resulted satisfactory in both the diets, but was significantly higher in diet (A than in diet (B (71,6% vs 67,3%. In conclusion, even though we wish the cultivation of sweet lupin would be increase in Italy, we retain that also bitter lupin (mixed with other feed to increase the palatability could be used as alternative protein source in dairy cattle diets.
An evaluation of fababean (Vicia faba) and lupin (Lupinus albus ...
African Journals Online (AJOL)
Sheep which utilized both crop residues gained in live mass ... live masses than sheep which grazed lupin crop residues at the fourth week .... model of 0rskov & McDonald (1979): p .... Production Laboratory are thanked for chemical analyses.
Paul, H.
1993-01-01
Beet necrotic yellow vein virus (BNYVV) causes rhizomania in sugar beet. The virus is transmitted by the soil-borne fungus Polymyxa betae . Rhizomania in sugar beet can cause serious losses in sugar yield. Breeding for resistance is the most promising way to control the
Sardjono; Zhu, Y.; Knol, W.
1998-01-01
To explore the possibilities of using lupine as a soybean replacement in fermented foods, fermentation profiles of lupine and soybean by Aspergillus oryzae and A. sojae, respectively, in a solid-state culture were compared. Biomass, spore concentration, oxygen consumption rate, carbon dioxide
Directory of Open Access Journals (Sweden)
Jolanta Legocka
2017-09-01
Full Text Available The levels of polyamines (PAs, proline (Pro, and γ-aminobutyric acid (GABA as well as the activity of diamine oxidase (DAO; EC 1.4.3.6 were studied in the roots of 2-day-old lupine (Lupinus luteus L. ‘Juno’ seedlings treated with 200 mM NaCl for 24 h. The effect of adding 1 mM aminoguanidine (AG, an inhibitor of DAO activity, was also analyzed. It was found that in roots of lupine seedlings growing under salt stress, a negative correlation between Pro accumulation and putrescine (Put content takes place. Pro level increased in roots by about 160% and, at the same time, Put content decreased by about 60%, as a result of ca. twofold increase of DAO activity. The AG added to the seedlings almost totally inhibited the activity of DAO, increased Put accumulation to control level, decreased Pro content by about 25%, and reduced GABA level by about 22%. Addition of 50 mM GABA to the lupine seedlings growing in the presence of AG and NaCl restored Pro content in roots to its level in NaCl-treated plants. In this research, the clear correlation between Put degradation and GABA and Pro accumulation was shown for the first time in the roots of seedlings growing under salt stress. This could be considered as a short-term response of a plant to high salt concentration. Our findings indicate that during intensive Pro accumulation in roots induced by salt stress, the pool of this amino acid is indirectly supported by GABA production as a result of Put degradation.
DEFF Research Database (Denmark)
Mogensen, Lisbeth; Lund, Peter; Kristensen, Troels
2008-01-01
. The supplement under investigation was: lupins in experiment 1, barley in experiment 2 and soybeans in experiment 3. The same forage mixture of grass-clover silage (84% of DM), grass pellets (11% of DM) and straw (5% of DM) was fed ad libitum in all the experiments. Toasting decreased effective rumen protein...... degradability determined in situ for all three supplements. Compared to untreated lupins toasting of lupins tended (P = 0.10) to increase milk yield, whereas toasting of soybeans did not affect milk yield. Toasting of lupins decreased (P = 0.03) milk protein content (32.2 versus 32.7 g/kg), whereas toasting...... of soybeans did not affect milk protein content. ECM yield was significantly higher (P = 0.002) for cows fed toasted soybeans than for cows fed untreated soybeans (28.1 versus 26.4 kg ECM) whereas there was no significant effect on ECM yield from toasting lupins or barley. It can be concluded...
Directory of Open Access Journals (Sweden)
Pavel Suchý
2010-01-01
Full Text Available The main objective of this experimental study was to determine how diets containing lupin meal affect the performance indicators, carcass value, and chemical composition of breast and thigh muscles in broiler chickens. The diets tested in experimental groups E1 and E2 differed as follows: in group E1, one third of nitrogen-containing substances (NSs from extracted soybean meal was replaced with NSs from lupin meal; in group E2, two thirds were replaced compared to the control group. The replacement of soybean meal with lupin meal in experimental diets failed to produce any significant effect on the average live weight of chickens on Day 42 of the fattening period compared to the control group. The replacement of soybean meal with lupin meal resulted in decreased average weight of carcass and breast muscles and in decreased yield of breast muscles. Differences between the control group (C and group E2 were significant (P ⪬ 0.01. Chickens in group E2 also showed a significant increase (P ⪬ 0.01 in the yield of the heart and stomach compared to the control group. The differences in weight and yield of thigh muscles between the control group and the experimental groups (E1 and E2 were not significantly affected. As far as chemical composition is concerned, chickens receiving the lupin-containing feed showed a significant (P ⪬ 0.01 increase in the ash content in breast muscles. On the contrary, in thigh muscles in group E2, the ash content decreased significantly (P ⪬ 0.01. The content of calcium showed an increasing trend in both breast and thigh muscles in both experimental groups. In contrast, the content of magnesium in chicken muscles in both experimental groups decreased. These differences were significant (P ⪬ 0.01 only in thigh muscles. Our results show that lupin seed is a suitable substitute for NSs contained in soybean extracted meal. It is considered optimal to replace up to one third of NSs contained in
Directory of Open Access Journals (Sweden)
Ana Carolina Firmino
2009-12-01
Full Text Available The Tomato yellow vein streak virus (ToYVSV is a putative species of begomovirus, which was prevalent on tomato crops in São Paulo State, Brazil, until 2005. The objectives of this study were to evaluate the interaction between ToYVSV and its vector Bemisia tabaci biotype B and to identify alternative hosts for the virus. The minimum acquisition and inoculation access periods of ToYVSV by B. tabaci were 30 min and 10 min, respectively. Seventy five percent of tomato-test plants were infected when the acquisition and inoculation access periods were 24 h. The latent period of the virus in the insect was 16 h. The ToYVSV was retained by B. tabaci until 20 days after acquisition. First generation of adult whiteflies obtained from viruliferous females were virus free as shown by PCR analysis and did not transmit the virus to tomato plants. Out of 34 species of test-plants inoculated with ToYVSV only Capsicum annuum, Chenopodium amaranticolor, C. quinoa, Datura stramonium, Gomphrena globosa, Nicotiana clevelandii and N. tabacum cv. TNN were susceptible to infection. B. tabaci biotype B was able to acquire the virus from all these susceptible species, transmitting it to tomato plants.O Tomato yellow vein streak virus (ToYVSV é uma espécie putativa de begomovirus que infecta o tomateiro (Solanum lycopersicon em diversas regiões do Brasil onde se cultiva essa solanácea, sendo a espécie prevalente no estado de São Paulo até 2005. Estudou-se a interação do ToYVSV com a Bemisia tabaci biótipo B e identificaram-se hospedeiras alternativas deste vírus. Os períodos de acesso mínimo de aquisição (PAA e de inoculação (PAI foram de 30 min e 10 min, respectivamente. A porcentagem de plantas infectadas chegou até cerca de 75% após um PAA e PAI de 24 h. O período de latência do vírus no vetor foi de 16 horas. O ToYVSV foi retido pela B. tabaci até 20 dias após a aquisição do vírus. Não foi detectada transmissão do vírus para prog
Yeheyis, Likawent; Kijora, Claudia; Wink, Michael; Peters, Kurt J
2011-01-01
The effect of a traditional Ethiopian lupin processing method on the chemical composition of lupin seed samples was studied. Two sampling districts, namely Mecha and Sekela, representing the mid- and high-altitude areas of north-western Ethiopia, respectively, were randomly selected. Different types of traditionally processed and marketed lupin seed samples (raw, roasted, and finished) were collected in six replications from each district. Raw samples are unprocessed, and roasted samples are roasted using firewood. Finished samples are those ready for human consumption as snack. Thousand seed weight for raw and roasted samples within a study district was similar (P > 0.05), but it was lower (P seed sample from Mecha was lower (P 0.05). The crude protein and crude fat contents of finished samples within a study district were higher (P seed samples. The crude ash content of raw and roasted lupin samples within a study district was higher (P processing method of lupin seeds in Ethiopia has a positive contribution improving the crude protein and crude fat content, and lowering the alkaloid content of the finished product. The study showed the possibility of adopting the traditional processing method to process bitter white lupin for the use as protein supplement in livestock feed in Ethiopia, but further work has to be done on the processing method and animal evaluation.
Directory of Open Access Journals (Sweden)
R Juodka
Full Text Available ABSTRACT A study was carried out to determine the effects of soybean meal replacement with different amounts of blue lupine in the diets of turkeys on the growth rate, anatomic carcass dissection data, chemical indicators of breast and thigh muscles and the content of tryptophan and oxyprolin. In total three hundred and sixty cross BIG-6 turkeys were allotted to two control and ten experimental groups of 30 one-day-old turkeys. The control group of turkeys was fed the diet containing soybean meal, whereas the trial groups were offered different amounts (from 20 to 30% of lupines. Group 4 and 5 were additionally given probiotic mixture Bio Plus 2B and allzyme SSF, respectively. Soybean oil replacement from 20 to 30% lupine in the diet had no influence on the growth rate, dressing percentage, edible parts and abdominal fat content of turkeys. The study indicated that lupines in the diet of turkeys had a different effect on the meat quality of different genders. Lupines did not have any negative effect on the meat quality of female turkeys and 30% lupines even improved the protein value index of breast muscles. However, 20-30 and 25-30% lupines in male turkey diets lowered dry matter and protein contents in breast muscles but had no negative influence on the main quality indicators in thigh muscles. The results of the study showed that the negative effect on the male breast muscle quality might be avoided using Bio Plus 2B or allzyme SSF additives in the male diets containing 30% lupines.
Gd-DTPA-enhanced MR venography for varicose veins of the calf
International Nuclear Information System (INIS)
Kohata, Yoshiko; Naito, Akira; Ito, Katuhide.
1995-01-01
2D time-of-flight MR venography (2D TOF MRV) was performed in 16 patients (25 calves) with varicose veins and 2 volunteers (4 calves), and compared with venography. Sequential SPGR (TR/TE/FA=45 ms/7 ms/60deg) transverse images and/or GRASS (TR/TE/FA=100 ms/13 ms/60deg) transverse images were obtained for MRV. Superior presaturation pulse (S-SAT) was placed in 21 calves, and 0.05 mmol/kg Gd-DTPA was used in all calves. Projection MRVs were generated with maximum intensity projection (MIP) reconstruction. Regarding sequence parameter, S-SAT was useful to eliminate signal from artery that would obscure the signal of deep veins. The detectability of deep veins was improved with the use of S-SAT. In the comparison with venography, MRV could more clearly demonstrate varicose veins more than 5 mm in diameter and their drainage veins than venography. But it could not so clearly demonstrate deep veins as venography. It could not detect fine varicose veins less than 5 mm in diameter and connecting veins with valve insufficiency. In the examination of varicose veins, detection of deep veins, large varicose veins and their main drainage veins is clinically important, because diagnosis of patency of deep veins and dilatation of the drainage veins is necessary to choose the treatment, concluding conservative therapy, stripping and sclerotherapy. However, detection of fine varicose veins and connecting veins are not so important because those veins seldom need treatment. MRV was not so suitable for detection of deep veins, but very useful for detection of varicose veins more than 5 mm in diameter and their main drainage veins. In conclusion, MRV is non-invasive and effective method in varicose veins of calf, and it can take the place of venography with the improvement of deep vein detectability. (author)
International Nuclear Information System (INIS)
Novikov, Yu.F.; Lobach, G.A.; Buzenko, T.A.; Zaretskaya, T.P.
1993-01-01
The basic regularities of radionuclide distribution between the obtained products have been studied using the fractionation of lupine and clover phytomass as an example. The content of radionuclides in protein concentrates has been shown to be strongly related to the crop species. A scheme and a regime of the fractionation of leaf-stem lupine biomass contaminated with cesium radioisotopes and strontium-90 which ensured the minimizing of their residual content in protein-vitaminic and protein concentrates have been selected with due accout of experimental data
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Guranowski, Andrzej; Wojdyła, Anna M; Rydzik, Anna M; Stepiński, Janusz; Jemielity, Jacek
2011-01-01
Adenosine 5'-phosphoramidate (NH₂-pA) is an uncommon natural nucleotide of poorly understood biochemistry and function. We studied a plant enzyme potentially involved in the catabolism of NH₂-pA. A fast and simple method comprising extraction of yellow lupin (Lupinus luteus) seed-meal with a low ionic strength buffer, ammonium sulfate and acetone fractionations, removal of contaminating proteins by heat denaturation, and affinity chromatography on AMP-agarose, yielded homogenous nucleoside 5'-phosphoramidase. Mass spectrometric analysis showed that the lupin hydrolase exhibits closest similarity to Arabidopsis thaliana Hint1 protein. The substrate specificity of the lupin enzyme, in particular its ability to split the P-S bond in adenosine 5'-phosphorothioate, is typical of known Hint1 proteins. Adenosine 5'-phosphofluoride and various derivatives of guanosine 5'-phosphoramidate were also substrates. Neither common divalent metal cations nor 10 mM EDTA or EGTA affected the hydrolysis of NH₂-pA. The enzyme functions as a homodimer (2 x 15,800 Da). At the optimum pH of 7.0, the K(m) for NH₂-pA was 0.5 µM and k(cat) 0.8 s⁻¹ (per monomer active site). The properties of the lupin nucleoside 5'-phosphoramidase are compared with those of its counterparts from other organisms.
LUPIN, a new instrument for pulsed neutron fields
Energy Technology Data Exchange (ETDEWEB)
Caresana, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); Ferrarini, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); CNAO, Via Privata Campeggi, 27100 Pavia (Italy); Manessi, G.P., E-mail: giacomo.paolo.manessi@cern.ch [CERN, 1211 Geneva 23 (Switzerland); University of Liverpool, Department of Physics, L69 7ZE Liverpool (United Kingdom); Silari, M. [CERN, 1211 Geneva 23 (Switzerland); Varoli, V. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy)
2013-06-01
A number of studies focused in the last decades on the development of survey meters to be used in pulsed radiation fields. This is a topic attracting widespread interest for applications such as radiation protection and beam diagnostics in accelerators. This paper describes a new instrument specifically conceived for applications in pulsed neutron fields (PNF). The detector, called LUPIN, is a rem counter type instrument consisting of a {sup 3}He proportional counter placed inside a spherical moderator. It works in current mode with a front-end electronics consisting of a current–voltage logarithmic amplifier, whose output signal is acquired with an ADC and processed on a PC. This alternative signal processing allows the instrument to be used in PNF without being affected by saturation effects. Moreover, it has a measurement capability ranging over many orders of burst intensity. Despite the fact that it works in current mode, it can measure a single neutron interaction. The LUPIN was first calibrated in CERN's calibration laboratory with a PuBe source. Measurements were carried out under various experimental conditions at the Helmholtz-Zentrum in Berlin, in the stray field at various locations of the CERN Proton Synchrotron complex and around a radiotherapy linear accelerator at the S. Raffaele hospital in Milan. The detector can withstand single bursts with values of H⁎(10) up to 16 nSv/burst without showing any saturation effect. It efficiently works in pulsed stray fields, where a conventional rem-counter underestimates by a factor of 2. It is also able to reject the very intense and pulsed photon contribution that often accompanies the neutron field with good reliability. -- Highlights: ► LUPIN is a new detector specifically conceived to work in neutron pulsed fields. ► The detector is a rem counter type instrument working in current mode. ► The performances of the detectors were studied under various experimental conditions. ► The detector
Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth
Energy Technology Data Exchange (ETDEWEB)
Shelp, B J; Kitheka, A M; Cauwenberghe, O.R. Van [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [Grand Forks Human Nutrition Research Center, Agricultural Research service, Grand Forks, ND (United States); Spiers, G A [Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)
1998-12-01
The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 {mu}M to 3.5 mM, with B being present at 2.9-3.5 {mu}M. For each element assayed, the concentration was higher in phloem exudate (1.6 {mu}M to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched {sup 10}B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both {sup 10}B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au) 35 refs.
Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth
International Nuclear Information System (INIS)
Shelp, B.J.; Kitheka, A.M.; Cauwenberghe, O.R. Van; Vanderpool, R.A.; Spiers, G.A.
1998-01-01
The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 μM to 3.5 mM, with B being present at 2.9-3.5 μM. For each element assayed, the concentration was higher in phloem exudate (1.6 μM to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched 10 B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both 10 B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au)
Lupin seeds lower plasma lipid concentrations and normalize antioxidant parameters in rats
Directory of Open Access Journals (Sweden)
Osman, M.
2011-06-01
Full Text Available This study was designed to test bitter and sweet lupin seeds for lipid-lowering and for their antioxidative activities in hypercholesterolemic rats. The levels of plasma lipid, malondialdehyde (MDA and whole blood reduced glutathione (GSH, as well as the activities of transaminases (ALT and AST, lactate dehydrogenase (LDH in plasma, superoxide dismutase (SOD, glutathione peroxidase (GPx in erythrocytes and plasma glutathione reductase (GR, glutathione-S-transferase (GST and catalase (CAT were examined. A hypercholesterolemia-induced diet manifested in the elevation of total lipids (TL, total cholesterol (TC, triglycerides (TG, LDL-C and MDA levels, ALT, AST, LDH activities and the depletion of GSH and enzymic antioxidants. The supplementation of a hypercholesterolemia-induced diet with bitter and sweet lupin seeds significantly lowered the plasma levels of TL, TC, TG and LDL-C. ALT, AST and LDH activities slightly decreased in treated groups compared with the hypercholesterolemic group (HC. Furthermore, the content of GSH significantly increased while MDA significantly decreased in treated groups compared with the HC group. In addition, the bitter lupin seed group improved enzymic antioxidants compared with the HC group. In general, the results indicated that the bitter lupin seed supplements are better than those containing sweet lupin seeds. These results suggested that the hypocholesterolemic effect of bitter and sweet lupin seed supplements might be due to their abilities to lower the plasma cholesterol level as well as to slow down the lipid peroxidation process and to enhance the antioxidant enzyme activity.
Este estudio fue diseñado para evaluar semillas de altramuces dulces y amargas como agentes que bajan los lípidos y estudiar su efecto en la actividad antioxidante en ratas hipercolesterolémicas. El nivel de lípidos en plasma, malondialdehido (MDA y glutatión reducido (GSH, así como la actividad transaminasa (ALT y AST
Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence
2013-06-01
Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.
KINETICS OF EXTRACTION OF EXTRACTIVE SUBSTANCES FROM A LUPINE WITH VARIOUS GEOMETRICAL FORM
Directory of Open Access Journals (Sweden)
S. S. Ivanov
2014-01-01
Full Text Available Summary. Relevance of a subject is proved and the main directions of researches are defined. The research problem is formulated – to predict rate of decrease in a mass-containingf a firm phase and to establish functional connection of concentration of extract over time. Soy and lupine, as sources of valuable nutritious components are analysed. The soy shortcomings which chemical components are inhibitors of a number of digestive enzymes, such as pepsin and chymotrypsin are convincingly shown. The carbohydrate fraction of soy is rich with the oligosaccharides causing an intestinal meteorism. Therefore topical issue about replacement of soy with perspective leguminous culture – the lupine, deprived of the shortcomings inherent in soy. The structure and physical and chemical properties of subcheese serum is presented. The method of calculation of the average sizes of particles of raw materials of a sphere having a geometrical form, the cylinder and an unlimited plate is received. Results of research of kinetics of extraction from a lupine are given at various geometrical form of raw materials. The preferable shape of a body is defined at exhausting course of process of extraction of raw materials in the form of a plate. At the same time, other geometrical forms aren't denied as the form of crumbled, for example, is more technological in production. Graphic dependences are in details described and the analysis of the obtained data is made. Composition use – dairy plant extract in various industries and, in particular, in dairy for receiving lactic products is offered. Further work is determination of coefficients of molecular diffusion, creation of mathematical models with use of the received extraction dependences, and also the process software. This material, in its cumulative analysis, gives the chance to choose hardware and technological registration of process of extraction which will provide the maximum extraction from a lupine of a
O'Rourke, Jamie A; Yang, S Samuel; Miller, Susan S; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W; Vance, Carroll P
2013-02-01
Phosphorus, in its orthophosphate form (P(i)), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to P(i) deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in P(i)-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to P(i) supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to P(i) deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to P(i) deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the P(i) status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in P(i) deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to P(i) deficiency.
Fiallo-Olivé, Elvira; Chirinos, Dorys T; Geraud-Pouey, Francis; Navas-Castillo, Jesús
2017-08-01
Wild plants of the family Convolvulaceae are hosts for a few New World begomoviruses (genus Begomovirus, family Geminiviridae). In this work, we report the complete genome sequence of a new begomovirus infecting the wild convolvulaceous plant Jacquemontia tamnifolia in Venezuela. The cloned bipartite genome showed the organization of typical New World begomoviruses and was found to be phylogenetically related to those of begomoviruses from Venezuela and other Caribbean countries. Several recombination events have been shown to have occurred involving genome fragment exchange with related begomoviruses infecting crops such as tomato and cucurbits and wild plants, including Jacquemontia sp. We propose the name jacquemontia yellow vein virus (JacYVV) for this new begomovirus.
Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian
2012-02-01
Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.
Zaworska, Anita; Frankiewicz, Andrzej; Kasprowicz-Potocka, Małgorzata
2017-08-01
The aims of this study were to provide a controlled fermentation process of blue lupin seeds (Lupinus angustifolius, cv. Neptun), monitor the changes in seed composition and determine the influence of the fermentation on the apparent ileal digestibility (AID) of crude protein (CP) and amino acids in growing pigs, compared with raw lupin seeds. The fermentation with bacteria and yeast was conducted for 24 h at 25ºC under aerobic conditions. Seed fermentation increased the contents of CP, fibre, fat and ash and most of the analysed amino acids but reduced the levels of the nitrogen-free extractives. Furthermore, fermentation decreased the contents of raffinose family oligosaccharides and phytic acids but increased the alkaloid content. The AID was estimated on three barrows (mean initial body weight 25 kg), surgically fitted with a T-cannula in the distal ileum. The pigs received three diets, each for 6 d, within three experimental periods (3 × 3 Latin Square design). The diets contained soybean meal (Group SBM), raw lupin seeds (Group RL) or fermented lupin seeds (Group FL) as solely protein sources. Fermentation had a positive impact on the AID of CP and methionine, cysteine, isoleucine, leucine, phenylalanine and valine (p fermented lupin seeds did not affect the microbial status of the ileal digesta. Moreover, ammonia content in the caecal digesta did not differ between Groups RL and FL, although it was significantly higher than in Group SBM. It can be concluded that the fermentation process modified the chemical composition of nutrients in seeds, which can influence the digestibility and utilisation of the fermentation product in animal diets compared to raw seeds.
Energy Technology Data Exchange (ETDEWEB)
Noaman, E; Mansour, S Z; Ibrahim, N K [Radiation Biology Dept., National Centre for Radiation Research and Technology, Atomic Energy Authority, Cairo (Egypt)
2007-07-01
Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)
International Nuclear Information System (INIS)
Noaman, E.; Mansour, S.Z.; Ibrahim, N.K.
2007-01-01
Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)
Directory of Open Access Journals (Sweden)
Giovanni Chaves-Bedoya
2013-08-01
Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection
General properties of grapevine viruses occurring in Hungary
Directory of Open Access Journals (Sweden)
Eszter Cseh
2012-03-01
Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.
Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ...
African Journals Online (AJOL)
Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ( Lupizus albus cv. Kiev) as protein sources for ... P igsi n the metabolisrna ndN balance trial consurned5 % less( P < 0.01)o 1'thel upind ietc omparedto the fabab eand iet (l 370 vs. | 440 gld).N o significandt ift'erenceisn the digestiblee nergy( DE) contenta nd ...
O’Rourke, Jamie A.; Yang, S. Samuel; Miller, Susan S.; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W.; Vance, Carroll P.
2013-01-01
Phosphorus, in its orthophosphate form (Pi), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to Pi deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in Pi-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to Pi supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to Pi deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to Pi deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the Pi status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in Pi deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to Pi deficiency. PMID:23197803
Villa, Caterina; Costa, Joana; Gondar, Cristina; Oliveira, M Beatriz P P; Mafra, Isabel
2018-10-01
Lupine is widely used as an ingredient in diverse food products, but it is also a source of allergens. This work aimed at proposing a method to detect/quantify lupine as an allergen in processed foods based on a normalised real-time PCR assay targeting the Lup a 4 allergen-encoding gene of Lupinus albus. Sensitivities down to 0.0005%, 0.01% and 0.05% (w/w) of lupine in rice flour, wheat flour and bread, respectively, and 1 pg of L. albus DNA were obtained, with adequate real-time PCR performance parameters using the ΔCt method. Both food matrix and processing affected negatively the quantitative performance of the assay. The method was successfully validated with blind samples and applied to processed foods. Lupine was estimated between 4.12 and 22.9% in foods, with some results suggesting the common practice of precautionary labelling. In this work, useful and effective tools were proposed for the detection/quantification of lupine in food products. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Payton Mark
2007-04-01
Full Text Available Abstract Background Plasmodiophorids and chytrids are zoosporic parasites of algae and land plant and are distributed worldwide. There are 35 species belonging to the order Plasmodiophorales and three species, Polymyxa betae, P. graminis, and Spongospora subterranea, are plant viral vectors. Plasmodiophorid transmitted viruses are positive strand RNA viruses belonging to five genera. Beet necrotic yellow vein virus (BNYVV and its vector, P. betae, are the causal agents for rhizomania. Results Evidence of BNYVV replication and movement proteins associating with P. betae resting spores was initially obtained using immunofluorescence labeling and well characterized antisera to each of the BNYVV proteins. Root cross sections were further examined using immunogold labeling and electron microscopy. BNYVV proteins translated from each of the four genomic and subgenomic RNAs accumulate inside P. betae resting spores and zoospores. Statistical analysis was used to determine if immunolabelling detected viral proteins in specific subcellular domains and at a level greater than in control samples. Conclusion Virus-like particles were detected in zoosporangia. Association of BNYVV replication and movement proteins with sporangial and sporogenic stages of P. betae suggest that BNYVV resides inside its vector during more than one life cycle stage. These data suggest that P. betae might be a host as well as a vector for BNYVV
Lubicz, Jeanmarie Verchot; Rush, Charles M; Payton, Mark; Colberg, Terry
2007-04-05
Plasmodiophorids and chytrids are zoosporic parasites of algae and land plant and are distributed worldwide. There are 35 species belonging to the order Plasmodiophorales and three species, Polymyxa betae, P. graminis, and Spongospora subterranea, are plant viral vectors. Plasmodiophorid transmitted viruses are positive strand RNA viruses belonging to five genera. Beet necrotic yellow vein virus (BNYVV) and its vector, P. betae, are the causal agents for rhizomania. Evidence of BNYVV replication and movement proteins associating with P. betae resting spores was initially obtained using immunofluorescence labeling and well characterized antisera to each of the BNYVV proteins. Root cross sections were further examined using immunogold labeling and electron microscopy. BNYVV proteins translated from each of the four genomic and subgenomic RNAs accumulate inside P. betae resting spores and zoospores. Statistical analysis was used to determine if immunolabelling detected viral proteins in specific subcellular domains and at a level greater than in control samples. Virus-like particles were detected in zoosporangia. Association of BNYVV replication and movement proteins with sporangial and sporogenic stages of P. betae suggest that BNYVV resides inside its vector during more than one life cycle stage. These data suggest that P. betae might be a host as well as a vector for BNYVV.
Hereditary dwarfism in yellow lupin (Lupinus luteus L
Directory of Open Access Journals (Sweden)
Tadeusz Kazimierski
2015-01-01
Full Text Available A dwarf plant was found in the F4 generation of a hybrid between two yellow lupin subspecies. Genetic analysis demonstrated that the dwarf grwoth is conditioned by one recessive factor which was named nanus. This factor acts pleiotroipically since it reduces the height, changes the morphological structure and some anatomical traits and reduces fertility in the dwarf plants. It is believed that in the chromosome with translocation a gene block arose in the F4, plant. These genes acting as a compact system cause dwarfism, changes in the anatomical structure and reduce fertility.
Sclerotherapy of Varicose Veins and Spider Veins
... Index A-Z Sclerotherapy of Varicose Veins and Spider Veins Sclerotherapy uses injections from a very fine, ... Sclerotherapy? What is Sclerotherapy of Varicose Veins and Spider Veins? Sclerotherapy is a minimally invasive treatment used ...
Bartkiene, E; Juodeikiene, G; Vidmantiene, D; Zdunczyk, Z; Zdunczyk, P; Juskiewicz, J; Cizeikiene, D; Matusevicius, P
2013-09-01
The present study proposes the contribution of lactic acid bacteria and plants rich in bioactive substances and high-quality proteins as alternative products for human diets in improving the gut environment as potential against pathogenic bacteria. The effect of diets supplemented with soya, flaxseed and lupine flours fermented with a Pediococcus acidilactici KTU05-7 probiotic strain in the gastrointestinal tract (GIT) of Wistar rats were analyzed. In vivo experiments showed a positive effect of long time lactofermentation of plant material on the body weight of rats. Diets with fermented yellow lupine resulted in enhanced activities of α-glucosidase, β-galactosidases, as well as high levels of lactic acid bacteria, bifidobacteria and enterococci in the GIT were determined. Lactofermentation of analyzed plant products had a significantly lowering effect on Escherichia coli compared with the control group. The dominant flora of large intestines like Bifidobacterium and anaerobic cocci were found in high levels after diets with fermented lupine.
A novel technique for compensation of space charge effects in the LUPIN-II detector
Energy Technology Data Exchange (ETDEWEB)
Cassell, C., E-mail: cc878@uowmail.edu.au [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy); University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Ferrarini, M. [Fondazione CNAO, via Caminadella16, 20123 Milano (Italy); Rosenfeld, A. [University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Caresana, M. [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy)
2015-12-21
A new method for improving REM counter performance in Pulsed Neutron Fields (PNFs) has been developed. This method uses an analysis of the build-up of space charge in the counter to compensate for an underestimation of Ambient Dose Equivalent (H*(10)) in intense pulsed fields. It was applied to three sets of experimental data acquired using the LUPIN-II REM counter device, which is designed for use in PNFs. The data was acquired using the cyclotron at Helmholtz-Zentrum Berlin für Materialien und Energie GmbH (HZB), at the HiRadMat facility at CERN and at the ‘Elettra Sincrotrone Trieste’ (ELETTRA), Italy. A comparison of the data with and without this compensation method is used to highlight its effectiveness. The LUPIN-II performance, which has already been shown to be able to cope with fields of up to hundreds of nSv/burst, is improved by at least one order of magnitude, with further potential for improvement.
DEFF Research Database (Denmark)
Tomasi, Nicola; Kretzschmar, Tobias; Espen, Luca
2009-01-01
ABSTRACT White lupin (Lupinus albus L.) is able to grow on soils with sparingly available phosphate (P) by producing specialized structures called cluster roots.To mobilize sparingly soluble P forms in soils, cluster roots release substantial amounts of carboxylates and concomitantly acidify the ...
Directory of Open Access Journals (Sweden)
Bogusław I Olkowski
2010-01-01
Full Text Available This work examined the impact of enzyme preparation with specific activity towards non starch polysaccharides on performance, morphological characteristics of gastrointestinal tract organs, microscopic evaluation of jejunal mucosa, and microbial status of ileum, caeca, and excreta in broilers fed a diet containing a high content of lupine meal. One-day-old chickens (Ross 308, mixed sex were randomly divided into control and experimental groups. Each group consisted of 36 birds, with 6 replications,and with 6 chickens per replication. The control group was fed the basal diet (consisting of maize and 40% of lupine, while the experimental treatment group was fed the basal diet supplemented with 0.06% commercial enzyme (Ronozyme VP. Chickens were fed diets in mash form for 4 weeks. Enzyme preparation significantly (P P P Enterobacteriaceae in caeca and excreta, and coliforms in excreta only (P < 0.01. Appropriate combination of enzyme preparations with activity towards degrading carbohydrates may offer a potential to reduce the deleterious impact of lupine in broilers.
Khan, Asifa; Luqman, Suaib; Masood, Nusrat; Singh, Dhananjay Kumar; Saeed, Sana Tabanda; Samad, Abdul
2016-07-01
The infection of Eclipta yellow vein virus [EcYVV-IN, Accession No. KC476655], recently reported for the first time, on Andrographis paniculata was studied for redox-mediated alteration mechanism in infected plants. A. paniculata, an important medicinal plant, is used in traditional Indian, Chinese and modern system of medicine. Andrographolide, one of the foremost components of this plant, is known for its varied pharmacological properties. Our investigation provides insight into the effect of virus-induced changes in the singlet oxygen quenching due to the alteration in pigment content (chlorophyll and carotenoids) as well as activation of plant secondary metabolism along with defense activation leading to changes in enzymatic and non-enzymatic redox status. Due to infection, a reduction in carotenoid content was observed which leads to reduced quenching of singlet oxygen. An increased level of enzymatic (SOD and APX) and non-enzymatic antioxidant (DPPH, FRAP, RP, NO, TAC and TP) activities were also observed in virus-infected plants with a positive correlation (>0.9). However, CAT activity was diminished which could be either due to its proteolytic degradation or inactivation by superoxide anions (O(2-.)), NO or peroxynitrite radicals. A significant (p < 0.05) increase in total phenolic content was observed in the infected plants while no considerable difference was seen in the total flavonoid content. Our results highlighted the alteration in redox status caused by virus-induced biotic stress on the plants and could be useful for understanding the after effects of viral infection This study could also be helpful in developing biomimetic methods for improving the production of secondary metabolites of pharmaceutical importance. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
María I. Palacio
2014-02-01
Full Text Available The in vitro prebiotic activity of galactooligosaccharides (GOS and low-molecular-weight carbohydrates (LMWC extracted from lupin and squash seeds on the growth of Lactobacillus paracasei BGP1 was studied. To this end, the change in cell density after 24 h of L. paracasei growth on 1% (w/v glucose, 1% (w/v raffinose, 1% (w/v commercial inulin GR, 1% (w/v lupin extract, and 1% (w/v squash extract relative to the change in cell density of a mixture of enteric strains under the same culture conditions were evaluated. Additionally, the principal components of GOS and LMWC in the extracts were identified using Thin Layer Chromatography. The highest prebiotic activity score was for L. paracasei grown on squash extract (0.55±0.03, followed by lupin extract (0.49±0.02, inulin (0.38±0.05 and raffinose (0.37±0.05. These results will contribute to selecting plant species as potential sources of prebiotic ingredients for the development of functional foods.
Pelvic Vein Embolisation in the Management of Varicose Veins
International Nuclear Information System (INIS)
Ratnam, Lakshmi A.; Marsh, Petra; Holdstock, Judy M.; Harrison, Charmaine S.; Hussain, Fuad F.; Whiteley, Mark S.; Lopez, Anthony
2008-01-01
Pelvic vein incompetence is common in patients with atypical varicose veins, contributing to their recurrence after surgery. Therefore, refluxing pelvic veins should be identified and treated. We present our experience with pelvic vein embolisation in patients presenting with varicose veins. Patients presenting with varicose veins with a duplex-proven contribution from perivulval veins undergo transvaginal duplex sonography (TVUS) to identify refluxing pelvic veins. Those with positive scans undergo embolisation before surgical treatment of their lower limb varicose veins. A total of 218 women (mean age of 46.3 years) were treated. Parity was documented in the first 60 patients, of whom 47 (78.3%) were multiparous, 11 (18.3%) had had one previous pregnancy, and 2 (3.3%) were nulliparous. The left ovarian vein was embolised in 78%, the right internal iliac in 64.7%, the left internal iliac in 56.4%, and the right ovarian vein in 42.2% of patients. At follow-up TVUS, mild reflux only was seen in 16, marked persistent reflux in 6, and new reflux in 3 patients. These 9 women underwent successful repeat embolisation. Two patients experienced pulmonary embolisation of the coils, of whom 1 was asymptomatic and 1 was successfully retrieved; 1 patient had a misplaced coil protruding into the common femoral vein; and 1 patient had perineal thrombophlebitis. The results of our study showed that pelvic venous embolisation by way of a transjugular approach is a safe and effective technique in the treatment of pelvic vein reflux.
International Nuclear Information System (INIS)
Komazaki, Toshio
1994-01-01
The usefulness and the limitation of magnetic resonance angiography (MRA) for the assessment of the portal vein and its branches, i.e., the collateral veins of portal hypertensive patients, were studied. In a total of 22 patients with portal hypertension, both MRA and percutaneous transhepatic portography (PTP) were done at the same time. MRA and PTP images were read at random by three observers. The discriminative scores, decided from the grades of clearness of images, were calculated for six portal venous vessels. The discrimination of the portal vein, splenic vein, paraumbilical vein and gastrorenal shunt was easy on condition that they were clearly visualized by PTP. Thus the accuracy of MRA, which was calculated by comparing it with PTP, the gold standard, was high and above 95%. Regarding the left gastric vein and short gastric vein, the accuracy of MRA were lower than the former four vessels but were still above 80%. MRA, the noninvasive method, seems useful for the first choice to see the total image of portal venous system. (author)
Sohrab, Sayed Sartaj; Daur, Ihsanullah
2018-02-01
Mentha is a very important crop grown and used extensively for many purposes in the Kingdom of Saudi Arabia. Begomoviruses are whitefly-transmitted viruses causing serious disease in many important plants exhibiting variable symptoms with significant economic loss globally. During farmers' field survey, yellow vein mosaic disease was observed in Mentha longifolia plants growing near tomato fields in Saudi Arabia. The causative agent was identified in 11 out of 19 samples using begomovirus-specific primers and the association of begomovirus with yellow vein mosaic disease in M. longifolia was confirmed. The full-length viral genome and betasatellite were amplified, cloned, and sequenced bidirectionally. The full DNA-A genome was found to have 2785 nucleotides with 1365 bp-associated betasatellite molecule. An attempt was made to amplify DNA-B, but none of the samples produced any positive amplicon of expected size which indicated the presence of monopartite begomovirus. The sequence identity matrix and phylogenetic analysis, based on full genome showed the highest identity (99.6%) with Tomato yellow leaf curl virus (TYLCV) and in phylogenetic analysis it formed a closed cluster with Tomato leaf curl virus infecting tomato and Corchorus crop in Saudi Arabia. The sequence analysis results of betasatellites showed the highest identity (98.9%) with Tomato yellow leaf curl betasatellites infecting tomato and phylogenetic analysis using betasatellites formed a close cluster with Tomato yellow leaf curl betasatellites infecting tomato and Corchorus crops, which has already been reported to cause yellow vein mosaic and leaf curl disease in many cultivated and weed crops growing in Saudi Arabia. The identified begomovirus associated with yellow vein mosaic disease in mentha could be a mutated strain of TYLCV and tentatively designated as TYLCV-Mentha isolate. Based on published data and latest information, this is the first report of identification of Tomato yellow leaf
CO2-DSA in lower extremity veins: a clinical application
International Nuclear Information System (INIS)
Guo Jinhe; Teng Gaojun; Zhu Guangyu; Liu Zhensheng; Li Guozhao; Ding Huijuan; Shen Zhiping; He Shicheng; Deng Gang; Fang Wen
2005-01-01
Objective: To explore the feasibility and usefulness of carbon dioxide digital subtraction angiography (CO 2 -DSA) in deep veins of lower extremity via the dorsal is pedis vein. Methods: CO 2 -DSA in lower extremity veins was performed in 15 patients (15 limbs affected, male 9, female 6) by injection of CO 2 via the dorsal is pedis vein. Among them, 8 patients were suspected with deep venous thrombosis (DVT), 6 patients with saphena magna dilation, and 1 patient with a follow-up after thrombolysis due to DVT. Results: Excellent image was obtained in 12 cases, which showed branches of the venous system clearly, as well as the details of DVT. Good image was obtained in 2 cases. Technical failure was encountered in one patient due to inaccessible puncture veins. Mild discomfort (transient pain at the percutaneous site) during the procedure was demonstrated in 11 patients. There was no severe side effects or complications in this series. Conclusion: CO 2 -DSA in lower extremity veins is feasible and safe, the preliminary result is satisfactory. (authors)
Diagnosis of deep vein thrombosis using multi-detector helical CT
Energy Technology Data Exchange (ETDEWEB)
Kimura, Masashi; Minamiguchi, Hiroki; Sahara, Shinya [Wakayama Medical Coll. (Japan)] [and others
2002-11-01
The purpose of this study was to evaluate the usefulness of multi-detector helical CT (MDHCT) with contrast medium in the diagnosis of deep vein thrombosis (DVT). The bilateral veins of the dorsal pedis in 45 patients (12 men, 33 women; average age, 64 years) under clinical suspicion of DVT were first punctured using 22-G needles. Then CT scanning from the level of the foot to the inferior vena cava was started 20 sec after the initial injection of 200 mL of dilute contrast medium (50 mL nonionic iodinated contrast medium of 300 mgI/mL and 150 mL saline) at a rate of 5 mL/sec. Two patients were excluded because of unsuccessful venous puncture. The average scanning time in 43 patients was 38.5{+-}7.9 seconds. Images of veins from the foot to the inferior vena cava were clearly demonstrated in each case. MDHCT showed DVT in 32 cases and patent deep vein in 11 cases. Simultaneous venography of the lower extremity in 18 patients clearly visualized DVT at the same level detected by contrast MDHCT. MDHCT for the diagnosis of DVT has the advantages of wider scanning rage, shorter scanning time, and finer Z-axis resolution than the other diagnostic modalities. (author)
Diagnosis of deep vein thrombosis using multi-detector helical CT
International Nuclear Information System (INIS)
Kimura, Masashi; Minamiguchi, Hiroki; Sahara, Shinya
2002-01-01
The purpose of this study was to evaluate the usefulness of multi-detector helical CT (MDHCT) with contrast medium in the diagnosis of deep vein thrombosis (DVT). The bilateral veins of the dorsal pedis in 45 patients (12 men, 33 women; average age, 64 years) under clinical suspicion of DVT were first punctured using 22-G needles. Then CT scanning from the level of the foot to the inferior vena cava was started 20 sec after the initial injection of 200 mL of dilute contrast medium (50 mL nonionic iodinated contrast medium of 300 mgI/mL and 150 mL saline) at a rate of 5 mL/sec. Two patients were excluded because of unsuccessful venous puncture. The average scanning time in 43 patients was 38.5±7.9 seconds. Images of veins from the foot to the inferior vena cava were clearly demonstrated in each case. MDHCT showed DVT in 32 cases and patent deep vein in 11 cases. Simultaneous venography of the lower extremity in 18 patients clearly visualized DVT at the same level detected by contrast MDHCT. MDHCT for the diagnosis of DVT has the advantages of wider scanning rage, shorter scanning time, and finer Z-axis resolution than the other diagnostic modalities. (author)
“Crooked calf syndrome”, the contracture-type skeletal defects and cleft palate caused by velvet lupine (Lupinus leucophyllus) on the channel Scablands of east-central Washington State are the same as those defects induced by Conium maculatum (poison-hemlock) and Nicotiana spp. (wild tobacco) in rum...
The Lupinus genus is a large group of legumes, some of which cause a congenital condition in cattle referred to as “Crooked Calf Syndrome” (CCS). Only Lupines that contain the alkaloids anagyrine or ammodendrine are problematic to cattle producers. The syndrome is manifest by a series of multiple ...
Directory of Open Access Journals (Sweden)
Tihomir Miličević
2013-06-01
Full Text Available The presence and occurrence of Fusarium species was examined on the seeds of cultivated legumes – common vetch (Vicia sativa, white lupine (Lupinus albus, and wild legumes: bird’s-foot trefoil (Lotus corniculatus, wild alfalfa (Medicago sativa, black locust (Robinia pseudoacacia, honey locust (Gleditsia triacanthos, sweet clover (Melilotus officinalis, bird vetch (Vicia cracca and meadow vetchling (Lathyrus pratensis. Thirteen Fusarium species were identified - F. verticillioides, F. acuminatum, F. avenaceum, F. tricinctum F. oxysporum, F. scirpi, F. semitectum, F. culmorum, F. proliferatum, F. pseudograminearum, F. sporotrichioides, F. sambucinum and F. heterosporum. Species F. verticillioides and F. proliferatum were determined on seeds of the cultivated legumes (common vetch and white lupine. Other 11 Fusarium species were determined on seeds of wild legumes (bird’s-foot trefoil, wild alfalfa, sweet clover and bird vetch among which the most prevalent were species F. avenaceum and F. acuminatum.
International Nuclear Information System (INIS)
Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello
2013-01-01
Highlights: •A glycaemia-reducing lupin seed protein is internalized by HepG2 cells. •The protein accumulates in the cytosol in an intact form. •The internalized protein is multiply phosphorylated. -- Abstract: Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity
Ciccarelli, Anna; Calabrò, Claudia; Imperatore, Clara; Scala, Guglielmo
2014-01-01
A case of anaphylaxis is reported in the course of a prick by prick with Lupinus albus and roasted peanut in a 20-year-old woman. We focused on some main topics. First of all it seems important to underscore the potential risks connected to the practice of the prick-by-prick with fresh foods in allergic patients, especially when testing cross-reactive substances, such as White Lupine, peanuts, or soy. It is important that clinicians who perform prick tests be aware of the risk related with in vivo tests in allergic patients. Second, we discuss the problem of the hidden allergens, such as White Lupine flour, or soy flour which are utilized to improve wheat flour because of their lower cost. Patients with a demonstrated allergy to peanuts should be assessed for lupine allergy and informed about the “hidden allergens” issue. Finally, we believe that component resolved diagnosis, the serum specific IgE against molecular components, that is normally considered a second-level diagnostic step has an important role even as a first line approach at least in some selected cases. PMID:25477973
Gullón, Patricia; Gullón, Beatriz; Tavaria, Freni; Vasconcelos, Marta; Gomes, Ana Maria
2015-10-01
Broad beans (Vicia faba) and lupin seeds (Lupinus albus) are legumes rich in a wide range of compounds, which may represent a useful dietary approach for modulating the human gut microbiome. In this work, after in vitro digestion, legume samples were used as carbon sources in anaerobic batch cultures to evaluate their impact on the intestinal microbiota composition and on their metabolic products. The fermentations were monitored by a decrease in pH, generation of short chain fatty acids (SCFA) and lactate and the changes in the dynamic bacterial populations by fluorescence in situ hybridization (FISH). The total SCFA at the end of fermentation was 81.52 mM for lupin seeds and 78.41 mM for broad beans accompanied by a decrease of the pH for both legumes. The microbial groups that increased significantly (P spp., Lactobacillus-Enterococcus, Atopobium, Bacteroides-Pretovella, Clostridium coccoides-Eubacterium rectale, Faecalibacterium prausnitzii and Roseburia intestinalis. This impact on the intestinal microbiota suggests that lupin seeds and broad beans may be used in the development of novel functional foods, which can be included in dietary strategies for human health promotion.
... stripping; Venous reflux - vein stripping; Venous ulcer - veins Patient Instructions Surgical wound care - open Varicose veins - what to ask your doctor Images Circulatory system References American Family Physician. Management of varicose veins. www.aafp.org/afp/2008/ ...
Directory of Open Access Journals (Sweden)
Enoc Jara-Peña
2013-06-01
Full Text Available The present investigation was carried out with objective to determine the response of red raspberry to vermicompost application and lupine (intercropped or not in the phase of vegetative growth under greenhouse conditions in Montecillo, Mexico. In the experiment 11 treatments were studied with 9 replications per treatment, with a complete factorial (5 × 2 plus an additional treatment consisting of a chemical fertilization with N100 P80 K80. As vegetable material adventitious buds of raspberry were used, statistically significant differences were found between treatments in number of leaves, plant height, cane diameter, fresh and dry matter in raspberry. The biggest response was obtained with 90 and 120 g pot–1 of vermicompost. In general, the lupine intercropped with raspberry permitted a slight competion but favored the biggest development in the foliar area.
Directory of Open Access Journals (Sweden)
Hakan Demirci
2016-01-01
Full Text Available Portal vein thrombosis is an important cause of presinusoidal portal hypertension. Portal vein thrombosis commonly occurs in patient with cirrhosis, malignancy and prothrombotic states. Patients with acute portal vein thrombosis have immediate onset. Patients with chronic portal vein thrombosis have developed portal hypertension and cavernous portal transformation. Portal vein thrombosis is diagnosed with doppler ultrasound, computed tomography and magnetic resonance imaging. Therapy with low molecular weight heparin achieves recanalization in more than half of acute cases.
Collateral veins in left renal vein stenosis demonstrated via CT
Energy Technology Data Exchange (ETDEWEB)
Lien, H.H.; Lund, G.; Talle, K.
1983-02-01
Twelve patients with left renal vein stenosis from tumor compression were studied with CT. All had distended collateral veins in the perirenal space which either formed a radiating or a cobweb pattern or appeared as marked longitudinal veins. Inferior phrenic vein branches were seen in seven patients and were considerably enlarged in two. Other major veins possibly taking part in collateral circulation could not be recognized due to obliteration of fat planes. The renal fascia was thickened in eleven patients, probably due to edema. A close study of the perirenal space with CT may give valuable information about collateral development.
Collateral veins in left renal vein stenosis demonstrated via CT
International Nuclear Information System (INIS)
Lien, H.H.; Lund, G.; Talle, K.
1983-01-01
Twelve patients with left renal vein stenosis from tumor compression were studied with CT. All had distended collateral veins in the perirenal space which either formed a radiating or a cobweb pattern or appeared as marked longitudinal veins. Inferior phrenic vein branches were seen in seven patients and were considerably enlarged in two. Other major veins possibly taking part in collateral circulation could not be recognized due to obliteration of fat planes. The renal fascia was thickened in eleven patients, probably due to edema. A close study of the perirenal space with CT may give valuable information about collateral development. (orig.)
Al-Shahwan, I M; Abdalla, O A; Al-Saleh, M A; Amer, M A
2017-09-01
A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus , Convolvulus arvensis , Malva parviflora , Rubus fruticosus , Hippuris vulgaris , and Flaveria trinervia . These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata , Solanum tuberosum , Solanum melongena , Phaseolus vulgaris , Cucurbita maxima , Capsicum annuum , and Vicia faba . The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV) {12.5 and 4.5%}, Lucerne transient streak virus (LTSV) {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV) {1.4 and 4.5%}, Bean common mosaic virus (BCMV) {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV) {1.2 and 4%}, White clover mosaic virus (WCIMV) {1.0 and 5%}, Cucumber mosaic virus (CMV) {0.8 and 3%}, Pea streak virus (PeSV) {0.4 and 4.5%} and Tobacco streak virus (TSV) {0.3 and 2.5%}. Alfalfa mosaic virus (AMV), the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV) was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90
Directory of Open Access Journals (Sweden)
I.M. Al-Shahwan
2017-09-01
Full Text Available A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus, Convolvulus arvensis, Malva parviflora, Rubus fruticosus, Hippuris vulgaris, and Flaveria trinervia. These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata, Solanum tuberosum, Solanum melongena, Phaseolus vulgaris, Cucurbita maxima, Capsicum annuum, and Vicia faba. The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV {12.5 and 4.5%}, Lucerne transient streak virus (LTSV {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV {1.4 and 4.5%}, Bean common mosaic virus (BCMV {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV {1.2 and 4%}, White clover mosaic virus (WCIMV {1.0 and 5%}, Cucumber mosaic virus (CMV {0.8 and 3%}, Pea streak virus (PeSV {0.4 and 4.5%} and Tobacco streak virus (TSV {0.3 and 2.5%}. Alfalfa mosaic virus (AMV, the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90
Wiche, Oliver; Fischer, Ronny; Moschner, Christin; Székely, Balázs
2015-04-01
Concentrations of Germanium (Ge) and Rare Earth Elements in soils are estimated at 1.5 mg kg -1 (Ge), 25 mg kg -1 (La) and 20 mg kg -1 (Nd), which are only roughly smaller than concentrations of Pb and Zn. Germanium and rare earth elements are thus not rare but widely dispersed in soils and therefore up to date, only a few minable deposits are available. An environmental friendly and cost-effective way for Ge and rare earth element production could be phytomining. However, the most challenging part of a phytomining of these elements is to increase bioavailable concentrations of the elements in soils. Recent studies show, that mixed cultures with white lupine or other species with a high potential to mobilize trace metals in their rhizosphere due to an acidification of the soil and release of organic acids in the root zone could be a promising tool for phytomining. Complexation of Ge and rare earth elements by organic acids might play a key role in controlling bioavailability to plants as re-adsorption on soil particles and precipitation is prevented and thus, concentrations in the root zone of white lupine increase. This may also allow the complexes to diffuse along a concentration gradient to the roots of mixed culture growing species leading to enhanced plant uptake. However, to optimize mixed cultures it would be interesting to know to which extend mobilization of trace metals is dependent from chemical speciation of elements in soil due to the interspecific interaction of roots. A method for the identification of complexes of germanium and rare earth elements with organic acids, predominantly citric acid in the rhizosphere of white lupine was developed and successfully tested. The method is based on coupling of liquid chromatography with ICP-MS using a zic-philic column (SeQuant). As a preliminary result, we were able to show that complexes of germanium with citric acid exist in the rhizosphere of white lupin, what may contribute to the bioavailability of this
... because the valves of the veins no longer work. Under the pressure of gravity these veins can continue to expand and, in ... and to determine whether the vein valves are work- ing properly or have ... painless. How are varicose veins treated? Varicose veins are always ...
Shaw, Jane; Love, Andrew J; Makarova, Svetlana S; Kalinina, Natalia O; Harrison, Bryan D; Taliansky, Michael E
2014-01-01
Cajal bodies (CBs) are distinct nuclear bodies physically and functionally associated with the nucleolus. In addition to their traditional function in coordinating maturation of certain nuclear RNAs, CBs participate in cell cycle regulation, development, and regulation of stress responses. A key "signature" component of CBs is coilin, the scaffolding protein essential for CB formation and function. Using an RNA silencing (loss-of-function) approach, we describe here new phenomena whereby coilin also affects, directly or indirectly, a variety of interactions between host plants and viruses that have RNA or DNA genomes. Moreover, the effects of coilin on these interactions are manifested differently: coilin contributes to plant defense against tobacco rattle virus (tobravirus), tomato black ring virus (nepovirus), barley stripe mosaic virus (hordeivirus), and tomato golden mosaic virus (begomovirus). In contrast, with potato virus Y (potyvirus) and turnip vein clearing virus (tobamovirus), coilin serves to increase virus pathogenicity. These findings show that interactions with coilin (or CBs) may involve diverse mechanisms with different viruses and that these mechanisms act at different phases of virus infection. Thus, coilin (CBs) has novel, unexpected natural functions that may be recruited or subverted by plant viruses for their own needs or, in contrast, are involved in plant defense mechanisms that suppress host susceptibility to the viruses.
Spider veins: How are they removed? I have spider veins on my legs. What options are available ... M.D. Several options are available to remove spider veins — thin red lines or weblike networks of ...
Smith, Stuart C.; Choy, Rachel; Johnson, Stuart K.; Hall, Ramon S.; Wildeboer-Veloo, Alida C. M.; Welling, Gjalt W.
Background: Changes in the composition of gastrointestinal microbiota by dietary interventions using pro- and prebiotics provide opportunity for improving health and preventing disease. However, the capacity of lupin kernel fiber (LKFibre), a novel legume-derived food ingredient, to act as a
... Leer en español What Is Varicose (VAR-i-kos) veins are swollen, twisted veins that you can ... TA-ze-uhs), spider veins, varicoceles (VAR-i-ko-seals), and other vein problems. Telangiectasias Telangiectasias are ...
Atresia of the bilateral pulmonary veins: a rare and dismal anomaly identified on cardiac CT
Energy Technology Data Exchange (ETDEWEB)
Goo, Hyun Woo; Park, Sang-Hyub; Koo, Hyun Jung; Cho, Young Hoon; Lee, Eunsol [University of Ulsan College of Medicine, Asan Medical Center, Department of Radiology and Research Institute of Radiology, Seoul (Korea, Republic of)
2014-08-15
Imaging findings of bilateral pulmonary vein atresia have not been described. To describe cardiac CT findings and clinical outcomes of bilateral pulmonary vein atresia. Three newborns with bilateral pulmonary vein atresia were encountered at our institution during a period of 8 years. We evaluated prenatal echocardiographic findings, clinical presentations, postnatal echocardiographic findings, chest radiographic findings, cardiac CT findings and clinical outcomes. All newborns presented immediately after birth with severe cyanosis, respiratory distress and acidosis that were unresponsive to medical management. Prenatal and postnatal echocardiographic studies and chest radiography were misleading, inconclusive or nonspecific in making the diagnosis in these children; however cardiac CT clearly demonstrated atresia of the bilateral pulmonary veins with multiple small mediastinal collateral veins and pulmonary edema. Surgical treatments were not feasible for this anomaly. Their clinical outcomes were universally dismal and all infants died within 3 days. Cardiac CT provides an accurate diagnosis of bilateral pulmonary vein atresia and leads to prompt treatment decision in these children. (orig.)
Atresia of the bilateral pulmonary veins: a rare and dismal anomaly identified on cardiac CT
International Nuclear Information System (INIS)
Goo, Hyun Woo; Park, Sang-Hyub; Koo, Hyun Jung; Cho, Young Hoon; Lee, Eunsol
2014-01-01
Imaging findings of bilateral pulmonary vein atresia have not been described. To describe cardiac CT findings and clinical outcomes of bilateral pulmonary vein atresia. Three newborns with bilateral pulmonary vein atresia were encountered at our institution during a period of 8 years. We evaluated prenatal echocardiographic findings, clinical presentations, postnatal echocardiographic findings, chest radiographic findings, cardiac CT findings and clinical outcomes. All newborns presented immediately after birth with severe cyanosis, respiratory distress and acidosis that were unresponsive to medical management. Prenatal and postnatal echocardiographic studies and chest radiography were misleading, inconclusive or nonspecific in making the diagnosis in these children; however cardiac CT clearly demonstrated atresia of the bilateral pulmonary veins with multiple small mediastinal collateral veins and pulmonary edema. Surgical treatments were not feasible for this anomaly. Their clinical outcomes were universally dismal and all infants died within 3 days. Cardiac CT provides an accurate diagnosis of bilateral pulmonary vein atresia and leads to prompt treatment decision in these children. (orig.)
Female Pelvic Vein Embolization: Indications, Techniques, and Outcomes
Energy Technology Data Exchange (ETDEWEB)
Lopez, Anthony James, E-mail: consultant@radiologist.co.uk [The Imaging Clinic (United Kingdom)
2015-08-15
Until recently, the main indication for pelvic vein embolization (PVE) in women was to treat pelvic venous congestion syndrome (PVC) but increasingly, patients with refluxing pelvic veins associated with leg varicosities are also being treated. A more unusual reason for PVE is to treat pelvic venous malformations, although such lesions may be treated with sclerotherapy alone. Embolotherapy for treating PVC has been performed for many years with several published studies included in this review, whilst an emerging indication for PVE is to treat lower limb varicosities associated with pelvic vein reflux. Neither group, however, has been subjected to an adequate randomized, controlled trial. Consequently, some of the information presented in this review should be considered anecdotal (level III evidence) at this stage, and a satisfactory ‘proof’ of clinical efficacy remains deficient until higher-level evidence is presented. Furthermore, a wide range of techniques not accepted by all are used, and some standardization will be required based on future mandatory prospective studies. Large studies have also clearly shown an unacceptably high recurrence rate of leg varicose veins following venous surgery. Furthermore, minimally or non-invasive imaging is now revealing that there is a refluxing pelvic venous source in a significant percentage of women with de novo leg varicose veins, and many more with recurrent varicosities. Considering that just over half the world’s population is female and a significant number of women not only have pelvic venous reflux, but also have associated leg varicosities, minimally invasive treatment of pelvic venous incompetence will become a common procedure.
Female Pelvic Vein Embolization: Indications, Techniques, and Outcomes
International Nuclear Information System (INIS)
Lopez, Anthony James
2015-01-01
Until recently, the main indication for pelvic vein embolization (PVE) in women was to treat pelvic venous congestion syndrome (PVC) but increasingly, patients with refluxing pelvic veins associated with leg varicosities are also being treated. A more unusual reason for PVE is to treat pelvic venous malformations, although such lesions may be treated with sclerotherapy alone. Embolotherapy for treating PVC has been performed for many years with several published studies included in this review, whilst an emerging indication for PVE is to treat lower limb varicosities associated with pelvic vein reflux. Neither group, however, has been subjected to an adequate randomized, controlled trial. Consequently, some of the information presented in this review should be considered anecdotal (level III evidence) at this stage, and a satisfactory ‘proof’ of clinical efficacy remains deficient until higher-level evidence is presented. Furthermore, a wide range of techniques not accepted by all are used, and some standardization will be required based on future mandatory prospective studies. Large studies have also clearly shown an unacceptably high recurrence rate of leg varicose veins following venous surgery. Furthermore, minimally or non-invasive imaging is now revealing that there is a refluxing pelvic venous source in a significant percentage of women with de novo leg varicose veins, and many more with recurrent varicosities. Considering that just over half the world’s population is female and a significant number of women not only have pelvic venous reflux, but also have associated leg varicosities, minimally invasive treatment of pelvic venous incompetence will become a common procedure
Directory of Open Access Journals (Sweden)
Sogawa K
2015-10-01
Full Text Available Kenji Sogawa, Taiji Nagaoka, Akihiro Ishibazawa, Atsushi Takahashi, Tomofumi Tani, Akitoshi Yoshida Department of Ophthalmology, Asahikawa Medical University, Asahikawa, Japan Purpose: To evaluate how the growth of neovascularization elsewhere (NVE was delineated in an eye with hemicentral retinal vein occlusion (CRVO using optical coherence tomography (OCT angiography. Patients and methods: We examined a 64-year-old man diagnosed with hemi-CRVO. The area around the occluded vein was scanned using a spectral-domain OCT device (RTVue XR Avanti. Blood flow was detected using the split-spectrum amplitude-decorrelation angiography (SSADA algorithm. Color fundus photography, fluorescein angiography (FA, and OCT angiography examinations were performed at the first visit and at 3 and 6 months postpresentation. Results: At the first visit, FA revealed delayed retinal venous filling and extensive areas of capillary nonperfusion. The patient underwent a trial of intravitreal ranibizumab injection (0.5 mg/0.05 mL for the treatment of macular edema. At 3 months postpresentation, there was no NVE around the occluded vein in the en-face SSADA image, but at 6 months, NVE appeared on the occluded veins. The en-face SSADA image showed the NVE structure in the fibrovascular membrane on the occluded vein more clearly than FA images. Conclusion: OCT angiography clearly visualized the sprouting of NVE in an eye with hemi-CRVO. New findings of the vascular structure of NVE in hemi-CRVO were revealed using the en-face SSADA algorithm. Keywords: OCT angiography, hemi-CRVO, NVE
Varicose vein - noninvasive treatment
... spider veins. These are small varicose veins. Salt water (saline) or a chemical solution is injected into the varicose vein. The vein will harden and then disappear. Laser treatment can be used on the surface of the skin. Small bursts ...
Tang, Jianlin; Abbas, Jihad; Hoetzl, Katherine; Allison, David; Osman, Mahamed; Williams, Mallory; Zelenock, Gerald B
2014-12-01
62 year old Caucasian female with pancreatic head mass abutting the superior mesenteric vein (SMV) presented with fine needle aspiration biopsy confirmed diagnosis of ductal adenocarcinoma. CT scan showed near complete obstruction of portal vein and large SMV collateral development. After 3 months of neoadjuvant therapy, her portal vein flow improved significantly, SMV collateral circulation was diminished. Pancreaticoduodenectomy (PD) and superior mesenteric portal vein (SMPV) confluence resection were performed; A saphenous vein interposition graft thrombosed immediately. The splenic vein remnant was distended and adjacent to the stump of the portal vein. Harvesting an internal jugular vein graft required extra time and using a synthetic graft posed a risk of graft thrombosis or infection. As a result, we chose to perform a direct anastomosis of the portal and splenic vein in a desperate situation. The anastomosis decompressed the mesenteric venous system, so we then ligated the SMV. The patient had an uneventful postoperative course, except transient ascites. She redeveloped ascites more than one year later. At that time a PET scan showed bilateral lung and right femur metastatic disease. She expired 15 months after PD. The lessons we learned are (1) Before SMPV confluence resection, internal jugular vein graft should be ready for reconstruction. (2) Synthetic graft is an alternative for internal jugular vein graft. (3) Direct portal vein to SMV anastomosis can be achieved by mobilizing liver. (4) It is possible that venous collaterals secondary to SMV tumor obstruction may have allowed this patient's post-operative survival.
Improving the Outcome of Vein Grafts: Should Vascular Surgeons Turn Veins into Arteries?
Isaji, Toshihiko; Hashimoto, Takuya; Yamamoto, Kota; Santana, Jeans M.; Yatsula, Bogdan; Hu, Haidi; Bai, Hualong; Jianming, Guo; Kudze, Tambudzai; Nishibe, Toshiya; Dardik, Alan
2017-01-01
Autogenous vein grafts remain the gold standard conduit for arterial bypass, particularly for the treatment of critical limb ischemia. Vein graft adaptation to the arterial environment, i.e., adequate dilation and wall thickening, contributes to the superior performance of vein grafts. However, abnormal venous wall remodeling with excessive neointimal hyperplasia commonly causes vein graft failure. Since the PREVENT trials failed to improve vein graft outcomes, new strategies focus on the ada...
Re-translocation of boron in broccoli and lupin during early reproductive growth
Energy Technology Data Exchange (ETDEWEB)
Marentes, E; Shelp, B J [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [USDA, Human Nutrition Research Center, Agricultural Research Service, ND (United States); [Spiers, G.A. Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)
1997-06-01
The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable {sup 10}B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether {sup 10}B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was {sup 10}B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs.
Re-translocation of boron in broccoli and lupin during early reproductive growth
International Nuclear Information System (INIS)
Marentes, E.; Shelp, B.J.; Vanderpool, R.A.
1997-01-01
The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable 10 B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether 10 B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was 10 B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs
Kisaran Inang dan Keragaman Gejala Infeksi Turnip Mosaic Virus
Directory of Open Access Journals (Sweden)
Eliza Suryati Rusli
2007-07-01
Full Text Available The incidence of mosaic disease on vegetable crops in Indonesia has been reported recently. The disease is caused by TuMV which is considered as a new and important virus on caisin and turnip in Indonesia. Field survey has been conducted to determine disease incidence in vegetable growing areas. Symptom variability and host range of TuMV was further studied through mechanical inoculation to cruciferae and solanaceae plants. Observation during field survey has proved that TuMV has infected caisin and turnip in Java and Bali. The highest intensity of mosaic disease i.e. 63,3% occurs in Tumpangan-Malang, followed by Denpasar Selatan and Bandungan-Semarang with the intensity of 30,5% and 19,0% respectively. TuMV infection causes different types of symptoms, such as: wrinkled leaf, blistered leaf, vein banding, vein clearing, leaf distortion and proliferation. The host range of TuMV involves those plants belong to cruciferae (cabbage, broccoli, caisin, turnip, cauliflower, chinese cabbage, pak coy; solanaceae (N. tabacum, N. benthamiana, N. glutinosa; and chenopodiaceae (C. amaranticolor. Furthermore, N. glutinosa can be used as differential host for TuMV isolates.
Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J
2013-01-01
The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.
Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J.
2013-01-01
The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein. PMID:24278278
Accessory hepatic vein: MR imaging
International Nuclear Information System (INIS)
Lee, Chang Hee; Rho, Tack Soo; Cha, Sang Hoon; Park, Cheol Min; Cha, In Ho
1995-01-01
To evaluate the MR appearance of the accessory hepatic veins. The study included 87 consecutive patients for whom abdominal MR images were obtained. The subjects who had liver lesion or hepatic vascular abnormalities were excluded. Couinaud classified accessory hepatic veins into inferior and middle right hepatic veins. Our major interests were evaluation of the incidence, morphology, and location of the accessory hepatic vein. Inferior right hepatic vein was demonstrated in 43 out of 87 patients (49%). The morphology was linear in 35 patients (80.5%), and V-shaped in 8 patients (19.5%). In 40 patients (93%), the inferior right hepatic vein was located in the posteroinferior aspect of the right lobe. Middle right hepatic vein was demonstrated in 7 out of 87 patients (8%). All were single linear in morphology, combined with the inferior right hepatic vein, and located between the right hepatic vein and inferior right hepatic vein. The accessory hepatic vein was demonstrated in 49% among the Korean adult population, and was located in posteroinferior portion of the liver, in 93%
Tang, Jianlin; Abbas, Jihad; Hoetzl, Katherine; Allison, David; Osman, Mahamed; Williams, Mallory; Zelenock, Gerald B.
2014-01-01
62 year old Caucasian female with pancreatic head mass abutting the superior mesenteric vein (SMV) presented with fine needle aspiration biopsy confirmed diagnosis of ductal adenocarcinoma. CT scan showed near complete obstruction of portal vein and large SMV collateral development. After 3 months of neoadjuvant therapy, her portal vein flow improved significantly, SMV collateral circulation was diminished. Pancreaticoduodenectomy (PD) and superior mesenteric portal vein (SMPV) confluence resection were performed; A saphenous vein interposition graft thrombosed immediately. The splenic vein remnant was distended and adjacent to the stump of the portal vein. Harvesting an internal jugular vein graft required extra time and using a synthetic graft posed a risk of graft thrombosis or infection. As a result, we chose to perform a direct anastomosis of the portal and splenic vein in a desperate situation. The anastomosis decompressed the mesenteric venous system, so we then ligated the SMV. The patient had an uneventful postoperative course, except transient ascites. She redeveloped ascites more than one year later. At that time a PET scan showed bilateral lung and right femur metastatic disease. She expired 15 months after PD. Conclusion The lessons we learned are (1) Before SMPV confluence resection, internal jugular vein graft should be ready for reconstruction. (2) Synthetic graft is an alternative for internal jugular vein graft. (3) Direct portal vein to SMV anastomosis can be achieved by mobilizing liver. (4) It is possible that venous collaterals secondary to SMV tumor obstruction may have allowed this patient's post-operative survival. PMID:25568802
Virus diseases in lettuce in the Mediterranean basin.
Moreno, Aranzazu; Fereres, Alberto
2012-01-01
Lettuce is frequently attacked by several viruses causing disease epidemics and considerable yield losses along the Mediterranean basin. Aphids are key pests and the major vectors of plant viruses in lettuce fields. Lettuce mosaic virus (LMV) is probably the most important because it is seed-transmitted in addition to be transmissible by many aphid species that alight on the crop. Tomato spotted wilt virus (TSWV) is another virus that causes severe damage since the introduction of its major vector, the thrips Frankliniella occidentalis. In regions with heavy and humid soils, Lettuce Mirafiori big-vein virus (LMBVV) can also produce major yield losses. Copyright © 2012 Elsevier Inc. All rights reserved.
Varicose Veins - Multiple Languages
... Concerns and Discomforts of Pregnancy: Varicose Veins - English MP3 Concerns and Discomforts of Pregnancy: Varicose Veins - 简体中文 (Chinese, Simplified (Mandarin dialect)) MP3 Concerns and Discomforts of Pregnancy: Varicose Veins - English ...
Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan
International Nuclear Information System (INIS)
Elamin, Malik El Mubarak Mohamed
1996-12-01
Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 μg/g. Pb 9-10 μg/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in the
Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan
Energy Technology Data Exchange (ETDEWEB)
Elamin, Malik El Mubarak Mohamed [Department of Biochemistry and Soil Science, Faculty of Agriculture, University of Khartoum, Khartoum (Sudan)
1996-12-01
Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 {mu}g/g. Pb 9-10 {mu}g/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in
Awad, E; Austin, B
2010-05-01
Feeding rainbow trout, Oncorhynchus mykiss (Walbaum), with 1% lupin, Lupinus perennis, mango, Mangifera indica, or stinging nettle, Urtica dioica, for 14 days led to reductions in mortality after challenge with Aeromonas hydrophila. In addition, there was significant enhancement in serum bactericidal activity, respiratory burst and lysozyme activity in the treatment groups compared to the controls. Use of lupin and mango led to the highest number of red blood and white blood cells in recipient fish, with use of stinging nettle leading to the highest haematocrit and haemoglobin values; the highest value of mean corpuscular volume and haemoglobin was in the control groups and those fed with stinging nettle.
Rurek, Michal
2010-08-18
Dehydrins represent hydrophilic proteins acting mainly during cell dehydration and stress response. Dehydrins are generally thermostable; however, the so-called dehydrin-like (dehydrin-related) proteins show variable thermolability. Both groups immunoreact with antibodies directed against the K-segment of dehydrins. Plant mitochondrial dehydrin-like proteins are poorly characterized. The purpose of this study was to extend previous reports on plant dehydrins by comparing the level of immunoprecipitated dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress. All the analyzed plant species showed constitutive accumulation of thermostable mitochondrial putative dehydrins ranging from 50 to 70 kDa. The mitochondrial dehydrin-like proteins observed in cauliflower and Arabidopsis ranged from 10 to 100 kDa and in lupin imbibed seeds and hypocotyls--from 20 to 90 kDa. Cold treatment increased mainly the accumulation of 10-100 kDa cauliflower and Arabidopsis dehydrin-like proteins, in the patterns different in cauliflower leaf and inflorescence mitochondria. However, in lupin mitochondria, cold affected mainly 25-50 kDa proteins and seemed to induce the appearance of some novel dehydrin-like proteins. The influence of frost stress on cauliflower leaf mitochondrial dehydrin- like proteins was less significant. The impact of heat stress was less significant in lupin and Arabidopsis than in cauliflower inflorescence mitochondria. Cauliflower mitochondrial dehydrin-like proteins are localized mostly in the mitochondrial matrix; it seems that some of them may interact with mitochondrial membranes. All the results reveal an unexpectedly broad spectrum of dehydrin-like proteins accumulated during some abiotic stress in the mitochondria of the plant species analyzed. They display only limited similarity in size to those reported previously in maize, wheat and rye
Energy Technology Data Exchange (ETDEWEB)
Beddy, P. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland)]. E-mail: pbeddy@eircom.net; Geoghegan, T. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland); Ramesh, N. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland); Buckley, O. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland); O' Brien, J. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland); Colville, J. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland); Torreggiani, W.C. [Department of Radiology, The Adelaide and Meath Hospital, Tallaght, Dublin 24 (Ireland)
2006-05-15
Purpose: Central venous cannulation via the common femoral vein is an important starting point for many interventions. The purpose of this study was to determine the optimum conditions for cannulation of the femoral vein and to compare these with the relative changes in the internal jugular vein. Methods: High-resolution 2D ultrasound was utilised to determine variability of the calibre of the femoral and internal jugular veins in 10 healthy subjects. Venous diameter was assessed during the Valsalva manoeuvre and in different degrees of the Trendelenburg position. Results: The Valsalva manoeuvre significantly increased the size of the femoral and internal jugular veins. There was a relatively greater increase in femoral vein diameter when compared with the internal jugular vein of 40 and 29%, respectively. Changes in body inclination (Trendelenburg position) did not significantly alter the luminal diameter of the femoral vein. However, it significantly increased internal jugular vein diameter. Conclusions: Femoral vein cannulation is augmented by the Valsalva manoeuvre but not significantly altered by the gravitational position of the subject.
Detection of beet soil-borne virus and beet virus Q in sugarbeet in Greece
Pavli, R.; Prins, M.; Skaracis, G.N.
2010-01-01
Sugar beet plants with typical rhizomania symptoms were collected from the five major cultivation zones of Greece. The presence of Beet necrotic yellow vein virus (BNYVV), the primary causal agent of the disease, was ascertained by DAS-ELISA in 38 out of 40 fields surveyed and the positive samples
Directory of Open Access Journals (Sweden)
Takahiro Ogura
Full Text Available The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.
Comparing of organic nutrients digestibility in the feed rations containing lupin and peas in horses
Pavel Šajdler; Ladislav Zeman
2005-01-01
The aim of this study was to find out and compare organic nutrients digestibility in feed rations containing different forage legumes in balance trials on horses. The trials were always performed on a group of six sports horses (weight of 495 to 742 kg). Six feed rations were tested, which contained different proportion of certain forage legume in empirical feed mixtures. Three feed mixtures contained white lupine seeds (WLS) – Lu 0 (0.01% WLS), Lu 7 (7% WLS), Lu 14 (14% WLS) and surplus thre...
CT findings of portal vein aneurysm
International Nuclear Information System (INIS)
Yang, Dal Mo; Chang, Mi Son; Yoon, Myung Hwan; Kim, Hak Soo; Kim, Hyung Sik; Chung, Hyo Sun; Chung, Jin Woo
1999-01-01
To describe the CT findings of portal vein aneurysm in eight patients. All patients included in this study (two men and six women) underwent CT examinations between October 1996 and June1998. Of these eight, three were suffering from hepatic disease and portal hypertension. We determined the location, shape, size, and characteristics of the lesions, and the presence or absence of portal vein anomaly. Seven patients had intrahepatic portal vein aneurysm (at the umbilical portion of the left portal vein in five patients, between the transverse and umbilical portion of the left portal vein in one, and at the bifurcation of the anterior and posterior branch of the right portal vein in one), while extrahepatic portal vein aneurysm, at the confluence of the superior mesenteric and splenic vein was found in only one. Lesions were cyst-shaped in seven cases and saccular in one, and showed well-circumscribed, markedly enhanced mass, which communicated with the portal vein and/or gives off major branches. Portal vein anomaly, in which the right anterior segmental portal vein originated from the umbilical portion of the left portal vein, was seen in three patients. In all three, intrahepatic portal vein aneurysm was present at the umbilical portion of the left portal vein, and in one, the umbilical protion of the left portal vein was located to the right of the Cantlic line. CT examination can help reveal portal vein aneurysm by detecting a well-circumscribed, markedly enhanced mass which communicates with the portal vein and/or gives off major branches
DEFF Research Database (Denmark)
Omland, Lars Haukali; Krarup, Henrik; Jepsen, Peter
2010-01-01
It is unknown whether mortality differs between patients with chronic hepatitis C virus (HCV) replication and those who cleared the virus after infection. We examined the impact of chronic HCV replication on mortality among Danish patients testing positive for HCV antibodies.......It is unknown whether mortality differs between patients with chronic hepatitis C virus (HCV) replication and those who cleared the virus after infection. We examined the impact of chronic HCV replication on mortality among Danish patients testing positive for HCV antibodies....
Effect of extrusion, espansion and toasting on the nutritional value of peas, faba beans and lupins
Directory of Open Access Journals (Sweden)
Filippo Rossi
2010-01-01
Full Text Available An assessment was made of the effect that different treatments (toasting, expansion, extrusion have on the nutritionalvalue of protein plants (pea, faba bean, lupin. In a randomized block design, feeds were screened for enzymaticdigestibility of starch and protein, N solubility and in vitro protein degradability. Expansion and extrusion cause increasedstarch enzymatic degradability while toasting produced virtually no effects. In peas this value increased from 11.80% inmeal to 39.70% in the extruded product; 85.37% is the percentage for the expanded product, while 10.90% is the starchdigestibility value for toasted peas. In faba beans the extrusion process increased starch digestibility from 11.39% to85.05%, while in extruded lupins a complete starch hydrolysis was obtained, while in the meal the polysaccharide digestionwas 54.48%.The expansion and extrusion processes significantly decreased rumen degradability during the first 8 hours of incubation.Toasted peas had lower degradability if compared with controls but not with the other treatments. The onlypotentially alternative source to soybean is the extruded faba bean. In spite of its lower protein content, this feed ischaracterized by a considerably lower in vitro protein degradability than soybean. This implies that the digestible foodprotein content is comparable (124.90 g/kg DM to that of soybean (109.78 g/kg DM and definitely higher than thatof all other protein plants.
A Rare Complication of the Thyroid Malignancies: Jugular Vein Invasion
International Nuclear Information System (INIS)
Dikici, Atilla Süleyman; Yıldırım, Onur; Er, Mehmet Emin; Kılıç, Fahrettin; Tutar, Onur; Kantarcı, Fatih; Mihmanlı, Ismail
2015-01-01
Unilateral invasion of the internal jugular vein (IJV) after subtotal thyroidectomy caused by local recurrence of papillary thyroid carcinoma is extremely rare. We report a case of papillary thyroid carcinoma which invades IJV with hypervascular tumor thrombus. We report a case of a 52-year-old woman with a history of previous thyroid operation who presented with a 2-month history of a painless, growing, hard, solitary mass on the left side of the neck. Clinical examination revealed also ipsilateral cervical lymphadenopathy. Radiological examination showed a necrotic and cystic mass arising from the operated area extending and invading the left jugular vein wall with hypervascular tumor thrombus. Cytological examination of the mass confirmed a papillary thyroid carcinoma (PTC) and enlarged metastatic lymph nodes. Therefore, total thyroidectomy with left neck dissection and segmental resection of the left internal jugular vein were performed, and the tumor thrombus was cleared successfully. Invasion of IJV with hypervascular tumor thrombosis is an extremely rare condition in papillary thyroid carcinoma. Thrombosis of IJV is probably underdiagnosed. Early-stage diagnosis is important for long-term survival rates
Comparison between mechanical properties of human saphenous vein and umbilical vein
Directory of Open Access Journals (Sweden)
Hamedani Borhan
2012-08-01
Full Text Available Abstract Background As a main cause of mortality in developed countries, Coronary Artery Disease (CAD is known as silent killer with a considerable cost to be dedicated for its treatment. Coronary Artery Bypass Graft (CABG is a common remedy for CAD for which different blood vessels are used as a detour. There is a lack of knowledge about mechanical properties of human blood vessels used for CABG, and while these properties have a great impact on long-term patency of a CABG. Thus, studying these properties, especially those of human umbilical veins which have not been considered yet, looks utterly necessary. Methods Umbilical vein, as well as human Saphenous vein, are respectively obtained after cesarean and CABG. First, histological tests were performed to investigate different fiber contents of the samples. Having prepared samples carefully, force-displacement results of samples were rendered to real stress–strain measurements and then a fourth-order polynomial was used to prove the non-linear behavior of these two vessels. Results Results were analyzed in two directions, i.e. circumferentially and longitudinally, which then were compared with each other. The comparison between stiffness and elasticity of these veins showed that Saphenous vein’s stiffness is much higher than that of umbilical vein and also, it is less stretchable. Furthermore, for both vessels, longitudinal stiffness was higher than that of circumferential and in stark contrast, stretch ratio in circumferential direction came much higher than longitudinal orientation. Conclusion Blood pressure is very high in the region of aorta, so there should be a stiff blood vessel in this area and previous investigations showed that stiffer vessels would have a better influence on the flow of bypass. To this end, the current study has made an attempt to compare these two blood vessels’ stiffness, finding that Saphenous vein is stiffer than umbilical vein which is somehow as stiff as
CT diagnosis of tumor thrombus of the renal vein and inferior vena cava
International Nuclear Information System (INIS)
Masuda, Fujio; Chen, Zuicho; Oishi, Yukihiko; Machida, Toyohei
1980-01-01
We used computed tomography (CT) for diagnosis in 4 cases of renal tumor associated with tumor thrombus of the renal vein and inferior vana cava. The results obtained are described below: A total of 4 cases consisting of 3 cases of renal cell carcinoma and one case of squamous cell carcinoma of the renal pelvis, treated at the Jikei University Hospital during the six months period from January to June of 1979, were studied. The affected side was right in 3 cases and left in one case. In all of the former cases the tumor thrombus was extending from the renal vein to the inferior vena cava, while in the latter case it was confined in the renal vein. All these 4 cases received CT together with renal arteriography and inferior venacavography, followed by nephrectomy, and were confirmed of the presence of tumor thrombus in the renal vein and inferior vena cava operatively. CT findings revealed a pronounced enlargement of the renal vein, and tumor thrombus of the renal vein was diagnosed in all of the 4 cases. In 2 of 3 cases in which tumor thrombus extended to the inferior vena cava, the dilated renal vein was found to be connected to the slightly dilated inferior vena cava, while in the remaining one case the outline of the inferior vena cava was obscure, showing no clear dilatation. After contrast enhancement, a filling defect was seen in the inferior vena cava. CT findings of tumor thrombus in the vein indicated a dilatation of the renal vein and inferior vena cava. In addition, a filling defect was found after contrast enhancement, suggesting that CT is helpful as a diagnostic aid. (author)
How do leaf veins influence the worldwide leaf economic spectrum? Review and synthesis.
Sack, Lawren; Scoffoni, Christine; John, Grace P; Poorter, Hendrik; Mason, Chase M; Mendez-Alonzo, Rodrigo; Donovan, Lisa A
2013-10-01
Leaf vein traits are implicated in the determination of gas exchange rates and plant performance. These traits are increasingly considered as causal factors affecting the 'leaf economic spectrum' (LES), which includes the light-saturated rate of photosynthesis, dark respiration, foliar nitrogen concentration, leaf dry mass per area (LMA) and leaf longevity. This article reviews the support for two contrasting hypotheses regarding a key vein trait, vein length per unit leaf area (VLA). Recently, Blonder et al. (2011, 2013) proposed that vein traits, including VLA, can be described as the 'origin' of the LES by structurally determining LMA and leaf thickness, and thereby vein traits would predict LES traits according to specific equations. Careful re-examination of leaf anatomy, published datasets, and a newly compiled global database for diverse species did not support the 'vein origin' hypothesis, and moreover showed that the apparent power of those equations to predict LES traits arose from circularity. This review provides a 'flux trait network' hypothesis for the effects of vein traits on the LES and on plant performance, based on a synthesis of the previous literature. According to this hypothesis, VLA, while virtually independent of LMA, strongly influences hydraulic conductance, and thus stomatal conductance and photosynthetic rate. We also review (i) the specific physiological roles of VLA; (ii) the role of leaf major veins in influencing LES traits; and (iii) the role of VLA in determining photosynthetic rate per leaf dry mass and plant relative growth rate. A clear understanding of leaf vein traits provides a new perspective on plant function independently of the LES and can enhance the ability to explain and predict whole plant performance under dynamic conditions, with applications towards breeding improved crop varieties.
Vein grafting in fingertip replantations.
Yan, Hede; Jackson, William D; Songcharoen, Somjade; Akdemir, Ovunc; Li, Zhijie; Chen, Xinglong; Jiang, Liangfu; Gao, Weiyang
2009-01-01
In this retrospective study, the survival rates of fingertip replantation with and without vein grafting were evaluated along with their postoperative functional and cosmetic results. One hundred twenty-one-fingertip amputations were performed in 103 patients between September 2002 and July 2007. Thirty-four amputated fingertips were replanted without vein grafting, while 87 amputated fingertips were replanted with vein grafting for arterial and/or venous repairs. The overall survival rates of the replantations with and without vein grafting were 90% (78/87) and 85% (29/34), respectively. The survival rates were 88% (36/41) with venous repair, 93% (25/27) with arterial repair, and 89% (17/19) with both. Nineteen patients without vein grafting and 48 patients with vein grafting had a follow-up period of more than one year. Good cosmetic and functional outcomes were observed in both groups of patients. The results show that vein grafting is a reliable technique in fingertip replantations, showing no significant difference (P > 0.05) in survival between those with and without vein grafting. Furthermore, no significant difference (P > 0.05) in survival was found between cases with vein grafts for arterial and/or venous repairs. In fingertip replantations with vein grafting, favorable functional and esthetic results can be achieved without sacrificing replantation survival. (c) 2009 Wiley-Liss, Inc.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
The design and fabrication of two portal vein flow phantoms by different methods
Energy Technology Data Exchange (ETDEWEB)
Yunker, Bryan E., E-mail: bryan.yunker@ucdenver.edu; Lanning, Craig J.; Shandas, Robin; Hunter, Kendall S. [Department of Bioengineering, University of Colorado – Denver/Anschutz, 12700 East 19th Avenue, MS 8607, Aurora, Colorado 80045 (United States); Dodd, Gerald D., E-mail: gerald.dodd@ucdenver.edu; Chang, Samuel; Scherzinger, Ann L. [Department of Radiology, University of Colorado – SOM, 12401 East 17th Avenue, Mail Stop L954, Aurora, Colorado 80045 (United States); Chen, S. James, E-mail: james.chen@ucdenver.edu [Department of Medicine, University of Colorado Denver, Colorado 80045 and Department of Medicine/Cardiology, University of Colorado – SOM, 12401 East 17th Avenue, Mail Stop B132, Aurora, Colorado 80045 (United States); Feng, Yusheng, E-mail: yusheng.feng@utsa.edu [Department of Mechanical Engineering, University of Texas – San Antonio, One UTSA Circle, Mail Stop: AET 2.332, San Antonio, Texas 78249–0670 (United States)
2014-02-15
Purpose: This study outlines the design and fabrication techniques for two portal vein flow phantoms. Methods: A materials study was performed as a precursor to this phantom fabrication effort and the desired material properties are restated for continuity. A three-dimensional portal vein pattern was created from the Visual Human database. The portal vein pattern was used to fabricate two flow phantoms by different methods with identical interior surface geometry using computer aided design software tools and rapid prototyping techniques. One portal flow phantom was fabricated within a solid block of clear silicone for use on a table with Ultrasound or within medical imaging systems such as MRI, CT, PET, or SPECT. The other portal flow phantom was fabricated as a thin walled tubular latex structure for use in water tanks with Ultrasound imaging. Both phantoms were evaluated for usability and durability. Results: Both phantoms were fabricated successfully and passed durability criteria for flow testing in the next project phase. Conclusions: The fabrication methods and materials employed for the study yielded durable portal vein phantoms.
Determination of human herpes simplex virus in clear cerebrospinal ...
African Journals Online (AJOL)
MICROBIO TA
simplex viruses (HSV) type 1 and 2 using a commercial multiplex PCR kit. ... CSF and is the method most widely used for diagno- sing viral CNS .... of HSV-2 and purple– proportion of samples with dual infection (both HSV-1 and HSV-2).
Directory of Open Access Journals (Sweden)
E. W. Kitajima
1965-01-01
Full Text Available Partículas esferoidais de 50-60mμ de diâmetro foram encontradas em preparações semipurificadas e em preparações rápidas de plantas de couve infetadas com um vírus que induz faixa amarela das nervuras (VFANC. Essas partículas têm um capsídeo aparentemente icosaedral, constituído de 92 capsômeros de 50-60 A de diâmetro. Quando tratadas com acetato de uranila, revelaram a existência de uma zona central, que se impregna fortemente com êste corante, possìvelmente constituída de nucleoproteína. Tais partículas não foram encontradas em plantas sadias, mas foram nelas detectadas, após serem inoculadas por união de tecidos, por meios mecânicos ou por afídeos com VFANC. Partículas similares foram encontradas em secções ultra-finas de tecido foliar de couve infetado com o VFANC, porém apresentavam um diâmetro ligeiramente menor, da ordem de 35-45mμ. Invariàvelmente, essas partículas foram encontradas em meio às inclusões citoplasmáticas de forma e dimensões variadas, constituídas de uma massa amorfa, granular e densa. Tais inclusões puderam também ser observadas em secções mais espêssas e montadas para microscopia óptica. Possìvelmente o VFANC pertence ao grupo do vírus do mosaico da couve-flôr, dada a semelhança na morfologia das partículas e nas moléstias induzidas.Spherical particles, 50-60 mμ, in diameter were found in partially purified preparalions, and also in quick preparations made from plants infected with a virus inducing yellow vein banding in cole (Brassica oleracea var. acephala . These particles apparently had an icosahedral capsid composed by 92 capsomeres, each with 50-60 A in diameter. Uranyl acetate treatment of these particles revealed a central zone, about 25-30 mμ in diameter, which bound strongly with the stain, indicating that this part of the particle is nucleoprotein. Such particles were absent in healthy plants, but they were detected after these plants were inoculated by
Schloß, Svenja; Wedell, Ines; Koch, Matthias; Rohn, Sascha; Maul, Ronald
2015-06-15
The hepatotoxin phomopsin A (PHO-A), a secondary metabolite mainly produced by the fungus Diaporthe toxica, occurs predominantly on sweet lupins. Along with the growing interest in sweet lupins for food and feed commodities, concerns have been raised about fungal infestations, and consequently, about the determination of PHO-A. High performance liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) represents the most suitable analytical technique for sensitive and selective detection of mycotoxins including PHO-A. However, isotopic labeled substances are needed as internal standards for a reliable and convenient quantification. As no isotope standard for PHO-A is currently available, a biosynthesis of fully (15)N6-labeled PHO-A was established by cultivation of D. toxica on defined media containing Na(15)NO3 and (15)N-labeled yeast extract as the only nitrogen sources. The identity of (15)N6-PHO-A was confirmed by high resolution mass spectrometry. The new (15)N6-labeled standard will facilitate the method development for PHO-A including a more accurate quantification by LC-MS/MS. Copyright © 2015 Elsevier Ltd. All rights reserved.
Vein matching using artificial neural network in vein authentication systems
Noori Hoshyar, Azadeh; Sulaiman, Riza
2011-10-01
Personal identification technology as security systems is developing rapidly. Traditional authentication modes like key; password; card are not safe enough because they could be stolen or easily forgotten. Biometric as developed technology has been applied to a wide range of systems. According to different researchers, vein biometric is a good candidate among other biometric traits such as fingerprint, hand geometry, voice, DNA and etc for authentication systems. Vein authentication systems can be designed by different methodologies. All the methodologies consist of matching stage which is too important for final verification of the system. Neural Network is an effective methodology for matching and recognizing individuals in authentication systems. Therefore, this paper explains and implements the Neural Network methodology for finger vein authentication system. Neural Network is trained in Matlab to match the vein features of authentication system. The Network simulation shows the quality of matching as 95% which is a good performance for authentication system matching.
Absence of Middle Hepatic Vein Combined with Retro-Aortic Left Renal Vein: a Very Rare Case Report
Directory of Open Access Journals (Sweden)
Sezer Akçer
2012-06-01
Full Text Available The hepatic and renal veins drain into the inferior vena cava. The upper group of hepatic veins consists of three veins which extend to the posterior face of the liver to join the inferior cava. The left renal vein passes anterior to the aorta just below the origin of the superior mesenteric artery. We detected a variation in the hepatic and renal veins in a multislice CT angiogram of a nine-year-old male patient in the Radiology Department of Afyon Kocatepe University Medical School. The upper group hepatic veins normally drains into the inferior vena cava as three separate trunks, namely the right, left and middle. In our case, we found that only the right and left hepatic veins existed and the middle hepatic vein was absent. Furthermore, the left renal vein, which normally passes anterior to the abdominal aorta, was retro-aortic. Left renal vein variations are of great importance in planning retroperitoneal surgery and vascular interventions. Knowledge of a patient’s hepatic vein and renovascular anatomy and determining their variations and anomalies are of critical importance to abdominal operations, transplantations and preoperative evaluation of endovascular interventions.
Directory of Open Access Journals (Sweden)
Jie Lu
Full Text Available Virus infection of plants may induce a variety of disease symptoms. However, little is known about the molecular mechanism of systemic symptom development in infected plants. Here we performed the first next-generation sequencing study to identify gene expression changes associated with disease development in tobacco plants (Nicotiana tabacum cv. Xanthi nc induced by infection with the M strain of Cucumber mosaic virus (M-CMV. Analysis of the tobacco transcriptome by RNA-Seq identified 95,916 unigenes, 34,408 of which were new transcripts by database searches. Deep sequencing was subsequently used to compare the digital gene expression (DGE profiles of the healthy plants with the infected plants at six sequential disease development stages, including vein clearing, mosaic, severe chlorosis, partial and complete recovery, and secondary mosaic. Thousands of differentially expressed genes were identified, and KEGG pathway analysis of these genes suggested that many biological processes, such as photosynthesis, pigment metabolism and plant-pathogen interaction, were involved in systemic symptom development. Our systematic analysis provides comprehensive transcriptomic information regarding systemic symptom development in virus-infected plants. This information will help further our understanding of the detailed mechanisms of plant responses to viral infection.
International Nuclear Information System (INIS)
Schellhammer, Frank; Esch, Jan Schulte am; Hammerschlag, Sascha; Knoefel, Wolfram Trudo; Fuerst, Guenter
2008-01-01
Portal vein thrombosis is an infrequent entity, which may cause high morbidity and mortality. We report a case of portal vein thrombosis due to benign stenosis following partial pancreatoduodenectomy with segmental replacement of the portal vein by a Gore-tex graft. Using a surgical access to jenunal veins, local thrombolysis, mechanical fragmentation of thrombus, and stent placement were successfully performed.
Real - time NASBA detection of strawberry vein banding virus
Czech Academy of Sciences Publication Activity Database
Hanzlíková-Vašková, Dana; Špak, Josef; Klerks, M. M.; Schoen, C. D.; Thompson, J. R.; Jelkmann, W.
2004-01-01
Roč. 110, - (2004), s. 213-221 ISSN 0929-1873 Grant - others:EU(XE) QLRT-PL99-1553 Institutional research plan: CEZ:AV0Z5051902 Keywords : strawberry virus * detection Subject RIV: EE - Microbiology, Virology Impact factor: 1.384, year: 2004
Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello
2013-08-09
Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity. Copyright © 2013 Elsevier Inc. All rights reserved.
Influence of organic N Sources on N transformation and uptake by lupine plants using 15N technique
International Nuclear Information System (INIS)
Abdel-Salam, A.A.; Gadalla, A.M.; Abdel- Aziz, H.A.; Galal, Y.G.M.; EL-degwy, S.M.
2008-01-01
A pot experiment was carried out under greenhouse conditions to evaluate the comparative efficiency and transformation of nitrogen applied either as mineral or organic forms. The obtained data showed that shoot dry weight was enhanced by compost and its mixture with leucaena. When organic sources were combined with 15 N, the leucaena.compost mixture (LC p ) gave the highest yield, and the other two were not significantly different from each other. Reinforcing the organic N with mineral N caused an average greater N.uptake over the non reinforced treatment. Similar trend was noticed with root system. Nitrogen uptake by roots was increased according to the order of LC > L > C. N derived from fertilizer (% Ndff) by lupine shoots was significantly affected by fertilizer addition either alone or reinforced with organic plant residues. Both, the portions (%) or absolute values (mg pot -1 ) of Ndff were increased by adding the organic residues. The highest value of Ndfs was recorded with application of leucaena followed by compost, then Leucaena + compost. Portion Ndfa reflected an effective response of lupines plants to Rhizobium inoculation. Addition of LC mixture combined with 15 N-fertilizer had enhanced the N 2 fixation and increased Ndfa value by about 66.7 % over those recorded with 15 N0 treatment. Organic amendment of leucaena could be an efficient source for N to infertile sandy soils
Determination of human herpes simplex virus in clear cerebrospinal ...
African Journals Online (AJOL)
The purpose of this study was to test CSF obtained from different regions of Rwanda for herpes simplex viruses (HSV) type 1 and 2 using a commercial multiplex PCR kit. CSF samples were obtained from patients with clinical suspicion of meningitis and encephalitis which may be caused by different microorganisms ...
Glasa, M; Matisová, J; Hricovský, I; Kúdela, O
1997-12-01
The susceptibility of peach GF 305 seedlings and herbaceous plants to five plum pox virus (PPV) isolates from orchards of western Slovakia was investigated. PPV was isolated from diseased plum, apricot and peach trees, and transmitted by chip-budding to peach GF 305. The herbaceous plants were infected by mechanical inoculation. The transmission was analysed by symptomatology and double sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Infected peaches developed leaf distortion, tissue clearing along the veins and small chlorotic spots (isolate BOR-3). With exception of BOR-3, the PPV isolates transmitted from peach caused local chlorotic spots on Chenopodium foetidum. The character of symptoms changed when a sap from PPV-infected Nicotiana benthamiana was used as virus inoculum. From N. benthamiana, the PPV isolates could be transmitted to Pisum sativum, cv. Colmo (light green mosaic), N. clevelandii and N. clevelandii x N. glutinosa hybrid (latent infection or chlorotic spots).
The economics of vein disease.
Sales, Clifford M; Podnos, Joan; Levison, Jonathan
2007-09-01
The management of cosmetic vein problems requires a very different approach than that for the majority of most other vascular disorders that occur in a vascular surgery practice. This article focuses on the business aspects of a cosmetic vein practice, with particular attention to the uniqueness of these issues. Managing patient expectations is critical to the success of a cosmetic vein practice. Maneuvering within the insurance can be difficult and frustrating for both the patient and the practice. Practices should use cost accounting principles to evaluate the success of their vein work. Vein surgery--especially if performed within the office--can undergo an accurate break-even analysis to determine its profitability.
Nakamura, Katsumasa; Sasaki, Tomonari; Ohga, Saiji; Yoshitake, Tadamasa; Terashima, Kotaro; Asai, Kaori; Matsumoto, Keiji; Shinoto, Makoto; Shioyama, Yoshiyuki; Nishie, Akihoro; Honda, Hiroshi
2014-11-01
There are few effective methods to detect or prevent the extravasation of injected materials such as chemotherapeutic agents and radiographic contrast materials. To investigate whether a thermographic camera could visualize the superficial vein and extravasation using the temperature gradient produced by the injected materials, an infrared thermographic camera with a high resolution of 0.04 °C was used. At the room temperature of 26 °C, thermal images and the time course of the temperature changes of a paraffin phantom embedded with rubber tubes (diameter 3.2 mm, wall thickness 0.8 mm) were evaluated after the tubes were filled with water at 15 °C or 25 °C. The rubber tubes were embedded at depths of 0 mm, 1.5 mm, and 3.0 mm from the surface of the phantom. Temperature changes were visualized in the areas of the phantom where the tubes were embedded. In general, changes were more clearly detected when greater temperature differences between the phantom and the water and shallower tube locations were employed. The temperature changes of the surface of a volunteer's arm were also examined after a bolus injection of physiological saline into the dorsal hand vein or the subcutaneous space. The injection of 5 ml room-temperature (26 °C) saline into the dorsal hand vein enabled the visualization of the vein. When 3 ml of room-temperature saline was injected through the vein into the subcutaneous space, extravasation was detected without any visualization of the vein. The subtraction image before and after the injection clearly showed the temperature changes induced by the saline. Thermography may thus be useful as a monitoring system to detect extravasation of the injected materials.
A rare complication of Ramsey Hunt Syndrome: Sınus vein thrombosis
Directory of Open Access Journals (Sweden)
Ramiz Ahmedov
2011-03-01
Full Text Available Ramsay-Hunt Syndrome (RHS is a rare affection characterized by peripheral facial paralysis (PFP, skin eruption in the auricular canal and cochleovestibular symptoms. It is produced by varicella-zoster virus(VZV reactivation at the geniculate ganglia. In elderly and immunocompromised individuals, the virus may reactivate to produce shingles (zoster. After zoster resolves, many elderly patients experience postherpetic neuralgia. Uncommonly, VZV can spread to large cerebral arteries to cause a spectrum of large-vessel vascular damage, ranging from vasculopathy to vasculitis, with stroke. In immunocompromised individuals, especially those with cancer or acquired immunodeficiency syndrome, deeper tissue penetration of the virus may occur (as compared with immunocompetent individuals, with resultant myelitis, small-vessel vasculopathy, ventriculitis, and meningoencephalitis. The polymerase chain reaction (PCR analysis of cerebrospinal fluid remains the mainstay for diagnosing the neurologic complications of VZV during life. We report a case of Ramsay Hunt syndrome complicated with cerebral venous thrombosis. Patient received treatment with acyclovir and anticoagulation. Early treatment with acyclovir therapy and anticoagulation could improve the recovery rate of facial nerve palsy and sinus vein thrombosis
Mieczkowska, A.; Jansman, A.J.M.; Kwakkel, R.P.; Smulikowski, S.
2005-01-01
Two hundred fifty six broiler chickens, 22-days-old, allocated to four groups of four replicate pens with 16 birds each, and six adult ileostomized roosters were used. Four diets containing maize starch and 550 g/kg whole or 458 g/kg dehulled lupin seeds (Lupinus luteus L. cv. Amulet) as the only
International Nuclear Information System (INIS)
Podleśny, J.
1999-01-01
The experiment went on over 6 weeks. Plants emergence depended on the temperature and pre-sowing laser irradiation of seeds. White lupine seeds germinated better under normal thermal conditions than in chilling stress. Triple irradiation of seeds showed the best advantageous effect improving the quality of plant emergence, irrespective of thermal conditions. The plants sprouted about 3-4 days earlier in comparison to plants from not irradiated seeds. Laser light positively affected also the height of plants, root length and dry matter yield of roots and aboveground parts
African Journals Online (AJOL)
OWNER
Deep Vein Thrombosis: Risk Factors and Prevention in Surgical Patients. Deep Vein ... preventable morbidity and mortality in hospitalized surgical patients. ... the elderly.3,4 It is very rare before the age ... depends on the risk level; therefore an .... but also in the post-operative period. ... is continuing uncertainty regarding.
Directory of Open Access Journals (Sweden)
P. Suchý
2006-01-01
Full Text Available The main aim of this experiment was to verify the suitability of two Polish varieties of dehulled lupin seed (the low-protein SONET variety and the high-protein JUNO variety as protein components to replace 50% of soya extract meal in feeding mixtures designed for the feeding of young broilers. The results of this experiment demonstrate that suitable treatment of lupin seed (dehulling may significantly increase its nutritional value. Dehulling provides a product (core in which the level of nitrogen-containing substances is by 27% higher than that in the original seed, providing an important protein component to be added in feeding mixtures for chickens. The experiment has also shown that production performance depends on the particular Lupinus variety used. Chickens fed on the JUNO variety seed (Group E1 reached a live weight of 2.332 kg on Day 40, which is comparable with the control group of chickens (2.337 kg; Group C. However, chickens in Group E2 fed on the SONET variety seed had a conclusively lower average weight (2.280 kg (P Lupinus genus is a major source of the amino acid arginine, which is often deficient in the feeding mixtures.
Stewart, Jared J; Polutchko, Stephanie K; Demmig-Adams, Barbara; Adams, William W
2018-01-01
An Arabidopsis thaliana accession with naturally low vein density, Eifel-5 (Ei-5), was compared to Columbia-0 (Col-0) with respect to rosette growth, foliar vein architecture, photosynthesis, and transpiration. In addition to having to a lower vein density, Ei-5 grew more slowly, with significantly lower rates of rosette expansion, but had similar capacities for photosynthetic oxygen evolution on a leaf area basis compared to Col-0. The individual foliar minor veins were larger in Ei-5, with a greater number of vascular cells per vein, compared to Col-0. This compensation for low vein density resulted in similar values for the product of vein density × phloem cell number per minor vein in Ei-5 and Col-0, which suggests a similar capacity for foliar sugar export to support similar photosynthetic capacities per unit leaf area. In contrast, the product of vein density × xylem cell number per minor vein was significantly greater in Ei-5 compared to Col-0, and was associated not only with a higher ratio of water-transporting tracheary elements versus sugar-transporting sieve elements but also significantly higher foliar transpiration rates per leaf area in Ei-5. In contrast, previous studies in other systems had reported higher ratios of tracheary to sieve elements and higher transpiration rate to be associated with higher - rather than lower - vein densities. The Ei-5 accession thus further underscores the plasticity of the foliar vasculature by illustrating an example where a higher ratio of tracheary to sieve elements is associated with a lower vein density. Establishment of the Ei-5 accession, with a low vein density but an apparent overcapacity for water flux through the foliar xylem network, may have been facilitated by a higher level of precipitation in its habitat of origin compared to that of the Col-0 accession.
Choi, Sun Hee; Hagiwara-Komoda, Yuka; Atsumi, Go; Shimada, Ryoko; Hisa, Yusuke; Naito, Satoshi
2013-01-01
In pea carrying cyv1, a recessive gene for resistance to Clover yellow vein virus (ClYVV), ClYVV isolate Cl-no30 was restricted to the initially infected cells, whereas isolate 90-1 Br2 overcame this resistance. We mapped the region responsible for breaking of cyv1-mediated resistance by examining infection of cyv1 pea with chimeric viruses constructed from parts of Cl-no30 and 90-1 Br2. The breaking of resistance was attributed to the P3 cistron, which is known to produce two proteins: P3, from the main open reading frame (ORF), and P3N-PIPO, which has the N-terminal part of P3 fused to amino acids encoded by a small open reading frame (ORF) called PIPO in the +2 reading frame. We introduced point mutations that were synonymous with respect to the P3 protein but nonsynonymous with respect to the P3N-PIPO protein, and vice versa, into the chimeric viruses. Infection of plants with these mutant viruses revealed that both P3 and P3N-PIPO were involved in overcoming cyv1-mediated resistance. Moreover, P3N-PIPO quantitatively affected the virulence of Cl-no30 in cyv1 pea. Additional expression in trans of the P3N-PIPO derived from Cl-no30, using White clover mosaic virus as a vector, enabled Cl-no30 to move to systemic leaves in cyv1 pea. Susceptible pea plants infected with chimeric ClYVV possessing the P3 cistron of 90-1 Br2, and which were therefore virulent toward cyv1 pea, accumulated more P3N-PIPO than did those infected with Cl-no30, suggesting that the higher level of P3N-PIPO in infected cells contributed to the breaking of resistance by 90-1 Br2. This is the first report showing that P3N-PIPO is a virulence determinant in plants resistant to a potyvirus. PMID:23616656
Moolhuijzen, P; Cakir, M; Hunter, A; Schibeci, D; Macgregor, A; Smith, C; Francki, M; Jones, M G K; Appels, R; Bellgard, M
2006-06-01
The identification of markers in legume pasture crops, which can be associated with traits such as protein and lipid production, disease resistance, and reduced pod shattering, is generally accepted as an important strategy for improving the agronomic performance of these crops. It has been demonstrated that many quantitative trait loci (QTLs) identified in one species can be found in other plant species. Detailed legume comparative genomic analyses can characterize the genome organization between model legume species (e.g., Medicago truncatula, Lotus japonicus) and economically important crops such as soybean (Glycine max), pea (Pisum sativum), chickpea (Cicer arietinum), and lupin (Lupinus angustifolius), thereby identifying candidate gene markers that can be used to track QTLs in lupin and pasture legume breeding. LegumeDB is a Web-based bioinformatics resource for legume researchers. LegumeDB analysis of Medicago truncatula expressed sequence tags (ESTs) has identified novel simple sequence repeat (SSR) markers (16 tested), some of which have been putatively linked to symbiosome membrane proteins in root nodules and cell-wall proteins important in plant-pathogen defence mechanisms. These novel markers by preliminary PCR assays have been detected in Medicago truncatula and detected in at least one other legume species, Lotus japonicus, Glycine max, Cicer arietinum, and (or) Lupinus angustifolius (15/16 tested). Ongoing research has validated some of these markers to map them in a range of legume species that can then be used to compile composite genetic and physical maps. In this paper, we outline the features and capabilities of LegumeDB as an interactive application that provides legume genetic and physical comparative maps, and the efficient feature identification and annotation of the vast tracks of model legume sequences for convenient data integration and visualization. LegumeDB has been used to identify potential novel cross-genera polymorphic legume
Directory of Open Access Journals (Sweden)
Łucja ePrzysiecka
2015-04-01
Full Text Available Lupins, like other legumes, have a unique biosynthesis scheme of 5-deoxy-type flavonoids and isoflavonoids. A key enzyme in this pathway is chalcone isomerase (CHI, a member of CHI-fold protein family, encompassing subfamilies of CHI1, CHI2, CHI-like (CHIL, and fatty acid-binding (FAP proteins. Here, two Lupinus angustifolius (narrow-leafed lupin CHILs, LangCHIL1 and LangCHIL2, were identified and characterized using DNA fingerprinting, cytogenetic and linkage mapping, sequencing and expression profiling. Clones carrying CHIL sequences were assembled into two contigs. Full gene sequences were obtained from these contigs, and mapped in two L. angustifolius linkage groups by gene-specific markers. Bacterial artificial chromosome fluorescence in situ hybridization approach confirmed the localization of two LangCHIL genes in distinct chromosomes. The expression profiles of both LangCHIL isoforms were very similar. The highest level of transcription was in the roots of the third week of plant growth; thereafter, expression declined. The expression of both LangCHIL genes in leaves and stems was similar and low. Comparative mapping to reference legume genome sequences revealed strong syntenic links; however, LangCHIL2 contig had a much more conserved structure than LangCHIL1. LangCHIL2 is assumed to be an ancestor gene, whereas LangCHIL1 probably appeared as a result of duplication. As both copies are transcriptionally active, questions arise concerning their hypothetical functional divergence. Screening of the narrow-leafed lupin genome and transcriptome with CHI-fold protein sequences, followed by Bayesian inference of phylogeny and cross-genera synteny survey, identified representatives of all but one (CHI1 main subfamilies. They are as follows: two copies of CHI2, FAPa2 and CHIL, and single copies of FAPb and FAPa1. Duplicated genes are remnants of whole genome duplication which is assumed to have occurred after the divergence of Lupinus, Arachis
Martingano, Daniel; Eisenberg, Justin; Aglialoro, George C
2016-01-01
In pregnant women, the risk of venous thromboembolism increases 4 to 5 fold over that in nonpregnant women. Deep vein thromboses in the calf occur in approximately 6% of cases, with a 20% incidence of propagation, but new imaging methods suggest a higher rate. Nevertheless, the management of isolated soleal vein thrombosis is currently one of the most debated issues in the field of venous thromboembolism, and a clear set of principles for the management of this unique clinical problem remains undefined. The authors present the case of a 37-year-old woman with a history of recurrent spontaneous abortions and cervical insufficiency who presented with a short cervix and acute right isolated soleal vein thrombosis. Long-term anticoagulantion therapy was recommended. Future studies on the risk of isolated soleal vein thrombosis propagation in the setting of pregnancy are required to identify the most effective treatment options for this clinical problem.
Directory of Open Access Journals (Sweden)
Jianlin Tang
2014-12-01
Conclusion: The lessons we learned are (1 Before SMPV confluence resection, internal jugular vein graft should be ready for reconstruction. (2 Synthetic graft is an alternative for internal jugular vein graft. (3 Direct portal vein to SMV anastomosis can be achieved by mobilizing liver. (4 It is possible that venous collaterals secondary to SMV tumor obstruction may have allowed this patient's post-operative survival.
Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei
2018-05-01
Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].
Chiao, F B; Resta-Flarer, F; Lesser, J; Ng, J; Ganz, A; Pino-Luey, D; Bennett, H; Perkins, C; Witek, B
2013-06-01
We investigated the patient characteristic factors that correlate with identification of i.v. cannulation sites with normal eyesight. We evaluated a new infrared vein finding (VF) technology device in identifying i.v. cannulation sites. Each subject underwent two observations: one using the conventional method (CM) of normal, unassisted eyesight and the other with the infrared VF device, VueTek's Veinsite™ (VF). A power analysis for moderate effect size (β=0.95) required 54 samples for within-subject differences. Patient characteristic profiles were obtained from 384 subjects (768 observations). Our sample population exhibited an overall average of 5.8 [95% confidence interval (CI) 5.4-6.2] veins using CM. As a whole, CM vein visualization were less effective among obese [4.5 (95% CI 3.8-5.3)], African-American [4.6 (95% CI 3.6-5.5 veins)], and Asian [5.1 (95% CI 4.1-6.0)] subjects. Next, the VF technology identified an average of 9.1 (95% CI 8.6-9.5) possible cannulation sites compared with CM [average of 5.8 (95% CI 5.4-6.2)]. Seventy-six obese subjects had an average of 4.5 (95% CI 3.8-5.3) and 8.2 (95% CI 7.4-9.1) veins viewable by CM and VF, respectively. In dark skin subjects, 9.1 (95% CI 8.3-9.9) veins were visible by VF compared with 5.4 (95% CI 4.8-6.0) with CM. African-American or Asian ethnicity, and obesity were associated with decreased vein visibility. The visibility of veins eligible for cannulation increased for all subgroups using a new infrared device.
International Nuclear Information System (INIS)
Jiang Zaibo; Shan Hong; Guan Shouhai; Zhu Kangshun; Huang Mingsheng; Li Zhengran; Guo Tiansheng; Liu Lang
2002-01-01
Objective: To evaluate the palliative therapeutic effects of transjugular intrahepatic portosystemic shunt (TIPS) in portal vein tumor thrombosis (PVTT) complicated with portal vein hypertension, and to discuss the technical skills. Methods: There were 14 cases of end-stage hepatocellular carcinoma complicated with PVTT and portal vein hypertension, the average age was 53.6 yr. There were 8 cases with complete occlusion of main portal vein, 6 eases with incomplete thrombosis, and 5 cases combined with portal vein cavernous transformation. One case had simple hemorrhage, 3 eases had intractable ascites, and 10 cases had hemorrhage accompanied by intractable ascites. Results: The procedure of TIPS was successful in 10 cases, the successful rate was about 71%. The mean portal vein pressure was reduced from 37.2 mm Hg to 18.2 mm Hg, with an average reduction of 19.0 mm Hg. After the procedure of TIPS, the ascites decreased, hemorrhage stopped and the clinical symptoms disappeared. The average survival period was 132.3 days. The procedure were failing in 4 cases. Conclusion: TIPS was an effective palliative therapeutic methods to control the hemorrhage and ascites aroused by hepatic carcinoma complicated with PVTT
International Nuclear Information System (INIS)
Turgeon, R.; Wimmers, L.E.
1988-01-01
Vein loading of exogenous [ 14 C]sucrose was studied using short uptake and wash periods to distinguish between direct loading into veins and loading via mesophyll tissue. Mature leaf tissue of Pisum sativum L. cv Little Marvel, or Coleus blumei Benth. cv Candidum, was abraded and leaf discs were floated on [ 14 C]sucrose solution for 1 or 2 minutes. Discs were then washed for 1 to 30 min either at room temperature or in the cold and were frozen, lyophilized, and autoradiographed. In P. sativum, veins were clearly labeled after 1 minute uptake and 1 minute wash periods. Autoradiographic images did not change appreciably with longer times of uptake or wash. Vein loading was inhibited by p-chloromercuribenzenesulfonic acid. These results indicate that uptake of exogenous sucrose occurs directly into the veins in this species. When C. blumei leaf discs were floated on [ 14 C]sucrose for 2 minutes and washed in the cold, the mesophyll was labeled but little, if any, minor vein loading occurred. When discs were labeled for 2 minutes and washed at room temperature, label was transferred from the mesophyll to the veins within minutes. These results indicate that there may be different patterns of phloem loading of photosynthetically derived sucrose in these two species
Characterization of active-site residues of the NIa protease from tobacco vein mottling virus.
Hwang, D C; Kim, D H; Lee, J S; Kang, B H; Han, J; Kim, W; Song, B D; Choi, K Y
2000-10-31
Nuclear inclusion a (NIa) protease of tobacco vein mottling virus is responsible for the processing of the viral polyprotein into functional proteins. In order to identify the active-site residues of the TVMV NIa protease, the putative active-site residues, His-46, Asp-81 and Cys-151, were mutated individually to generate H46R, H46A, D81E, D81N, C151S, and C151A, and their mutational effects on the proteolytic activities were examined. Proteolytic activity was completely abolished by the mutations of H46R, H46A, D81N, and C151A, suggesting that the three residues are crucial for catalysis. The mutation of D81E decreased kcat marginally by about 4.7-fold and increased Km by about 8-fold, suggesting that the aspartic acid at position 81 is important for substrate binding but can be substituted by glutamate without any significant decrease in catalysis. The replacement of Cys-151 by Ser to mimic the catalytic triad of chymotrypsin-like serine protease resulted in the drastic decrease in kcat by about 1,260-fold. This result might be due to the difference of the active-site geometry between the NIa protease and chymotrypsin. The protease exhibited a bell-shaped pH-dependent profile with a maximum activity approximately at pH 8.3 and with the abrupt changes at the respective pKa values of approximately 6.6 and 9.2, implying the involvement of a histidine residue in catalysis. Taken together, these results demonstrate that the three residues, His-46, Asp-81, and Cys-151, play a crucial role in catalysis of the TVMV NIa protease.
Directory of Open Access Journals (Sweden)
Avdhesh Bansal
2015-01-01
Full Text Available The chylothorax is not a common presentation, and bilateral chylothorax in patients with chronically high central venous pressure secondary to venous thrombosis is a rare in incidence. We reported a case of bilateral chylothorax in a patient of chronic deep vein thrombosis (DVT in central veins with chronic thromboembolic pulmonary hypertension who presented with 2 weeks history of increased breathlessness, bilateral chest discomfort and weakness. Work-up with chest X-ray and ultrasonography-chest showed gross left sided and mild right sided pleural effusion, thoracocentesis was consistent with chylothorax. Contrast enhanced computed tomography-chest showed multiple collateral formation of left side subclavian vein, venous Doppler showed old DVT in right and left subclavian veins and two-dimensional echocardiogram showed finding of severe pulmonary hypertension. After 24 h of fasting and conservative management, pleural drain became clear and decreased in the amount. Patient′s video assisted thoracoscopic surgery was done, and thoracic duct was ligated and cut down at diaphragmatic level and bilateral talc pleurodesis done. Patient improved clinically and radiologically.
Studies on soluble carbohydrates in yellow lupin (Lupinus luteus L. seeds of different age
Directory of Open Access Journals (Sweden)
Kazimierz Zalewski
2011-01-01
Full Text Available Yellow lupin seeds cv. Juno were stored under laboratory conditions for 2 month, 4, 6 and 8 years. Eighteen soluble carbohydrates were identified in embryonic axes and cotyledons of different age seeds. The concentration of soluble carbohydrates in analysed seeds ranged from 25 to 34% of dry mass. Axes contained more carbohydrates than cotyledons. Stachyose dominated in axes, and verbascose - in cotyledons. Other detected galactosides were: galactinol, galactosyl pinitols and galactosyl chiro-inositols (fagopyritols, but their content was several-fold lower than that of RFOs (in both axes and cotyledons tissues. The concentration of soluble carbohydrates indicated, that sucrose to RFOs mass ratio, or other changes in sugars composition are not indicators of seed storage.
Winter, Sebastian; Schlüter, Ralf; Hlousek, Felix; Buske, Stefan
2017-04-01
A test site for the design, implementation and operation of an underground in-situ bioleaching unit has been installed by the „Biohydrometallurgical Center for Strategic Elements" at the research and education mine "Reiche Zeche" of Technical University Bergakademie Freiberg. For this purpose an ore vein block will be developed and mined with the bio-hydrometallurgical in-situ leaching technology. As a site survey an underground seismic tomography experiment has been performed to investigate the spatial distribution of the ore vein within this block consisting mainly of gneiss and with dimensions of about 30 x 10 meters. The experiment was performed with a sledgehammer as source and 76 three-component receivers with source and receiver point intervals of about 1 m surrounding the approximately rectangular block. High precision laser scanning was performed to obtain accurate source and receiver positions which was particularly necessary to obtain reliable results due to the generally high wave velocities of the gneiss. The resulting seismic data set showed a high signal-to-noise ratio with clear first arrivals which were picked for all source and receiver combinations and subsequently used as input to a first-arrival tomographic inversion scheme. The resulting velocity model has very good ray coverage and shows well resolved high- and low-velocity regions within the block. These regions can be clearly assigned to mapped outcrops of the ore vein along the galleries surrounding the block, including a correlation of low velocities to fractured rock parts as well as high velocities to the undisturbed ore vein core, respectively. In summary the obtained velocity model and the inferred spatial distribution of the ore vein provides a good basis for planning and implementing the actual ore mining step using the envisaged bioleaching technology.
Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John
2005-01-01
We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA inter...
Concerns and Discomforts of Pregnancy - Varicose Veins
Concerns and Discomforts of Pregnancy - Varicose Veins Varicose veins are enlarged veins you may see on your ... Healthy Roads Media project www. healthyroadsmedia. org English - Concerns and Discomforts of Pregnancy (Varicose Veins) Last reviewed ...
Corrosion cast study of the canine hepatic veins.
Uršič, M; Vrecl, M; Fazarinc, G
2014-11-01
This study presents a detailed description of the distribution, diameters and drainage patterns of hepatic veins on the basis of the corrosion cast analysis in 18 dogs. We classified the hepatic veins in three main groups: the right hepatic veins of the caudate process and right lateral liver lobe, the middle hepatic veins of the right medial and quadrate lobes and the left hepatic veins of both left liver lobes and the papillary process. The corrosion cast study showed that the number of the veins in the Nomina Anatomica Veterinaria and most anatomical textbooks is underestimated. The number of various-sized hepatic veins of the right liver division ranged from 3 to 5 and included 1 to 4 veins from the caudate process and 2 to 4 veins from the right lateral liver lobe. Generally, in all corrosion casts, one middle-sized vein from the right part of the right medial lobe, which emptied separately in the caudal vena cava, was established. The other vein was a large-sized vein from the remainder of the central division, which frequently joined the common left hepatic vein from the left liver lobes. The common left hepatic vein was the largest of all the aforementioned hepatic veins.
Normal hepatic vein patterns on ultrasound
International Nuclear Information System (INIS)
Kim, Hae Jin; Chae, Yoo Soon; Park, Hea Yeoung; Park, Bok Hwan; Kim, Yang Sook
1987-01-01
Understanding of the anatomy of the hepatic vein is important in manipulation for transplantation of the liver, hepatectomy and the treatment of hepatic trauma with avulsion of the hepatic vein. Demonstrated of the inferior right hepatic vein (IRHV) is also important; in some cases of hepatocellular carcinoma, thrombus can be seen in the IRHV; in primary Budd-Chiari syndrome, the IRHV is main draining vein; during hepatectomy, the postero-inferior segment of the right lobe and draining IRHV can be preserved. For some 10 months ultrasound examination was done in a total of 124 patients with normal liver function with special emphasis on the hepatic vein, their branches, and the IRHV, and analysed in terms of branching pattern and relative size of the hepatic vein and the detection rate of the IRHV.
The Arabidopsis synaptotagmin SYTA regulates the cell-to-cell movement of diverse plant viruses
Directory of Open Access Journals (Sweden)
Asako eUchiyama
2014-11-01
Full Text Available Synaptotagmins are a large gene family in animals that have been extensively characterized due to their role as calcium sensors to regulate synaptic vesicle exocytosis and endocytosis in neurons, and dense core vesicle exocytosis for hormone secretion from neuroendocrine cells. Thought to be exclusive to animals, synaptotagmins have recently been characterized in Arabidopsis thaliana, in which they comprise a five gene family. Using infectivity and leaf-based functional assays, we have shown that Arabidopsis SYTA regulates endocytosis and marks an endosomal vesicle recycling pathway to regulate movement protein-mediated trafficking of the Begomovirus Cabbage leaf curl virus (CaLCuV and the Tobamovirus Tobacco mosaic virus (TMV through plasmodesmata (Lewis and Lazarowitz, 2010. To determine whether SYTA has a central role in regulating the cell-to-cell trafficking of a wider range of diverse plant viruses, we extended our studies here to examine the role of SYTA in the cell-to-cell movement of additional plant viruses that employ different modes of movement, namely the Potyvirus Turnip mosaic virus (TuMV, the Caulimovirus Cauliflower mosaic virus (CaMV and the Tobamovirus Turnip vein clearing virus (TVCV, which in contrast to TMV does efficiently infect Arabidopsis. We found that both TuMV and TVCV systemic infection, and the cell-to-cell trafficking of the their movement proteins, were delayed in the Arabidopsis Col-0 syta-1 knockdown mutant. In contrast, CaMV systemic infection was not inhibited in syta-1. Our studies show that SYTA is a key regulator of plant virus intercellular movement, being necessary for the ability of diverse cell-to-cell movement proteins encoded by Begomoviruses (CaLCuV MP, Tobamoviruses (TVCV and TMV 30K protein and Potyviruses (TuMV P3N-PIPO to alter PD and thereby mediate virus cell-to-cell spread.
The umbilical and paraumbilical veins of man.
Martin, B F; Tudor, R G
1980-03-01
During its transit through the umbilicus structural changes occur in the thick wall of the extra-abdominal segment of the umbilical vein whereby the components of the intra-abdominal segment acquire an essentially longitudinal direction and become arranged in fibro-elastic and fibro-muscular zones. The vein lumen becomes largely obliterated by asymmetrical proliferation of loose subendothelial conective tissue. The latter forms a new inner zone within which a small segment of the lumen persists in an eccentric position. This residual lumen transmits blood to the portal system from paraumbilical and systemic sources, and is retained in the upper part of the vein, even in old age. A similar process of lumen closure is observed in the ductus venosus. In early childhood the lower third of the vein undergoes breakdown, with fatty infiltration, resulting in its complete division into vascular fibro-elastic strands, and in old age some breakdown occurs in the outermost part of the wall of the upper two thirds. The paraumbilical veins are thick-walled and of similar structure to the umbilical vein. Together they constitute an accessory portal system which is confined between the layers of the falciform ligament and is in communication with the veins of the ventral abdominal wall. The constituents form an ascending series, namely, Burow's veins, the umbilical vein, and Sappey's inferior and superior veins. The main channel of Sappey's inferior veins may be the remnant of the right umbilical vein since it communicates with the right rectus sheath and often communicates directly with the portal system within the right lobe of the liver. The results are of significance in relation to clinical usage of the umbilical vein.
Idiopathic Bilateral External Jugular Vein Thrombosis.
Hindi, Zakaria; Fadhel, Ehab
2015-08-20
Vein thrombosis is mainly determined by 3 factors, which constitute a triad called Virchow's triad: hypercoagulability, stasis, and endothelial injury. Venous thrombosis commonly occurs in the lower extremities since most of the blood resides there and flows against gravity. The veins of the lower extremities are dependent on intact valves and fully functional leg muscles. However, in case of valvular incompetency or muscular weakness, thrombosis and blood stasis will occur as a result. In contrast, the veins of the neck, specially the jugulars, have distensible walls which allow flexibility during respiration. In addition, the blood directly flows downward towards the heart. Nevertheless, many case reports mentioned the thrombosis of internal jugular veins and external jugular veins with identified risk factors. Jugular vein thrombosis has previously been associated in the literature with a variety of medical conditions, including malignancy. This report is of a case of idiopathic bilateral external jugular vein thrombosis in a 21 year-old male construction worker of Southeast Asian origin with no previous medical history who presented with bilateral facial puffiness of gradual onset over 1 month. Doppler ultrasound and computed tomography were used in the diagnosis. Further work-up showed no evidence of infection or neoplasia. The patient was eventually discharged on warfarin. The patient was assessed after 6 months and his symptoms had resolved completely. Bilateral idiopathic external jugular veins thrombosis is extremely rare and can be an indicator of early malignancy or hidden infection. While previous reports in the literature have associated jugular vein thrombosis with malignancy, the present case shows that external jugular vein thrombosis can also be found in persons without malignancy.
Ternary diagram of extract proteins / solvent systems: Sesame, soybean and lupine proteins
Directory of Open Access Journals (Sweden)
Mohamed, S. S.
2004-09-01
Full Text Available Solvent extraction as a method of extracting protein from oilseed meals offers the advantage of higher efficiency. Unfortunately, the published literature points to the gap in the work concerned with the necessary equilibrium diagram to design due process equipment for such extracts. Initiated by this lack of basic knowledge, the present study has been undertaken to provide the equilibrium data for three different ternary systems, namely: sesame protein / sodium hydroxide solution system, soybean protein / sodium hydroxide solution system and lupine protein / sodium hydroxide solution system. These oilseed meals were selected because of their high protein content (53.4 %, 46.2 % and 42.3 % protein, respectively. The study also concentrated on the evaluation of the major parameters affecting the extraction process, i.e. the normality of the sodium hydroxide solution used as extracting solvent and the initial oilseed solvent to meal feeding ratio. The results obtained indicate that the best normality of sodium hydroxide solution used for extracting soybean and lupine protein is 0.02N, while 0.04N solution is required for extracting sesame protein. Also, operating at a liquid to solid feed ratio of 30:1 and 50:1 for soybean, sesame and lupine, respectively, is enough to reach a high protein extract. Correlations were presented for each locus of under flow compositions, graphically acquired, and the data are compared with those calculated by analytical solutions.La extracción con disolventes es un método de extracción de proteínas de las harinas de semillas oleaginosas que ofrece la ventaja de su elevada eficacia. Desafortunadamente, la bibliografía coincide en el vacío existente con respecto a los diagramas de equilibrio necesarios para el diseño de los equipos adecuados. Debido a esta falta de conocimientos, el presente estudio se ha llevado a cabo para obtener datos de tres sistemas ternarios: sistema proteína de sésamo / disolución de
Directory of Open Access Journals (Sweden)
Mohammad AKRAM
2010-09-01
Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.
Blood sampling from adrenal gland vein
International Nuclear Information System (INIS)
Sun Yong; Ni Caifang
2009-01-01
Adrenal gland vein sampling is an interventional method to get the blood samples from the adrenal gland vein. The blood is obtained via a catheter which is selectively inserted in the adrenal gland vein. This technique is mainly used to be diagnostic for primary hyperaldosteronism. A full knowledge of the anatomy and variations of the adrenal gland vein, serious preoperative preparation and skilled catheterization manipulation are necessary for obtaining sufficient blood sample and for reducing the occurrence of complications. Providing the physicians with definite diagnostic evidence and being technically feasible, adrenal gland vein sampling should become one of the routine examinations for clarifying the cause of primary hyperaldosteronism. (authors)
Directory of Open Access Journals (Sweden)
G Raghavendra Prasad
2013-01-01
Full Text Available Extrahepatic portal hypertension is not an uncommon disease in childhood, but isolated inferior mesenteric portal varices and lower gastrointestinal (GI bleed have not been reported till date. A 4-year-old girl presented with lower GI bleed. Surgical exploration revealed extrahepatic portal vein obstruction with giant inferior mesenteric vein and colonic varices. Inferior mesenteric vein was joining the superior mesenteric vein. The child was treated successfully with inferior mesenteric - inferior vena caval anastomosis. The child was relieved of GI bleed during the follow-up.
Zhang, Mei; Yan, Feng; Huang, Bin; Wu, Zhoupeng; Wen, Xiaorong
2017-01-01
Abstract Rationale: Primary leiomyosarcoma (LMS) of the vein is a rare tumor that arises from the smooth muscle cells of the vessel wall and has an extremely poor prognosis. This tumor can occur in vessels such as the inferior vena cava, great saphenous vein, femoral vein, iliac vein, popliteal vein, and renal vein; the inferior vena cava is the most common site. LMS of the femoral vein can result in edema and pain in the lower extremity; therefore, it is not easy to be differentiated from deep vein thrombosis (DVT). Moreover, virtually no studies have described the ultrasonographic features of LMS of the vein in detail. Patient concerns: We present a case of a 55-year-old woman with LMS of the left femoral vein that was misdiagnosed as having deep vein thrombosis (DVT) on initial ultrasonographic examination. The patient began to experience edema and pain in her left leg seven months previously. She was diagnosed as having DVT on initial ultrasonographic examination, but the DVT treatment that she had received for 7 months failed to improve the status of her left lower limb. Diagnoses: She subsequently underwent re-examination by means of a multimodal ultrasonographic imaging approach (regular B-mode imaging, color Doppler imaging, pulsed-wave Doppler imaging, contrast-enhanced ultrasonography), which confirmed a diagnosis of LMS. Interventions: This patient was treated successfully with surgery. Outcomes: This case demonstrates that use of multiple ultrasonographic imaging techniques can be helpful to diagnose LMS accurately. Detection of vasculature in a dilated vein filled with a heterogeneous hypoechoic substance on ultrasonography is a sign of a tumor. Lessons: The pitfall of misdiagnosing this tumor as DVT is a useful reminder. PMID:29145269
Duplex sonography of the near-surface leg veins
International Nuclear Information System (INIS)
Mendoza, E.
2007-01-01
The book contains the following contributions: The ultrasonograph, selection of the ultrasonic transducer, anatomy of the near-surface vein system, physiology of the near-surface vein system, varicose status classification, systematics of the duplex sonography of near-surface leg veins, provocational maneuver for the duplex sonographic varicose diagnostics, exploration of vena saphena parva, perforans veins, side branches, phlebitis, sonography for varicose therapy, postsurgical sonography, deep leg veins, examination of near-surface leg veins for the pathology of the deep vein system, differential diagnostic clarification of leg oedema from the phlebologic-lymphological view, diagnostic side features along the near-surface leg veins
Squara, Fabien; Tomi, Julien; Scarlatti, Didier; Theodore, Guillaume; Moceri, Pamela; Ferrari, Emile
2017-12-01
Axillary vein access for pacemaker implantation is uncommon in many centres because of the lack of training in this technique. We assessed whether the introduction of the axillary vein technique was safe and efficient as compared with cephalic vein access, in a centre where no operators had any previous experience in axillary vein puncture. Patients undergoing pacemaker implantation were randomized to axillary or cephalic vein access. All three operators had no experience nor training in axillary vein puncture, and self-learned the technique by reading a published review. Axillary vein puncture was fluoroscopy-guided without contrast venography. Cephalic access was performed by dissection of delto-pectoral groove. Venous access success, venous access duration (from skin incision to guidewire or lead in superior vena cava), procedure duration, X-ray exposure, and peri-procedural (1 month) complications were recorded. results We randomized 74 consecutive patients to axillary (n = 37) or cephalic vein access (n = 37). Axillary vein was successfully accessed in 30/37 (81.1%) patients vs. 28/37 (75.7%) of cephalic veins (P = 0.57). Venous access time was shorter in axillary group than in cephalic group [5.7 (4.4-8.3) vs. 12.2 (10.5-14.8) min, P < 0.001], as well as procedure duration [34.8 (30.6-38.4) vs. 42.0 (39.1-46.6) min, P = 0.043]. X-ray exposure and peri-procedural overall complications were comparable in both groups. Axillary puncture was safe and faster than cephalic access even for the five first procedures performed by each operator. Self-taught axillary vein puncture for pacemaker implantation seems immediately safe and faster than cephalic vein access, when performed by electrophysiologists trained to pacemaker implantation but not to axillary vein puncture. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For Permissions, please email: journals.permissions@oup.com.
Synthesis of graphene oxide and reduced graphene oxide by needle platy natural vein graphite
Energy Technology Data Exchange (ETDEWEB)
Rathnayake, R.M.N.M. [National Institute of Fundamental Studies, Kandy (Sri Lanka); Graduate School of Engineering, Toyota Technological Institute, 2-12-1 Hisakata, Tempaku, Nagoya 468-8511 (Japan); Wijayasinghe, H.W.M.A.C., E-mail: athulawijaya@gmail.com [National Institute of Fundamental Studies, Kandy (Sri Lanka); Pitawala, H.M.T.G.A. [Department of Geology, University of Peradeniya, Peradeniya (Sri Lanka); Yoshimura, Masamichi; Huang, Hsin-Hui [Graduate School of Engineering, Toyota Technological Institute, 2-12-1 Hisakata, Tempaku, Nagoya 468-8511 (Japan)
2017-01-30
Highlights: • The high purity of this form of needle platy natural vein graphite is expected to synthesize GO and rGO readily and efficiently, as compared to the synthetic and less pure graphite raw materials. • Production of large-scale GO and rGO for industrial applications can be achieved by using this highly crystalline NPG vein graphite, and it adds value to the natural resources. • High quality, few-layer, and cost effective GO and rGO can achieve great results using this low cost, natural graphite. - Abstract: Among natural graphite varieties, needle platy vein graphite (NPG) has very high purity. Therefore, it is readily used to prepare graphene oxide (GO) and reduced graphene oxide (rGO). In this study, GO and rGO were prepared using chemical oxidation and reduction process, respectively. The synthesized materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), and Fourier transform infrared (FTIR) spectroscopy. XRD studies confirmed the increase of the interlayer spacing of GO and rGO in between 3.35 to 8.66 A°. AFM studies showed the layer height of rGO to be 1.05 nm after the reduction process. TEM micrographs clearly illustrated that the prepared GO has more than 25 layers, while the rGO has only less than 15 layers. Furthermore, the effect of chemical oxidation and reduction processes on surface morphology of graphite were clearly observed in FESEM micrographs. The calculated R{sub O/C} of GO and rGO using XPS analysis are 5.37% and 1.77%, respectively. The present study revealed the successful and cost effective nature of the chemical oxidation, and the reduction processes for the production of GO and rGO out of natural vein graphite.
Synthesis of graphene oxide and reduced graphene oxide by needle platy natural vein graphite
International Nuclear Information System (INIS)
Rathnayake, R.M.N.M.; Wijayasinghe, H.W.M.A.C.; Pitawala, H.M.T.G.A.; Yoshimura, Masamichi; Huang, Hsin-Hui
2017-01-01
Highlights: • The high purity of this form of needle platy natural vein graphite is expected to synthesize GO and rGO readily and efficiently, as compared to the synthetic and less pure graphite raw materials. • Production of large-scale GO and rGO for industrial applications can be achieved by using this highly crystalline NPG vein graphite, and it adds value to the natural resources. • High quality, few-layer, and cost effective GO and rGO can achieve great results using this low cost, natural graphite. - Abstract: Among natural graphite varieties, needle platy vein graphite (NPG) has very high purity. Therefore, it is readily used to prepare graphene oxide (GO) and reduced graphene oxide (rGO). In this study, GO and rGO were prepared using chemical oxidation and reduction process, respectively. The synthesized materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), and Fourier transform infrared (FTIR) spectroscopy. XRD studies confirmed the increase of the interlayer spacing of GO and rGO in between 3.35 to 8.66 A°. AFM studies showed the layer height of rGO to be 1.05 nm after the reduction process. TEM micrographs clearly illustrated that the prepared GO has more than 25 layers, while the rGO has only less than 15 layers. Furthermore, the effect of chemical oxidation and reduction processes on surface morphology of graphite were clearly observed in FESEM micrographs. The calculated R_O_/_C of GO and rGO using XPS analysis are 5.37% and 1.77%, respectively. The present study revealed the successful and cost effective nature of the chemical oxidation, and the reduction processes for the production of GO and rGO out of natural vein graphite.
Hepatic VX2 tumor after portal vein occlusion in rabbits: evaluation with DSA
International Nuclear Information System (INIS)
Qi Yueyong; Zou Liguang; Dai Shuhua; Zhang Qichuan; Chen Lin; Huang Xiaobing; Huan Guangqiang
2006-01-01
Objective: To study the value of DSA for hepatic vascular anatomy, and to evaluate the efficacy of portal vein occlusion in rabbits with hepatic VX2 tumor. Methods: Twenty New Zealand white rabbits were randomly divided into two groups with 10 in each group, including test group A and positive control group B of ham operation. For the test group A, portal branch ligation (PBL) was performed for the left external branch after 3 weeks of the tumor implantation to the left external lobe. Two weeks later, the DSA of hepatic artery and portal vein were performed in all of the rabbits. Results: The total displaying effectiveness of the branches of hepatic artery by DSA was better than that by vascular perfusion. There was hypovascular blood supply to hepatic artery implantation of the tumor in the test group A, comparing with that of the group B. Conclusion: DSA can clearly display special details of the hepatic vascular anatomy in rabbits, and play an important role in post-procedural evaluation of the portal vein occlusion in rabbits. (authors)
Carré, B; Leclercq, B
1985-11-01
1. The cell-wall material of white lupin (Lupinus albus L.) cotyledon is characterized by low contents of cellulose (47 g/kg) and lignin (17 g/kg) and a high content of pectic substances (710 g/kg). The digestion of lupin cell-wall material by adult cockerels was estimated using gas-liquid chromatographic analyses of alditol acetates derived from polysaccharide sugars. The analyses were performed in the destarched water-insoluble fractions of feed and excreta. Digestibility measurements were carried out using a 3 d balance period including a 2 d feeding period and a 24 h final starvation period. 2. In the first experiment, six animals were given a diet containing 510 g white lupin cotyledon flour/kg which was the only source of protein and cell walls in the diet. The apparent digestibility of cell-wall components was near zero. 3. In the second experiment, three diets were prepared by diluting a fibre-free basal diet (diet A) by a semi-purified cell-wall preparation introduced at two different levels: 100 g/kg (diet B) and 200 g/kg (diet C). The semi-purified cell walls were prepared from the white lupin cotyledon flour used in the first experiment. The true digestibilities of polysaccharides measured in birds given diets B and C were near zero. It is suggested that the measurement of the neutral-detergent fibre (NDF) content according to Van Soest & Wine (1967) is not a suitable procedure for estimating the undigestible fibre content in poultry nutrition as the cell-wall pectic substances are not included in the NDF measurement. 4. Addition of the semi-purified cell-wall preparation (Expt 2) resulted in a slight decrease in the apparent protein digestibility. This decrease might be explained by the addition of undigestible cell-wall protein. 5. Addition of the semi-purified cell-wall preparation (Expt 2) had no effect on the apparent lipid digestibility. 6. The metabolizable energy values of the basal diet fraction of diets B and C were calculated assuming that
Chawla, Yogesh K; Bodh, Vijay
2015-03-01
Portal vein thrombosis is an important cause of portal hypertension. PVT occurs in association with cirrhosis or as a result of malignant invasion by hepatocellular carcinoma or even in the absence of associated liver disease. With the current research into its genesis, majority now have an underlying prothrombotic state detectable. Endothelial activation and stagnant portal blood flow also contribute to formation of the thrombus. Acute non-cirrhotic PVT, chronic PVT (EHPVO), and portal vein thrombosis in cirrhosis are the three main variants of portal vein thrombosis with varying etiological factors and variability in presentation and management. Procoagulant state should be actively investigated. Anticoagulation is the mainstay of therapy for acute non-cirrhotic PVT, with supporting evidence for its use in cirrhotic population as well. Chronic PVT (EHPVO) on the other hand requires the management of portal hypertension as such and with role for anticoagulation in the setting of underlying prothrombotic state, however data is awaited in those with no underlying prothrombotic states. TIPS and liver transplant may be feasible even in the setting of PVT however proper selection of candidates and type of surgery is warranted. Thrombolysis and thrombectomy have some role. TARE is a new modality for management of HCC with portal vein invasion.
Directory of Open Access Journals (Sweden)
Sandeep G Jakhere
2011-01-01
Full Text Available A communicating vein between the left renal vein and the left ascending lumbar vein has only rarely been reported in the imaging literature. There are very few reports of varicosity of this communicating vein. Nonetheless, awareness about this communicating vein is of utmost importance for surgeons performing aortoiliac surgeries and nephrectomies as it may pose technical difficulties during surgery or cause life-threatening retroperitoneal hemorrhage. Varicosity of this venous channel may be mistaken for paraaortic lymphadenopathy, adrenal pseudo-mass, or renal artery aneurysm. We report a case of a patient with varicosity of this communicating vein, which mimicked a left renal artery aneurysm. A novel hypothesis is also proposed to explain the relationship with abdominal pain.
Hepatitis B and A virus antibodies in alcoholic steatosis and cirrhosis
DEFF Research Database (Denmark)
Gluud, C; Aldershvile, J; Henriksen, J
1982-01-01
Sera from 74 alcoholics with cirrhosis and 63 alcoholics with steatosis were tested for antibody to hepatitis B surface antigen, to hepatitis B core antigen, and to hepatitis A virus by radioimmunoassay or enzyme-linked immunosorbent assay. No significant difference between the two groups...... of alcoholics could be found concerning the prevalence of these antibodies. The total group of patients had antibody to hepatitis B surface antigen or hepatitis B core antigen, or both, significantly (p less than 0.001) more often (26%) than sex- and age-matched controls (4%). No significant difference...... was found between patients and controls concerning the prevalence of antibody to hepatitis A virus (46% v 40%). In patients with cirrhosis, no correlation between wedged hepatic vein pressure or wedged-to-free hepatic vein pressure and any of the viral antibodies could be established. The present results...
Interventional treatment of iliac vein compression syndrome
International Nuclear Information System (INIS)
Li Xiaoqiang; Zhou Weiming; Nie Zhonglin; Yu Chaowen
2002-01-01
Objective: To explore the clinical significance of interventional treatment of iliac vein compression syndrome (IVCS). Methods: Percutaneous transluminal angioplasty (PTA) was performed in 40 cases. Thirty-three cases underwent endovascular stent implantation and 27 cases underwent second-stage left saphenous vein ligation and stripping and the valves of left femoral veins narrowing. Thirty-one cases were followed-up postoperatively and the duration was 6-66 months (mean 28 months). Results: The dilation of iliac veins was successful in 36 cases and there were god efficacy in all patients when they discharged from hospital. Followed-up during post-operation, all the limbs ulcers were cured and varicose veins disappeared. The skin pigmentation disappeared in 17 of 19 cases and markedly relieved in 2 cases. Left lower limb swelling disappeared in 15 of 17 cases and relieved in 2 cases. Conclusion: There is good efficacy in the interventional treatment of left iliac vein lesions, but second-stage procedures should be performed in secondary lesions of saphenous veins and valves of femoral veins
Infra-renal angles, entry into inferior vena cava and vertebral levels of renal veins.
Satyapal, K S
1999-10-01
Current norms for renal vasculature hold true in only half the population. Standard textbooks perpetuate old misconceptions regarding renal venous anatomy. This study is aimed to determine left and right infra-renal angles (L-IRA, R-IRA); entry level of renal veins into the inferior vena cava (IVC), and height of IVC under renal vein influence; and their vertebral level. One hundred morphologically normal en-bloc renal specimens randomly selected from post-mortem examinations were dissected and resin casted. IRA were also measured from venograms of 32 adult and 11 foetal cadavers, as were vertebral entry levels. IRA measurements (degrees) were as follows: left, 55 degrees +/- 16 degrees (20 degrees -102 degrees ); right, 60 degrees +/- 17 degrees (10 degrees -93 degrees ). Left vein entered IVC higher than right 54%, lower 36%, and opposite each other 10%. Vertical distance between lower borders of veins was 1.0 +/- 0.9 cm. Vertical distance of IVC under renal vein influence was 2.3 +/- 1.0 cm. Vertebral level of veins in adults lies between TI2-L2. In foetuses, IRA was as follows: left, 65 degrees +/- 12 degrees (45 degrees -90 degrees ); right, 58 degrees +/- 7 degrees (40 degrees -70 degrees ); vertebral level between T12 and L3. Similar IRA values from literature noted on right, 51 degrees (26 degrees -100 degrees ); differences on left, 77 degrees (43 degrees -94 degrees ), clearly differing from Williams et al. (Gray's Anatomy, 37(th) ed, 1989) statement that renal veins "open into the inferior vena cava almost at right angles." Large variations of IRA are not surprising since kidneys are considered normally "floating viscera," varying position with posture and respiratory movement as well as in live vs. cadaveric subjects. The entry level into the IVC also differs from Williams et al. This study uniquely quantitated actual height difference between lower borders of left and right veins. The data presented appears to be the first documentation of vertebral
The angiographic demonstration of hepatic vein obstruction
International Nuclear Information System (INIS)
Zu Maoheng; Xu Hao; Li Guojun; Gu Yuming; Wei Ning; Wang Cheng; Xu Wei
2004-01-01
Objective: To evaluate the angiographic feature of hepatic vein obstruction. Methods Forty-five patients (male 23, female 22, age 9-54 years) suffered from hepatic vein obstruction. The inferior vena cavography and the hepatic venography were performed in all cases. Results: IVC was free in 37 patients with hepatic vein obstruction, both IVC and HV were obstructed in 8 patients. The local or long stenosis of IVC was found in 31 inferior vena cavography. The diameter of IVC was normal in 12 patients. The sign of membranous dome was found in hepatic vein orifice in 5 cases and in accessory hepatic vein orifice in 4 cases. Intrahepatic venous collaterals were found in 45 cases. Conclusion: Hepatic vein obstruction can be reproached primarily in inferior vena cavography, the membranous dome is a direct sign of membranous obstruction of HV and AHV in inferior vena cavography. The selected hepatic venography can provide reliable evidence to diagnose hepatic vein obstruction
Directory of Open Access Journals (Sweden)
Javier Villacreses
2015-04-01
Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.
Directory of Open Access Journals (Sweden)
Felix Fuentes
2013-08-01
Full Text Available There is increasing demand world-wide, from government agencies and the private sector for cutting-edge biometric security technology that is difficult to breach but userfriendly at the same time. Some of the older tools, such as fingerprint, retina and iris scanning, and facial recognition software have all been found to have flaws and often viewed negatively because of many cultural and hygienic issues associated with them. Comparatively, mapping veins as a human barcode, a new technology, has many advantages over older technologies. Specifically, reproducing a three-dimensional model of a human vein system is impossible to replicate. Vein map technology is distinctive because of its state-of-the-art sensors are only able to recognize vein patterns if hemoglobin is actively flowing through the person
Deep vein thrombosis of the leg
Energy Technology Data Exchange (ETDEWEB)
Lee, Eun Hee; Rhee, Kwang Woo; Jeon, Suk Chul; Joo, Kyung Bin; Lee, Seung Ro; Seo, Heung Suk; Hahm, Chang Kok [College of Medicine, Hanyang University, Seoul (Korea, Republic of)
1987-04-15
Ascending contrast venography is the definitive standard method for the diagnosis of deep vein thrombosis (DVT) of the lower extremities. Authors analysed 22 cases of DVT clinically and radiographically. 1.The patients ranged in age from 15 to 70 yrs and the most prevalent age group was 7th decade (31%). There was an equal distribution of males and females. 2.In 11 cases of 22 cases, variable etiologic factors were recognized, such as abdominal surgery, chronic bedridden state, local trauma on the leg, pregnancy, postpartum, Behcet's syndrome, iliac artery aneurysm, and chronic medication of estrogen. 3.Nineteen cases out of 22 cases showed primary venographic signs of DVT, such as well-defined filling defect in opacified veins and narrowed, irregularly filled venous lumen. In only 3 cases, the diagnosis of DVT was base upon the segmental nonvisualization of deep veins with good opacification of proximal and distal veins and presence of collaterals. 4.Extent of thrombosis: 3 cases were confined to calf vein, 4 cases extended to femoral vein, and 15 cases had involvement above iliac vein. 5.In 17 cases involving relatively long segment of deep veins, propagation pattern of thrombus was evaluated by its radiologic morphology according to the age of thrombus: 9 cases suggested central or antegrade propagation pattern and 8 cases, peripheral or retrograde pattern. 6.None of 22 cases showed clinical evidence of pulmonary embolism. The cause of the rarity of pulmonary embolism in Korean in presumed to be related to the difference in major involving site and propagation pattern of DVT in the leg.
Deep vein thrombosis of the leg
International Nuclear Information System (INIS)
Lee, Eun Hee; Rhee, Kwang Woo; Jeon, Suk Chul; Joo, Kyung Bin; Lee, Seung Ro; Seo, Heung Suk; Hahm, Chang Kok
1987-01-01
Ascending contrast venography is the definitive standard method for the diagnosis of deep vein thrombosis (DVT) of the lower extremities. Authors analysed 22 cases of DVT clinically and radiographically. 1.The patients ranged in age from 15 to 70 yrs and the most prevalent age group was 7th decade (31%). There was an equal distribution of males and females. 2.In 11 cases of 22 cases, variable etiologic factors were recognized, such as abdominal surgery, chronic bedridden state, local trauma on the leg, pregnancy, postpartum, Behcet's syndrome, iliac artery aneurysm, and chronic medication of estrogen. 3.Nineteen cases out of 22 cases showed primary venographic signs of DVT, such as well-defined filling defect in opacified veins and narrowed, irregularly filled venous lumen. In only 3 cases, the diagnosis of DVT was base upon the segmental nonvisualization of deep veins with good opacification of proximal and distal veins and presence of collaterals. 4.Extent of thrombosis: 3 cases were confined to calf vein, 4 cases extended to femoral vein, and 15 cases had involvement above iliac vein. 5.In 17 cases involving relatively long segment of deep veins, propagation pattern of thrombus was evaluated by its radiologic morphology according to the age of thrombus: 9 cases suggested central or antegrade propagation pattern and 8 cases, peripheral or retrograde pattern. 6.None of 22 cases showed clinical evidence of pulmonary embolism. The cause of the rarity of pulmonary embolism in Korean in presumed to be related to the difference in major involving site and propagation pattern of DVT in the leg
Bilateral meandering pulmonary veins
Energy Technology Data Exchange (ETDEWEB)
Thupili, Chakradhar R.; Udayasankar, Unni [Pediatric Imaging, Imaging Institute Cleveland Clinic, Cleveland, OH (United States); Renapurkar, Rahul [Imaging Institute Cleveland Clinic, Thoracic Imaging, L10, Cleveland, OH (United States)
2015-06-15
Meandering pulmonary veins is a rare clinical entity that can be mistaken for more complex congenital syndromes such as hypogenetic lung syndrome. We report imaging findings in a rare incidentally detected case of bilateral meandering pulmonary veins. We briefly discuss the role of imaging in diagnosing this condition, with particular emphasis on contrast-enhanced CT. (orig.)
The veining phenomenon in unalloyed plutonium
International Nuclear Information System (INIS)
White, J.S.
1976-01-01
An investigation has been made of the veining phenomenon in unalloyed plutonium. The surface markings, or veins, which are sometimes seen on α-phase plutonium samples, arise as a result of the β→α transformation. As far as is known, this veining is unrivalled in its scale and form as compared with the solid state surface transformation effects shown by any other metal. The phenomenon has been explained by the application of the Le Chatelier principle to the phase change. In this instance, the large (10%) volume contraction associated with the β→α reaction and the anisotropy of the nonoclinic α-phase structure, account for the fact that the veins are so prominent in plutonium. On the basis of the proposed model, the veins can only form at temperatures where the transformation mechanism is non-martensitic. (Auth.)
Unusual termination of the right testicular vein | Woldeyes | Anatomy ...
African Journals Online (AJOL)
The testicular veins are formed by the veins emerging from the testis and epididymis forming the pampiniform venous plexus. The right testicular vein drains into inferior vena cava and the left testicular vein to the left renal vein. Testicular veins display a great variability with regard to their number, course and sites of ...
Directory of Open Access Journals (Sweden)
Halil Ibrahim Serin
2015-12-01
Full Text Available A 32-years old woman presented to the emergency room of Bozok University Research Hospital with right renal colic. Multidetector computed tomography (MDCT showed compression of the proximal ureter by the right ovarian vein and compression of the right distal ureter by the right external iliac vein. To the best of our knowledge, right proximal ureteral compression by the ovarian vein together with distal ureteral compression by the external iliac vein have not been reported in the literature. Ovarian vein and external iliac vein compression should be considered in patients presenting to the emergency room with renal colic or low back pain and a dilated collecting system.
A structural analysis of the Minas da Panasqueira vein network and related fracture generations
Jacques, Dominique; Vieira, Romeu; Muchez, Philippe; Sintubin, Manuel
2014-05-01
The Minas da Panasqueira is a world-class W-Cu-Sn vein-type deposit, situated within the Central Iberian Zone of the Palaeozoic Iberian Massif (Portugal). The deposit consists of a network of subhorizontal, sill-like massive quartz veins situated above the southwestern extremity of a greisen cupola, within regionally metamorphosed, isoclinally folded, lower-greenschist slates and greywackes. The greisen cupola is part of a larger intrusive complex, emplaced during the late- to post-tectonic stage of the Variscan orogeny. The late-Variscan granitoid(s) underlying the Panasqueira deposit is considered to have served as a major metal source. The structure of the network of subhorizontal extension veins, consists of numerous planar vein lobes that are separated by host-rock bridges and merge at branch-points. A structural analysis demonstrates that not only within the Panasqueira mine, but also on a more regional scale, one or more generations of flat-lying fractures are present. The veins clearly exploited these pre-existing discontinuities, as confirmed by (1) the vein geometry being directly influenced by variations in the orientation of the initial fracture sets and (2) the geometry of the rock bridges and overlapping vein morphologies, consistently showing straight-line propagating crack tips. If veining is governed by a preferential, strongly developed anisotropy in the host rock, the hypothesis of vein lobes and rock bridges forming during propagation of the parent crack by tip-line bifurcation and confinement processes (Foxford et al., 2000) does not seem plausible. Instead, we propose that the rock bridges formed from several, initially separate and small veinlets that eventually overlapped in an en echelon arrangement during progressive propagation and inflation. Bending of the rock bridges and incipient vein rotation indicate that veining occurred near the brittle-ductile transition. Using a quantitative analysis of bridge orientations, vein aspect ratios
Shida, Takuya; Umezu, Mitsuo; Iwasaki, Kiyotaka
2018-06-01
We analyzed the adverse events associated with an off-label use of arterial stents and CE-marked iliac vein stents for the treatment of iliac venous thromboembolism and investigated their relationships with the anatomical features of the iliac vein, to gain insights into the development of a better iliac vein stent. Reports of adverse events following the use of stents in the iliac vein were retrieved from the Manufacturer and User Facility Device Experience (MAUDE) database that contain suspected device-associated complications reported to the Food and Drug Administration. Data from 2006 to 2016 were investigated. The literature analysis was also conducted using PubMed, Cochrane Library, EMBASE, and Web of Science focusing on English articles published up to 4 October 2016. The analysis of 88 adverse events from the MAUDE database and 182 articles from the literature revealed that a higher number of adverse events had been reported following the use of arterial stents in the iliac vein compared to CE-marked iliac vein stents. While stent migration and shortening were reported only for the arterial stents, stent fracture and compression occurred regardless of the stent type, even though a vein does not pulsate. A study of the anatomical features of the iliac vein implies that bending, compression, and kink loads are applied to the iliac vein stents in vivo. For designing, developing, and pre-clinical testing of stents intended for use in the iliac vein, the above mechanical load environments induced by the anatomical features should be considered.
Preoperative mapping of the saphenous vein
DEFF Research Database (Denmark)
Levi-Mazloum, Niels Donald; Sillesen, H; Nielsen, Tina G
1995-01-01
A consecutive series of 92 patients had their greater saphenous vein assessed with duplex ultrasound scanning prior to planned infrainguinal bypass procedures. A naturally occurring optimal vein diameter was discovered. It was significantly correlated with higher postoperative ankle-brachial pres......-brachial pressure index (ABI) and lesser early postoperative thrombosis. A significant linear regression was found between the pre and postoperative vein diameter....
Directory of Open Access Journals (Sweden)
Alyssa Flobinus
2018-03-01
Full Text Available The RNA3 species of the beet necrotic yellow vein virus (BNYVV, a multipartite positive-stranded RNA phytovirus, contains the ‘core’ nucleotide sequence required for its systemic movement in Beta macrocarpa. Within this ‘core’ sequence resides a conserved “coremin” motif of 20 nucleotides that is absolutely essential for long-distance movement. RNA3 undergoes processing steps to yield a noncoding RNA3 (ncRNA3 possessing “coremin” at its 5′ end, a mandatory element for ncRNA3 accumulation. Expression of wild-type (wt or mutated RNA3 in Saccharomyces cerevisiae allows for the accumulation of ncRNA3 species. Screening of S. cerevisiae ribonuclease mutants identified the 5′-to-3′ exoribonuclease Xrn1 as a key enzyme in RNA3 processing that was recapitulated both in vitro and in insect cell extracts. Xrn1 stalled on ncRNA3-containing RNA substrates in these decay assays in a similar fashion as the flavivirus Xrn1-resistant structure (sfRNA. Substitution of the BNYVV-RNA3 ‘core’ sequence by the sfRNA sequence led to the accumulation of an ncRNA species in yeast in vitro but not in planta and no viral long distance occurred. Interestingly, XRN4 knockdown reduced BNYVV RNA accumulation suggesting a dual role for the ribonuclease in the viral cycle.
The CT appearance of the superior intercostal veins
International Nuclear Information System (INIS)
Lund, G.
1982-01-01
The CT appearance of the superior intercostal veins is described. The veins are more frequently seen on the right side. The right superior intercostal vein should not be misinterpreted as a paraspinal mass when it is large or bulges into the contour of the right lung. A case of stenosis of the left brachiocephalic vein is shown, where the left superior intercostal vein serves as a collateral. (orig.)
International Nuclear Information System (INIS)
Ibukuro, Kenji; Mori, Koichi; Tsukiyama, Toshitaka; Inoue, Yoshihiro; Iwamoto, Yukako; Tagawa, Kazumi
1999-01-01
We encountered a patient with gastric varix draining not via the usual left suprarenal vein but via the left inferior phrenic vein joining the left hepatic vein. Transfemoral balloon-occluded retrograde transvenous obliteration (BRTO) of the varix was performed under balloon occlusion of the left inferior phrenic vein via the left hepatic vein and retrograde injection of the sclerosing agent (5% of ethanolamine oleate) into the gastric varix. Disappearance of the gastric varix was confirmed on endoscopic examination 2 months later.
Fungal transmission of plant viruses.
Campbell, R N
1996-01-01
Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.
Directory of Open Access Journals (Sweden)
M. Berner
Full Text Available : Background: The complication of vein patch rupture is well described after carotid patch angioplasty; however, there is a paucity of data about the safety of vein patch closure in the setting of femoral endarterectomy. Methods/results: From May 2012 to May 2015, 115 femoral endarterectomies with patch closure were performed. A patch rupture occurred in three cases (2.6% with a mortality rate of 66% (2/3. In all cases the greater saphenous vein below the knee was used as patch material. Discussion/conclusion: Vein patches, particularly from small calibre veins, should be excluded in femoral endarterectomy procedures as they pose a substantial risk of rupture. Keywords: Angioplasty, Patch rupture, Femoral artery, Patch, Great saphenous vein
Varicose Veins: Role of Mechanotransduction of Venous Hypertension
Atta, Hussein M.
2012-01-01
Varicose veins affect approximately one-third of the adult population and result in significant psychological, physical, and financial burden. Nevertheless, the molecular pathogenesis of varicose vein formation remains unidentified. Venous hypertension exerted on veins of the lower extremity is considered the principal factor in varicose vein formation. The role of mechanotransduction of the high venous pressure in the pathogenesis of varicose vein formation has not been adequately investigated despite a good progress in understanding the mechanomolecular mechanisms involved in transduction of high blood pressure in the arterial wall. Understanding the nature of the mechanical forces, the mechanosensors and mechanotransducers in the vein wall, and the downstream signaling pathways will provide new molecular targets for the prevention and treatment of varicose veins. This paper summarized the current understanding of mechano-molecular pathways involved in transduction of hemodynamic forces induced by blood pressure and tries to relate this information to setting of venous hypertension in varicose veins. PMID:22489273
Kortekaas, J.A.; Ergonul, O.; Moormann, R.J.M.
2010-01-01
ARBO-ZOONET is an international network financed by the European Commission's seventh framework program. The major goal of this initiative is capacity building for the control of emerging viral vector-borne zoonotic diseases, with a clear focus on West Nile virus, Rift Valley fever virus, and
[Deep vein thrombosis prophylaxis.
Sandoval-Chagoya, Gloria Alejandra; Laniado-Laborín, Rafael
2013-01-01
Background: despite the proven effectiveness of preventive therapy for deep vein thrombosis, a significant proportion of patients at risk for thromboembolism do not receive prophylaxis during hospitalization. Our objective was to determine the adherence to thrombosis prophylaxis guidelines in a general hospital as a quality control strategy. Methods: a random audit of clinical charts was conducted at the Tijuana General Hospital, Baja California, Mexico, to determine the degree of adherence to deep vein thrombosis prophylaxis guidelines. The instrument used was the Caprini's checklist for thrombosis risk assessment in adult patients. Results: the sample included 300 patient charts; 182 (60.7 %) were surgical patients and 118 were medical patients. Forty six patients (15.3 %) received deep vein thrombosis pharmacologic prophylaxis; 27.1 % of medical patients received deep vein thrombosis prophylaxis versus 8.3 % of surgical patients (p < 0.0001). Conclusions: our results show that adherence to DVT prophylaxis at our hospital is extremely low. Only 15.3 % of our patients at risk received treatment, and even patients with very high risk received treatment in less than 25 % of the cases. We have implemented strategies to increase compliance with clinical guidelines.
Anomalous adrenal vein anatomy complicating the evaluation of primary hyperaldosteronism
Directory of Open Access Journals (Sweden)
Kaitlin M. Ford, BS
2018-02-01
Full Text Available Adrenal vein development in utero occurs concurrently with the development of the inferior vena cava, the renal veins, and the gonadal veins. The embryologic formation of these veins involves communication of various venous systems. Although the left adrenal-renal vein complex is most commonly described as a shared emptying of the left adrenal vein and the left inferior phrenic vein into the left renal vein, there have been reports of numerous anatomic variations of this complex. In this report, we present a case of a rare variant of the left adrenal vein, in which the left adrenal vein empties into the left gonadal vein, which takes an atypical course superolateral to the left kidney.
On dynamics of uranium vein mineralization
International Nuclear Information System (INIS)
Petrosyan, R.V.
1981-01-01
The formation of urnaium vein deposits and the essence of consanguinity of the mineralization and wall metasomatites are considered. The formation of uranium mineralization is analysed from the positions of Korzhinsky D. S. : the formation of metasomatite aureole and associated vein ores take place as a result of the development of one solution flow while the formation of mineral vein associations occurs on the background of contineous filtration of the solution during metasomato is due to a repeated (pulse) half-opening of fractures and their filling with a part of filtrating solution. The analysis of the available information on the example of two different uranium manifestations permits to reveal certain relations both in the character of wall rock alterations and between the metasomatosis and the formation of ore minerals in veins. The conclusion is made that spatial-time correlations of vein formations with wall metasomatites attest that the pulse formation of ores in veinlets occurs on the background and in interrelation with a consecutive precipitation of components in the aureole volume. The analysis of element migration dynamics in wall aureole carried out from the positions of the Korzhinsky hypothesis of the advance wave of acid components that takes into account the interaction of continuous and pulse mechanisms of solution movement permits to avoid contradictions when interpreting the processes of wall rock alterations and vein ore-forming, and permits to make a common scheme of vein ore-genesis [ru
Annulate lamellae in phloem cells of virus-infected Sonchus plants.
Steinkamp, M P; Hoefert, L L
1977-07-01
The occurrence of annulate lamellae (AL) in differentiating phloem of Sonchus oleraceus (Compositae) singly infected with sowthistle yellow vein virus (SYVV) and doubly infected with a combination of SYVV and beet yellow stunt virus is documented by electron microscopy. Cell types in which AL were found were immature sieve elements and phloem parenchyma cells. AL were found only in cells that also contained SYVV particles although a direct association between the virus and AL was not apparent. The substructure of the AL and the relationships between the AL and the nuclear envelope and endoplasmic reticulum are similar to those reported in other descriptions of this organelle in the literature. This report appears to be the first one concerning the association of AL with a plant virus disease.
A Morphological Insight of the Femoral Vein
Directory of Open Access Journals (Sweden)
Ferreira AH
2015-10-01
Full Text Available A total of 13 cadavers (12 men and 1 women of different age group were used for the study with the purpose to determine the prevalence of femoral vein duplication. Lower limb regions (26 sides were carefully dissected as per the standard dissection procedure. Femoral vein (unitruncular was found in 96.15% of specimen. Bitruncular configurations (total bifidity was found in a male cadaver of 75 years of age (3.85%. In the right lower limb, 6.5 cms below the inguinal ligament the femoral vein - lateral ramus received the lateral circumflex femoral vein, and the medial circumflex femoral vein, and the lateral and medial ramii formed a common venous trunk. Knowledge of the truncular venous variations is important to recognize and avoid potential errors in diagnosis of deep venous thrombosis of the femoral vein, in the case of an occluded duplicated trunk.
Levent, Hacer; Bilgiçli, Nermin
2011-11-01
In the present study, the effect of debittered lupin flour (LF) and whole buckwheat flour (BF) on the nutritional and sensory quality of gluten-free cake was studied. LF (10, 20, 30 and 40%) and BF (5, 10, 15 and 20%) were partially replaced with corn starch and rice flour mixture (1:1 w/w) in the gluten-free cake recipe. LF increased the protein, calcium, iron, manganese, phosphorus and zinc contents of the cakes, while BF caused a significant increase (P cakes. According to the overall acceptability rating, it was concluded that gluten-free cake could be produced with satisfactory results by the addition of LF and BF up to 30% and 10%, respectively.
Cavernous transformation of the portal vein
International Nuclear Information System (INIS)
Lehotska, V.; Dostalova, K.; Durkovsky, A.; Samal, V.
1995-01-01
In this contribution, the authors give an account of a rare case of a cavernous transformation of the portal vein that may have originated secondarily in a proliferative hematogenous disease with a polyglobulia and thrombosis in the periferal blood count as well as development of portal hypertension of a prehepatal type. The state of hyper-coagulation in a myeloproliferative disease may have lead to a chronic thrombosis of the portal vein with a subsequent malformation of the portal vein in terms of a cavernous transformation of the portal vein. The case is an interesting one because of the discrepancy between the gravity of the thrombotic complication and slightness of the symptoms in the clinical picture. The authors point out the importance of ultrasonography and computed tomography examination following the intravenous application of a water solution of a contrast medium in a morphologic diagnosing of a rare complication of a chronic thrombotic clot of the portal vein - the cavernous transformation. (authors)
Varicose Vein Treatment (Endovenous Ablation of Varicose Veins)
... associated veins. top of page What are the benefits vs. risks? Benefits No surgical incision is needed—only a small ... risk of infection. The chance of infection requiring antibiotic treatment appears to be less than one in ...
Preduodenal portal vein: its surgical significance.
Makey, D A; Bowen, J C
1978-11-01
Preduodenal portal vein is a rare anatomical variant which may be one of many anomalies in the neonate with duodenal "atresia." Preduodenal portal vein also may be an occasional finding in an adult undergoing biliary, gastric, or pancreatic surgery. Awareness and recognition of the anomaly are essential for the avoidance of injury during such operations. We report here a symptomless patient whose preduodenal portal vein was discovered at cholecystectomy.
Zhang, Mei; Yan, Feng; Huang, Bin; Wu, Zhoupeng; Wen, Xiaorong
2017-11-01
Primary leiomyosarcoma (LMS) of the vein is a rare tumor that arises from the smooth muscle cells of the vessel wall and has an extremely poor prognosis. This tumor can occur in vessels such as the inferior vena cava, great saphenous vein, femoral vein, iliac vein, popliteal vein, and renal vein; the inferior vena cava is the most common site. LMS of the femoral vein can result in edema and pain in the lower extremity; therefore, it is not easy to be differentiated from deep vein thrombosis (DVT). Moreover, virtually no studies have described the ultrasonographic features of LMS of the vein in detail. We present a case of a 55-year-old woman with LMS of the left femoral vein that was misdiagnosed as having deep vein thrombosis (DVT) on initial ultrasonographic examination. The patient began to experience edema and pain in her left leg seven months previously. She was diagnosed as having DVT on initial ultrasonographic examination, but the DVT treatment that she had received for 7 months failed to improve the status of her left lower limb. She subsequently underwent re-examination by means of a multimodal ultrasonographic imaging approach (regular B-mode imaging, color Doppler imaging, pulsed-wave Doppler imaging, contrast-enhanced ultrasonography), which confirmed a diagnosis of LMS. This patient was treated successfully with surgery. This case demonstrates that use of multiple ultrasonographic imaging techniques can be helpful to diagnose LMS accurately. Detection of vasculature in a dilated vein filled with a heterogeneous hypoechoic substance on ultrasonography is a sign of a tumor. The pitfall of misdiagnosing this tumor as DVT is a useful reminder.
Duplication of the Portal Vein: A Case Report
Energy Technology Data Exchange (ETDEWEB)
Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)
2009-12-15
The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally
Dua, Anahita; Heller, Jennifer; Lee, Cheong
2017-11-01
Phlegmasia cerulea dolens (PCD) is a rare condition resulting from venous occlusion that impairs arterial flow. We report a rare case of post-traumatic PCD after ligation of the iliac vein with successful treatment by right-to-left femoral vein to femoral vein bypass using left great saphenous vein (Palma procedure). The clinical presentation, diagnostic process, and approach to management along with a literature review on the operative management of PCD are presented in this case report.
Absent right superior caval vein in situs solitus
DEFF Research Database (Denmark)
Lytzen, Rebekka; Sundberg, Karin; Vejlstrup, Niels
2015-01-01
Introduction In up to 0.07% of the general population, the right anterior cardinal vein obliterates and the left remains open, creating an absent right superior caval vein and a persistent left superior caval vein. Absent right superior caval vein is associated with additional congenital heart...... disease in about half the patients. We wished to study the consequences of absent right superior caval vein as an incidental finding on prenatal ultrasonic malformation screening. Material and methods This is a retrospective case series study of all foetuses diagnosed with absent right superior caval vein...... no postnatal complications. All children were found to have healthy hearts at follow-up. CONCLUSIONS: In all cases, the findings proved to be a benign condition with no clinical manifestations or complications. Although isolated absent right superior caval vein does not seem to affect the outcome, associated...
Finger vein extraction using gradient normalization and principal curvature
Choi, Joon Hwan; Song, Wonseok; Kim, Taejeong; Lee, Seung-Rae; Kim, Hee Chan
2009-02-01
Finger vein authentication is a personal identification technology using finger vein images acquired by infrared imaging. It is one of the newest technologies in biometrics. Its main advantage over other biometrics is the low risk of forgery or theft, due to the fact that finger veins are not normally visible to others. Extracting finger vein patterns from infrared images is the most difficult part in finger vein authentication. Uneven illumination, varying tissues and bones, and changes in the physical conditions and the blood flow make the thickness and brightness of the same vein different in each acquisition. Accordingly, extracting finger veins at their accurate positions regardless of their thickness and brightness is necessary for accurate personal identification. For this purpose, we propose a new finger vein extraction method which is composed of gradient normalization, principal curvature calculation, and binarization. As local brightness variation has little effect on the curvature and as gradient normalization makes the curvature fairly uniform at vein pixels, our method effectively extracts finger vein patterns regardless of the vein thickness or brightness. In our experiment, the proposed method showed notable improvement as compared with the existing methods.
Infection of endothelial cells by common human viruses.
Friedman, H M
1989-01-01
Common human viruses were evaluated for their ability to replicate in the endothelial cells of human umbilical vein and bovine thoracic aorta in vitro. Infection occurred with most viruses. The susceptibilities of endothelial cells derived from bovine aorta, pulmonary artery, and vena cava were compared. Among the viruses studied, no differences were noted in the ability to grow in endothelial cells from these three large vessels. One virus, herpes simplex virus type 1, was evaluated for its ability to produce persistent infection of endothelial cells. Infection developed and persisted for up to 3 months. After the first week, productive infection was found in less than 1% of cells. Nevertheless, the infection markedly affected the growth and morphology of the endothelial monolayer. Infection with any of several different viruses was noted to alter endothelial cell functions, including adherence of granulocytes, production of colony-stimulating factor, and synthesis of matrix protein. In addition, herpes simplex virus type 1 induced receptors for the Fc portion of IgG and for complement component C3b. These findings indicate that common human viruses can profoundly affect the biology of the endothelium.
Adventitial cystic disease of the common femoral vein presenting as deep vein thrombosis
Directory of Open Access Journals (Sweden)
Young-Kyun Kim
2016-07-01
Full Text Available Adventitial cystic disease of the common femoral vein is a rare condition. We herein report the case of a 50-year-old woman who presented with painless swelling in her left lower leg that resembled deep vein thrombosis. She underwent femoral exploration and excision of the cystic wall. The presentation, investigation, treatment, and pathology of this condition are discussed with a literature review.
Bouzida, Nabila; Bendada, Abdelhakim; Maldague, Xavier P.
2009-05-01
The article aims first to present a new study on the thermal regulatory response of the human skin surface while exposed to a cold environment. Our work has shown that when a cold stress is applied to the left hand, thermal infrared imaging (MWIR spectral band: 3-5 μm) allows a clear observation of a temperature rise on the right hand. Moreover, a frequency analysis was also carried out upon selected vein pixels of the images monitored during the same cold stress experiment. The objective was to identify the specific frequencies that could be linked to some physiological mechanisms of the human body. This kind of study could be very useful for the characterization of possible thermo-physiological pathologies. Besides thermoregulation, we also present in this article some results on the extraction of the hand vein pattern. Firstly, we show some vein extraction results obtained after image processing of the thermal images recorded in the thermal band (MWIR), then we compare this vein pattern to the signature obtained with a camera operating in the NIR spectral band (0.85-1.7 μm). This method could be used as a complementary means for finger print signatures in biometrics.
Augmented reality based real-time subcutaneous vein imaging system.
Ai, Danni; Yang, Jian; Fan, Jingfan; Zhao, Yitian; Song, Xianzheng; Shen, Jianbing; Shao, Ling; Wang, Yongtian
2016-07-01
A novel 3D reconstruction and fast imaging system for subcutaneous veins by augmented reality is presented. The study was performed to reduce the failure rate and time required in intravenous injection by providing augmented vein structures that back-project superimposed veins on the skin surface of the hand. Images of the subcutaneous vein are captured by two industrial cameras with extra reflective near-infrared lights. The veins are then segmented by a multiple-feature clustering method. Vein structures captured by the two cameras are matched and reconstructed based on the epipolar constraint and homographic property. The skin surface is reconstructed by active structured light with spatial encoding values and fusion displayed with the reconstructed vein. The vein and skin surface are both reconstructed in the 3D space. Results show that the structures can be precisely back-projected to the back of the hand for further augmented display and visualization. The overall system performance is evaluated in terms of vein segmentation, accuracy of vein matching, feature points distance error, duration times, accuracy of skin reconstruction, and augmented display. All experiments are validated with sets of real vein data. The imaging and augmented system produces good imaging and augmented reality results with high speed.
Personal authentication through dorsal hand vein patterns
Hsu, Chih-Bin; Hao, Shu-Sheng; Lee, Jen-Chun
2011-08-01
Biometric identification is an emerging technology that can solve security problems in our networked society. A reliable and robust personal verification approach using dorsal hand vein patterns is proposed in this paper. The characteristic of the approach needs less computational and memory requirements and has a higher recognition accuracy. In our work, the near-infrared charge-coupled device (CCD) camera is adopted as an input device for capturing dorsal hand vein images, it has the advantages of the low-cost and noncontact imaging. In the proposed approach, two finger-peaks are automatically selected as the datum points to define the region of interest (ROI) in the dorsal hand vein images. The modified two-directional two-dimensional principal component analysis, which performs an alternate two-dimensional PCA (2DPCA) in the column direction of images in the 2DPCA subspace, is proposed to exploit the correlation of vein features inside the ROI between images. The major advantage of the proposed method is that it requires fewer coefficients for efficient dorsal hand vein image representation and recognition. The experimental results on our large dorsal hand vein database show that the presented schema achieves promising performance (false reject rate: 0.97% and false acceptance rate: 0.05%) and is feasible for dorsal hand vein recognition.
Thrombosis of right ovarian vein
International Nuclear Information System (INIS)
Forner, J.; Talens, A.; Flores, M.; Mendez, M.
2001-01-01
Ovarian vein thrombosis is a rare postpartum complication (0.1%). It can be fatal, since it can lead to sepsis, pulmonary thromboembolisms and inferior vena cava or renal vein thrombosis. Computed tomography and magnetic resonance imaging are the techniques of choice for its diagnosis, while the value of ultrasound is limited due to its low sensitivity and specificity. We report the case of a woman who, during puerperium, developed thrombosis of right ovarian vein that presented clinical, ultrasonographic and computed tomographic features of appendicitis. We describe the radiological sings and stress the fact that this diagnosis should be suspected in puerperal women. (Author) 9 refs
Assessment and management of patients with varicose veins.
Allen, Louise
Varicose veins are enlarged superficial veins found in the legs. This article explores the anatomy and physiology of the venous system to assist nurses to assess, manage and treat patients with varicose veins.
Directory of Open Access Journals (Sweden)
Radmard Kaikhosrov
2017-12-01
Full Text Available Situated about 130 km northeast of Tabriz (northwest Iran, the Mazra’eh Shadi deposit is in the Arasbaran metallogenic belt (AAB. Intrusion of subvolcanic rocks, such as quartz monzodiorite-diorite porphyry, into Eocene volcanic and volcano-sedimentary units led to mineralisation and alteration. Mineralisation can be subdivided into a porphyry system and Au-bearing quartz veins within andesite and trachyandesite which is controlled by fault distribution. Rock samples from quartz veins show maximum values of Au (17100 ppb, Pb (21100 ppm, Ag (9.43ppm, Cu (611ppm and Zn (333 ppm. Au is strongly correlated with Ag, Zn and Pb. In the Au-bearing quartz veins, factor group 1 indicates a strong correlation between Au, Pb, Ag, Zn and W. Factor group 2 indicates a correlation between Cu, Te, Sb and Zn, while factor group 3 comprises Mo and As. Based on Spearman correlation coefficients, Sb and Te can be very good indicator minerals for Au, Ag and Pb epithermal mineralisation in the study area. The zoning pattern shows clearly that base metals, such as Cu, Pb, Zn and Mo, occur at the deepest levels, whereas Au and Ag are found at higher elevations than base metals in boreholes in northern Mazra’eh Shadi. This observation contrasts with the typical zoning pattern caused by boiling in epithermal veins. At Mazra’eh Shadi, quartz veins containing co-existing liquid-rich and vapour-rich inclusions, as strong evidence of boiling during hydrothermal evolution, have relatively high Au grades (up to 813 ppb. In the quartz veins, Au is strongly correlated with Ag, and these elements are in the same group with Fe and S. Mineralisation of Au and Ag is a result of pyrite precipitation, boiling of hydrothermal fluids and a pH decrease.
Deep vein thrombosis: a clinical review
Directory of Open Access Journals (Sweden)
Kesieme EB
2011-04-01
Full Text Available Emeka Kesieme1, Chinenye Kesieme2, Nze Jebbin3, Eshiobo Irekpita1, Andrew Dongo11Department of Surgery, Irrua Specialist Teaching Hospital, Irrua, Nigeria; 2Department of Paediatrics, Irrua Specialist Teaching Hospital, Irrua, Nigeria; 3Department of Surgery, University of Port Harcourt Teaching Hospital, Port-Harcourt, NigeriaBackground: Deep vein thrombosis (DVT is the formation of blood clots (thrombi in the deep veins. It commonly affects the deep leg veins (such as the calf veins, femoral vein, or popliteal vein or the deep veins of the pelvis. It is a potentially dangerous condition that can lead to preventable morbidity and mortality.Aim: To present an update on the causes and management of DVT.Methods: A review of publications obtained from Medline search, medical libraries, and Google.Results: DVT affects 0.1% of persons per year. It is predominantly a disease of the elderly and has a slight male preponderance. The approach to making a diagnosis currently involves an algorithm combining pretest probability, D-dimer testing, and compression ultrasonography. This will guide further investigations if necessary. Prophylaxis is both mechanical and pharmacological. The goals of treatment are to prevent extension of thrombi, pulmonary embolism, recurrence of thrombi, and the development of complications such as pulmonary hypertension and post-thrombotic syndrome.Conclusion: DVT is a potentially dangerous condition with a myriad of risk factors. Prophylaxis is very important and can be mechanical and pharmacological. The mainstay of treatment is anticoagulant therapy. Low-molecular-weight heparin, unfractionated heparin, and vitamin K antagonists have been the treatment of choice. Currently anticoagulants specifically targeting components of the common pathway have been recommended for prophylaxis. These include fondaparinux, a selective indirect factor Xa inhibitor and the new oral selective direct thrombin inhibitors (dabigatran and selective
International Nuclear Information System (INIS)
Nishida, Norifumi; Ninoi, Teruhisa; Kitayama, Toshiaki; Yamamoto, Akira; Sakai, Yukimasa; Sato, Kimihiko; Hamuro, Masao; Nakamura, Kenji; Inoue, Yuichi; Yamada, Ryusaku
2004-01-01
A 66-year-old woman with a gastric varix, draining into a dilated left adrenal vein and a left inferior phrenic vein, was treated with dual balloon-occluded retrograde transvenous obliteration (B-RTO). Under balloon occlusion of the left adrenal vein and the left inferior phrenic vein, retrograde injection of a sclerosant (5% ethanolamine oleate) into the gastric varix was performed. Two weeks later, disappearance of flow in the gastric varix was confirmed on endoscopic ultrasound examination
Recurrence of superficial vein thrombosis in patients with varicose veins.
Karathanos, Christos; Spanos, Konstantinos; Saleptsis, Vassileios; Tsezou, Aspasia; Kyriakou, Despina; Giannoukas, Athanasios D
2016-08-01
To investigate which factors other than history of superficial vein thrombosis (SVT) are associated with recurrent spontaneous SVT episodes in patients with varicose veins (VVs). Patients with a history of spontaneous SVT and VVs were followed up for a mean period of 55 months. Demographics, comorbidities, and thrombophilia screening test were analyzed. Patients were grouped according to the clinical-etiology-anatomy-pathophysiology classification. A multiple logistic regression analysis with the forward likelihood ratio method was undertaken. Thirteen patients out of 97 had a recurrence SVT episode during the follow-up period. All those patients were identified to have a thrombophilia defect. Protein C and S, antithrombin, and plasminogen deficiencies were more frequently present in patients without recurrence. Gene mutations were present in 38% in the nonrecurrence group and 77% in the recurrence group. After logistic regression analysis, patients with dislipidemia and mutation in prothrombin G20210A (FII) had an increased risk for recurrence by 5.4-fold and 4.6-fold, respectively. No deep vein thrombosis or pulmonary embolism occurred. Dislipidemia and gene mutations of F II are associated with SVT recurrence in patients with VVs. A selection of patients may benefit from anticoagulation in the short term and from VVs intervention in the long term. © The Author(s) 2015.
Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR
Directory of Open Access Journals (Sweden)
Hoseong Choi
2013-03-01
Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.
Eekeren, R. van; Boersma, D.; Elias, S.; Holewijn, S.; Werson, D.A.; Vries, J.P. de; Reijnen, M.M.P.J.
2011-01-01
PURPOSE: To evaluate the feasibility and safety of endovenous mechanochemical ablation (MOCA) for the treatment of great saphenous vein (GSV) incompetence. METHODS: The newly developed ClariVein device uses a technique that combines mechanical endothelial damage using a rotating wire with the
Real-time dynamic imaging of virus distribution in vivo.
Directory of Open Access Journals (Sweden)
Sean E Hofherr
2011-02-01
Full Text Available The distribution of viruses and gene therapy vectors is difficult to assess in a living organism. For instance, trafficking in murine models can usually only be assessed after sacrificing the animal for tissue sectioning or extraction. These assays are laborious requiring whole animal sectioning to ascertain tissue localization. They also obviate the ability to perform longitudinal or kinetic studies in one animal. To track viruses after systemic infection, we have labeled adenoviruses with a near-infrared (NIR fluorophore and imaged these after intravenous injection in mice. Imaging was able to track and quantitate virus particles entering the jugular vein simultaneous with injection, appearing in the heart within 500 milliseconds, distributing in the bloodstream and throughout the animal within 7 seconds, and that the bulk of virus distribution was essentially complete within 3 minutes. These data provide the first in vivo real-time tracking of the rapid initial events of systemic virus infection.
Leiomyosarcoma of the renal vein
Directory of Open Access Journals (Sweden)
Lemos Gustavo C.
2003-01-01
Full Text Available Leiomyosarcoma of the renal vein is a rare tumor of complex diagnosis. We presented a case of renal vein leiomyosarcoma detected in a routine study. The primary treatment was complete surgical removal of the mass. In cases where surgical removal is not possible the prognosis is poor, with high rates of local recurrence and distant spread.
Design of biometrics identification system on palm vein using infrared light
Syafiq, Muhammad; Nasution, Aulia M. T.
2016-11-01
Image obtained by the LED with wavelength 740nm and 810nm showed that the contrast gradient of vein pattern is low and palm pattern still exist. It means that 740nm and 810nm are less suitable for the detection of blood vessels in the palm of the hand. At a wavelength of 940nm, the pattern is clearly visible, and the pattern of the palms is mostly gone. Furthermore, the pre-processing performed using smoothing process which include Gaussian filter and median filter and contrast stretching. Image segmentation is done by getting the ROI area that would be obtained its information. The identification process of image features obtained by using MSE (Mean Suare Error) method ,LBP (Local Binary Pattern). Furthermore, we will use a database consists of 5 different palm vein pattern which will be used for testing the tool in the identification process. All the process above are done using Raspberry Pi device. The Obtained MSE parameter is 0.025 and LBP features score are less than 10-3 for image to be matched.
Ultrasound assessment of great saphenous vein insufficiency
Directory of Open Access Journals (Sweden)
Chander RK
2015-06-01
Full Text Available Rajiv K Chander,1 Thomas S Monahan1,2 1Section of Vascular Surgery, Department of Surgery, University of Maryland School of Medicine, 2Department of Surgery, Baltimore Veterans Affairs Medical Center, Baltimore, MD, USA Abstract: Duplex ultrasonography is the ideal modality to assess great saphenous vein insufficiency. Duplex ultrasonography incorporates both gray scale images to delineate anatomy and color-Doppler imaging that visualizes the flow of blood in a structure. Assessment of great saphenous vein requires definition of the anatomy, augmentation of flow, evaluation for both superficial and deep vein thrombosis, and determining the presence of reflux. Currently, evolution in the treatment of reflux also relies on ultrasound for the treatment of the disease. Understanding the utilization of the ultrasound for the diagnosis and treatment of greater saphenous vein reflux is important for practitioners treating reflux disease. Keywords: duplex ultrasonography, small saphenous vein
Gonadal vein tumor thrombosis due to renal cell carcinoma
Directory of Open Access Journals (Sweden)
Hamidreza Haghighatkhah
2015-01-01
Full Text Available Renal cell carcinoma (RCC had a tendency to extend into the renal vein and inferior vena cava, while extension into the gonadal vein has been rarely reported. Gonadal vein tumor thrombosis appears as an enhancing filling defect within the dilated gonadal vein anterior to the psoas muscle and shows an enhancement pattern identical to that of the original tumor. The possibility of gonadal vein thrombosis should be kept in mind when looking at an imaging study of patients with RCC
Endovascular management for significant iatrogenic portal vein bleeding.
Kim, Jong Woo; Shin, Ji Hoon; Park, Jonathan K; Yoon, Hyun-Ki; Ko, Gi-Young; Gwon, Dong Il; Kim, Jin Hyoung; Sung, Kyu-Bo
2017-11-01
Background Despite conservative treatment, hemorrhage from an intrahepatic branch of the portal vein can cause hemodynamic instability requiring urgent intervention. Purpose To retrospectively report the outcomes of hemodynamically significant portal vein bleeding after endovascular management. Material and Methods During a period of 15 years, four patients (2 men, 2 women; median age, 70.5 years) underwent angiography and embolization for iatrogenic portal vein bleeding. Causes of hemorrhage, angiographic findings, endovascular treatment, and complications were reported. Results Portal vein bleeding occurred after percutaneous liver biopsy (n = 2), percutaneous radiofrequency ablation (n = 1), and percutaneous cholecystostomy (n = 1). The median time interval between angiography and percutaneous procedure was 5 h (range, 4-240 h). Common hepatic angiograms including indirect mesenteric portograms showed active portal vein bleeding into the peritoneal cavity with (n = 1) or without (n = 2) an arterioportal (AP) fistula, and portal vein pseudoaneurysm alone with an AP fistula (n = 1). Successful transcatheter arterial embolization (n = 2) or percutaneous transhepatic portal vein embolization (n = 2) was performed. Embolic materials were n-butyl cyanoacrylate alone (n = 2) or in combination with gelatin sponge particles and coils (n = 2). There were no major treatment-related complications or patient mortality within 30 days. Conclusion Patients with symptomatic or life-threatening portal vein bleeding following liver-penetrating procedures can successfully be managed with embolization.
Conventional tomographic hilar anatomy emphasizing the pulmonary veins
International Nuclear Information System (INIS)
Genereux, G.P.
1983-01-01
The pulmonary hili are a frequent site of interpretive uncertainty because of thir complex anatomy. The right hilar shadow relates primarily to the ascending and descending pulmonary arteries and the right superior pulmonary vein, whereas the left hilar density accrues from the left pulmonary artery, left descending pulmonary artery, and left superior pulmonary vein. The right and left superoir pulmonary veins are intimately associated with and inseparable from the arteries. Knowledge of the course of these veins facilitates their identification on conventional tomograms. The right and left inferior pulmonary veins lie behind the lower hili and contribute only a small increment to the normal hilar density; the horizontal course of these vessels readily distinguishes them from the vertically oriented lower lobe arteries. Prominence of both the right and left superior and inferior veins may cause hilar pseudotumors. Conventional tomograms are most helpful in understanding plain radiographs. A multiview approach in anteroposterior, 55 0 posterior oblique, and lateral projections is recommended for a complete assessment. Computed tomography in transaxial sections adds further understanding of spatial relations in the hili, including the contributions of the pulmonary veins
International Nuclear Information System (INIS)
Ueda, Takashi; Uchikoshi, Masato; Imaoka, Izumi; Iwaya, Kazuo; Matsuo, Michimasa; Wada, Akihiko
2005-01-01
True FISP (fast imaging with steady-state free precession) is a fast imaging technique that provides high SNR (signal to noise ratio) and excellent delineation of parenchymal organs. The contrast of True FISP depends on the mixture of T 2 /T 1 . Vessels with slow flow are usually displayed as high signal intensity on True FISP images. The purpose of this study was to optimize fat-suppressed (FS) segmented True FISP imaging for portal veins, hepatic veins, and bile ducts. FS segmented True FISP images were applied to the phantoms of liver parenchyma, saline, and oil with various flip angles (every 10 degrees from 5-65 degrees) and k-space segmentations (3, 15, 25, 51, 75, 99). Five healthy volunteers were also examined to get optimized flip angle and k-space segmentation. The largest flip angle, 65 degrees, showed the best contrast between the liver parenchyma phantom, saline, and oil. The largest segmentations, 99, provided the best contrast between a liver parenchyma phantom and saline. However, the signal of the oil phantom exceeded that of the liver parenchyma phantom with 99 segmentations. As a result, the flip angle of 65 degrees and 75 segments is recommended to get the best contrast between the liver parenchyma phantom and saline, while suppressing the signal of oil. The volunteer studies also support the phantom studies and showed excellent anatomical delineation of portal veins, hepatic veins, and bile ducts when using these parameters. We conclude that True FISP is potentially suitable for the imaging of portal veins, hepatic veins, and bile ducts. The flip angle of 65 degrees with 75 segments is recommended to optimize FS segmented True FISP images. (author)
Generating and analyzing synthetic finger vein images
Hillerström, Fieke; Kumar, Ajay; Veldhuis, Raymond N.J.
2014-01-01
Abstract: The finger-vein biometric offers higher degree of security, personal privacy and strong anti-spoofing capabilities than most other biometric modalities employed today. Emerging privacy concerns with the database acquisition and lack of availability of large scale finger-vein database have posed challenges in exploring this technology for large scale applications. This paper details the first such attempt to synthesize finger-vein images and presents analysis of synthesized images fo...
Directory of Open Access Journals (Sweden)
Fortunat Młodzianowski
2015-01-01
Full Text Available In the cotyledons of dry lupine seeds the presence of starch was not demonstrated. Its formation during seed imbibition in darkness is accompanied by a reduction in the thickness of cell walls containing hemicelluloses. It is believed that the products of hemicellulose hydrolysis, particullarily in isolated cotyledons, arę the main source of materials for the synthesis of starch, In the process of cell wall decomposition the invaginations of plasmalemma appear to be involved. Kinetin enhance the hydrolysis of cell walls and the mobilization of starch in isolated cotyledons.
Rapid detection of fifteen known soybean viruses by dot-immunobinding assay.
Ali, Akhtar
2017-11-01
A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012-2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time. Copyright © 2017 Elsevier B.V. All rights reserved.
Endovascular Radiofrequency Ablation for Varicose Veins
2011-01-01
Executive Summary Objective The objective of the MAS evidence review was to conduct a systematic review of the available evidence on the safety, effectiveness, durability and cost–effectiveness of endovascular radiofrequency ablation (RFA) for the treatment of primary symptomatic varicose veins. Background The Ontario Health Technology Advisory Committee (OHTAC) met on August 26th, 2010 to review the safety, effectiveness, durability, and cost-effectiveness of RFA for the treatment of primary symptomatic varicose veins based on an evidence-based review by the Medical Advisory Secretariat (MAS). Clinical Condition Varicose veins (VV) are tortuous, twisted, or elongated veins. This can be due to existing (inherited) valve dysfunction or decreased vein elasticity (primary venous reflux) or valve damage from prior thrombotic events (secondary venous reflux). The end result is pooling of blood in the veins, increased venous pressure and subsequent vein enlargement. As a result of high venous pressure, branch vessels balloon out leading to varicosities (varicose veins). Symptoms typically affect the lower extremities and include (but are not limited to): aching, swelling, throbbing, night cramps, restless legs, leg fatigue, itching and burning. Left untreated, venous reflux tends to be progressive, often leading to chronic venous insufficiency (CVI). A number of complications are associated with untreated venous reflux: including superficial thrombophlebitis as well as variceal rupture and haemorrhage. CVI often results in chronic skin changes referred to as stasis dermatitis. Stasis dermatitis is comprised of a spectrum of cutaneous abnormalities including edema, hyperpigmentation, eczema, lipodermatosclerosis and stasis ulceration. Ulceration represents the disease end point for severe CVI. CVI is associated with a reduced quality of life particularly in relation to pain, physical function and mobility. In severe cases, VV with ulcers, QOL has been rated to be as bad
Umbilical vein draining into the inferior vena cava via the internal iliac vein, bypassing the liver
International Nuclear Information System (INIS)
Currarino, G.; Stannard, M.W.; Texas Univ., Dallas, TX; Kolni, H.
1991-01-01
This is the third report of an anomalous umbilical vein draining ectopically in a left pelvic vein, probably the left internal iliac, and through the inferior vena cava into the right atrium. The anomaly was encountered in a newborn infant with nonimmune hydrops fetalis, hypertrophic cardiomyopathy, multiorgan failure and possibly Noonan Syndrome. (orig.)
Umbilical vein draining into the inferior vena cava via the internal iliac vein, bypassing the liver
Energy Technology Data Exchange (ETDEWEB)
Currarino, G.; Stannard, M.W. (Children' s Medical Center, Dallas, TX (United States). Dept. of Radiology Texas Univ., Dallas, TX (United States). Southwestern Medical Center); Kolni, H. (Methodist Hospital, Dallas, TX (United States). Dept. of Pediatrics)
1991-05-01
This is the third report of an anomalous umbilical vein draining ectopically in a left pelvic vein, probably the left internal iliac, and through the inferior vena cava into the right atrium. The anomaly was encountered in a newborn infant with nonimmune hydrops fetalis, hypertrophic cardiomyopathy, multiorgan failure and possibly Noonan Syndrome. (orig.).
Anabestani, Ameneh; Behjatnia, Seyed Ali Akbar; Izadpanah, Keramat; Tabein, Saeid
2017-01-01
Beet curly top virus (BCTV) and beet curly top Iran virus (BCTIV) are known as the causal agents of curly top disease in beet and several other dicotyledonous plants in Iran. These viruses are transmitted by Circulifer species, and until now, there has been no confirmed report of their seed transmission. A percentage (38.2–78.0%) of the seedlings developed from the seeds of a petunia local cultivar under insect-free conditions showed stunting, interveinal chlorosis, leaf curling, and vein swelling symptoms, and were infected by BCTV when tested by PCR. Presence of BCTV in seed extracts of petunia local cultivar was confirmed by PCR and IC-PCR, followed by sequencing. Agroinoculation of curly top free petunia plants with a BCTV infectious clone resulted in BCTV infection of plants and their developed seeds. These results show the seed infection and transmission of BCTV in a local cultivar of petunia. Similar experiments performed with BCTIV showed that this virus is also seed transmissible in the same cultivar of petunia, although with a lower rate (8.8–18.5%). Seed transmission of curly top viruses may have significant implications in the epidemiology of these viruses. PMID:29035342
Patterning of leaf vein networks by convergent auxin transport pathways.
Sawchuk, Megan G; Edgar, Alexander; Scarpella, Enrico
2013-01-01
The formation of leaf vein patterns has fascinated biologists for centuries. Transport of the plant signal auxin has long been implicated in vein patterning, but molecular details have remained unclear. Varied evidence suggests a central role for the plasma-membrane (PM)-localized PIN-FORMED1 (PIN1) intercellular auxin transporter of Arabidopsis thaliana in auxin-transport-dependent vein patterning. However, in contrast to the severe vein-pattern defects induced by auxin transport inhibitors, pin1 mutant leaves have only mild vein-pattern defects. These defects have been interpreted as evidence of redundancy between PIN1 and the other four PM-localized PIN proteins in vein patterning, redundancy that underlies many developmental processes. By contrast, we show here that vein patterning in the Arabidopsis leaf is controlled by two distinct and convergent auxin-transport pathways: intercellular auxin transport mediated by PM-localized PIN1 and intracellular auxin transport mediated by the evolutionarily older, endoplasmic-reticulum-localized PIN6, PIN8, and PIN5. PIN6 and PIN8 are expressed, as PIN1 and PIN5, at sites of vein formation. pin6 synthetically enhances pin1 vein-pattern defects, and pin8 quantitatively enhances pin1pin6 vein-pattern defects. Function of PIN6 is necessary, redundantly with that of PIN8, and sufficient to control auxin response levels, PIN1 expression, and vein network formation; and the vein pattern defects induced by ectopic PIN6 expression are mimicked by ectopic PIN8 expression. Finally, vein patterning functions of PIN6 and PIN8 are antagonized by PIN5 function. Our data define a new level of control of vein patterning, one with repercussions on other patterning processes in the plant, and suggest a mechanism to select cell files specialized for vascular function that predates evolution of PM-localized PIN proteins.
Patterning of leaf vein networks by convergent auxin transport pathways.
Directory of Open Access Journals (Sweden)
Megan G Sawchuk
Full Text Available The formation of leaf vein patterns has fascinated biologists for centuries. Transport of the plant signal auxin has long been implicated in vein patterning, but molecular details have remained unclear. Varied evidence suggests a central role for the plasma-membrane (PM-localized PIN-FORMED1 (PIN1 intercellular auxin transporter of Arabidopsis thaliana in auxin-transport-dependent vein patterning. However, in contrast to the severe vein-pattern defects induced by auxin transport inhibitors, pin1 mutant leaves have only mild vein-pattern defects. These defects have been interpreted as evidence of redundancy between PIN1 and the other four PM-localized PIN proteins in vein patterning, redundancy that underlies many developmental processes. By contrast, we show here that vein patterning in the Arabidopsis leaf is controlled by two distinct and convergent auxin-transport pathways: intercellular auxin transport mediated by PM-localized PIN1 and intracellular auxin transport mediated by the evolutionarily older, endoplasmic-reticulum-localized PIN6, PIN8, and PIN5. PIN6 and PIN8 are expressed, as PIN1 and PIN5, at sites of vein formation. pin6 synthetically enhances pin1 vein-pattern defects, and pin8 quantitatively enhances pin1pin6 vein-pattern defects. Function of PIN6 is necessary, redundantly with that of PIN8, and sufficient to control auxin response levels, PIN1 expression, and vein network formation; and the vein pattern defects induced by ectopic PIN6 expression are mimicked by ectopic PIN8 expression. Finally, vein patterning functions of PIN6 and PIN8 are antagonized by PIN5 function. Our data define a new level of control of vein patterning, one with repercussions on other patterning processes in the plant, and suggest a mechanism to select cell files specialized for vascular function that predates evolution of PM-localized PIN proteins.
Quantification of deep medullary veins at 7 T brain MRI
Energy Technology Data Exchange (ETDEWEB)
Kuijf, Hugo J.; Viergever, Max A.; Vincken, Koen L. [University Medical Center Utrecht, Image Sciences Institute, Utrecht (Netherlands); Bouvy, Willem H.; Razoux Schultz, Tom B.; Biessels, Geert Jan [University Medical Center Utrecht, Department of Neurology, Brain Center Rudolf Magnus, Utrecht (Netherlands); Zwanenburg, Jaco J.M. [University Medical Center Utrecht, Image Sciences Institute, Utrecht (Netherlands); University Medical Center Utrecht, Department of Radiology, Utrecht (Netherlands)
2016-10-15
Deep medullary veins support the venous drainage of the brain and may display abnormalities in the context of different cerebrovascular diseases. We present and evaluate a method to automatically detect and quantify deep medullary veins at 7 T. Five participants were scanned twice, to assess the robustness and reproducibility of manual and automated vein detection. Additionally, the method was evaluated on 24 participants to demonstrate its application. Deep medullary veins were assessed within an automatically created region-of-interest around the lateral ventricles, defined such that all veins must intersect it. A combination of vesselness, tubular tracking, and hysteresis thresholding located individual veins, which were quantified by counting and computing (3-D) density maps. Visual assessment was time-consuming (2 h/scan), with an intra-/inter-observer agreement on absolute vein count of ICC = 0.76 and 0.60, respectively. The automated vein detection showed excellent inter-scan reproducibility before (ICC = 0.79) and after (ICC = 0.88) visually censoring false positives. It had a positive predictive value of 71.6 %. Imaging at 7 T allows visualization and quantification of deep medullary veins. The presented method offers fast and reliable automated assessment of deep medullary veins. (orig.)
Preoperative mapping of the saphenous vein
DEFF Research Database (Denmark)
Levi-Mazloum, Niels Donald; Sillesen, H; Nielsen, Tina G
1996-01-01
A series of 124 patients had their greater saphenous vein assessed with duplex ultrasound scanning prior to planned infrainguinal bypass procedures. 33 (27%) bypass procedures thrombosed within the first year. A naturally occurring optimal vein diameter was discovered: 5.0-6.5 mm at mid-thigh lev...
Recanalization after acute deep vein thrombosis
Directory of Open Access Journals (Sweden)
Gustavo Mucoucah Sampaio Brandao
2013-12-01
Full Text Available The process of recanalization of the veins of the lower limbs after an episode of acute deep venous thrombosis is part of the natural evolution of the remodeling of the venous thrombus in patients on anticoagulation with heparin and vitamin K inhibitors. This remodeling involves the complex process of adhesion of thrombus to the wall of the vein, the inflammatory response of the vessel wall leading to organization and subsequent contraction of the thrombus, neovascularization and spontaneous lysis of areas within the thrombus. The occurrence of spontaneous arterial flow in recanalized thrombosed veins has been described as secondary to neovascularization and is characterized by the development of flow patterns characteristic of arteriovenous fistulae that can be identified by color duplex scanning. In this review, we discuss some controversial aspects of the natural history of deep vein thrombosis to provide a better understanding of its course and its impact on venous disease.
International Nuclear Information System (INIS)
Sohn, Kyung Myung; Chung, Su Kyo; Lee, Sung Yong
2004-01-01
To evaluate the usefulness of the impedance index of the renal vein for the diagnosis of acute obstructive uropathy in rabbits. Ligation of the left ureter was done in 12 rabbits. Doppler sonography of the interlobar veins in both kidneys was checked before and 30 minutes, 1, 3, 6, 9 and 24 hours after ureteral ligation. The venous impedance index [(peak flow signal-least flow signal)/peak flow signal] was compared between the obstructed and non-obstructed kidneys for all periods. The change in the impedance index after ureteral ligation was also compared between the obstructed and non-obstructed kidneys. A decrease in the impedance index of the intrarenal vein was observed starting from 30 mins atter ureteral ligation, and the index remained low up to 24 hours after ureteral ligation. The obstructed kidneys had a significantly lower impedance index than the contralateral kidneys for all six of the postligation measurements (p< 0.05). There were significant differences in the change of impedance index after ureteral ligation between the obstructed and non-obstructed kidneys (p< 0.05). The impedance index of the intrarenal vein was significantly decreased in the obstructed kidneys. The measurement of the impedance index of the intrarenal vein using Doppler sonography could provide a useful method of diagnosing obstructive uropathy
Madhusudhan, KS; Agrawal, Nikhil; Srivastava, Deep N; Pal, Sujoy; Gupta, Arun K
2013-01-01
Extrahepatic portal vein stenosis is caused by a variety of benign and malignant diseases and results in development of symptoms due to portal hypertension. Benign post-surgical adhesions causing portal vein stenosis in non-transplant population is an uncommon etiology of portal hypertension. Endovascular treatment of such patients with angioplasty and stenting is uncommonly reported in literature. We report a case of portal hypertension caused by benign postoperative portal vein fibrosis, su...
Animal Model of Acute Deep Vein Thrombosis
International Nuclear Information System (INIS)
Roy, Sumit; Laerum, Frode; Brosstad, Frank; Kvernebo, Knut; Sakariassen, Kjell S.
1998-01-01
Purpose: To develop an animal model of acute deep vein thrombosis (DVT). Methods: In part I of the study nine juvenile domestic pigs were used. Each external iliac vein was transluminally occluded with a balloon catheter. Thrombin was infused through a microcatheter in one leg according to one of the following protocols: (1) intraarterial (IA): 1250 U at 25 U/min in the common femoral artery (n= 3); (2) intravenous (IV): 5000 U in the popliteal vein at 500 U/min (n= 3), or at 100 U/min (n= 3). Saline was administered in the opposite leg. After the animals were killed, the mass of thrombus in the iliofemoral veins was measured. The pudendoepiploic (PEV), profunda femoris (PF), and popliteal veins (PV) were examined. Thrombosis in the tributaries of the superficial femoral vein (SFVt) was graded according to a three-point scale (0, +, ++). In part II of the study IV administration was further investigated in nine pigs using the following three regimens with 1000 U at 25 U/min serving as the control: (1) 1000 U at 100 U/min, (2) 250 U at 25 U/min, (3) 250 U at 6.25 U/min. Results: All animals survived. In part I median thrombus mass in the test limbs was 1.40 g as compared with 0.25 g in the controls (p= 0.01). PEV, PFV and PV were thrombosed in all limbs infused with thrombin. IV infusion was more effective in inducing thrombosis in both the parent veins (mass 1.32-1.78 g) and SVFt (++ in 4 of 6 legs), as compared with IA infusion (mass 0.0-1.16 g; SFVt ++ in 1 of 3 legs). In part II thrombus mass in axial veins ranged from 1.23 to 2.86 g, and showed no relationship with the dose of thrombin or the rate of infusion. Tributary thrombosis was less extensive with 250 U at 25 U/min than with the other regimens. Conclusion: Slow distal intravenous thrombin infusion in the hind legs of pigs combined with proximal venous occlusion induces thrombosis in the leg veins that closely resembles clinical DVT in distribution
Distribution of Tomato spotted wilt virus in dahlia plants.
Asano, S; Hirayama, Y; Matsushita, Y
2017-04-01
Tomato spotted wilt virus (TSWV) causes significant losses in the production of the ornamental plant Dahlia variabilis in Japan. The purpose of this study was to examine the distribution of TSWV in dahlia plants and identify plant parts that can be used in the selection of TSWV-free plants. The distribution of TSWV was investigated using reverse transcriptional polymerase chain reaction (RT-PCR) and tissue blot immunoassay. The detection rate of TSWV in latent infected compound leaves was the highest in the petiole, and it decreased from the veins and rachis to the lamina. The tissue blot immunoassays of the leaflets showed an uneven distribution of TSWV, especially along the edge of the leaf blade. In stems, the detection rate of TSWV was high partway up the stem compared to that in the upper and the lower parts of the stem during the vegetative growth stage. A highly uneven distribution was observed in the bulb. Our results indicated that middle parts of the stem as well as the petioles, rachis, and veins of compound leaves are suitable for detection of TSWV in dahlias. This study is the first to report uneven distribution of TSWV in dahlia plants. In this study, the distribution of Tomato spotted wilt virus (TSWV) in various parts of dahlia plants was investigated for the first time. The distribution of TSWV was uneven in compound leaves, leaflets, stems, and bulbs. The middle parts of the stem or the petiole and leaf veins should be sampled to detect TSWV when selecting healthy plants. © 2017 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Javier Corral
2016-01-01
Full Text Available We are reporting a case of a healthy 21-year-old male, with no significant past medical history, who was found to have an incidental nonocclusive deep vein thrombosis in the right internal jugular vein detected on a head MRI previously ordered for work-up of headaches. A follow-up upper extremity venous Doppler ultrasound confirmed the presence of a partially occlusive deep vein thrombosis in the right jugular vein. The case presented is unique for the reason that the patient is young and has no prior risk factor, personal or familial, for venous thrombosis except for associated polycythemia on clinical presentation.
Veins improve fracture toughness of insect wings.
Directory of Open Access Journals (Sweden)
Jan-Henning Dirks
Full Text Available During the lifetime of a flying insect, its wings are subjected to mechanical forces and deformations for millions of cycles. Defects in the micrometre thin membranes or veins may reduce the insect's flight performance. How do insects prevent crack related material failure in their wings and what role does the characteristic vein pattern play? Fracture toughness is a parameter, which characterises a material's resistance to crack propagation. Our results show that, compared to other body parts, the hind wing membrane of the migratory locust S. gregaria itself is not exceptionally tough (1.04±0.25 MPa√m. However, the cross veins increase the wing's toughness by 50% by acting as barriers to crack propagation. Using fracture mechanics, we show that the morphological spacing of most wing veins matches the critical crack length of the material (1132 µm. This finding directly demonstrates how the biomechanical properties and the morphology of locust wings are functionally correlated in locusts, providing a mechanically 'optimal' solution with high toughness and low weight. The vein pattern found in insect wings thus might inspire the design of more durable and lightweight artificial 'venous' wings for micro-air-vehicles. Using the vein spacing as indicator, our approach might also provide a basis to estimate the wing properties of endangered or extinct insect species.
Transvenous liver biopsy via the femoral vein
International Nuclear Information System (INIS)
Khosa, F.; McNulty, J.G.; Hickey, N.; O'Brien, P.; Tobin, A.; Noonan, N.; Ryan, B.; Keeling, P.W.N.; Kelleher, D.P.; McDonald, G.S.A.
2003-01-01
AIM: To study the safety, effectiveness and diagnostic value of transvenous forceps biopsy of the liver in 54 patients with coagulopathy, gross ascites or morbid obesity and suspected liver disease in whom percutaneous liver biopsy was contraindicated. MATERIAL AND METHODS: Forceps biopsy of the liver via the femoral vein was attempted in 54 adult patients with advanced liver disease of unknown aetiology who had coagulation disorders (41 cases), gross ascites (11 cases) or morbid obesity (two cases). In each patient two to six biopsies (average four) were taken using a radial jaw forceps inserted via the right or left femoral vein. RESULTS: The procedure was successful in 53 cases. Hepatic vein catheterization failed in one patient. Adequate liver tissue for diagnosis was obtained in 84% of cases. One patient developed delayed haemorrhage at 12 h from a capsular leak that was undetected during the biopsy procedure. This patient required blood transfusions and laparotomy to control bleeding. There were no deaths in the 53 patients studied. Transient minor chest and shoulder pain was encountered during sheath insertion into a hepatic vein in 23 patients. Three patients developed a femoral vein haematoma, which resolved with conservative treatment. CONCLUSION: Transvenous liver biopsy via the femoral vein is another safe, effective, simple alternative technique of biopsy when the percutaneous route is contraindicated
Computed tomographic evaluation of the portal vein in the hepatomas
Energy Technology Data Exchange (ETDEWEB)
Lee, Kee Hyung; Lee, Seung Chul; Bae, Man Gil; Seo, Heung Suk; Kim, Soon Yong; Lee, Min Ho; Kee, Choon Suhk; Park, Kyung Nam [Hanyang University College of Medicine, Seoul (Korea, Republic of)
1986-10-15
Computed tomography and pornographic findings of 63 patients with hepatoma, undergone hepatic angiography and superior mesenteric pornography for evaluation of tumor and thrombosis of portal vein and determination of indication of transcatheter arterial embolization for palliative treatment of hepatoma from April, 85 to June, 86 in Hanyang university hospital, were reviewed. The results were as follows: 1. In 36 cases, portal vein thrombosis was detected during photography. Nineteen of 37 cases which revealed localized hepatoma in the right lobe of the liver showed portal vein thrombosis; 9 of 11 cases of the left lobe; 8 of 14 cases which were involved in entire liver revealed thrombosis. One case localized in the caudate lobe showed no evidence of invasion to portal vein. 2. Twenty-four of 34 cases with diffuse infiltrative hepatoma revealed portal vein thrombosis and the incidence of portal vein thrombosis in this type were higher than in the cases of the nodular type. 3. The portal vein thrombosis appeared as filling defects of low density in the lumen of the portal veins in CT and they did not reveal contrast enhancement. 4. CT revealed well the evidence of obstructions in the cases of portal vein thrombosis and the findings were well-corresponded to the findings of the superior mesenteric photography. 5. Five of the cases of the portal vein thrombosis were missed in the CT and the causes were considered as due to partial volume effect of enhanced portal vein with partial occlusion or arterioportal shunts. 6. Six of 13 cases with occlusion of main portal vein showed cavernous transformation and they were noted as multiple small enhanced vascularities around the porta hepatis in the CT. According to the results, we conclude that CT is a useful modality to detect the changes of the portal veins in the patients of the hepatoma.
Computed tomographic evaluation of the portal vein in the hepatomas
International Nuclear Information System (INIS)
Lee, Kee Hyung; Lee, Seung Chul; Bae, Man Gil; Seo, Heung Suk; Kim, Soon Yong; Lee, Min Ho; Kee, Choon Suhk; Park, Kyung Nam
1986-01-01
Computed tomography and pornographic findings of 63 patients with hepatoma, undergone hepatic angiography and superior mesenteric pornography for evaluation of tumor and thrombosis of portal vein and determination of indication of transcatheter arterial embolization for palliative treatment of hepatoma from April, 85 to June, 86 in Hanyang university hospital, were reviewed. The results were as follows: 1. In 36 cases, portal vein thrombosis was detected during photography. Nineteen of 37 cases which revealed localized hepatoma in the right lobe of the liver showed portal vein thrombosis; 9 of 11 cases of the left lobe; 8 of 14 cases which were involved in entire liver revealed thrombosis. One case localized in the caudate lobe showed no evidence of invasion to portal vein. 2. Twenty-four of 34 cases with diffuse infiltrative hepatoma revealed portal vein thrombosis and the incidence of portal vein thrombosis in this type were higher than in the cases of the nodular type. 3. The portal vein thrombosis appeared as filling defects of low density in the lumen of the portal veins in CT and they did not reveal contrast enhancement. 4. CT revealed well the evidence of obstructions in the cases of portal vein thrombosis and the findings were well-corresponded to the findings of the superior mesenteric photography. 5. Five of the cases of the portal vein thrombosis were missed in the CT and the causes were considered as due to partial volume effect of enhanced portal vein with partial occlusion or arterioportal shunts. 6. Six of 13 cases with occlusion of main portal vein showed cavernous transformation and they were noted as multiple small enhanced vascularities around the porta hepatis in the CT. According to the results, we conclude that CT is a useful modality to detect the changes of the portal veins in the patients of the hepatoma.
Sour and duke cherry viruses in South-West Europe
Directory of Open Access Journals (Sweden)
Rodrigo PÉREZ-SÁNCHEZ
2017-05-01
Full Text Available This study investigated the phytosanitary status of sour and duke cherry genetic resources in the Iberian Peninsula, and the incidence and leaf symptoms induced by the Prunus necrotic ringspot virus (PNRSV, Prune dwarf virus (PDV and Apple chlorotic leaf spot virus (ACLSV. Young leaf samples were taken from 204 sour and duke cherry trees belonging to ten cultivars, and were assayed by DAS-ELISA. Samples positive for any of the three viruses were also tested by RT-PCR. To associate the leaf symptoms with virus presence, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA and RT-PCR results indicated that 63% of the cherry trees were infected by at least one of these viruses. PNRSV occurred in all cultivars sampled and presented the highest infection rate (46%, followed by PDV (31% and ACLSV (6%. Many trees, (60 to 100%, were asymptomatic while harbouring single and mixed virus infections. The leaf symptoms associated with the viruses included chlorotic and dark brown necrotic ringspots on secondary veins and interveinal regions, for PNRSV, generalized chlorosis around the midveins, for PDV, chlorotic and reddish necrotic ringspots, for ACLSV, and generalized interveinal chlorosis, for mixed PNRSV and PDVinfections.
Park, Young Ho; Park, Kang Ryoung
2012-01-01
On the basis of the increased emphasis placed on the protection of privacy, biometric recognition systems using physical or behavioural characteristics such as fingerprints, facial characteristics, iris and finger‐vein patterns or the voice have been introduced in applications including door access control, personal certification, Internet banking and ATM machines. Among these, finger‐vein recognition is advantageous in that it involves the use of inexpensive and small devices that are diffic...
A Modified Technique of Basilic Vein Transposition for Haemodialysis
International Nuclear Information System (INIS)
Chaudhary, F. A.; Parvez, Z.
2014-01-01
Objective: To modify the technique of basilic vein transposition for vascular accesss for haemodialysis aiming at better maturation rate, longer survival of fistula and lesser complications. Study Design: Case series. Place and Duration of Study: Shaikh Zayed Hospital and Omer Hospital, Lahore, from February 2008 to July 2011. Methodology: Patients referred for basilic vein transposition for haemodialysis vascular access were prospectively enrolled. The surgical technique included small tracking incisions, an extra 3 - 4 cm of vein length harvesting to avoid tension in the vein in its new course, an oval arteriotomy and a smooth curved pathway, away from vein harvesting incision to avoid entrapment of vein in the scar. Maturation rate, fistula survival and other complications were noted. Results: There was no immediate failure in 51 patients. The complications during follow-up period were infection and thrombosis, bleeding and non-development of basilic vein in 2 patients each; and false aneurysm formation in one. Four patients died during follow-up period. The maturation time was 4.9 A +- 1.1 weeks. The early patency rate was 92.2%, same at 6 months and 90.7% at 12 months. Conclusion: Arteriovenous fistula constructed with modified technique of basilic vein transposition is an acceptable and valid option of vascular access for haemodialysis. (author)
Directory of Open Access Journals (Sweden)
KS Madhusudhan
2013-01-01
Full Text Available Extrahepatic portal vein stenosis is caused by a variety of benign and malignant diseases and results in development of symptoms due to portal hypertension. Benign post-surgical adhesions causing portal vein stenosis in non-transplant population is an uncommon etiology of portal hypertension. Endovascular treatment of such patients with angioplasty and stenting is uncommonly reported in literature. We report a case of portal hypertension caused by benign postoperative portal vein fibrosis, successfully treated by self-expandable metallic stent.
First Report of Carnation vein mottle virus Infecting Dianthus amurensis in China
Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (1). In August 2013, foliar mottle, shrinking and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Auton...
Applied anatomic study of testicular veins in adult cadavers and in human fetuses
Directory of Open Access Journals (Sweden)
Luciano A. Favorito
2007-04-01
Full Text Available OBJECTIVES: Analyze the anatomic variations of the testicular veins in human cadavers and fetuses. MATERIALS AND METHODS: One hundred male adult cadavers and 24 fetuses were studied. Four anatomic aspects were considered: 1 Number of testicular veins, 2 The local of vein termination, 3 Type and number of collaterals present and 4 Testicular vein termination angle. RESULTS: Cadavers - Right side - One testicular vein occurred in 85% and 2 veins in 5% of the cases. There were communicating veins with the colon in 21% of the cases. Left side - One testicular vein occurred in 82%, two veins in 15%, three veins in 2% and four veins in 1% of the cases. There were communicating veins with the colon in 31% of the cases. Fetuses - Right side -One testicular vein occurred in all cases. This vein drained to the vena cava in 83.3% of the cases, to the junction of the vena cava with the renal vein in 12.5% and to the renal vein in 4.2%. There were communicating veins with the colon in 25% of the cases. Left side - One testicular vein occurred in 66.6% of the cases, and 2 veins in occurred 33.3%. Communicating veins with the colon were found in 41.6% of the cases. CONCLUSION: The testicular vein presents numeric variations and also variations in its local of termination. In approximately 30% of the cases, there are collaterals that communicate the testicular vein with retroperitoneal veins. These anatomic findings can help understanding the origin of varicocele and its recurrence after surgical interventions.
Supracardiac total anomalous pulmonary venous connection with a descending vertical vein.
Shah, Sejal; Singh, Mukesh; John, Colin; Maheshwari, Sunita
2009-10-01
The commonly used Darling classification for total anomalous pulmonary venous connection (TAPVC) consists of supracardiac, cardiac, infracardiac, and mixed types (Craig et al., Lab Invest 6:44-64, 1967). In supracardiac TAPVC, the common pulmonary vein drains superiorly into the left innominate vein, the superior vena cava, or the azygos vein by way of an ascending vertical vein. We describe a case of supracardiac TAPVC draining into the azygos vein atypically by way of a descending vertical vein.
Induced chorioretinal venous anastomosis in experimental retinal branch vein occlusion.
McAllister, I L; Yu, D Y; Vijayasekaran, S; Barry, C; Constable, I
1992-01-01
Iatrogenic retinal vein to choroidal vein anastomoses were created using laser photocoagulation in six of seven dog eyes in which a partial branch retinal vein occlusion had previously been created photochemically. A similar attempt to create an anastomosis was made in six control eyes in which no branch vein occlusion was present. In the eyes in which a branch retinal vein had been created, a venous chorioretinal anastomosis appeared to be present by 3 to 6 weeks. In three control eyes simil...
International Nuclear Information System (INIS)
Kiyosue, Hiro; Tanoue, Shuichi; Sagara, Yoshiko; Okahara, Mika; Kashiwagi, Junji; Mori, Hiromu; Hori, Yuzo; Nagatomi, Hirofumi
2008-01-01
We evaluated the normal venous anatomy of the anterior medullary/anterior pontomesencephalic venous (AMV/APMV) system and bridging veins connected to the dural sinuses using magnetic resonance (MR) imaging and demonstrated cases of dural arteriovenous fistulas (DAVFs) with bridging venous drainage. MR images obtained using a 3D gradient echo sequence in 70 patients without lesions affecting the deep or posterior venous channels were reviewed to evaluate the normal anatomy of the AMV/APMV system and bridging veins. MR images and digital subtraction angiography in 80 cases with intracranial or craniocervical junction DAVFs were reviewed to evaluate the bridging venous drainage from DAVFs. MR images clearly revealed AMV/APMV in 35 cases. Fifteen cases showed a direct connection between AMV and APMV, while 15 cases showed an indirect communication via the transverse pontine vein or the bridging vein. In the five remaining cases, the AMV and APMV end separately to the bridging vein or the transverse pontine vein. Bridging veins were identified in 34 cases, connecting to the cavernous sinus in 33, to the suboccipital cavernous sinus in 11, and the inferior petrosal sinus in five cases. In 80 DAVF cases, seven of 40 cavernous sinus DAVFs, two craniocervical junction DAVFs, and one inferior petrosal sinus DAVF drained via bridging veins to the brain stem. The AMV/APMV and bridging veins showed various anatomies and frequently showed a connection to the cavernous sinus. Knowledge of the venous anatomy is helpful for the diagnosis and intravascular treatment of DAVFs. (orig.)
Radiation Retinopathy Associated with Central Retinal Vein Occlusion
Institute of Scientific and Technical Information of China (English)
Yan; Liu; FengWen
2007-01-01
Purpose: To report a case of radiation retinopathy associated with central retinal vein occlusion.Methods: The clinical features and fundus fluorescein angiography of this case were analyzed.Results: The patient had been treated with radiotherapy for her nasopharyngeal carcinoma, and presented with sudden visual loss in the left eye. The funduscopic examination and fluorescein angiography showed the features of radiation retinopathy in both eyes, and central retinal vein occlusion in the left eye.Conclusions: Radiation retinopathy can be associated with central retinal vein occlusion in the same eye, and it seems that the endothelial cell loss caused by radiation retinopathy may lead to retinal vein occlusion.
Disastrous Portal Vein Embolization Turned into a Successful Intervention
Energy Technology Data Exchange (ETDEWEB)
Dobrocky, Tomas, E-mail: tomas.dobrocky@insel.ch [University of Bern, Department of Interventional, Pediatric and Diagnostic Radiology, Inselspital, University Hospital (Switzerland); Kettenbach, Joachim, E-mail: joachim.kettenbach@stpoelten.lknoe.at [Universitätsklinikum St. Pölten-Lilienfeld, Institute of Medical Radiology, Diagnostic, Intervention (Austria); Lopez-Benitez, Ruben, E-mail: Ruben.lopez@insel.ch; Kara, Levent, E-mail: levent.kara@insel.ch [University of Bern, Department of Interventional, Pediatric and Diagnostic Radiology, Inselspital, University Hospital (Switzerland)
2015-10-15
Portal vein embolization (PVE) may be performed before hemihepatectomy to increase the volume of future liver remnant (FLR) and to reduce the risk of postoperative liver insufficiency. We report the case of a 71-year-old patient with hilar cholangiocarcinoma undergoing PVE with access from the right portal vein using a mixture of n-butyl-2-cyanoacrylate and ethiodized oil. During the procedure, nontarget embolization of the left portal vein occurred. An aspiration maneuver of the polymerized plug failed; however, the embolus obstructing portal venous flow in the FLR was successfully relocated into the right portal vein while carefully bypassing the plug with a balloon catheter, inflating the balloon, and pulling the plug into the main right portal vein.
Non-contact finger vein acquisition system using NIR laser
Kim, Jiman; Kong, Hyoun-Joong; Park, Sangyun; Noh, SeungWoo; Lee, Seung-Rae; Kim, Taejeong; Kim, Hee Chan
2009-02-01
Authentication using finger vein pattern has substantial advantage than other biometrics. Because human vein patterns are hidden inside the skin and tissue, it is hard to forge vein structure. But conventional system using NIR LED array has two drawbacks. First, direct contact with LED array raise sanitary problem. Second, because of discreteness of LEDs, non-uniform illumination exists. We propose non-contact finger vein acquisition system using NIR laser and Laser line generator lens. Laser line generator lens makes evenly distributed line laser from focused laser light. Line laser is aimed on the finger longitudinally. NIR camera was used for image acquisition. 200 index finger vein images from 20 candidates are collected. Same finger vein pattern extraction algorithm was used to evaluate two sets of images. Acquired images from proposed non-contact system do not show any non-uniform illumination in contrary with conventional system. Also results of matching are comparable to conventional system. We developed Non-contact finger vein acquisition system. It can prevent potential cross contamination of skin diseases. Also the system can produce uniformly illuminated images unlike conventional system. With the benefit of non-contact, proposed system shows almost equivalent performance compared with conventional system.
Management of reticular veins and telangiectases.
Smith, Philip Coleridge
2015-11-01
To review the literature related to the management of reticular varices and telangiectases of the lower limbs to provide guidance on the treatment of these veins. Very few randomised clinical trials are available in this field. A European Guideline has been published on the treatment of reticular varices and telangiectases, which is largely based on the opinion of experts. Older accounts written by individual phlebologists contain extensive advice from their own practice, which is valuable in identifying effective methods of sclerotherapy. All accounts indicate that a history should be taken combined with a clinical and ultrasound examination to establish the full extent of the venous disease. Sclerotherapy is commenced by injecting the larger veins first of all, usually the reticular varices. Later in the same session or in subsequent sessions, telangiectases can be treated by direct injection. Following treatment, the application of class 2 compression stockings for a period of up to three weeks is beneficial but not used universally by all phlebologists. Further sessions can follow at intervals of 2-8 weeks in which small residual veins are treated. Resistant veins can be managed by ultrasound-guided injection of underlying perforating veins and varices. Other treatments including RF diathermy and laser ablation of telangiectases have very limited efficacy in this condition. Sclerotherapy, when used with the correct technique, is the most effective method for the management of reticular varices and telangiectases. © The Author(s) 2015.
A review of the anatomy and clinical significance of adrenal veins.
Cesmebasi, Alper; Du Plessis, Maira; Iannatuono, Mark; Shah, Sameer; Tubbs, R Shane; Loukas, Marios
2014-11-01
The adrenal veins may present with a multitude of anatomical variants, which surgeons must be aware of when performing adrenalectomies. The adrenal veins originate during the formation of the prerenal inferior vena cava (IVC) and are remnants of the caudal portion of the subcardinal veins, cranial to the subcardinal sinus in the embryo. The many communications between the posterior cardinal, supracardinal, and subcardinal veins of the primordial venous system provide an explanation for the variable anatomy. Most commonly, one central vein drains each adrenal gland. The long left adrenal vein joins the inferior phrenic vein and drains into the left renal vein, while the short right adrenal vein drains immediately into the IVC. Multiple variations exist bilaterally and may pose the risk of surgical complications. Due to the potential for collaterals and accessory adrenal vessels, great caution must be taken during an adrenalectomy. Adrenal venous sampling, the gold standard in diagnosing primary hyperaldosteronism, also requires the clinician to have a thorough knowledge of the adrenal vein anatomy to avoid iatrogenic injury. The adrenal vein acts as an important conduit in portosystemic shunts, thus the nature of the anatomy and hypercoagulable states pose the risk of thrombosis. © 2014 Wiley Periodicals, Inc.
Kinetics of vein graft hyperplasia
International Nuclear Information System (INIS)
Zwolak, R.M.; Adams, M.C.; Clowes, A.W.
1986-01-01
Human aortocoronary vein grafts fail due to accelerated occlusive disease. The possibility that this is related to cellular hyperplasia was investigated in a rabbit model where kinetics of vein graft thickening, endothelial (EC) repair, and smooth muscle cell (SMC) proliferation were measured from 2 days to 24 weeks after implanting jugular vein segments in the carotid artery. Immediately after graft placement focal EC denudation was observed. These defects were repaired within 1 week and did not recur. By 4 weeks intimal area had increased 30 fold from 0.028 +/- 0.004 to 0.705 +/- 0.021 mm 2 , and a 24 weeks was 0.93 +/- 0.21 mm 2 . This response did not produce a reduction in graft lumen area. EC and SMC thymidine-labeling index were measured by en face and cross-section autoradiography after injection of 3 H-thymidine and perfusion fixation. Despite rapid EC surface repair EC labeling index remained elevated and only returned to normal levels at 12 weeks; SMC labeling was 10 fold greater than baseline even at 24 weeks (0.22% vs 0.02%). SMC mass demonstrated morphometrically increased between 2 and 12 weeks. Intimal thickening in vein grafts is due to SMC proliferation and develops after the EC layer has been restored. In contrast, intimal SMC proliferate in damaged arteries when the EC layer is absent and cease when the EC layer is regenerated
Interventional treatment for the occlusive hepatic veins in Budd-Chiari syndrome
International Nuclear Information System (INIS)
Zhang Xitong; Xu Ke; Feng Bo; Su Hongying; Li Hong; Zu Maoheng; Cui Jingguo; Yang Xueliang; Zhao Jinxu; Chen Kai
2003-01-01
Objective: To evaluate the interventional methods for occlusive hepatic veins in Budd-Chiari syndrome and its mid and long-term effects. Methods: Forty-two patients (male 17 cases and female 25 cases) aged from 18 to 57 years old (mean 34.5 years) were studied. The liver functions were Child A in 23 cases, Child B in 6 cases, and Child C in 13 cases, respectively. A total of 92 hepatic veins were occluded. Among them, 29 left hepatic veins, 24 middle hepatic veins, 36 right hepatic veins, and 3 accessory hepatic veins were occluded. Thirty-four patients were accompanied with the stenotic or occlusive inferior vena cave (IVC) . The interventional methods included: (1) recanalization of occlusive hepatic veins (by transjugular, transfemoral, and percutaneous transhepatic route, or the combination of above three methods); (2) percutaneous transluminal angioplasty; (3) self-expanding stent implantation. The occlusive IVC in 32 patients also accepted PTA and/or stent implantation. Results: The successful recanalization was carried out in forty hepatic veins in 40 patients. PTA of occlusive veins was followed by stent implantation in 8 patients. The pressure of hepatic veins dropped from 34.5 cm H 2 O (25.0-48.0 cm H 2 O) to 22.0 cm H 2 O (12.0-35.0 cm H 2 O) after intervention (T=11.50, P < 0.01). The symptoms and pathological signs improved obviously in 32 cases and improved partly in 8 cases. During the follow-up period from 1 month to 54 months (mean 27.5 months), one cases died of liver function failure at one month after intervention. The re-intervention of occlusive veins in two cases were performed and the better results were acquired again. Five cases didn't accept re-intervention. Neither recurrence of symptoms nor re-occlusion of hepatic veins was found in the other 32 patients. Conclusion: (1) Multiple and synthetical interventional methods for the occlusive hepatic veins in Budd-Chiari syndrome can be utilized. (2) The intervention of hepatic vein is mini
International Nuclear Information System (INIS)
Arkorful, E.
2012-11-01
Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were
Duplex sonography of the near-surface leg veins; Duplexsonographie der oberflaechlichen Beinvenen
Energy Technology Data Exchange (ETDEWEB)
Mendoza, E.
2007-07-01
The book contains the following contributions: The ultrasonograph, selection of the ultrasonic transducer, anatomy of the near-surface vein system, physiology of the near-surface vein system, varicose status classification, systematics of the duplex sonography of near-surface leg veins, provocational maneuver for the duplex sonographic varicose diagnostics, exploration of vena saphena parva, perforans veins, side branches, phlebitis, sonography for varicose therapy, postsurgical sonography, deep leg veins, examination of near-surface leg veins for the pathology of the deep vein system, differential diagnostic clarification of leg oedema from the phlebologic-lymphological view, diagnostic side features along the near-surface leg veins.
Generating and analyzing synthetic finger vein images
Hillerström, Fieke; Kumar, Ajay; Veldhuis, Raymond N.J.
2014-01-01
Abstract: The finger-vein biometric offers higher degree of security, personal privacy and strong anti-spoofing capabilities than most other biometric modalities employed today. Emerging privacy concerns with the database acquisition and lack of availability of large scale finger-vein database have
Complications of umbilical vein catherisation. Case Report
International Nuclear Information System (INIS)
Bothur-Nowacka, J.; Czech-Kowalska, J.; Gruszfeld, D.; Nowakowska-Rysz, M.; Dobrzanska, A.; Kosciesza, A.; Polnik, D.
2011-01-01
Umbilical vein catheterization is a relatively easy procedure performed routinely on the neonate intensive care units. It provides a fast central vein access, but some complications have been described in the literature. Case Reports: We presented a case report of a premature infant (34 hbd) with extravasation of the parenteral nutrition and drugs to the liver after umbilical vein catheterization. Fever and increasing biochemical markers of infection were observed. USG revealed a heterogenic, well-limited space of 4 cm in diameter, located in the right lobe of the liver. CT excluded liver abscess. Considering neoplastic process or incorrect location of the catheter of the central vein, we performed liver biopsy. Results: Cytological and biochemical analysis of the aspirated fluid revealed extravasation of parenteral nutrition to the liver.Our case confirms the necessity of controlling a proper location of the central catheter right after its insertion and during hospitalization. (authors)
[Treatment of nontumoral portal vein thrombosis in cirrhosis].
Bañares, Rafael; Catalina, María-Vega
2014-07-01
Portal vein thrombosis in cirrhosis is a relatively common complication associated with the presence of an accompanying prothrombotic phenotype of advanced cirrhosis. The consequences of portal vein thrombosis are relevant because it can be associated with impaired hepatic function, might contraindicate hepatic transplantation and could increase morbidity in the surgical procedure. There is controversy concerning the most effective treatment of portal vein thrombosis, which is based on information that is seldom robust and whose primary objective is to achieve a return to vessel patency. Various studies have suggested that starting anticoagulation therapy early is associated with portal vein repatency more frequently than without treatment and has a low rate of complications. There are no proven data on the type of anticoagulant (low-molecular-weight heparins or dicoumarin agents) and the treatment duration. The implementation of TIPS is technically feasible in thrombosis without cavernous transformation and is associated with portal vein recanalization in a significant proportion of cases. Thrombolytic therapy does not appear to present an adequate balance between efficacy and safety; its use is therefore not supported for this indication. The proper definition of treatment for portal vein thrombosis requires properly designed studies to delimit the efficacy and safety of the various alternatives. Copyright © 2014 Elsevier España, S.L. All rights reserved.
Catheter Displacement into Inferior Epigastric Vein Causing Local Phlebitis and Cellulitis
Directory of Open Access Journals (Sweden)
Noriko Hattori
2012-01-01
Full Text Available Catheter insertion for intravenous hyperalimentation is a commonly and widely used clinical technique. When compared with the incidence of complications associated with insertions into the internal jugular vein or the subclavian vein, complications associated with insertions into the femoral vein are less frequent. In this paper, we describe a very rare complication of femoral vein catheter insertion—namely, catheter displacement into the inferior epigastric vein.
Renal Vein Reconstruction for Harvesting Injury in Kidney Transplantation
Directory of Open Access Journals (Sweden)
Birkan Bozkurt
2014-03-01
Full Text Available Kidney transplantation is the best treatment choice in the end-stage renal disease. In the renal transplantation, renal vein damage or shortness which occurs during cadaveric or living donor nephrectomy causes technical difficulties for surgeons. The lack of the donors already especially cadaveric, the acquirement of the graft, gets very much importance. In this report, it is aimed to share the clinical experiment by which it seen, how anastomosis can become appropriate by using the renal vein which is damaged in the way that anastomosis cannot be done anyway by using cadaveric vena cava graft. The renal vein brought to length for anostomosis which is repaired by using cadaveric vena cava graft, is anastomosed successfully by becoming an end-to-side of the external iliac vein of the recipient. Vascular anastomoses are applied easily in technique. The time of the warm ischemia was under 2 hours and the kidney was functional in the post-operative period. Renal vein trombosis was not observed. The renal vein damage occured during cadaveric or living donor nephrectomy, can be repaired by some methods. In the kidneys in which vein requirement is done, the success rates are rather high although acute tubular necrosis and delayed function can be seen more.
Morphological studies in a model for dengue-2 virus infection in mice
Directory of Open Access Journals (Sweden)
Ortrud Monika Barth
2006-12-01
Full Text Available One of the main difficulties in studying dengue virus infection in humans and in developing a vaccine is the absence of a suitable animal model which develops the full spectrum of dengue fever, dengue haemorrhagic fever, and dengue shock syndrome. It is our proposal to present morphological aspects of an animal model which shows many similarities with the dengue infection in humans. BALB/c mice were intraperitoneally infected with non-neuroadapted dengue virus serotype 2 (DENV-2. Histopathological and morphometrical analyses of liver tissue revealed focal alterations along the infection, reaching wide-ranging portal and centrolobular veins congestion and sinusoidal cell death. Additional ultrastructural observations demonstrated multifocal endothelial injury, platelet recruitment, and alterated hepatocytes. Dengue virus antigen was detected in hepatocytes and in the capillar endothelium of the central lobular vein area. Liver function tests showed high levels of aspartate transaminase and alanine transaminase enzyme activity. Lung tissue showed interstitial pneumonia and mononuclear cells, interseptal oedema, hyperplasia, and hypertrophy of the bronchiolar epithelial cells. DENV-2 led to a transient inflammatory process, but caused focal alterations of the blood-exchange barrier. Viremia was observed from 2nd to 11th day p.i. by isolation of DENV-2 in C6/36 mosquito cell line inoculated with the supernatant of macerated liver, lung, kidney, and cerebellum tissues of the infected mice.
Congestive index of portal vein
International Nuclear Information System (INIS)
Kim, Won Ho; Kim, H. K.; Lee, S. C.; Han, S. H.; Han, K. H.; Chung, J. B.; Choi, H. J.
1989-01-01
In patients with portal hypertension, the blood flow volume is maintained despite decreased blood flow velocity due to enlargement of the vascular cross sectional area. Thus, the 'congestion index' of the portal vein, which is the ratio between the cross sectional area (cm2) and the blood flow velocity (cm/sec) determined by a Doppler ultrasonography, may be a sensitive index by which to assess portal hypertension. We performed Doppler ultrasonography on 24 normal subjects, 14 patients with biopsy proved chronic active hepatitis and 55 patients with liver cirrhosis in order to assess the diagnostic value of the congestion index. The cross sectional area of the portal vein was significantly enlarged and the mean blood flow velocity was significantly reduced in patients with liver cirrhosis compared with controls. However, the blood flow volume was no difference. The congestion index of the portal vein was significantly increased in patients with liver cirrhosis (0.113+0.035) compared with patients with chronic active hepatitis(0.078+0.029) (p<0.001) and controls (0.053+0.016) (p<0.001). The sensitivity, specificity and predictability of the congestion index for detection of patients with the cirrhosis of the liver were 76.4%, 100% and 100% respectively, when the normal range was set at mean+2SD. The results suggest that the congestion index of the portal vein may pla a significant role in diagnosis of portal hypertensive patients
Phenotypic heterogeneity in the endothelium of the human vortex vein system.
Yu, Paula K; Tan, Priscilla E Z; Cringle, Stephen J; McAllister, Ian L; Yu, Dao-Yi
2013-10-01
The vortex vein system is the drainage pathway for the choroidal circulation and serves an important function in the effective drainage of the exceptionally high blood flow from the choroidal circulation. As there are only 4-6 vortex veins, a large volume of blood must be drained from many choroidal veins into each individual vortex vein. The vortex vein system must also cope with passing through tissues of different rigidity and significant pressure gradient as it transverses from the intrao-cular to the extra-ocular compartments. However, little is known about how the vortex vein system works under such complex situations in both physiological and pathological condition. Endothelial cells play a vital role in other vascular systems, but they have not been studied in detail in the vortex vein system. The purpose of this study is to characterise the intracellular structures and morphology in both the intra-and extra-ocular regions of the human vortex vein system. We hypothesise the presence of endothelial phenotypic heterogeneity through the vortex vein system. The inferior temporal vortex vein system from human donor eyes were obtained and studied histologically using confocal microscopy. The f-actin cytoskeleton and nuclei were labelled using Alexa Fluor conjugated Phalloidin and YO-PRO-1. Eight regions of the vortex vein system were examined with the venous endothelium studied in detail with quantitative data obtained for endothelial cell and nuclei size and shape. Significant endothelial phenotypic heterogeneity was found throughout the vortex vein system with the most obvious differences observed between the ampulla and its downstream regions. Variation in the distribution pattern of smooth muscle cells, in particular the absence of smooth muscle cells around the ampulla, was noted. Our results suggest the presence of significantly different haemodynamic forces in different regions of the vortex vein system and indicate that the vortex vein system may play
Finger Vein Recognition Based on Personalized Weight Maps
Yang, Gongping; Xiao, Rongyang; Yin, Yilong; Yang, Lu
2013-01-01
Finger vein recognition is a promising biometric recognition technology, which verifies identities via the vein patterns in the fingers. Binary pattern based methods were thoroughly studied in order to cope with the difficulties of extracting the blood vessel network. However, current binary pattern based finger vein matching methods treat every bit of feature codes derived from different image of various individuals as equally important and assign the same weight value to them. In this paper, we propose a finger vein recognition method based on personalized weight maps (PWMs). The different bits have different weight values according to their stabilities in a certain number of training samples from an individual. Firstly we present the concept of PWM, and then propose the finger vein recognition framework, which mainly consists of preprocessing, feature extraction, and matching. Finally, we design extensive experiments to evaluate the effectiveness of our proposal. Experimental results show that PWM achieves not only better performance, but also high robustness and reliability. In addition, PWM can be used as a general framework for binary pattern based recognition. PMID:24025556
Finger Vein Recognition Based on Personalized Weight Maps
Directory of Open Access Journals (Sweden)
Lu Yang
2013-09-01
Full Text Available Finger vein recognition is a promising biometric recognition technology, which verifies identities via the vein patterns in the fingers. Binary pattern based methods were thoroughly studied in order to cope with the difficulties of extracting the blood vessel network. However, current binary pattern based finger vein matching methods treat every bit of feature codes derived from different image of various individuals as equally important and assign the same weight value to them. In this paper, we propose a finger vein recognition method based on personalized weight maps (PWMs. The different bits have different weight values according to their stabilities in a certain number of training samples from an individual. Firstly we present the concept of PWM, and then propose the finger vein recognition framework, which mainly consists of preprocessing, feature extraction, and matching. Finally, we design extensive experiments to evaluate the effectiveness of our proposal. Experimental results show that PWM achieves not only better performance, but also high robustness and reliability. In addition, PWM can be used as a general framework for binary pattern based recognition.
Centers for Disease Control (CDC) Podcasts
2012-04-05
This podcast discusses the risk for deep vein thrombosis in long-distance travelers and ways to minimize that risk. Created: 4/5/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Date Released: 4/5/2012.
Characterization of a porcine model of chronic superficial varicose veins.
Jones, Gregory T; Grant, Mark W; Thomson, Ian A; Hill, B Geraldine; van Rij, André M
2009-06-01
Previous animal models of venous disease, while inducing venous hypertension and valvular insufficiency, do not produce superficial varicose veins. In this study, we aimed to develop and characterize a pig-based model of superficial varicose veins. Right femoral arteriovenous fistulae (AVF) were surgically fashioned in young adult pigs. Animals were examined at postoperative times up to 15 weeks to determine the development of varicose veins and measurement of both blood pressure and flow velocities within the superficial thigh veins. Histology and vascular corrosion casts were used to characterize the resulting structural venous alterations. Porcine pathophysiological features were compared with those of human primary superficial varicose veins. Gross superficial varicosities developed over the ipsilateral medial thigh region after an initial lag period of 1-2 weeks. Veins demonstrated retrograde filling with valvular incompetence, and a moderate, non-pulsatile, venous hypertension, which was altered by changes in posture and Valsalva. Venous blood flow velocities were elevated to 15-30 cm/s in varicose veins. Structurally, pig varicose veins were enlarged, tortuous, had valvular degeneration, and regions of focal medial atrophy with or without overlying intimal thickening. The superficial varicose veins, which developed within this model, have a pathophysiology that is consistent with that observed in humans. The porcine femoral AVF model is proposed as a suitable experimental model to evaluate the pathobiology of superficial venous disease. It may also be suitable for the evaluation of treatment interventions including drug therapy.
[Portal perfusion with right gastroepiploic vein flow in liver transplant].
Mendoza-Sánchez, Federico; Javier-Haro, Francisco; Mendoza-Medina, Diego Federico; González-Ojeda, Alejandro; Cortés-Lares, José Antonio; Fuentes-Orozco, Clotilde
Liver transplantation in patients with liver cirrhosis, portal vein thrombosis, and cavernous transformation of the portal vein, is a complex procedure with high possibility of liver graft dysfunction. It is performed in 2-19% of all liver transplants, and has a significantly high mortality rate in the post-operative period. Other procedures to maintain portal perfusion have been described, however there are no reports of liver graft perfusion using right gastroepiploic vein. A 20 year-old female diagnosed with cryptogenic cirrhosis, with a Child-Pugh score of 7 points (class "B"), and MELD score of 14 points, with thrombosis and cavernous transformation of the portal vein, severe portal hypertension, splenomegaly, a history of upper gastrointestinal bleeding due to oesophageal varices, and left renal agenesis. The preoperative evaluation for liver transplantation was completed, and the right gastroepiploic vein of 1-cm diameter was observed draining to the infrahepatic inferior vena cava and right suprarenal vein. An orthotopic liver transplantation was performed from a non-living donor (deceased on January 30, 2005) using the Piggy-Back technique. Portal vein perfusion was maintained using the right gastroepiploic vein, and the outcome was satisfactory. The patient was discharged 13 days after surgery. Liver transplantation was performed satisfactorily, obtaining an acceptable outcome. In this case, the portal perfusion had adequate blood flow through the right gastroepiploic vein. Copyright © 2015 Academia Mexicana de Cirugía A.C. Publicado por Masson Doyma México S.A. All rights reserved.
A study of images of Projective Angles of pulmonary veins
Energy Technology Data Exchange (ETDEWEB)
Wang Jue [Beijing Anzhen Hospital, Beijing (China); Zhaoqi, Zhang [Beijing Anzhen Hospital, Beijing (China)], E-mail: zhaoqi5000@vip.sohu.com; Yu Wei; Miao Cuilian; Yan Zixu; Zhao Yike [Beijing Anzhen Hospital, Beijing (China)
2009-09-15
Aims: In images of magnetic resonance and computed tomography (CT) there are visible angles between pulmonary veins and the coronary, transversal or sagittal section of body. In this study these angles are measured and defined as Projective Angles of pulmonary veins. Several possible influential factors and characters of distribution are studied and analyzed for a better understanding of this imaging anatomic character of pulmonary veins. And it could be the anatomic base of adjusting correctly the angle of the central X-ray of the angiography of pulmonary veins undergoing the catheter ablation of atrial fibrillation (AF). Method: Images of contrast enhanced magnetic resonance angiography (CEMRA) and contrast enhanced computer tomography (CECT) of the left atrium and pulmonary veins of 137 health objects and patients with atrial fibrillation (AF) are processed with the technique of post-processing, and Projective Angles to the coronary and transversal sections are measured and analyzed statistically. Result: Project Angles of pulmonary veins are one of real and steady imaging anatomic characteristics of pulmonary veins. The statistical distribution of variables is relatively concentrated, with a fairly good representation of average value. It is possible to improve the angle of the central X-ray according to the average value in the selective angiography of pulmonary veins undergoing the catheter ablation of AF.
Adrenal vein catheterization. Anatomic considerations
Energy Technology Data Exchange (ETDEWEB)
El-Sherief, M.A. (Akademiska Sjukhuset, Uppsala (Sweden))
1982-01-01
Twenty post-mortem specimens and 93 phlebographies (56 right side, 37 left side) from 44 patients were investigated with respect to the adrenal venous anatomy. At autopsy, the venous orifices displayed in the area of adrenal drainage were injected bilaterally to identify the adrenal vein(s), the surrounding channels and the presence of interconnections. The findings were correlated with those at clinical phlebography, and the different sources of error were elicited. These were mainly found on the right side. Some guidelines are suggested in the hope that these will contribute to eliminate misconceptions.
International Nuclear Information System (INIS)
Nishie, Akihiro; Yoshimitsu, Kengo; Honda, Hiroshi; Kaneko, Kuniyuki; Kuroiwa, Toshiro; Fukuya, Tatsuro; Irie, Hiroyuki; Ninomiya, Toshiharu; Yoshimitsu, Takahiro; Hirakata, Hideki; Okuda, Seiya; Masuda, Kouji
1997-01-01
A 43-year-old non-cirrhotic woman suffered from encephalopathy caused by an extrahepatic portosystemic shunt between the ileal vein and inferior vena cava via the right gonadal vein. Percutaneous transcatheter embolization with stainless steel coils was performed by the retrograde systemic venous approach. Encephalopathy improved dramatically
International Nuclear Information System (INIS)
Rich, R.A.; Holland, H.D.; Petersen, U.
1975-01-01
A critical review is presented of published data bearing on the mineralogy, paragenesis, geochemistry, and origin of veiw-type uranium deposits. Its aim is to serve as a starting point for new research and as a basis for the development of new exploration strategies. During the formation of both vein and sandstone types of deposits uranium seems to have been dissolved by and transported in rather oxidized solutions, and deposited where these solutions encountered reducing agents such as carbon, sulfides, ferrous minerals and hydrocarbons. Granitic rocks abnormally enriched in uranium have apparently been the most common source for uranium in vein-type deposits. Oxidizing solutions have been derived either from the surface or from depth. Surface solutions saturated with atmospheric oxygen have frequently passed through red bed or clean sandstone conduits on their way to and from uranium source rocks. Deep solutions of non-surface origin have apparently become sufficiently oxidizing by passage through and equilibration with red beds. The common association of clean sandstones or red beds with uranium-rich granites in the vicinity of vein-type uranium deposits is probably not fortuitous, and areas where these rock types are found together are considered particularly favorable targets for uranium exploration
Harris, P; Da Silva, T; How, T
1996-01-01
A vein cuff interposed at the distal anastomosis between a prosthetic vascular graft and a recipient infrageniculate artery improves the chances of continued patency of the graft, at least in the short and medium term. The mode of effect appears to be suppression or modification of anastomotic myointimal hyperplasia (MIH). In the event of graft failure the recipient artery and run-off vessels remain free from MIH and their patency is preserved thereby improving the prospects for further vascular reconstruction and limb salvage. The mechanisms by which interposition vein cuffs might modulate MIH are reviewed. Experimental evidence is described to show that the geometry of a cuffed anastomosis promotes a characteristic haemodynamic flow structure with a stable vortex. It is suggested that this vortex exerts greater shear stress upon the wall of the artery than the normal laminar flow observed in conventional anastomoses. High shear stress is known to inhibit MIH.
Effect of pre-sowing gamma irradiated lupin seeds on growth characters and yield components
International Nuclear Information System (INIS)
Ragab, M.A.
1988-01-01
Selected seeds of lupin were exposed to Co 60 -source to achieve doses of 2.5, 5, 10, 20, 40, 80, 160, or 320 Grey, beside the control treatment, irradiated and unirradiated seeds were sown and the raised plants were grown under field condition at Agric. Dept. of Soil and Water Res. A.E.A. Representative plant samples were taken at early growth stage 15-days-old seedling at flowering and at harvest. The gained results could be summarized as follows: Plant growth parameters: Plant height, particularly at early stages and at flowering and the produced dry matter were statistically affected by the treatments. Leaf pigment content was intensified by almost 14-28% over control treatment. Total carbohydrates and soluble protein in plant leaves were statistically influenced by the applied irradiation doses. Number of pods was materially affected by the treatments while no remarkable effect was noted as far as a number of seeds/plant and dry weight of seeds/plant were considered: consequently: seed index was not materially affected
DEFF Research Database (Denmark)
Viuff, B.; Tjørnehøj, Kirsten; Larsen, Lars Erik
2002-01-01
and clearance in a natural target animal. Replication of BRSV was demonstrated in the luminal part of the respiratory epithelial cells and replication in the upper respiratory tract preceded the replication in the lower respiratory tract. Virus excreted to the lumen of the respiratory tract was cleared...... and the infections with human respiratory syncytial. virus and BRSV have similar clinical, pathological, and epidemiological characteristics. In this study we used experimental BRSV infection in calves as a model of respiratory syncytial virus infection to demonstrate important aspects of viral replication......Human respiratory syncytial virus is an important cause of severe respiratory disease in young children, the elderly, and in immunocompromised adults. Similarly, bovine respiratory syncytial virus (BRSV) is causing severe, sometimes fatal, respiratory disease in calves. Both viruses are pneumovirus...
Directory of Open Access Journals (Sweden)
Candy M Taylor
Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other
Directory of Open Access Journals (Sweden)
Sachin Chittawar
2013-01-01
Full Text Available Background: Demonstration of central: Peripheral adrenocorticotropic hormone (ACTH gradient is important for diagnosis of Cushing′s disease. Aim: The aim was to assess the utility of internal jugular vein (IJV: Peripheral vein ACTH ratio for diagnosis of Cushing′s disease. Materials and Methods: Patients with ACTH-dependent Cushing′s syndrome (CS patients were the subjects for this study. One blood sample each was collected from right and left IJV following intravenous hCRH at 3 and 5 min, respectively. A simultaneous peripheral vein sample was also collected with each IJV sample for calculation of IJV: Peripheral vein ACTH ratio. IJV sample collection was done under ultrasound guidance. ACTH was assayed using electrochemiluminescence immunoassay (ECLIA. Results: Thirty-two patients participated in this study. The IJV: Peripheral vein ACTH ratio ranged from 1.07 to 6.99 ( n = 32. It was more than 1.6 in 23 patients. Cushing′s disease could be confirmed in 20 of the 23 cases with IJV: Peripheral vein ratio more than 1.6. Four patients with Cushing′s disease and 2 patients with ectopic ACTH syndrome had IJV: Peripheral vein ACTH ratio less than 1.6. Six cases with unknown ACTH source were excluded for calculation of sensitivity and specificity of the test. Conclusion: IJV: Peripheral vein ACTH ratio calculated from a single sample from each IJV obtained after hCRH had 83% sensitivity and 100% specificity for diagnosis of CD.
Convolutional Neural Network-Based Finger-Vein Recognition Using NIR Image Sensors.
Hong, Hyung Gil; Lee, Min Beom; Park, Kang Ryoung
2017-06-06
Conventional finger-vein recognition systems perform recognition based on the finger-vein lines extracted from the input images or image enhancement, and texture feature extraction from the finger-vein images. In these cases, however, the inaccurate detection of finger-vein lines lowers the recognition accuracy. In the case of texture feature extraction, the developer must experimentally decide on a form of the optimal filter for extraction considering the characteristics of the image database. To address this problem, this research proposes a finger-vein recognition method that is robust to various database types and environmental changes based on the convolutional neural network (CNN). In the experiments using the two finger-vein databases constructed in this research and the SDUMLA-HMT finger-vein database, which is an open database, the method proposed in this research showed a better performance compared to the conventional methods.
DEFF Research Database (Denmark)
Lundgren, F; Schroeder, Torben Veith
2012-01-01
Randomized studies evaluating the effect of a vein collar at the distal anastomosis of PTFE-grafts show conflicting results. The study of the Joint Vascular Research Group (JVRG) of UK found improved primary patency while the Scandinavian Miller Collar Study (SCAMICOS) found neither any effect...
International Nuclear Information System (INIS)
Luska, G.; Langer, H.E.; Le Blanc, S.; Medizinische Hochschule Hannover
1984-01-01
The authors report on a fatal mesenteric vein thrombosis following an uncomplicated percutaneous transhepatic portal vein catheterisation for the localisation of an insulinoma. Several hours after the procedure the patient developed an acute abdomen. An emergency laparotomy revealed a haemorrhagic infarct of the ileum. The resected specimen showed an acute phlebitis with fresh thrombus. The cause of the phlebothrombosis was thought to be intimal damage from high osmolar contrast medium. There was no evidence of damage due to the catheder, either on the phlebogram or pathologically. (orig.) [de
Directory of Open Access Journals (Sweden)
Héctor Camilo Medina Cárdenas
2017-10-01
Full Text Available Viral diseases are among the most limiting factors in the production of potato in Colombia and the rest of the world. The best strategy to control plant viruses consists on the use of certified seed tubers, control of arthropod vectors and the use of adequate crop management practices that reduce mechanical transmission and the presence of viral reservoirs like weeds and volun-teer plants. However, the successful implementation of these practices relies on the availability of highly sensitive techniques that allow for the asymptomatic detection of viruses. In this work, we tested the performance of Next-generation sequencing (NGS and real time RT-PCR (RT-qPCR on a single volunteer potato plant (cv. Diacol-Capiro growing naturally in a seed-tuber storage facility in Yarumal (Antioquia. Our NGS results demonstrate a mixed infection with Potato virus Y (PVY and Potato leafroll virus (PLRV. RT-qPCR was performed in roots, main stolons, crown (root collar and upper, middle and lower leaves using specific primers for PVY, PLRV, Potato virus S (PVS, Potato virus V (PVV, Potato virus X (PVX and Potato yellow vein virus (PYVV. Only PVY and PLRV were detected in good agreement with the NGS data. This work demonstrates the use-fulness of both techniques for supporting integrated management of plant viruses in potato, in-cluding virus detection in natural reservoirs such as volunteer plants and weeds.
Incidental retroaortic left innominate vein in adult patient
Directory of Open Access Journals (Sweden)
Alexandre Semionov, MD, PhD
2017-09-01
Full Text Available Retro-aortic left innominate vein is a rare vascular abnormality, usually associated with congenital heart disease. Here we report a case of isolated retro-aortic left innominate vein in an adult female.
Nitroprusside modulates pulmonary vein arrhythmogenic activity
Directory of Open Access Journals (Sweden)
Chen Yao-Chang
2010-03-01
Full Text Available Abstract Background Pulmonary veins (PVs are the most important sources of ectopic beats with the initiation of paroxysmal atrial fibrillation, or the foci of ectopic atrial tachycardia and focal atrial fibrillation. Elimination of nitric oxide (NO enhances cardiac triggered activity, and NO can decrease PV arrhythmogensis through mechano-electrical feedback. However, it is not clear whether NO may have direct electrophysiological effects on PV cardiomyocytes. This study is aimed to study the effects of nitroprusside (NO donor, on the ionic currents and arrhythmogenic activity of single cardiomyocytes from the PVs. Methods Single PV cardiomyocytes were isolated from the canine PVs. The action potential and ionic currents were investigated in isolated single canine PV cardiomyocytes before and after sodium nitroprusside (80 μM, using the whole-cell patch clamp technique. Results Nitroprusside decreased PV cardiomyocytes spontaneous beating rates from 1.7 ± 0.3 Hz to 0.5 ± 0.4 Hz in 9 cells (P Conclusion Nitroprusside regulates the electrical activity of PV cardiomyocytes, which suggests that NO may play a role in PV arrhythmogenesis.
TrapEase inferior vena cava filter placement: use of the subclavian vein.
Stone, Patrick A; Aburahma, Ali F; Hass, Stephen M; Hofeldt, Matthew J; Zimmerman, William B; Deel, John T; Deluca, John A
2004-01-01
The purpose of this paper was to evaluate the safety and technical success of TrapEase inferior vena cava filter placement via the subclavian vein. As of yet, no reports in the literature have specifically investigated the use of the subclavian vein as a route for deploying TrapEase vena cava filters. Retrospective chart review was conducted of 135 patients with attempted TrapEase inferior vena cava filter placement over a 2-year period. In a majority of cases, the choice of subclavian vein approach was based primarily on surgeon preference. Other circumstances for subclavian vein deployment included cervical immobilization secondary to trauma, desire for concomitant placement of a subclavian long-term central venous access catheter, and patient body habitus limiting exposure to the internal jugular vein. One hundred and thirty-five filters were placed over this 2-year period. The internal jugular vein approach was used in 56 patients, the femoral vein approach in 39 patients, and the subclavian vein approach in 40 patients. Thirty-nine of the 40 TrapEase filter placements using the subclavian vein were successful. Twenty-six were deployed through the right subclavian vein and 14 through the left subclavian vein. The single failed subclavian deployment was due to the inability to pass the guidewire adequately into the inferior vena cava after successful cannulation of the right subclavian vein. The average deployment time for subclavian vein placement was 26 minutes when TrapEase filter placement was the only procedure performed. No insertional complications were encountered, specifically no pneumothoraces confirmed by chest radiography or fluoroscopy. The subclavian vein provides an alternative site of access for the TrapEase inferior vena cava filter. This route is comparable to other alternative methods evaluated both in average deployment time and complication occurrence. Furthermore, the subclavian vein route is valuable in patients with limited central access
Intravitreal triamcinolone acetonide injections in the treatment of retinal vein occlusions.
Roth, Daniel B; Cukras, Catherine; Radhakrishnan, Ravi; Feuer, William J; Yarian, David L; Green, Stuart N; Wheatley, Harold M; Prenner, Jonathan
2008-01-01
To report the visual acuity response after intravitreal triamcinolone injection in patients with macular edema due to retinal vein occlusions. Retrospective nonrandomized interventional series of 172 consecutive patients with macular edema due to retinal vein occlusions who were treated with intravitreal triamcinolone acetonide injection. Patients underwent Snellen visual acuity testing and ophthalmoscopic examination at baseline and 1, 3, 6, and 12 months after intravitreal triamcinolone acetonide injection. All subtypes of retinal vein occlusions showed significant improvements in mean visual acuity 1 month after injection. This improvement in visual acuity was maintained over the 12-month period for all but the central retinal vein occlusion group. Seventy-one (41.3%) of the 172 patients received more than one intravitreal triamcinolone injection for unresolved or recurrent macular edema. This study demonstrates a benefit associated with intravitreal triamcinolone acetonide injection for retinal vein occlusions that was maintained by patients with branch retinal vein occlusions and hemiretinal vein occlusions over a 12-month period. Visual acuity improvement was not maintained in patients with central retinal vein occlusions with this course of treatment.
Rodelo-Urrego, Manuel; García-Arenal, Fernando; Pagán, Israel
2015-01-01
Current declines in biodiversity put at risk ecosystem services that are fundamental for human welfare. Increasing evidence indicates that one such service is the ability to reduce virus emergence. It has been proposed that the reduction of virus emergence occurs at two levels: through a reduction of virus prevalence/transmission and, as a result of these epidemiological changes, through a limitation of virus genetic diversity. Although the former mechanism has been studied in a few host-virus interactions, very little is known about the association between ecosystem biodiversity and virus genetic diversity. To address this subject, we estimated genetic diversity, synonymous and non-synonymous nucleotide substitution rates, selection pressures, and frequency of recombinants and re-assortants in populations of Pepper golden mosaic virus (PepGMV) and Pepper huasteco yellow vein virus (PHYVV) that infect chiltepin plants in Mexico. We then analyzed how these parameters varied according to the level of habitat anthropization, which is the major cause of biodiversity loss. Our results indicated that genetic diversity of PepGMV (but not of PHYVV) populations increased with the loss of biodiversity at higher levels of habitat anthropization. This was mostly the consequence of higher rates of synonymous nucleotide substitutions, rather than of adaptive selection. The frequency of recombinants and re-assortants was higher in PepGMV populations infecting wild chiltepin than in those infecting cultivated ones, suggesting that genetic exchange is not the main mechanism for generating genetic diversity in PepGMV populations. These findings provide evidence that biodiversity may modulate the genetic diversity of plant viruses, but it may differentially affect even two closely related viruses. Our analyses may contribute to understanding the factors involved in virus emergence.
Robust finger vein ROI localization based on flexible segmentation.
Lu, Yu; Xie, Shan Juan; Yoon, Sook; Yang, Jucheng; Park, Dong Sun
2013-10-24
Finger veins have been proved to be an effective biometric for personal identification in the recent years. However, finger vein images are easily affected by influences such as image translation, orientation, scale, scattering, finger structure, complicated background, uneven illumination, and collection posture. All these factors may contribute to inaccurate region of interest (ROI) definition, and so degrade the performance of finger vein identification system. To improve this problem, in this paper, we propose a finger vein ROI localization method that has high effectiveness and robustness against the above factors. The proposed method consists of a set of steps to localize ROIs accurately, namely segmentation, orientation correction, and ROI detection. Accurate finger region segmentation and correct calculated orientation can support each other to produce higher accuracy in localizing ROIs. Extensive experiments have been performed on the finger vein image database, MMCBNU_6000, to verify the robustness of the proposed method. The proposed method shows the segmentation accuracy of 100%. Furthermore, the average processing time of the proposed method is 22 ms for an acquired image, which satisfies the criterion of a real-time finger vein identification system.
Robust Finger Vein ROI Localization Based on Flexible Segmentation
Directory of Open Access Journals (Sweden)
Dong Sun Park
2013-10-01
Full Text Available Finger veins have been proved to be an effective biometric for personal identification in the recent years. However, finger vein images are easily affected by influences such as image translation, orientation, scale, scattering, finger structure, complicated background, uneven illumination, and collection posture. All these factors may contribute to inaccurate region of interest (ROI definition, and so degrade the performance of finger vein identification system. To improve this problem, in this paper, we propose a finger vein ROI localization method that has high effectiveness and robustness against the above factors. The proposed method consists of a set of steps to localize ROIs accurately, namely segmentation, orientation correction, and ROI detection. Accurate finger region segmentation and correct calculated orientation can support each other to produce higher accuracy in localizing ROIs. Extensive experiments have been performed on the finger vein image database, MMCBNU_6000, to verify the robustness of the proposed method. The proposed method shows the segmentation accuracy of 100%. Furthermore, the average processing time of the proposed method is 22 ms for an acquired image, which satisfies the criterion of a real-time finger vein identification system.
Robust Finger Vein ROI Localization Based on Flexible Segmentation
Lu, Yu; Xie, Shan Juan; Yoon, Sook; Yang, Jucheng; Park, Dong Sun
2013-01-01
Finger veins have been proved to be an effective biometric for personal identification in the recent years. However, finger vein images are easily affected by influences such as image translation, orientation, scale, scattering, finger structure, complicated background, uneven illumination, and collection posture. All these factors may contribute to inaccurate region of interest (ROI) definition, and so degrade the performance of finger vein identification system. To improve this problem, in this paper, we propose a finger vein ROI localization method that has high effectiveness and robustness against the above factors. The proposed method consists of a set of steps to localize ROIs accurately, namely segmentation, orientation correction, and ROI detection. Accurate finger region segmentation and correct calculated orientation can support each other to produce higher accuracy in localizing ROIs. Extensive experiments have been performed on the finger vein image database, MMCBNU_6000, to verify the robustness of the proposed method. The proposed method shows the segmentation accuracy of 100%. Furthermore, the average processing time of the proposed method is 22 ms for an acquired image, which satisfies the criterion of a real-time finger vein identification system. PMID:24284769
Contact-free palm-vein recognition based on local invariant features.
Directory of Open Access Journals (Sweden)
Wenxiong Kang
Full Text Available Contact-free palm-vein recognition is one of the most challenging and promising areas in hand biometrics. In view of the existing problems in contact-free palm-vein imaging, including projection transformation, uneven illumination and difficulty in extracting exact ROIs, this paper presents a novel recognition approach for contact-free palm-vein recognition that performs feature extraction and matching on all vein textures distributed over the palm surface, including finger veins and palm veins, to minimize the loss of feature information. First, a hierarchical enhancement algorithm, which combines a DOG filter and histogram equalization, is adopted to alleviate uneven illumination and to highlight vein textures. Second, RootSIFT, a more stable local invariant feature extraction method in comparison to SIFT, is adopted to overcome the projection transformation in contact-free mode. Subsequently, a novel hierarchical mismatching removal algorithm based on neighborhood searching and LBP histograms is adopted to improve the accuracy of feature matching. Finally, we rigorously evaluated the proposed approach using two different databases and obtained 0.996% and 3.112% Equal Error Rates (EERs, respectively, which demonstrate the effectiveness of the proposed approach.
Contact-free palm-vein recognition based on local invariant features.
Kang, Wenxiong; Liu, Yang; Wu, Qiuxia; Yue, Xishun
2014-01-01
Contact-free palm-vein recognition is one of the most challenging and promising areas in hand biometrics. In view of the existing problems in contact-free palm-vein imaging, including projection transformation, uneven illumination and difficulty in extracting exact ROIs, this paper presents a novel recognition approach for contact-free palm-vein recognition that performs feature extraction and matching on all vein textures distributed over the palm surface, including finger veins and palm veins, to minimize the loss of feature information. First, a hierarchical enhancement algorithm, which combines a DOG filter and histogram equalization, is adopted to alleviate uneven illumination and to highlight vein textures. Second, RootSIFT, a more stable local invariant feature extraction method in comparison to SIFT, is adopted to overcome the projection transformation in contact-free mode. Subsequently, a novel hierarchical mismatching removal algorithm based on neighborhood searching and LBP histograms is adopted to improve the accuracy of feature matching. Finally, we rigorously evaluated the proposed approach using two different databases and obtained 0.996% and 3.112% Equal Error Rates (EERs), respectively, which demonstrate the effectiveness of the proposed approach.
DEFF Research Database (Denmark)
Holland-Fischer, Peter
2004-01-01
The case is presented of a 25-year-old Caucasian patient with Budd-Chiari syndrome due to membranous obstruction of the liver veins and inferior caval vein syndrome as a result of secondary hyperplasia of the caudate lobe of the liver, obstructing the caval vein. Diagnosis was established...... that angioplasty and TIPS are safe and efficient procedures to reduce liver engorgement and complications of portal hypertension in selected patients with Budd-Chiari syndrome....
Directory of Open Access Journals (Sweden)
Ashish Srivastava
2017-07-01
Full Text Available A previously unknown disease which causes severe vein thickening and inward leaf curl was observed in a number of opium poppy (Papaver somniferum L. plants. The sequence analysis of full-length viral genome and associated betasatellite reveals the occurrence of Ageratum enation virus (AEV and Ageratum leaf curl betasatellite (ALCB, respectively. Co-infiltration of cloned agroinfectious DNAs of AEV and ALCB induces the leaf curl and vein thickening symptoms as were observed naturally. Infectivity assay confirmed this complex as the cause of disease and also satisfied the Koch’s postulates. Comprehensive microscopic analysis of infiltrated plants reveals severe structural anomalies in leaf and stem tissues represented by unorganized cell architecture and vascular bundles. Moreover, the characteristic blebs and membranous vesicles formed due to the virus-induced disintegration of the plasma membrane and intracellular organelles were also present. An accelerated nuclear DNA fragmentation was observed by Comet assay and confirmed by TUNEL and Hoechst dye staining assays suggesting virus-induced programmed cell death. Virus-infection altered the biosynthesis of several important metabolites. The biosynthesis potential of morphine, thebaine, codeine, and papaverine alkaloids reduced significantly in infected plants except for noscapine whose biosynthesis was comparatively enhanced. The expression analysis of corresponding alkaloid pathway genes by real time-PCR corroborated well with the results of HPLC analysis for alkaloid perturbations. The changes in the metabolite and alkaloid contents affect the commercial value of the poppy plants.
Retinal vein occlusion: pathophysiology and treatment options
Karia, Niral
2010-01-01
Niral KariaDepartment of Ophthalmology, Southend Hospital, Prittlewell Chase, Westcliff on Sea, Essex, United KingdomAbstract: This paper reviews the current thinking about retinal vein occlusion. It gives an overview of its pathophysiology and discusses the evidence behind the various established and emerging treatment paradigms.Keywords: central, hemispheric, branch, retinal vein occlusion, visual loss
Directory of Open Access Journals (Sweden)
Endale Tefera
2014-01-01
Full Text Available Percutaneous closure of the patent arterial duct in patients with interrupted inferior caval vein poses a technical challenge. A 12-year-old girl with a patent ductus arteriosus (PDA and interrupted inferior caval vein is described in this report. The diagnosis of interrupted inferior caval vein and azygos continuation was made in the catheterization laboratory. A catheter was advanced and snared in the descending aorta. An exchange wire was advanced through the catheter and snared in the descending aorta. Then, an Amplatzer TorqVue 2 delivery sheath was advanced over the wire from the venous side and again snared in the descending aorta. An Amplatzer duct occluder (ADO size 8/6 was advanced through the sheath while still holding the sheath with a snare. The device was opened. The sheath was then unsnared once the aortic disc was completely out. The sheath and the device were pulled back into the duct and the device was successfully implanted. The device was then released and it attained a stable position. An aortic angiogram was performed which showed complete occlusion.
International Nuclear Information System (INIS)
Tefera, Endale; Bermudez-Cañete, Ramon
2014-01-01
Percutaneous closure of the patent arterial duct in patients with interrupted inferior caval vein poses a technical challenge. A 12-year-old girl with a patent ductus arteriosus (PDA) and interrupted inferior caval vein is described in this report. The diagnosis of interrupted inferior caval vein and azygos continuation was made in the catheterization laboratory. A catheter was advanced and snared in the descending aorta. An exchange wire was advanced through the catheter and snared in the descending aorta. Then, an Amplatzer TorqVue 2 delivery sheath was advanced over the wire from the venous side and again snared in the descending aorta. An Amplatzer duct occluder (ADO) size 8/6 was advanced through the sheath while still holding the sheath with a snare. The device was opened. The sheath was then unsnared once the aortic disc was completely out. The sheath and the device were pulled back into the duct and the device was successfully implanted. The device was then released and it attained a stable position. An aortic angiogram was performed which showed complete occlusion
[Intraosseous veins of the maxilla in the newborn].
Bogdanov, R A
1975-12-01
The intraosseous veins of the maxilla in newborns grow larger with enlargement of the bone and become disposed in three mutually perpendicular planes. The venous plexus of the alveolar process is large. V. v. vallares are thin and interlace forming a network. The veins of interdental septum are well pronounced. The thick venous network of the periosteum and the mucous membrane of the nasal surface of the palatine process includes the vessels transversal and longitudinal to the nasal septum. The venous loops of the incisor part are of triangular, pentagonal and polygonal shape. The veins of the palatine process are connected with 3-4 large vessels falling into the vessels of the tear duct. The transversal and oblique veins of the oral surface of the palatine process are connected with large vessels disposed in parallel to the medial structure of the hard palate. The venous network of the incisor part of the bone is restricted by densified small arc-shaped plexuses. Two-three largest veins lie sagittally and, connected by arc-shaped anastomoses, are tributaries of the vessels of the palate bone, soft palate and pharynx.
Anatomical variation of thyroid veins on contrast-enhanced multi-detector row computed tomography
Energy Technology Data Exchange (ETDEWEB)
Tomita, Hayato, E-mail: m04149@yahoo.co.jp [Department of Radiology, St. Marianna University School of Medicine, Yokohama City Seibu Hospital, 1197-1 Yasashicho, Asahi-ku, Yokohama, Kanagawa 241-0811 (Japan); Yamada, Takayuki; Murakami, Kenji; Hashimoto, Kazuki; Tazawa, Yoko; Kumano, Reiko [Department of Radiology, St. Marianna University School of Medicine, Yokohama City Seibu Hospital, 1197-1 Yasashicho, Asahi-ku, Yokohama, Kanagawa 241-0811 (Japan); Nakajima, Yasuo [Department of Radiology, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8511 (Japan)
2015-05-15
Highlights: • This is the first study to demonstrate the anatomy of thyroid veins on contrasted-enhanced MDCT. • Identifying the thyroid vein on MDCT prior to selective venous sampling of parathyroid hormone provides clinical information to interventional radiologist. • Detecting especially the inferior thyroid veins with individual variability in numbers, locations, and lengths may have an effect on SVS for HPT and decrease the difficulty and time of the procedure. - Abstract: Objective: The objective of this study was to clarify the anatomical variation of thyroid veins into the systemic vein using contrast-enhanced multi-detector row computed tomography (MDCT). Design and methods: : The subjects were 80 patients (34 males and 46 females; mean age, 50.1 years; age range, 15–92 years) with neck diseases who underwent MDCT. The number and location of inflow points of the thyroid veins into the systemic vein, and the length from the junction of bilateral brachiocephalic veins to the orifice of inferior thyroid vein were investigated by reviewing the axial and coronal images. Results: All superior thyroid veins were detected. Right and left middle thyroid veins were identified in 39 and 29 patients, respectively. Right inferior thyroid veins, left inferior thyroid veins, and common trunks were detected in 43, 46, and 39 patients, respectively; in five patients, two left thyroid veins were identified. All left inferior thyroid veins and 34 common trunks flowed into the innominate vein, while right ones had some variations in inflow sites. Mean lengths were 3.01 ± 1.30 cm (range, 0.5–6.19) and 2.04 ± 0.91 cm (0.5–4.4) in the left inferior thyroid vein and common trunk, and 1.96 ± 1.05 cm (0.81–4.8) and 1.65 ± 0.69 cm (0.63–2.94) in the right one flowing into the right internal jugular vein and the innominate vein, respectively. Conclusions: The numbers and orifices of thyroid veins were identified at high rates on contrast-enhanced MDCT. This
DEFF Research Database (Denmark)
Christensen, Jan Pravsgaard; Marker, O; Thomsen, Allan Randrup
1994-01-01
) was followed by measurement of footpad swelling. Ten days after virus inoculation, the animals were sacrificed and spleen virus titer together with splenic Tc activity was measured. With regard to all three parameters a continuous distribution was observed in this backcross population. However, using cutoff...... values based on parental and F1 animals tested in parallel, 11/30 animals were assigned Tc responders, 23/30 DTH responders and 10/30 cleared virus with maximal efficiency. Comparison of responder status with regard to the different parameters revealed a strong correlation between Tc responsiveness...... and the ability to clear virus. Amongst Tc low responders a correlation between DTH reactivity and virus clearance was observed. Taken together, these results indicate that non-MHC genes affect virus clearance through regulation of the antiviral T-cell response, especially the virus-specific Tc response. However...
Utilizing the Pahenu2 mouse model for phenylketonuria (PKU), we developed an improved expression vector containing the Woodchuck Hepatitis Virus post-transcriptional regulatory element inserted into a rAAV-mPAH construct (rAAV-mPAH-WPRE) for treatment of PKU. Following portal vein delivery of these ...
DEFF Research Database (Denmark)
Jensen, Annette Nygaard; Hansen, L. L.; Baggesen, Dorte Lau
2013-01-01
This study aimed to assess whether inclusion of chicory or lupine (prebiotics) in the diet of pre-slaughter pigs for just 1 or 2 weeks could change the composition of their intestinal microbiota, stimulate the growth of bifidobacteria and help to lower the amount of thermoplilic Campylobacter spp...... values >5% relative to the intensity of total abundance differed between the feed treatments (P prebiotics in the diet of pre-slaughter pigs elicited changes in the composition of the intestinal microbiota...
DEFF Research Database (Denmark)
Stensballe, Lone Graff; Ravn, Henrik; Kristensen, Kim
2009-01-01
This study used 459 prospectively sampled cord blood samples to examine the association between maternally derived respiratory syncytial virus (RSV)-neutralizing antibodies and the RSV hospitalization season in Denmark. We found a clear temporal association and suggest that RSV-neutralizing antib......This study used 459 prospectively sampled cord blood samples to examine the association between maternally derived respiratory syncytial virus (RSV)-neutralizing antibodies and the RSV hospitalization season in Denmark. We found a clear temporal association and suggest that RSV......-neutralizing antibody level plays a role in the RSV seasonal pattern....
International Nuclear Information System (INIS)
Chennur, Vikash SrinivasaiahSetty; Sharma, Raju; Gamanagatti, Shivanand; Gupta, Arun Kumar; Bhatnagar, Veereshwar; Vishnubhatla, Sreenivas
2011-01-01
Extrahepatic portal vein obstruction (EHPVO) is a common cause of paediatric portal hypertension and the only permanent treatment is shunt surgery. The inferior mesenteric vein (IMV) is a portal venous channel that can be used for the shunt when the splenic vein/superior mesenteric vein is thrombosed or when a lienorenal shunt is not possible. To compare MDCT venography (MDCTV) and contrast-enhanced MR venography (CEMRV) for visualisation of the IMV in children with EHPVO. This was a prospective study of 26 children (4-12 years, median 10 years) who underwent MDCTV and CEMRV. The IMV visualisation was graded using 4- and 2-point scales and the difference in visualisation was assessed by calculating the exact significance probability (P). The IMV was visualised in all children on MDCTV and 25/26 children on CEMRV (96%). The images were diagnostic in 23/26 children (88%) on MDCTV and in 18/26 (69%) children on CEMRV (P = 0.063). MDCTV and CEMRV are comparable for IMV visualisation with a tendency toward MDCTV being superior. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Chennur, Vikash SrinivasaiahSetty; Sharma, Raju; Gamanagatti, Shivanand; Gupta, Arun Kumar [All India Institute of Medical Sciences (AIIMS), Department of Radiology, New Delhi (India); Bhatnagar, Veereshwar [AIIMS, Department of Paediatric Surgery, New Delhi (India); Vishnubhatla, Sreenivas [AIIMS, Department of Biostatistics, New Delhi (India)
2011-03-15
Extrahepatic portal vein obstruction (EHPVO) is a common cause of paediatric portal hypertension and the only permanent treatment is shunt surgery. The inferior mesenteric vein (IMV) is a portal venous channel that can be used for the shunt when the splenic vein/superior mesenteric vein is thrombosed or when a lienorenal shunt is not possible. To compare MDCT venography (MDCTV) and contrast-enhanced MR venography (CEMRV) for visualisation of the IMV in children with EHPVO. This was a prospective study of 26 children (4-12 years, median 10 years) who underwent MDCTV and CEMRV. The IMV visualisation was graded using 4- and 2-point scales and the difference in visualisation was assessed by calculating the exact significance probability (P). The IMV was visualised in all children on MDCTV and 25/26 children on CEMRV (96%). The images were diagnostic in 23/26 children (88%) on MDCTV and in 18/26 (69%) children on CEMRV (P = 0.063). MDCTV and CEMRV are comparable for IMV visualisation with a tendency toward MDCTV being superior. (orig.)
Primary leiomyosarcoma of the innominate vein.
Illuminati, Giulio; Miraldi, Fabio; Mazzesi, Giuseppe; D'urso, Antonio; Ceccanei, Gianluca; Bezzi, Marcello
2007-01-01
Primary venous leiomyosarcoma is rare. We report the case of a primary leiomyosarcoma of the left innominate vein, with neoplastic thrombus extending into the left jugular and subclavian veins. The tumor was curatively resected en bloc with anterior mediastinal and laterocervical lymphatics, through a median sternotomy prolonged into left cervicotomy. Primary venous sarcomas may be associated with prolonged survival in individual cases, with curative resection recommended as the standard treatment, in the absence of distant spread.
Right top pulmonary vein: Evaluation with 64 section multidetector computed tomography
International Nuclear Information System (INIS)
Arslan, Gokhan; Dincer, Elvan; Kabaalioglu, Adnan; Ozkaynak, Can
2008-01-01
Purpose: To evaluate the incidence and anatomic features of the rare variant of the pulmonary veins named 'right top pulmonary vein' as depicted with 64 section multidetector computed tomography (MDCT). Materials and methods: MDCT of 610 patients obtained over 12 months period for diagnosis of suspected thoracic or cardiac pathology were routinely reviewed in transverse and 3D images. The frequency of right top pulmonary vein (RTPV) was determined and anatomic features were also documented. Results: Right top pulmonary vein (RTPV) is a supernumerary vein arising from the roof of the right part of the left atrium separately from the orifice of the right superior pulmonary vein. It crosses behind the intermediate bronchus and drains mainly posterior segment of the right upper lobe but also receives few subsegmental branches of superior segment of the right lower lobe. It was detected in 2.2% of patients (14/610). The mean diameter of RTPV was 5.1 mm. Conclusion: The RTPV is a rare venous drainage variation of pulmonary veins. It is important to be aware of this anatomic pattern for avoiding misinterpretation of pulmonary venographic findings, inadvertent ablation of pulmonary vein and perioperative bleeding during video assisted thorocoscopic lobectomy
International Nuclear Information System (INIS)
Daud Mohamad; Mackanzie, A.B.; Russell, M.J.
1996-01-01
Analysis of uranium and thorium clearly show evidence that the uranium veins in hornfelsed Silurian greywackes at Beeswing have been subjected to two phases of uranium distribution i.e. (i) long - term leaching with preferential loss Of sup 234 U relative to sup 238 U, and (ii) recent, rapid loss of uranium with a probability of dissolution of uranium from the vein qf about 5.2 x 10 sup -5 y sup -1. Uranium content in the soil generally tends to be enriched at depth and near the surface as a result of leaching of veins materials. The near surface uranium is only observed closed to the veins, suggesting highly efficient retardation of uranium by organic matter, whereas uranium-rich soil at depth represent re-deposition of uranium from groundwater, probably associated with Fe-Mn sesquioxides or uptake by clay minerals. The study revealed that the overlying soil acts as a potentially important site of deposition and as such constitute the final barrier in the multi-barrier systems for radioactive waste disposal
Regional heterogeneity of endothelial cells in the porcine vortex vein system.
Tan, Priscilla Ern Zhi; Yu, Paula K; Cringle, Stephen J; Morgan, William H; Yu, Dao-Yi
2013-09-01
The aim of this study was to investigate whether region-dependent endothelial heterogeneity is present within the porcine vortex vein system. The superior temporal vortex vein in young adult pig eyes were dissected out and cannulated. The intact vortex vein system down to the choroidal veins was then perfused with labels for f-actin and nucleic acid. The endothelial cells within the choroidal veins, pre-ampulla, anterior portion of the ampulla, mid-ampulla, posterior portion of the ampulla, post-ampulla, intra-scleral canal and the extra-ocular vortex vein regions were studied in detail using a confocal microscopy technique. The endothelial cell and nuclei length, width, area and perimeter were measured and compared between the different regions. Significant regional differences in the endothelial cell and nuclei length, width, area and perimeter were observed throughout the porcine vortex vein system. Most notably, very narrow and elongated endothelia were found in the post-ampulla region. A lack of smooth muscle cells was noted in the ampulla region compared to other regions. Heterogeneity in endothelial cell morphology is present throughout the porcine vortex vein system and there is a lack of smooth muscle cells in the ampulla region. This likely reflects the highly varied haemodynamic conditions and potential blood flow control mechanisms in different regions of the vortex vein system. Copyright © 2013 Elsevier Inc. All rights reserved.
Management Strategy for Patients With Chronic Subclavian Vein Thrombosis.
Keir, Graham; Marshall, M Blair
2017-02-01
We performed a systematic review to determine best practice for the management of patients with chronic or subacute subclavian vein thrombosis. This condition is best managed with surgical excision of the first rib followed by long-term anticoagulation. Interventional techniques aimed at restoring patency are ineffective beyond 2 weeks postthrombosis. Additional therapeutic options should be made based on the severity of symptoms as well as vein status. Patients with milder symptoms are given decompression surgery followed by anticoagulation whereas patients with more severe symptoms are considered for either a jugular vein transposition or saphenous patch based on the vein characteristics. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
MULTIPLE VARIATIONS OF THE SUPERFICIAL JUGULAR VEINS: CASE REPORT AND CLINICAL RELEVANCE
Directory of Open Access Journals (Sweden)
George Paraskevas
2014-01-01
Full Text Available The jugular venous system constitutes the primary venous drainage of the head and neck. It includes a profundus or subfascial venous system, formed by the two internal jugular veins, and a superficial or subcutaneous one, formed by the two anterior and two external jugular veins. We report one case of unilateral anatomical variations of the external and anterior jugular veins. Particularly, on the right side, three external jugular veins co-existed with two anterior jugular veins. Such a combination of venous anomalies is extremely rare. The awareness of the variability of these veins is essential to anesthesiologists and radiologists, since the external jugular vein constitutes a common route for catheterization. Their knowledge is also important to surgeons performing head and neck surgery.
Surgery for acquired cardiovascular disease: antiseptic treatment of contaminated vein grafts.
Schmidt, F P; Peivandi, A A; Kohnen, W; Jansen, B
2014-04-01
Saphenous vein grafts harvested for use as bypass conduits can be contaminated intraoperatively, e.g. by being inadvertently dropped to the floor of the operating room (OR). This study was performed to investigate microorganisms most likely contaminating vein grafts and to assess the possible efficacy of measures to treat potentially contaminated vein grafts antiseptically for further use. In a first step we determined the microbiological flora of the OR using surface cultures and cultures from intentionally dropped vein grafts. Several antiseptic agents (PVP-iodine 10%, octenidinhydrochloride 0.1%, polyhexanide 1%) were evaluated for their in vitro efficacy to disinfect artificially contaminated vein segments. The most promising antiseptic regimen was tested on veins contaminated in a real OR setting. Finally, we tested for possible alterations in mechanical properties of the veins caused by antiseptic treatment. Coagulase-negative staphylococci where the predominant bacteria recovered from the OR with 59.9%. Antiseptic treatment with a combination of octenidine and PVP-iodine resulted in a higher rate of negative cultures than any single agent. Treatment of 50 saphenous vein grafts contaminated in the OR with the combination regimen resulted in only 3 positive cultural results within 7 days. Mechanical tear-stress testing comparing antiseptically treated vein grafts with controls showed no difference in their resistance to tear stress. Antiseptic treatment of contaminated vein grafts was shown to be effective in a high percentage of cases without altering mechanical properties of grafts and may be an option for the surgeon in case of a contamination.
Amouzeshi, Ahmad; Teshnisi, Mohamad Abbassi; Zirak, Nahid; Shamloo, Alireza Sepehri; Hoseinikhah, Hamid; Alizadeh, Behzad; Moeinipour, Aliasghar
2016-01-01
Harvesting of the greater saphenous vein is almost an inevitable part of coronary artery bypass grafting (CABG) operations, and it is done by two main techniques, i.e., conventional or open vein harvesting (OVH) and the minimally-invasive endoscopic vein harvesting (EVH). This study aimed to compare these two techniques in off-pump CABG procedures with respect to clinical and pathological outcomes. This cohort study was conducted on CABG candidates during a one-year period from October 2013 through September 2014 in the Department of Cardiac Surgery at Mashhad University of Medical Sciences. Eighty-seven patients voluntarily underwent EVH, and another 86 patients matched for age, gender, and other cardiovascular risk factors were selected for OVH. They were followed up for six weeks, and the main outcome measures were infections of the wound, pain, duration of hospital stay, and the costs of hospitalization. Paired sample t-test, independent t-test, or their non-parametric equivalents and the chi-squared test were used by SPSS version 17.0 for data analysis. The mean duration of time for vein harvesting was shorter in the EVH group (p < 0.001), and the pain score was lower (p = 0.04). No infections occurred at the site of the wound. The length of hospital stay was not significantly different for the two groups (OVH versus EVH: 8.5 ± 3.3 versus 8.4 ± 3.2 days; p-value: 0.08). Hospitalization costs were significantly higher in the EVH group (OVH versus EVH: 5.8 ± 4.7 versus 7.3 ± 2.0 million Tomman; p-value: 0.008), yet no difference was diagnosed with respect to endothelial damage in the vein grafts harvested by the EVH and OVH techniques. EVH is considered as a minimally invasive and safe vein harvesting technique in our Center, and it can reduce the harvesting time and post-operative pain. In addition, its efficiency was similar to that of OVH.
Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun
2016-03-01
The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.
Directory of Open Access Journals (Sweden)
Huiyan Fan
Full Text Available Rhizomania is one of the most devastating diseases of sugar beet. It is caused by Beet necrotic yellow vein virus (BNYVV transmitted by the obligate root-infecting parasite Polymyxa betae. Beta macrocarpa, a wild beet species widely used as a systemic host in the laboratory, can be rub-inoculated with BNYVV to avoid variation associated with the presence of the vector P. betae. To better understand disease and resistance between beets and BNYVV, we characterized the transcriptome of B. macrocarpa and analyzed global gene expression of B. macrocarpa in response to BNYVV infection using the Illumina sequencing platform.The overall de novo assembly of cDNA sequence data generated 75,917 unigenes, with an average length of 1054 bp. Based on a BLASTX search (E-value ≤ 10-5 against the non-redundant (NR, NCBI protein, Swiss-Prot, the Gene Ontology (GO, Clusters of Orthologous Groups of proteins (COG and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, there were 39,372 unigenes annotated. In addition, 4,834 simple sequence repeats (SSRs were also predicted, which could serve as a foundation for various applications in beet breeding. Furthermore, comparative analysis of the two transcriptomes revealed that 261 genes were differentially expressed in infected compared to control plants, including 128 up- and 133 down-regulated genes. GO analysis showed that the changes in the differently expressed genes were mainly enrichment in response to biotic stimulus and primary metabolic process.Our results not only provide a rich genomic resource for beets, but also benefit research into the molecular mechanisms of beet- BNYV Vinteraction.
Directory of Open Access Journals (Sweden)
Jane McAllister
2014-09-01
Full Text Available Rhabdoviridae represent a diverse group of viruses with the potential to cause disease in humans, animals and plants. Currently there are nine genera in the family; however a large number of rhabdoviruses remain unassigned. Here we characterise three novel rhabdoviruses genomes. Almpiwar virus (ALMV, isolated from skinks in northern Queensland, is the first completely sequenced rhabdovirus from squamates, with serological studies indicating multiple animal host species. Harrison Dam virus (HARDV and Walkabout Creek virus (WACV were isolated from mosquitoes in the Northern Territory and biting midges in southern Queensland respectively and their vertebrate hosts remain unknown. Serological cross-neutralisation tests with other Australian rhabdoviruses indicate that ALMV, WACV and HARDV are distinct viruses with little antigenic cross-reactivity. Next-generation sequencing revealed that all viruses encode the core proteins common to rhabdoviruses (N, P, M, G and L, plus additional ORFs between the M and G genes. HARDV also contains a small ORF between the G and L genes. Phylogenetic analysis of N and L proteins suggests that HARDV and WACV share a common lineage with the tupaviruses and Sandjimba group, whereas ALMV is a distinct and divergent virus showing no clear relationship to any rhabdovirus except the recently characterised Niahka virus (NIAV.
International Nuclear Information System (INIS)
Gadalla, A.M.; El-Ghandour, I.A.; Abdel Aziz, H.A.; Hamdy, A.; Aly, M.M.
2002-01-01
The lupine Rhizobium symbiosis and contribution of N 2 fixation under different levels of irrigation water salinity were examined. Lysimeter experiment was established under greenhouse conditions during the year 2002-2003. In this experiment, inoculated plants were imposed to different salinity levels of irrigation water and N-fertilizer treatment. Plant height was decreased under different salinity levels, nitrogen treatments and bacterial inoculation. Similar trend was noticed with leaf area. The highest leaf area was recorded with salt tolerant bacterial inoculation (SBI) and splitting N-treatment. Highest values of N-uptake occurred after 100 day intervals under the tested factors. Relative decrease in N-uptake did not exceed 40% of those recorded with the fresh water treatment as affected by experimental factors. Nitrogen uptake by the whole plant reflected an increase at 3 dS/m salinity level of irrigation water. Relative increases were 5% and 15% for normal bacteria inoculation under single dose (NI) and splitting
Directory of Open Access Journals (Sweden)
Rishi Nayyar
2010-01-01
Full Text Available Leiomyosarcoma of inferior vena cava (IVC involving bilateral renal veins presents a surgical challenge. Herein, we report the successful management of two such cases using restoration of left renal venous outflow by saphenous vein interposition graft as first step of surgery. Then radical resection of tumor and right kidney was done. IVC was lastly reconstructed using Gore-Tex graft. This report highlights the surgical challenges to ensure radical resection. Furthermore, the importance of restoring left renal outflow in presence of concomitant right nephrectomy is discussed. Both the patients were disease free at six months with no loss of left renal glomerular filtration rate.
Beta irradiation inhibits neo-intimal formation in vein grafts
International Nuclear Information System (INIS)
Lang Xiaoou; Ji Shenquan; Zeng Ke; Li Jun; Liu Bingbing; Ma Wenfeng; Zhang Qiang
2002-01-01
Objective: The study was to evaluate the effect of beta irradiation on intimal proliferation response in vein grafts. Methods: An autogenous vein graft model was established in 40 rats by transplanting internal branch of jugular vein to carotid artery by end-to-end anastomosis. The vein was irradiated by 32 P before anastomosis. Four dose schedules were studied: (1) control graft (nonirradiated); (2) irradiated with 8 Gy; (3) 18 Gy; and (4) 36 Gy. The grafted veins were harvested at 2 weeks after the operation. IH (intimal hyperplasia) and SMC (smooth muscle cell) proliferation were histologically and immuno-histochemically observed and analyzed by a computer digitalising system. Results: In 18 Gy and 36 Gy-irradiated grafts compared with the control, there was a significant decrease in the average intimal thickness (P 0.05). Immunohistochemical analysis of PCNA indicated decrease of positive cells in both 18 Gy and 36 Gy groups compared with 8 Gy and the control group (P 0.05) groups, and there was also no significant difference between 8 Gy and the control group (P > 0.05). Conclusion: These preliminary results demonstrate that proper dose of beta irradiation in vein graft inhibits smooth muscle cells proliferation and neo-intimal hyperplasia in rat
Geometric Analysis of Vein Fracture Networks From the Awibengkok Core, Indonesia
Khatwa, A.; Bruhn, R. L.; Brown, S. R.
2003-12-01
Fracture network systems within rocks are important features for the transportation and remediation of hazardous waste, oil and gas production, geothermal energy extraction and the formation of vein fillings and ore deposits. A variety of methods, including computational and laboratory modeling have been employed to further understand the dynamic nature of fractures and fracture systems (e.g. Ebel and Brown, this session). To substantiate these studies, it is also necessary to analyze the characteristics and morphology of naturally occurring vein systems. The Awibengkok core from a geothermal system in West Java, Indonesia provided an excellent opportunity to study geometric and petrologic characteristics of vein systems in volcanic rock. Vein minerals included chlorite, calcite, quartz, zeolites and sulphides. To obtain geometric data on the veins, we employed a neural net image processing technique to analyze high-resolution digital photography of the veins. We trained a neural net processor to map the extent of the vein using RGB pixel training classes. The resulting classification image was then converted to a binary image file and processed through a MatLab program that we designed to calculate vein geometric statistics, including aperture and roughness. We also performed detailed petrographic and microscopic geometric analysis on the veins to determine the history of mineralization and fracturing. We found that multi-phase mineralization due to chemical dissolution and re-precipitation as well as mechanical fracturing was a common feature in many of the veins and that it had a significant role for interpreting vein tortuosity and history of permeability. We used our micro- and macro-scale observations to construct four hypothetical permeability models that compliment the numerical and laboratory modeled data reported by Ebel and Brown. In each model, permeability changes, and in most cases fluctuates, differently over time as the tortuosity and aperture of
Preventing Deep Vein Thrombosis
... Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management ... skin. A clot also can form if blood flow is too slow the lining of a vein ...
Corrêa, R L; Silva, T F; Simões-Araújo, J L; Barroso, P A V; Vidal, M S; Vaslin, M F S
2005-07-01
Cotton blue disease is an aphid-transmitted cotton disease described in Brazil in 1962 as Vein Mosaic "var. Ribeirão Bonito". At present it causes economically important losses in cotton crops if control measures are not implemented. The observed symptoms and mode of transmission have prompted researchers to speculate that cotton blue disease could be attributed to a member of the family Luteoviridae, but there was no molecular evidence supporting this hypothesis. We have amplified part of the genome of a virus associated with this disease using degenerate primers for members of the family Luteoviridae. Sequence analysis of the entire capsid and a partial RdRp revealed a virus probably belonging to the genus Polerovirus. Based on our results we propose that cotton blue disease is associated with a virus with the putative name Cotton leafroll dwarf virus (CLRDV).
Finger Vein Recognition Based on Local Directional Code
Meng, Xianjing; Yang, Gongping; Yin, Yilong; Xiao, Rongyang
2012-01-01
Finger vein patterns are considered as one of the most promising biometric authentication methods for its security and convenience. Most of the current available finger vein recognition methods utilize features from a segmented blood vessel network. As an improperly segmented network may degrade the recognition accuracy, binary pattern based methods are proposed, such as Local Binary Pattern (LBP), Local Derivative Pattern (LDP) and Local Line Binary Pattern (LLBP). However, the rich directional information hidden in the finger vein pattern has not been fully exploited by the existing local patterns. Inspired by the Webber Local Descriptor (WLD), this paper represents a new direction based local descriptor called Local Directional Code (LDC) and applies it to finger vein recognition. In LDC, the local gradient orientation information is coded as an octonary decimal number. Experimental results show that the proposed method using LDC achieves better performance than methods using LLBP. PMID:23202194
Finger Vein Recognition Based on Local Directional Code
Directory of Open Access Journals (Sweden)
Rongyang Xiao
2012-11-01
Full Text Available Finger vein patterns are considered as one of the most promising biometric authentication methods for its security and convenience. Most of the current available finger vein recognition methods utilize features from a segmented blood vessel network. As an improperly segmented network may degrade the recognition accuracy, binary pattern based methods are proposed, such as Local Binary Pattern (LBP, Local Derivative Pattern (LDP and Local Line Binary Pattern (LLBP. However, the rich directional information hidden in the finger vein pattern has not been fully exploited by the existing local patterns. Inspired by the Webber Local Descriptor (WLD, this paper represents a new direction based local descriptor called Local Directional Code (LDC and applies it to finger vein recognition. In LDC, the local gradient orientation information is coded as an octonary decimal number. Experimental results show that the proposed method using LDC achieves better performance than methods using LLBP.
Palm Vein Verification Using Multiple Features and Locality Preserving Projections
Directory of Open Access Journals (Sweden)
Ali Mohsin Al-juboori
2014-01-01
Full Text Available Biometrics is defined as identifying people by their physiological characteristic, such as iris pattern, fingerprint, and face, or by some aspects of their behavior, such as voice, signature, and gesture. Considerable attention has been drawn on these issues during the last several decades. And many biometric systems for commercial applications have been successfully developed. Recently, the vein pattern biometric becomes increasingly attractive for its uniqueness, stability, and noninvasiveness. A vein pattern is the physical distribution structure of the blood vessels underneath a person’s skin. The palm vein pattern is very ganglion and it shows a huge number of vessels. The attitude of the palm vein vessels stays in the same location for the whole life and its pattern is definitely unique. In our work, the matching filter method is proposed for the palm vein image enhancement. New palm vein features extraction methods, global feature extracted based on wavelet coefficients and locality preserving projections (WLPP, and local feature based on local binary pattern variance and locality preserving projections (LBPV_LPP have been proposed. Finally, the nearest neighbour matching method has been proposed that verified the test palm vein images. The experimental result shows that the EER to the proposed method is 0.1378%.
Yamashita, Rikiya; Yamaoka, Toshihide; Nishitai, Ryuta; Isoda, Hiroyoshi; Taura, Kojiro; Arizono, Shigeki; Furuta, Akihiro; Ohno, Tsuyoshi; Ono, Ayako; Togashi, Kaori
2017-07-01
This study aimed to evaluate the common features and variations of portal vein anatomy in right-sided round ligament (RSRL), which can help propose a method to detect and diagnose this anomaly. In this retrospective study of 14 patients with RSRL, the branching order of the portal tree was analyzed, with special focus on the relationship between the dorsal branch of the right anterior segmental portal vein (P A-D ) and the lateral segmental portal vein (P LL ), to determine the common features. The configuration of the portal vein from the main portal trunk to the right umbilical portion (RUP), the inclination of the RUP, and the number and thickness of the ramifications branching from the right anterior segmental portal vein (P A ) were evaluated for variations. In all subjects, the diverging point of the P A-D was constantly distal to that of the P LL . The portal vein configuration was I- and Z-shaped in nine and five subjects, respectively. The RUP was tilted to the right in all subjects. In Z-shaped subjects, the portal trunk between the branching point of the right posterior segmental portal vein and that of the P LL was tilted to the left in one subject and was almost parallel to the vertical plane in four subjects. Multiple ramifications were radially distributed from the P A in eight subjects, whereas one predominant P A-D branched from the P A in six subjects. Based on the diverging points of the P A-D and P LL , we proposed a three-step method for the detection and diagnosis of RSRL.
Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian
2012-07-01
HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.
A Tight Spot After Pulmonary Vein Catheter Ablation
Amir, Rabia; Yeh, Lu; Montealegre-Gallegos, Mario; Saraf, Rabya; Matyal, Robina; Mahmood, Feroze
2016-01-01
A 52-YEAR-OLD woman with a history of embolic stroke due to paroxysmal atrial fibrillation was referred to the authors’ institution for epicardial surgical pulmonary vein isolation with left atrial appendage resection. The patient had 2 previous failed pulmonary vein catheter ablations. Dense
van Overdam, Koen A; Missotten, Tom; Spielberg, Leigh H
2015-12-01
To update the surgical technique in which a vitrectomy is performed and a retinal branch vein is cannulated and infused with recombinant tissue plasminogen activator (RTPA) to treat central retinal vein occlusion (CRVO) in patients who present with very low visual acuity (VA). Twelve consecutive patients (12 eyes) with CRVO and low VA (logMAR >1.00) at presentation were treated using this method. Cannulation of a peripapillary retinal vein and stable injection of RTPA was successfully performed without surgery-related complications in all 12 eyes. At 12 months after surgery, 8 of the 12 patients (67%) experienced at least one line of improvement in best corrected visual acuity; 6 of the 12 (50%) improved ≥5 lines and 2 (17%) improved ≥8 lines. After additional grid laser and/or subconjunctival or intravitreal corticosteroids, the mean decrease in central foveal thickness was 260 μm, and the mean total macular volume decreased from 12.10 mm(3) to 9.24 mm(3) . Four patients received panretinal photocoagulation to treat either iris neovascularization (n = 2) or neovascularization of the retina and/or disc (n = 2). Administration of RTPA via a peripapillary vein using this updated technique provides an alternative or additional treatment option for patients with very low VA after CRVO. © 2015 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
CT of portal vein tumor thrombosis. Usefulness of dynamic CT
Energy Technology Data Exchange (ETDEWEB)
Takemoto, Kazumasa; Inoue, Yuichi; Tanaka, Masahiro; Nemoto, Yutaka; Nakamura, Kenji [Osaka City Univ. (Japan). Faculty of Medicine
1983-08-01
We evaluated CT findings of portal vein tumor thrombosis in 16 hepatomas by plain, contrast and dynamic CT. Plain and contrast CT findings were an enlargement of the portal vein (81%), intraluminal low density area (63%). Dynamic CT enhanced the diagnostic capability of the tumor thrombus as a relatively low density area because of the marked enhancement of the portal vein. In addition, dynamic CT newly demonstrated hyperdense peripheral ring (35%) and arterio portal shunt (35%). It is advisable to select the scan level to include the portal vein when dynamic CT is performed in the patient of hepatocellular carcinoma.
Palm vein recognition based on directional empirical mode decomposition
Lee, Jen-Chun; Chang, Chien-Ping; Chen, Wei-Kuei
2014-04-01
Directional empirical mode decomposition (DEMD) has recently been proposed to make empirical mode decomposition suitable for the processing of texture analysis. Using DEMD, samples are decomposed into a series of images, referred to as two-dimensional intrinsic mode functions (2-D IMFs), from finer to large scale. A DEMD-based 2 linear discriminant analysis (LDA) for palm vein recognition is proposed. The proposed method progresses through three steps: (i) a set of 2-D IMF features of various scale and orientation are extracted using DEMD, (ii) the 2LDA method is then applied to reduce the dimensionality of the feature space in both the row and column directions, and (iii) the nearest neighbor classifier is used for classification. We also propose two strategies for using the set of 2-D IMF features: ensemble DEMD vein representation (EDVR) and multichannel DEMD vein representation (MDVR). In experiments using palm vein databases, the proposed MDVR-based 2LDA method achieved recognition accuracy of 99.73%, thereby demonstrating its feasibility for palm vein recognition.
[Cockett's syndrome, May-Thurner syndrome, or iliac vein compression syndrome].
Gil Martín, A R; Carreras Aja, M; Arrieta Ardieta, I; Labayen Azparren, I
2014-01-01
Iliac vein compression syndrome (also known as May-Thurner syndrome or Cockett's syndrome) is a rare clinical entity in which the left common iliac vein is compressed when it passes between the right common iliac artery and the spine. The sustained compression and trauma caused by the pulsatile force of the artery on the vein damage the intima and lead to the formation of membranes or bands in the vascular lumen that hinder or obstruct the flow of blood in the vein, favoring thrombus formation. The current treatment strategy of choice is endovascular vein patch angioplasty and stenting with the aim of improving the caliber of the lumen and enabling normal venous drainage. We present two cases of May-Thurner syndrome and review the clinical and CT findings. Copyright © 2011 SERAM. Published by Elsevier Espana. All rights reserved.
Strasberg, Steven M; Bhalla, Sanjeev; Sanchez, Luis A; Linehan, David C
2011-11-01
The risks of developing sinistral portal hypertension as a result of occlusion of the splenic vein close to its termination during a Whipple procedure are unclear. Our purpose was to compare the pattern of venous collateral development after splenic vein ligation in an extended Whipple procedure with the pattern of collateral development in cases of sinistral portal hypertension. Five patients underwent an extended Whipple procedure in which the splenic vein was divided and not reconstructed. Six to eight months later detailed mapping of venous return from the spleen was determined by contrast-enhanced multidetector computed tomography or in one case by 3D contrast-enhanced MRI. Spleen size and length of residual patent splenic vein were also measured. The literature on sinistral portal hypertension was evaluated to ascertain whether the venous collateral pattern in cases of left-sided portal hypertension was similar to the pattern that developed when the splenic vein was ligated at its termination in the Whipple procedure. A length of splenic vein remained patent in all five patients, measuring 4.5 to 11.5 cm from the spleen. Splenomegaly did not develop. Blood returned from the spleen by multiple collaterals including collaterals in the omentum and mesocolon. These types of collaterals do not develop in sinistral portal hypertension, nor is residual patent splenic vein seen. Ligation of the splenic vein close to its termination in five patients resulted in a pattern of venous return different from patients that have developed left-sided portal hypertension.
A rare case of anastomosis between the external and internal jugular veins.
Karapantzos, Ilias; Zarogoulidis, Paul; Charalampidis, Charalampos; Karapantzou, Chrysanthi; Kioumis, Ioannis; Tsakiridis, Kosmas; Mpakas, Andrew; Sachpekidis, Nikolaos; Organtzis, John; Porpodis, Konstantinos; Zarogoulidis, Konstantinos; Pitsiou, Georgia; Zissimopoulos, Athanasios; Kosmidis, Christoforos; Fouka, Evagelia; Demetriou, Theodoros
2016-01-01
Jugular veins bring deoxygenated blood from the head back to the heart. There are two sets of external and internal veins. The external jugular vein receives the greater part of the blood from the cranium and the deep parts of the face. It commences from the substance of the parotid gland and runs down the neck at the posterior border of sternocleidomastoideus and ends in the subclavian vein in front of the scalenus anterior. The external jugular vein is covered by the platysma and its upper half runs parallel with the great auricular nerve. There is also another minor jugular vein, the anterior, draining the submaxillary region. In our patient, we recognized a shunt between the external and internal jugular veins. It appeared in the middle of the veins, between the pair of valves, which are placed ~2.5 cm above the termination of the vessel. The anastomosis was fully functional, and there was no problem in the blood pressure of the patient. Moreover, the shunt was not associated with any systemic disease.
Quartz-molybdenite veins in the Priestly Lake granodiorite, north-central Maine
Ayuso, Robert A.; Shank, Stephen G.
1983-01-01
Quartz-molybdenite veins up to 15 cm in width occur in fine to medium-grained porphyritic biotite-hornblende granodiorite at Priestly Lake north-central Maine. An area of about 150 m x 150 m contains quartz-molybdenite veins; a larger area is characterized by barren quartz veins. Quartz-molybdenite veins are concentrated within the most felsic variants of the intrusion as suggested by lower mafic mineral contents. The pluton has a narrow range in SiO2 (67-70 wt.%), major oxides, and in trace-element compositions. Molybdenite occurs as coarse grained clusters in pockets within the quartz veins, and fills fractures in the quartz veins and host rocks. Disseminated molybdenite in the granodiorite is relatively rare and occurs only in the area characterized by a high density of quartz veins (up to 50 veins per square meter). Alteration envelopes along the quartz veins are very thin or absent, although in some areas the granodiorite appears to be selectively and pervasively altered. Sericite, chlorite, epidote, calcite, pyrite, and quartz are concentrated near the quartz-molybdenite veins. Many of the field and geochemical characteristics of the Priestly Lake pluton are unlike those of major molybdenum-producing areas (Climax, Henderson, Urad). For example, the area of alteration seems to be of limited extent, the host rock is not intensely altered hydrothermally at the surface, the density of fractures is rather low in the mineralized area, and the amount of disseminated molybdenite appears to be small. However, the Priestly Lake pluton may be a small fraction of a concealed batholith as suggested by geophysical data. It is conceivable that the type of mineralization at the surface might be the expression of more extensive molybdenite mineralization at depth. The quartz-molybdenite veins in the Priestly Lake pluton are significant because they indicate that potential molybdenum sources for producing mineralized granites were available at depth. Future studies should be
A new design concept for knitted external vein-graft support mesh.
Singh, Charanpreet; Wang, Xungai
2015-08-01
Autologous vein-graft failure significantly limits the long-term efficacy of coronary artery bypass procedures. The major cause behind this complication is biomechanical mismatch between the vein and coronary artery. The implanted vein experiences a sudden increase (10-12 fold) in luminal pressures. The resulting vein over-distension or 'ballooning' initiates wall thickening phenomenon and ultimate occlusion. Therefore, a primary goal in improving the longevity of a coronary bypass procedure is to inhibit vein over-distension using mechanical constriction. The idea of using an external vein-graft support mesh has demonstrated sustained benefits and wide acceptance in experimental studies. Nitinol based knitted structures have offered more promising mechanical features than other mesh designs owing to their unique loosely looped construction. However, the conventional plain knit construction still exhibits limitations (radial compliance, deployment ease, flexibility, and bending stresses) which limit this design from proving its real clinical advantage. The new knitted mesh design presented in this study is based on the concept of composite knitting utilising high modulus (nitinol and polyester) and low modulus (polyurethane) material components. The experimental comparison of the new design with a plain knit design demonstrated significant improvement in biomechanical (compliance, flexibility, extensibility, viscoelasticity) and procedural (deployment limit) parameters. The results are indicative of the promising role of new mesh in restoring the lost compliance and pulsatility of vein-graft at high arterial pressures. This way it can assist in controlled vein-graft remodelling and stepwise restoration of vein mechanical homoeostasis. Also, improvement in deployment limit parameter offers more flexibility for a surgeon to use a wide range of vein diameters, which may otherwise be rendered unusable for a plain knit mesh. Copyright © 2015 Elsevier Ltd. All rights
Anatomical variations of the right hepatic veins and their relevance to surgery.
Hribernik, Marija; de Cecchis, Lucio; Trotovsek, Blaz; Gadzijev, Eldar M; Ravnik, Dean
2003-01-01
In a morphological study of the right hepatic veins anatomical characteristics of surgical importance were looked for. 110 cadaveric human livers were prepared by the corrosion casts method. The confluence patterns of the superior right hepatic vein, the hepatocaval confluence, the accessory right hepatic veins and the anastomoses between hepatic veins in the right hemiliver were examined. Four types of the superior right hepatic vein, based on the length of its trunk and the confluence pattern of its main tributaries were determined and their frequency was calculated. Type I was found in 20%, type II in 40%, type III in 25% and type IV in 15%. Accessory right hepatic veins with a minimal caliber of 0.4 cm, which were always present in type IV, were also found in other types, all together in 27% of the casts. The tributary-free part of the superior right hepatic vein at hepatocaval confluence was longer than 1 cm in 77%. In the right hemiliver 109 anastomoses were found in 29/110 liver casts. Knowing the characteristics of different superior right hepatic vein types and of the accessory right hepatic veins may be useful in segment-oriented liver resections and in right side living donor resections.
Kim, Hyoung Ook; Kim, Jae Kyu; Park, Jin Gyoon; Yim, Nam Yeol; Kang, Yang Jun; Jung, Hye Doo
2016-01-01
PURPOSE We aimed to evaluate the efficiency of placing an inferior vena cava (IVC) filter through the same popliteal vein access site used for percutaneous endovenous intervention in patients with extensive lower extremity deep vein thrombosis. METHODS This retrospective study included 21 patients who underwent IVC filter insertion through the popliteal vein over a three-year period. Patient medical records were reviewed for the location of the deep vein thrombosis, result of filter removal, and total number of endovascular procedures needed for filter insertion and recanalization of the lower extremity venous system. Follow-up lower extremity computed tomography (CT) venography was also reviewed in each patient to assess the degree of filter tilt in the IVC. RESULTS All patients had extensive lower extremity deep vein thrombosis involving the iliac vein and/or femoral vein. Seventeen patients showed deep vein thrombosis of the calf veins. In all patients, IVC filter insertion and the recanalization procedure were performed during a single procedure through the single popliteal vein access site. In the 17 patients undergoing follow-up CT, the mean tilt angle of the filter was 7.14°±4.48° in the coronal plane and 8.77°±5.49° in the sagittal plane. Filter retrieval was successful in 16 of 17 patients (94.1%) in whom filter retrieval was attempted. CONCLUSION Transpopliteal IVC filter insertion is an efficient technique that results in low rates of significant filter tilt and enables a single session procedure using a single venous access site for filter insertion and percutaneous endovenous intervention. PMID:27559713
Formation of quartz veins by local dissolution and transport of silica
Energy Technology Data Exchange (ETDEWEB)
Wangen, Magnus; Munz, Ingrid Anne
2004-08-01
A simple model is proposed for the (often) thick quartz veins observed in the Modum Complex in Southern Norway. The formation of these veins cannot easily be explained by silica imported by hot ascending fluids. The proposed model has dissolution in the host rock adjacent to the veins as the source for silica. The suggested process for vein formation is represented by a reaction-diffusion equation, and the process is studied in terms of a Damkoehler number. Estimates for the growth rate of quartz cement are derived. The estimates for the growth rate can be used to constrain poorly known parameters of the vein formation process, like for instance, the degree of supersaturation in the host rock. (Author)
Amaku, Marcos; Coutinho, Francisco Antonio Bezerra; Chaib, Eleazar; Massad, Eduardo
2013-01-01
We address the observation that, in some cases, patients infected with the hepatitis C virus (HCV) are cleared of HCV when super-infected with the hepatitis A virus (HAV). We hypothesise that this phenomenon can be explained by the competitive exclusion principle, including the action of the immune system, and show that the inclusion of the immune system explains both the elimination of one virus and the co-existence of both infections for a certain range of parameters. We discuss the potential clinical implications of our findings.
Primary extraskeletal mesenchymal chondrosarcoma arising from the iliac vein
Directory of Open Access Journals (Sweden)
Hua Zhang
2017-10-01
Full Text Available The iliac vein is an extremely rare site for mesenchymal chondrosarcoma, and patients with primary extraskeletal mesenchymal chondrosarcoma arising from a vein always suffer a very poor prognosis. We report a case of a 45-year-old female who presented with a 5-month history of left leg edema in 2015. Contrast-enhanced computed tomography showed a large mass in the left iliac vein with scattered calcifications. Wide-margin resection was performed, and histopathologic and immunohistochemical analyses confirmed the presence of intraluminal mesenchymal chondrosarcoma with local invasion out of the vein wall. Due to poor patient compliance, postoperative neoadjuvant chemotherapy and radiotherapy were not started, and a bone scan performed 16 weeks postoperatively showed multiple bone metastases. The patient died on the twenty-fourth postoperative week.
Iliac Vein Compression Syndrome due to Bladder Distention Caused by Urethral Calculi
Directory of Open Access Journals (Sweden)
Akiko Ikegami
2015-01-01
Full Text Available We report a rare case of iliac vein compression syndrome caused by urethral calculus. A 71-year-old man had a history of urethral stenosis. He complained of bilateral leg edema and dysuria for 1 week. Physical examination revealed bilateral distention of the superficial epigastric veins, so obstruction of both common iliac veins or the inferior vena cava was suspected. Plain abdominal computed tomography showed a calculus in the pendulous urethra, distention of the bladder (as well as the right renal pelvis and ureter, and compression of the bilateral common iliac veins by the distended bladder. Iliac vein compression syndrome was diagnosed. Bilateral iliac vein compression due to bladder distention (secondary to neurogenic bladder, benign prostatic hyperplasia, or urethral calculus as in this case is an infrequent cause of acute bilateral leg edema. Detecting distention of the superficial epigastric veins provides a clue for diagnosis of this syndrome.
The study of multi-detector CT on the grouping and measuring of the hepatic veins
International Nuclear Information System (INIS)
Wang Xianliang; Dong Guang; Geng Hai; Wang Wengang; Li Linkun; Gao Wei; Wang Rongfang
2007-01-01
Objective: To study the three-dimensional topography of the hepatic vein (HV), the inferior vena cava(IVC) and the inferior right hepatic vein(IRHV) in the retrohepatic and pre-IVC tunnel in human beings, and to provide an anatomic reference for liver surgery. Methods: One hundred and ten volunteers underwent CT scanning at 60 to 75 s after injection of contrast medium, and their HV, IVC and IRHV were reconstructed into MPR and 3D-MIP images. The hepatic veins were grouped according to the way by which the hepatic vein enters IVC. The angle between the right hepatic vein and the middle hepatic vein or the trunk of hepatic vein was measured, and the width from right hepatic vein to middle hepatic vein or to the trunk of hepatic vein on IVC was recorded. The frequency of IRHV was observed, and the length of the tunnel was measured. Results: Among the 110 volunteers, there were 6 cases (5.45%) with three hepatic veins respectively entering IVC, 98 cases (89.10%) with right hepatic vein and a common trunk of the middle hepatic vein and the left hepatic vein entering IVC, and 6 cases (5.45%) with left hepatic vein and a common trunk of the right hepatic vein and the middle hepatic vein entering IVC. The mean value of the angles between the right hepatic vein and the middle hepatic vein or the mink of hepatic vein was (55 ± 18) degree. The width from the right hepatic vein to the middle hepatic vein or to the trunk of hepatic vein was (21 ± 7)mm. The IRHV was observed in 30 cases(27.27%). The mean value of the tunnel length was (53 ± 11) mm. Conclusion: The parameters of the retrohepatic and pre-IVC tunnel in human beings can be measured accurately by the imaging of MPR, which can provide an anatomic reference for the liver surgery. (authors)
Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards
Directory of Open Access Journals (Sweden)
Z. Gholampour
2016-02-01
phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously
Right ovarian vein drainage variant: Is there a relationship with pelvic varices?
International Nuclear Information System (INIS)
Koc, Zafer; Ulusan, Serife; Oguzkurt, Levent
2006-01-01
Objective: To correlate right ovarian vein (ROV) variations that drain into the right renal vein (RRV) with the presence of pelvic varices. Materials and methods: Routine abdominal multidetector-row computed tomography scans of 324 women were analyzed for the presence and type of ROV variations in this retrospective study. The subjects were divided into 2 groups: those with ROV variations and those without such variations. The diameters of the subjects' ROV, left ovarian vein (LOV), and parauterine veins were measured. Pelvic varices and the presence and degree of ovarian vein reflux were noted and compared between the 2 groups. The χ 2 -test and the Pearson correlation test were used for statistical analysis. Results: Thirty-two (9.9%) of 324 women studied exhibited ROV variant that drained into the right renal vein, and the remaining subjects (90.1%) exhibited a normal pattern of ROV drainage that flowed directly into the inferior vena cava. Pelvic varices were identified in 59 (18%) of the subjects. Reflux was not observed in any patient without pelvic varices. Fifty-seven of 59 women exhibited ovarian vein reflux. In 56 of those 57 individuals, reflux occurred only in the LOV, and in 1 subject, reflux was noted predominantly in the ROV. No significant relationship between the presence of an ROV that drained into the right renal vein and pelvic varices was noted. Conclusion: Although right-sided pelvic varices associated with right ovarian vein drainage variations are rare, anatomic variations of the right ovarian vein are not. This study did not find an association between the presence of right ovarian vein and pelvic varices
Right ovarian vein drainage variant: Is there a relationship with pelvic varices?
Energy Technology Data Exchange (ETDEWEB)
Koc, Zafer [Baskent Universitesi, Adana Hastanesi, Radyoloji Boeluemue, Serin Evler 39, Sok. No. 6 Yueregir, Adana (Turkey)]. E-mail: koczafer@gmail.com; Ulusan, Serife [Baskent Universitesi, Adana Hastanesi, Radyoloji Boeluemue, Serin Evler 39, Sok. No. 6 Yueregir, Adana (Turkey); Oguzkurt, Levent [Baskent Universitesi, Adana Hastanesi, Radyoloji Boeluemue, Serin Evler 39, Sok. No. 6 Yueregir, Adana (Turkey)
2006-09-15
Objective: To correlate right ovarian vein (ROV) variations that drain into the right renal vein (RRV) with the presence of pelvic varices. Materials and methods: Routine abdominal multidetector-row computed tomography scans of 324 women were analyzed for the presence and type of ROV variations in this retrospective study. The subjects were divided into 2 groups: those with ROV variations and those without such variations. The diameters of the subjects' ROV, left ovarian vein (LOV), and parauterine veins were measured. Pelvic varices and the presence and degree of ovarian vein reflux were noted and compared between the 2 groups. The {chi}{sup 2}-test and the Pearson correlation test were used for statistical analysis. Results: Thirty-two (9.9%) of 324 women studied exhibited ROV variant that drained into the right renal vein, and the remaining subjects (90.1%) exhibited a normal pattern of ROV drainage that flowed directly into the inferior vena cava. Pelvic varices were identified in 59 (18%) of the subjects. Reflux was not observed in any patient without pelvic varices. Fifty-seven of 59 women exhibited ovarian vein reflux. In 56 of those 57 individuals, reflux occurred only in the LOV, and in 1 subject, reflux was noted predominantly in the ROV. No significant relationship between the presence of an ROV that drained into the right renal vein and pelvic varices was noted. Conclusion: Although right-sided pelvic varices associated with right ovarian vein drainage variations are rare, anatomic variations of the right ovarian vein are not. This study did not find an association between the presence of right ovarian vein and pelvic varices.
Acute paraumbilical vein recanalization: an unusual complication of acute pancreatitis
Directory of Open Access Journals (Sweden)
R J Foster
2015-04-01
Full Text Available Acute pancreatitis is associated with a number of well-known complications and imaging findings. Spontaneous recanalization of the paraumbilical veins as a consequence of pancreatitis in a patient with an otherwise normal liver is, however, a rare entity. This case report depicts this unusual complication as a consequence of gallstone pancreatitis in a patient with a non-cirrhotic liver and no clinical or radiological evidence of portal hypertension. There was recanalization of the paraumbilical veins followed by thrombosis, which is believed to have propagated in a retrograde fashion into distal branches of the otherwise patent portal vein. A literature search for similar cases such as this has yielded no results. Although rare, clinicians and radiologists alike need to be aware of this finding. This case discussion highlights the embryology and anatomy of the paraumbilical veins, as well as discusses the management of paraumbilical and portal vein thrombosis.
Finger Vein Recognition Using Optimal Partitioning Uniform Rotation Invariant LBP Descriptor
Directory of Open Access Journals (Sweden)
Bang Chao Liu
2016-01-01
Full Text Available As a promising biometric system, finger vein identification has been studied widely and many relevant researches have been proposed. However, it is hard to extract a satisfied finger vein pattern due to the various vein thickness, illumination, low contrast region, and noise existing. And most of the feature extraction algorithms rely on high-quality finger vein database and take a long time for a large dimensional feature vector. In this paper, we proposed two block selection methods which are based on the estimate of the amount of information in each block and the contribution of block location by looking at recognition rate of each block position to reduce feature extraction time and matching time. The specific approach is to find out some local finger vein areas with low-quality and noise, which will be useless for feature description. Local binary pattern (LBP descriptors are proposed to extract the finger vein pattern feature. Two finger vein databases are taken to test our algorithm performance. Experimental results show that proposed block selection algorithms can reduce the feature vector dimensionality in a large extent.
Sliding Window-Based Region of Interest Extraction for Finger Vein Images
Yang, Lu; Yang, Gongping; Yin, Yilong; Xiao, Rongyang
2013-01-01
Region of Interest (ROI) extraction is a crucial step in an automatic finger vein recognition system. The aim of ROI extraction is to decide which part of the image is suitable for finger vein feature extraction. This paper proposes a finger vein ROI extraction method which is robust to finger displacement and rotation. First, we determine the middle line of the finger, which will be used to correct the image skew. Then, a sliding window is used to detect the phalangeal joints and further to ascertain the height of ROI. Last, for the corrective image with certain height, we will obtain the ROI by using the internal tangents of finger edges as the left and right boundary. The experimental results show that the proposed method can extract ROI more accurately and effectively compared with other methods, and thus improve the performance of finger vein identification system. Besides, to acquire the high quality finger vein image during the capture process, we propose eight criteria for finger vein capture from different aspects and these criteria should be helpful to some extent for finger vein capture. PMID:23507824
Directory of Open Access Journals (Sweden)
Tatiana C. Santos
2009-04-01
Full Text Available A distribuição intraparenquimal das veias porta-hepáticas foi estudada em 30 gansos domésticos. Latex Neoprene corado foi injetado pela veia isquiática e os animais forma fixados por imersão e injeção intramuscular com formol a 10% e dissecados. O fígado esteve composto por um grande lobo hepático direito e por um lobo hepático esquerdo menor, os quais estiveram conectados por uma ponte de parênquima. O lobo direito do fígado teve exclusivamente vasos do sistema porta-hepático formados pela distribuição intraparenquimal da veia porta-hepática direita, enquanto que no lobo esquerdo estes originaram-se da veia porta-hepática direita e de pequenas veias porta-hepáticas esquerdas. A veia porta-hepática direita emitiu o ramo caudal direito, que emitiu um pequeno ramo caudolateral direito e um grande ramo caudomedial direito. Cranialmente esta veia emitiu os ramos craniais direito e ramos lateral direito. A porção transversa da veia porta-hepática direita cruzou para o lobo hepático esquerdo, emitindo de 1 a 6 pequenos ramos craniais e caudais para a região média do fígado. No lobo esquerdo, o ramo esquerdo da veia porta-hepática direita emitiu o ramo cranial esquerdo, o ramo lateral esquerdo e o ramo medial. De 1 a 6 veias porta-hepáticas esquerdas foram identificadas desembocando ou no ramo esquerdo da veia porta-hepática direita ou em sua porção transversa, oriundos do ventrículo gástrico e do pró-ventrículo. Em 40% dos gansos uma veia porta-hepática própria oriunda da confluência de vasos venosos da face esquerda do ventrículo distribuiu-se na extremidade caudal do lobo esquerdo isoladamente.The intraparenchymal distribution of the hepatic portal veins in 30 domestic geese were studied. Stained Neoprene latex was injected into the isquiatic vessels, and the animals were fixed in 10% formaldehyde by immersion and intramuscular injection. The liver of geese was composed of a large right and a smaller left
Nora virus persistent infections are not affected by the RNAi machinery.
Habayeb, Mazen S; Ekström, Jens-Ola; Hultmark, Dan
2009-05-29
Drosophila melanogaster is widely used to decipher the innate immune system in response to various pathogens. The innate immune response towards persistent virus infections is among the least studied in this model system. We recently discovered a picorna-like virus, the Nora virus which gives rise to persistent and essentially symptom-free infections in Drosophila melanogaster. Here, we have used this virus to study the interaction with its host and with some of the known Drosophila antiviral immune pathways. First, we find a striking variability in the course of the infection, even between flies of the same inbred stock. Some flies are able to clear the Nora virus but not others. This phenomenon seems to be threshold-dependent; flies with a high-titer infection establish stable persistent infections, whereas flies with a lower level of infection are able to clear the virus. Surprisingly, we find that both the clearance of low-level Nora virus infections and the stability of persistent infections are unaffected by mutations in the RNAi pathways. Nora virus infections are also unaffected by mutations in the Toll and Jak-Stat pathways. In these respects, the Nora virus differs from other studied Drosophila RNA viruses.
Clay, Nicole K; Nelson, Timothy
2005-06-01
Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process.
Portal Vein Stenting for Portal Biliopathy with Jaundice
Energy Technology Data Exchange (ETDEWEB)
Hyun, Dongho, E-mail: mesentery@naver.com; Park, Kwang Bo, E-mail: kbjh.park@samsung.com [Sungkyunkwan University School of Medicine, Department of Radiology, Samsung Medical Center (Korea, Republic of); Lim, Seong Joo [Konyang University, Department of Radiology, College of Medicine, Konyang University Hospital (Korea, Republic of); Hwang, Jin Ho [Hallym University Sacred Heart Hospital, Department of Radiology (Korea, Republic of); Sinn, Dong Hyun [Sungkyunkwan University School of Medicine, Department of Medicine, Samsung Medical Center (Korea, Republic of)
2016-04-15
Portal biliopathy refers to obstruction of the bile duct by dilated peri- or para-ductal collateral channels following the main portal vein occlusion from various causes. Surgical shunt operation or endoscopic treatment has been reported. Herein, we report a case of portal biliopathy that was successfully treated by interventional portal vein recanalization.
Martino, Rodrigo B; Júnior, Eserval Rocha; Manuel, Valdano; Rocha-Santos, Vinicius; D'Albuquerque, Luis Augusto C; Andraus, Wellington
2017-10-11
BACKGROUND Adequate portal venous flow is required for successful liver transplantation. Reduced venous flow and blood flow 'steal' by collateral vessels are a concern, and when there is a prominent splenorenal shunt present, ligation of the left renal vein has been recommended to improve portal venous blood flow. CASE REPORT A 51-year-old man who had undergone right nephrectomy in childhood required liver transplantation for liver cirrhosis and hepatocellular carcinoma due to hepatitis C virus (HCV) infection. The patient had no other comorbidity and no history of hepatorenal syndrome. At transplantation surgery, portal venous flow was poor and did not improve with ligation of shunt veins, but ligation of the left renal vein improved portal venous flow. On the first and fifth postoperative days, the patient was treated with basiliximab, a chimeric monoclonal antibody to the IL-2 receptor, and methylprednisolone. The calcineurin inhibitor, tacrolimus, was introduced on the fifth postoperative day. On the sixteenth postoperative day, renal color Doppler ultrasound showed normal left renal parenchyma; hepatic Doppler ultrasound showed good portal vein flow and preserved hepatic parenchyma in the liver transplant. CONCLUSIONS This case report has shown that in a patient with a single left kidney, left renal vein ligation is feasible and safe in a patient with no other risk factors for renal impairment following liver transplantation. Modification of postoperative immunosuppression to avoid calcineurin inhibitors in the very early postoperative phase may be important in promoting good recovery of renal function and to avoid the need for postoperative renal dialysis.
Near-infrared image formation and processing for the extraction of hand veins
Bouzida, Nabila; Hakim Bendada, Abdel; Maldague, Xavier P.
2010-10-01
The main objective of this work is to extract the hand vein network using a non-invasive technique in the near-infrared region (NIR). The visualization of the veins is based on a relevant feature of the blood in relation with certain wavelengths of the electromagnetic spectrum. In the present paper, we first introduce the image formation in the NIR spectral band. Then, the acquisition system will be presented as well as the method used for the image processing in order to extract the vein signature. Extractions of this pattern on the finger, on the wrist and on the dorsal hand are achieved after exposing the hand to an optical stimulation by reflection or transmission of light. We present meaningful results of the extracted vein pattern demonstrating the utility of the method for a clinical application like the diagnosis of vein disease, of primitive varicose vein and also for applications in vein biometrics.
Novel Percutaneous Radiofrequency Ablation of Portal Vein Tumor Thrombus: Safety and Feasibility
Energy Technology Data Exchange (ETDEWEB)
Mizandari, Malkhaz [High Technology Medical Center, Tbilisi State Medical University (Georgia); Ao, Guokun [The 309 Hospital of People' s Liberation Army, Department on Oncology (China); Zhang Yaojun; Feng Xi [Imperial College London, Department of Surgery and Cancer (United Kingdom); Shen Qiang [The First Minimally Invasive Department of Eastern Hepatobiliary Surgery Hospital (China); Chen Minshan [Cancer Centre of Sun Yat-Sen University, Department of Hepatobiliary Surgery (China); Lau, Wan Yee [Chinese University of Hong Kong, Department of Surgery, Faculty of Medicine (Hong Kong); Nicholls, Joanna; Jiao Long; Habib, Nagy, E-mail: nagy.habib@imperial.ac.uk [Imperial College London, Department of Surgery and Cancer (United Kingdom)
2013-02-15
We report our experience of the safety of partial recanalization of the portal vein using a novel endovascular radiofrequency (RF) catheter for portal vein tumor thrombosis. Six patients with liver cancer and tumor thrombus in the portal vein underwent percutaneous intravascular radiofrequency ablation (RFA) using an endovascular bipolar RF device. A 0.035-inch guidewire was introduced into a tributary of the portal vein and through which a 5G guide catheter was introduced into the main portal vein. After manipulation of the guide catheter over the thrombus under digital subtraction angiography, the endovascular RF device was inserted and activated around the thrombus. There were no observed technique specific complications, such as hemorrhage, vessel perforation, or infection. Post-RFA portography showed partial recanalization of portal vein. RFA of portal vein tumor thrombus in patients with hepatocellular carcinoma is technically feasible and warrants further investigation to assess efficacy compared with current recanalization techniques.
The color Doppler ultrasonography in in the diagnosis of deep vein thrombosis
International Nuclear Information System (INIS)
Ameneiro Perez, Santiago; Alvarez Sanchez, Jose A.; Rodriguez Villalonga, Luis; Borras Migues, Marisela; Quinnones Castro, Mayda
2004-01-01
The paper was aimed at evaluating the accuracy of color Doppler ultrasonography, a noninvasive method, in the diagnosis of deep vein thrombosis of the lower limbs, comparing it to the results of the cruel and costly diagnostic g olden rule , that is, phlebography. Methods: Color Doppler ultrasonography served to assess 102 patients clinically suspected of deep vein thrombosis of the lower limbs, taking into account the following criteria: vein compressibility, echographic images, color, Vein Doppler signal modulation after several maneuvers and distal compression. Sensitivity, specificity, positive and negative predictive values and diagnostic efficacy were estimated for each criteria, taking the phlebography as a reference. Results: Total or partial lack of vein compressibility combined with the vein flow evaluation is the ultrasonographic criterion that reveals higher degree of sensitivity, specificity and efficacy (0,98; 0,95 and 0,97 respectively. Color Doppler ultrasonography is a highly effective noninvasive diagnostic method that detects deep vein thrombosis in proximal areas of the lower limbs
Study of sugar beet viruses transmitted by Polymyxa betae in the Czech Republic
Directory of Open Access Journals (Sweden)
Rysanek Pavel
2006-01-01
Full Text Available Sugar beet viruses transmitted by Polymyxa betae are very widespread in the Czech Republic. Beet soil-borne virus (BSBV is present in almost all fields used for sugar beet growing, beet virus Q (BVQ is present in about 50% of fields but beet necrotic yellow vein virus (BNYVV is present in some limited regions only. It means that mixed infections of sugar beet by at least two viruses are quite common in the field. P. betae also occurs in almost all fields where sugar beet is now grown. Only two populations of P. betae not transmitting any virus were found. Cystosori of P. betae can harbour viruses without loosing infectivity for a very long time. We were able to detect these viruses in plants grown in soil stored dry for 12 years. BNYVV can cause serious yield losses under mideuropean conditions reaching up to 50% of sugar yield, whereas harmfulness BSBV and BVQ is questionable, because they also occur in fields with no problems concerning sugar beet growing. The host range of these viruses was studied. Both infect all types of beet (sugar fodder, red beet, mangold and spinach and usually are detectable in root system only. Other chenopodiaceous plants are infected only by some virus strains. These strains are also able to spread into above-ground parts of plants.
Endovascular vein harvest: systemic carbon dioxide absorption.
Maslow, Andrew M; Schwartz, Carl S; Bert, Arthur; Hurlburt, Peter; Gough, Jeffrey; Stearns, Gary; Singh, Arun K
2006-06-01
Endovascular vein harvest (EDVH) requires CO(2) insufflation to expand the subcutaneous space, allowing visualization and dissection of the saphenous vein. The purpose of this study was to assess the extent of CO(2) absorption during EDVH. Prospective observational study. Single tertiary care hospital. Sixty patients (30 EDVH and 30 open-vein harvest) undergoing isolated coronary artery bypass graft surgery. Hemodynamic, procedural, and laboratory data were collected prior to (baseline), during, and at it the conclusion (final) of vein harvesting. Data were also collected during cardiopulmonary bypass (CPB). Data were compared by using t tests, analysis of variance, and correlation statistics when needed. There were significant increases in arterial CO(2) (PaCO(2), 35%) and decreases in pH (1.35%) during EDVH. These were associated with increases in heart rate, mean blood pressure, and cardiac output. Within the EDVH group, greater elevations (>10 mmHg) in PaCO2 were more likely during difficult harvest procedures, and these patients exhibited greater increase in heart rate. Elevated CO(2) persisted during CPB, requiring higher systemic gas flows and greater use of phenylephrine to maintain desired hemodynamics. EDVH was associated with systemic absorption of CO(2). Greater absorption was more likely in difficult procedures and was associated with greater hemodynamic changes requiring medical therapy.
Recognition of extremophilic archaeal viruses by eukaryotic cells
DEFF Research Database (Denmark)
Uldahl, Kristine Buch; Wu, Linping; Hall, Arnaldur
2016-01-01
followed viral uptake, intracellular trafficking and cell viability in human endothelial cells of brain (hCMEC/D3 cells) and umbilical vein (HUVEC) origin. Whereas SMV1 is efficiently internalized into both types of human cells, SSV2 differentiates between HUVECs and hCMEC/D3 cells, thus opening a path......Viruses from the third domain of life, Archaea, exhibit unusual features including extreme stability that allow their survival in harsh environments. In addition, these species have never been reported to integrate into human or any other eukaryotic genomes, and could thus serve for exploration...
Varicography in the preoperative evaluation of primary varicose veins
International Nuclear Information System (INIS)
Pinzani, A.; Paoli, G.; Gongolo, A.; Spreafico, G.
1989-01-01
Primary varicose veins in the lower limb are usually well evaluated by the surgeon, who avails himself of tornequet tests and Doppler US. However, the operation is often followed by failure or recurrence, or else it requires ugly skin dissection to eradicate an unforeseeably complicated varicose vein. The authors suggest that, whenever the surgeon considers the information obtained with tests and Doppler US inadequate for planning surgery, varicography be performed to get further morphological (and functional) data about the origin of varicose veins, which is of fundamental importance for an accurate surgical planning (crossectomy, stripping, ligation, sclerosis). Out of 100 varicographies consecutively carried out on patients in whom clinical examination was not conclusive, 62% allowed an already planned surgical approach to be changed. The figure rose to 100% in the case of unusual varicose veins. Such a results allowed the needs of both the surgeon (selectivity, effectiveness, radicality) and the patients (narrow scars, absence of relapse) to be respected. Furthermore, it has been pointed out that some vein segments are often only pathological, and they are to be adequately treated, while others can be undamaged, and they are to be preserved for both their function and an eventual by-pass surgery. Varicography is rapidly performed, without complication, and is well accepted by the patients. It is a fundamental help in the preoperative study of primary varicose veins, especially in case of unusual ones, whenever the surgeon is in the slightest diagnostic - and therefore surgical - doubt
Palm-vein classification based on principal orientation features.
Directory of Open Access Journals (Sweden)
Yujia Zhou
Full Text Available Personal recognition using palm-vein patterns has emerged as a promising alternative for human recognition because of its uniqueness, stability, live body identification, flexibility, and difficulty to cheat. With the expanding application of palm-vein pattern recognition, the corresponding growth of the database has resulted in a long response time. To shorten the response time of identification, this paper proposes a simple and useful classification for palm-vein identification based on principal direction features. In the registration process, the Gaussian-Radon transform is adopted to extract the orientation matrix and then compute the principal direction of a palm-vein image based on the orientation matrix. The database can be classified into six bins based on the value of the principal direction. In the identification process, the principal direction of the test sample is first extracted to ascertain the corresponding bin. One-by-one matching with the training samples is then performed in the bin. To improve recognition efficiency while maintaining better recognition accuracy, two neighborhood bins of the corresponding bin are continuously searched to identify the input palm-vein image. Evaluation experiments are conducted on three different databases, namely, PolyU, CASIA, and the database of this study. Experimental results show that the searching range of one test sample in PolyU, CASIA and our database by the proposed method for palm-vein identification can be reduced to 14.29%, 14.50%, and 14.28%, with retrieval accuracy of 96.67%, 96.00%, and 97.71%, respectively. With 10,000 training samples in the database, the execution time of the identification process by the traditional method is 18.56 s, while that by the proposed approach is 3.16 s. The experimental results confirm that the proposed approach is more efficient than the traditional method, especially for a large database.
The umbilical and paraumbilical veins of man.
Martin, B F; Tudor, R G
1980-01-01
During its transit through the umbilicus structural changes occur in the thick wall of the extra-abdominal segment of the umbilical vein whereby the components of the intra-abdominal segment acquire an essentially longitudinal direction and become arranged in fibro-elastic and fibro-muscular zones. The vein lumen becomes largely obliterated by asymmetrical proliferation of loose subendothelial conective tissue. The latter forms a new inner zone within which a small segment of the lumen persis...
Aneurysmal malformation of the extrahepatic portal vein: a case report
International Nuclear Information System (INIS)
Lee, Jeong Min; Kang, Sung Soo; Kim, Chong Soo; Han, Hyeun Young
1999-01-01
Aneurysmal malformation of the portal vein is a rare entity. To our knowledge, only scattered reports of portal vein aneurysms appear in the literature in English, and there is no previously published report in Korean. We describe a case exhibiting aneurysmal malformation of the extrahepatic portal vein at the hepatic hilum ; the findings demonstrated by ultrasound, CT and angiography are discussed, a review of previously described cases is included
Congenital vascular malformations: the persistence of marginal and embryonal veins.
Weber, J; Daffinger, N
2006-05-01
In about 18% of cases with conginental vascular malformations we find a perspective of an atypical truncular vein, located along the outside of the leg, frequently extended from the dorsal foot up to the bottom. In presence of a normally developed system of the deep collecting veins of the lower limb and within the pelvic outflow we are talking about a persisting marginal vein (MV). Hypoplasia or even aplasia of the main deep veins in contrary defines the persisting embryonal vein (EV). Already in childhood these truncular dysplastic veins tend to develop varicose enlargement, causing severe reflux of a huge volume of blood--even more when being associated with av-fistulas (46%). In consequence a rapidly growing chronic venous insufficiency will guide to additional injuries. We have analysed 97 patients showing a persisting MV (n: 92 ) within a total of 102 legs. A persistent embryonal vein (EV) was seen 10 times within this clientel. The persisting truncular veins, associated with phlebectasias and typical clinical symptoms have been examined in a diagnostic "step-by-step" procedure, mainly phlebographically (ascending leg phlebography and varicography), including direct venous blood pressure measurements (phlebodynamometry) and--if needed--by arteriography, showing av-shunting fistulae in 46% of cases. CT and MRI were consulted for the exact therapy planing (frequently initially offered as a non-invasive, however, inadequate key of diagnostic). Actually now these techniques cannot replace pre-operatively the angiographic imaging techniques. The analysis of clinical, morphologic and functional signs, guiding to a specific therapy-relevant classification of MV's and EV's will be presented. And a specific strategy of surgical repair, interventional treatment of av-fistulas and conservative compressive follow-up treatment attempting palliative recompensation of the diseased venous outflow will be discussed also.
Le, Trong Binh; Lee, Taeg Ki; Park, Keun-Myoung; Jeon, Yong Sun; Hong, Kee Chun; Cho, Soon Gu
2018-04-25
To investigate the incidence and potential causes of contralateral deep vein thrombosis (DVT) after common iliac vein (CIV) stent placement in patients with May-Thurner syndrome (MTS). Data of 111 patients (women: 73%) who had CIV stent implantation for symptomatic MTS at a single center were retrospectively analyzed. Mean patient age was 63.1 ± 15.2 years. Median follow-up was 36 months (range, 1-142 months). Stent location was determined by venogram and classified as extended to the inferior vena cava (IVC), covered the confluence, or confined to the iliac vein. Potential causes of contralateral DVT were presumed based on venographic findings. The relationship between stent location and contralateral DVT was analyzed. Ten patients (9%, men/women: 4/6) exhibited contralateral DVT at a median timing of 40 months (range, 6-98 months). Median age was 69 years (range, 42-85 years). Median follow-up was 73.5 months (range, 20-134 months). Potential causes were venous intimal hyperplasia (VIH) (n = 7), "jailing" (n = 2), and indeterminate (n = 1). All patients with VIH had previous CIV stents overextended to the IVC. Overextension of CIV stent was associated with contralateral DVT (P VIH should be considered a potential cause. Copyright © 2018 SIR. Published by Elsevier Inc. All rights reserved.
Morphology of congenital portosystemic shunts involving the left colic vein in dogs and cats.
White, R N; Parry, A T
2016-05-01
To describe the anatomy of congenital portosystemic shunts involving the left colic vein in dogs and cats. Retrospective review of a consecutive series of dogs and cats managed for congenital portosystemic shunts. For inclusion a shunt involving the left colic vein with recorded intraoperative mesenteric portovenography or computed tomography angiography along with direct gross surgical observations at the time of surgery was required. Six dogs and three cats met the inclusion criteria. All cases had a shunt which involved a distended left colic vein. The final communication with a systemic vein was variable; in seven cases (five dogs, two cats) it was via the caudal vena cava, in one cat it was via the common iliac vein and in the remaining dog it was via the internal iliac vein. In addition, two cats showed caudal vena cava duplication. The morphology of this shunt type appeared to be a result of an abnormal communication between either the left colic vein or the cranial rectal vein and a pelvic systemic vein (caudal vena cava, common iliac vein or internal iliac vein). This information may help with surgical planning in cases undergoing shunt closure surgery. © 2016 British Small Animal Veterinary Association.
Plantar vein thrombosis: a rare cause of plantar foot pain
International Nuclear Information System (INIS)
Siegal, Daniel S.; Wu, Jim S.; Brennan, Darren D.; Hochman, Mary G.; Challies, Tracy
2008-01-01
Plantar vein thrombosis is a rare condition, with only a handful of cases reported in the literature. The cause is unknown; however, the disease has been attributed to prior surgery, trauma, and paraneoplastic conditions. We present a case of a 32-year-old female runner with plantar vein thrombosis diagnosed on contrast-enhanced MRI and confirmed on ultrasound. The symptoms resolved with conservative treatment and evaluation revealed the presence of a prothrombin gene mutation and use of oral contraceptive pills. To our knowledge, this is the first case of plantar vein thrombosis diagnosed initially by MRI. Moreover, this case suggests that plantar vein thrombosis should be considered in patients with hypercoagulable states and plantar foot pain. (orig.)
Plantar vein thrombosis: a rare cause of plantar foot pain
Energy Technology Data Exchange (ETDEWEB)
Siegal, Daniel S.; Wu, Jim S.; Brennan, Darren D.; Hochman, Mary G. [Beth Israel Deaconess Medical Center, Department of Radiology, Boston, MA (United States); Challies, Tracy [Beth Israel Deaconess Medical Center, Department of Pathology, Boston, MA (United States)
2008-03-15
Plantar vein thrombosis is a rare condition, with only a handful of cases reported in the literature. The cause is unknown; however, the disease has been attributed to prior surgery, trauma, and paraneoplastic conditions. We present a case of a 32-year-old female runner with plantar vein thrombosis diagnosed on contrast-enhanced MRI and confirmed on ultrasound. The symptoms resolved with conservative treatment and evaluation revealed the presence of a prothrombin gene mutation and use of oral contraceptive pills. To our knowledge, this is the first case of plantar vein thrombosis diagnosed initially by MRI. Moreover, this case suggests that plantar vein thrombosis should be considered in patients with hypercoagulable states and plantar foot pain. (orig.)
Directory of Open Access Journals (Sweden)
Opincariu Diana
2016-09-01
Full Text Available Persistent left superior vena cava is an anomalous vein that derives from a malfunction of obliteration of the left common cardinal vein during intrauterine life. The diagnosis can be suggested by a dilated coronary sinus as seen in echocardiography, or other imagistic methods. Due to the lack of hemodynamic impairment, and consequently with few or no symptoms, this vascular anomaly is frequently discovered incidentally. In this brief report we present the case of a 35-year-old male known with a complex congenital cardiovascular malformation that included atrial septum defect, persistent left superior vena cava and anomalous right pulmonary vein drainage in the PLSVC, diagnosed with sinoatrial block that required pacemaker implantation. Due to the patient’s medical history, investigations to decide the best approach needed for pacemaker implantation were performed, including a thoracic CT that incidentally found additional anomalies — the hemiazygos vein draining in PLSVC and the lack of the left brachiocephalic vein.
Collateral veins in inferior caval vein occlusion demonstrated via CT
International Nuclear Information System (INIS)
Lien, H.H.; Lund, G.
1983-01-01
CT-scans of 12 patients with tumour-induced occlusion of the inferior vena cava were studied with regard to collateral veins. A comparison was performed with findings at phlebography in 10 patients and at autopsy in 2. The site and appearance of the main collateral pathway are presented. A close study of vascular structures renders useful information on collateral circulation in occlusion of the inferior vena cava. (orig.)
2012-04-09
..., 23, 37, et al. Customer Clearing Documentation, Timing of Acceptance for Clearing, and Clearing..., 38, and 39 RIN 3038-0092, -0094 Customer Clearing Documentation, Timing of Acceptance for Clearing... implement new statutory provisions enacted by Title VII of the Dodd-Frank Wall Street Reform and Consumer...
Clay, Nicole K.; Nelson, Timothy
2005-01-01
Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process. PMID:15894745
Iliac vein stenosis is an underdiagnosed cause of pelvic venous insufficiency.
Santoshi, Ratnam K N; Lakhanpal, Sanjiv; Satwah, Vinay; Lakhanpal, Gaurav; Malone, Michael; Pappas, Peter J
2018-03-01
Reflux in the ovarian veins, with or without an obstructive venous outflow component, is reported to be the primary cause of pelvic venous insufficiency (PVI). The degree to which venous outflow obstruction plays a role in PVI is currently ill-defined. We retrospectively reviewed the charts of 227 women with PVI who presented to the Center for Vascular Medicine from January 2012 to September 2015. Assessments and interventions consisted of an evaluation for other causes of chronic pelvic pain by a gynecologist; preintervention and postintervention visual analog scale (VAS) pain score; complete venous duplex ultrasound examination; and Clinical, Etiology, Anatomy, and Pathophysiology classification. All patients underwent diagnostic venography of their pelvic and left ovarian veins as well as intravascular ultrasound of their iliac veins. Patients were treated in one of six ways: ovarian vein embolization (OVE) alone (chemical ± coils), OVE with staged iliac vein stenting, OVE with simultaneous iliac vein stenting, iliac vein stenting alone, OVE with venoplasty, and venoplasty alone. Of the 227 women treated, the average age and number of pregnancies was 46.4 ± 10.4 years and 3.36 ± 1.99, respectively. Treatment distribution was the following: OVE, n = 39; OVE with staged stenting, n = 94; OVE with simultaneous stenting, n = 33; stenting alone, n = 50; OVE with venoplasty, n = 8; and venoplasty alone, n = 3. Seven patients in the OVE and stenting groups (staged) and one patient in the OVE + venoplasty group required a second embolization of the left ovarian vein. Eighty percent (181/227) of patients demonstrated an iliac stenosis >50% by intravascular ultrasound. Average VAS scores for the entire cohort before and after intervention were 8.45 ± 1.11 and 1.86 ± 1.61 (P ≤ .001). In the staged group, only 9 of 94 patients reported a decrease in the VAS score with OVE alone. VAS score decreased from 8.6 ± 0.89 before OVE to 7.97 ± 2.10 after OVE
Energy Technology Data Exchange (ETDEWEB)
Bae, Bong Kyung; Kim, Jae Chul [Dept. of Radiation Oncology, Kyungpook National University School of Medicine, Daegu (Korea, Republic of)
2016-09-15
The purpose of current study is to evaluate the response of the patients with portal vein thrombosis (PVT) or hepatic vein thrombosis (HVT) in hepatocellular carcinoma (HCC) treated with three-dimensional conformal radiation therapy (3D-CRT). In addition, survival of patients and potential prognostic factors of the survival was evaluated. Forty-seven patients with PVT or HVT in HCC, referred to our department for radiotherapy, were retrospectively reviewed. For 3D-CRT plans, a gross tumor volume (GTV) was defined as a hypodense filling defect area in the portal vein (PV) or hepatic vein (HV). Survival of patients, and response to radiation therapy (RT) were analyzed. Potential prognostic factors for survival and response to RT were evaluated. The median survival time of 47 patients was 8 months, with 1-year survival rate of 15% and response rate of 40%. Changes in Child-Pugh score, response to RT, Eastern cooperative oncology group performance status (ECOG PS), hepatitis C antibody (HCVAb) positivity, and additional post RT treatment were statistically significant prognostic factors for survival in univariate analysis (p = 0.000, p = 0.018, p = 0.000, p = 0.013, and p = 0.047, respectively). Of these factors, changes in Child-Pugh score, and response to RT were significant for patients' prognosis in multivariate analysis (p = 0.001 and p = 0.035, respectively). RT could constitute a reasonable treatment option for patients with PVT or HVT in HCC with acceptable toxicity. Changes in Child-Pugh score, and response to RT were statistically significant factors of survival of patients.
The risk of varicose veins in standing female workers
Directory of Open Access Journals (Sweden)
Tony Hidayat
2013-07-01
Full Text Available AbstrakLatar belakang:Varises sering terjadi pada karyawan yang harus bekerja dalam posisi kerja berdiri. Tujuan penelitian ini untuk mengetahui beberapa faktor risiko terhadap varises tungkai dan atau kaki di antara pekerja perempuan. Metode:Penelitian potong lintang ini dilakukan pada Januari-Maret 2010. Sampel penelitian yang dipilih secara purposif yang memenuhi kriteria inklusi penelitian di antara pekerja perempuan perlu bekerja dalam posisi kerja berdiri. Data dikumpulkan dengan wawancara, pemeriksaan fisik dan observasi posisi kerja berdiri. Pengolahan data untuk menentukan faktor dominan terhadap varises menggunakan pendekatan risiko relatif.Hasil:Dari 152 karyawan yang terdapat 111 yang bersedia mengikuti penelitian, dan yang menderita varises tungkai dan atau kaki sebanyak 52,3% (53 orang. Sebagian besar responden berusia 18-35 tahun, memiliki masa kerja 3-17 tahun, bekerja dalam posisi kerja banyak berdiri. Sebagian kecil responden memiliki riwayat varises di dalam keluarga (13,51%, memakai kontrasepsi oral (11,71%, memiliki kebiasaan olah raga (18,02% dan memakai sepatu hak tinggi (11,71%. Faktor umur, pemakaian kontrasepsi oral, pemakaian sepatu hak tinggi, kebiasaan olah raga, posisi kerja berdiri, tempat kerja, dan masa kerja tidak berhubungan dengan varises tungkai dan atau kaki. Karyawan yang mempunyai dibandingkan dengan yang tidak mempunyai riwayat keluarga varises, berisiko 69% lebih tinggi menderita varises [risiko relatif (RR = 1,69; P = 0.121]. Kesimpulan:Karyawan yang mempunyai riwayat keluarga varises berisiko lebih tinggi menderita varises. (Health Science Indones 2013;1:47-50 Kata kunci:varises, posisi kerja berdiriAbstractBackground: Varicose veins often occur in employees who have to work in a position of standing work. The purpose of this study to determine risk factors for varicose veins and leg or foot among women workers.Methods: In this cross-sectional study in January-March 2010 the
A free vein graft cap influences neuroma formation after nerve transection.
Galeano, Mariarosaria; Manasseri, Benedetto; Risitano, Giovanni; Geuna, Stefano; Di Scipio, Federica; La Rosa, Paola; Delia, Gabriele; D'Alcontres, Francesco Stagno; Colonna, Michele R
2009-01-01
: Neuroma formation is a major problem in nerve surgery and consensus about its prevention has not been reached. It has been suggested that vein covering can reduce neuroma formation in transected nerves. In this article, the Authors propose an easy and novel method of covering by nerve stump capping with a free vein graft. : Neuroma-like lesions were created on the rat thigh sectioning the femoral nerve above its division in 16 animals. The proximal nerve stump was invaginated into the lumen of a 1.5 cm long femoral free vein graft on the right side, and the vein was closed on itself by microsurgical sutures to form a cap for the nerve stump. On the left side acting as the control neuroma, the nerve was cut and left uncovered. Histological and immunohistochemical assessment was used to quantify the degree of neuroma formation. : Significant differences were found in both neuroma size and axon-glia organization between the treated and control sides indicating that free vein graft capping reduced neuroma formation in comparison to uncovered nerve stumps. : Our results confirm that vein-covering of a transected nerve stump can be effective in reducing neuroma formation. Moreover, unlike previous works that buried the nerve into an adjacent vein left in place, our experiments showed that also the use of a free vein graft cap can hinder neuroma formation. Although translation of rat experiments to the clinics should be dealt with caution, our data suggest a careful clinical use of the technique. (c) 2009 Wiley-Liss, Inc. Microsurgery, 2009.
Galen's vein aneurysm as cause of heart failure
International Nuclear Information System (INIS)
Echeverria, Claudia; Cassalett, Gabriel; Franco, Jaime; Carrillo, Gustavo
2005-01-01
We present the case of a newborn admitted to the intensive care unit with a heart failure of difficult medical management. A large ductus arteriosus was found. It was surgically corrected, but the heart failure persisted and did not improve with medical treatment. Incidentally, a big Galen's vein aneurysm was found. Galen's vein aneurysm is a rare congenital pathology, originated by a fusion defect of the internal cerebral veins. Due to its low resistance, it produces a picture of high-output heart failure. Large defects may contain 50% to 60% of cardiac output. An aneurysm may be suspected in each newborn or infant with clinical picture of heart failure and right cardiac chamber dilation without any evidence of structural cardiac anomaly
Renal computed angiography. Part I: Renal CT phlebography. Renal veins variants
International Nuclear Information System (INIS)
Al-Amin, M.; Krupev, M.; Hadjidekov, V.; Plachkov, I.
2012-01-01
The changing trend in renal surgery, transplantation and minimal invasive urology implies preprocedure evaluation of renal veins. Development of imaging methods offers new possibilities for venographic visualization. The goal of this study is to present authors experience in visualization of renal veins using 64 MDCT and to evaluate the utility in assessments of their variants. 128 patients (68 females and 60 males, mean age 53,3) with urological complaints underwent 64MDCT examination including CT angiography. Contrast enhancement includes 3-4ml/sec injection flow of 90 ml contrast medium followed by 20 ml saline at the same rate. In 23 out of 128 examined patients some of the common variants of the renal vein is found. 64 MDCT angiography visualize very well renal veins and becomes method of choice in preoperative assessment of renal vein anatomy. (authors)
Directory of Open Access Journals (Sweden)
Łukasz Migdalski
2015-10-01
Full Text Available Psychological functioning of patients in early stages of venous insufficiency has not been a common subject of scientific investigation so far, even though this group of patients experiences many limitations in daily functioning, as well as psychological distress. Varicose veins are the most common type of venous insufficiency, with an epidemiology of up to 50% of the western population. The present study is concerned with the functioning of a group undergoing surgery of varicose veins. The operation was carried out in an ambulatory mode, and such psychological factors as acceptance of illness, anxiety–state, anxiety–trait, and wellbeing (treated as personality construct have been considered. It is the first time that such variables have been used with the new tool for assessing quality of life in venous diseases (VEINES Qol/Sym, and no previous findings about applying VEINES Qol/Sym to assess patients after varicose veins operations exist. The results are promising, especially for combining such psychological variables as anxiety, acceptance of illness, or wellbeing with specific venous measures of quality of life. It has been proved that there is a need for monitoring psychological variables in the group of patients in an early stage of chronic venous illness. Further research on other venous patient groups is necessary to fully understand the specificity of these groups.
Analysis of hepatic vein variations in healthy people with 64-slice spiral CT
International Nuclear Information System (INIS)
Zhang Rong; Li Yong; Shen Jun; Zeng Weike; Li Jieting; Huang Suiqiao; Liang Biling; Liu Chao
2007-01-01
Objective: To analyze variations of hepatic vein in healthy people with 64-slice spiral CT. Methods: Seventy-five healthy subjects underwent multi-slice spiral computed (MSCT) hepatic venography. The anatomy of the junction of the hepatic veins with the inferior vena cava and the intrahepatic drainage territory of the hepatic veins and tributaries were evaluated. The hepatic veins were classified according to three anatomic classification (Nakamura's, Marcos's and Kawasaki's classification) methods respectively. Results: There was a common trunk of the middle and left hepatic veins before joining the IVC in 86.7% (65/75)of the cases. In 13.3% (10/75)of the cases, the three main hepatic veins joined the IVC separately. The ratios of Nakamma's classification type A, B, C of hepatic veins were 49.4% (37/75), 37.3% (28/75), and 13.3% (10/75) respectively. The ratios of Marcos's classification type A, B, C of hepatic veins were 56.0% (42/75), 24.0% (18/75), and 20.0% (15/75) respectively. The ratios of Kawasaki's classification type I, II of hepatic vein were 40.0% (30/75) and 60.0% (45/75). Conclusion: Multi-slice spiral CT hepatic venography can provide visualization of peripheral hepatic venous branches in details. (authors)
Pe-Piper, Georgia; Piper, David J. W.; McFarlane, Chris R. M.; Sangster, Chris; Zhang, Yuanyuan; Boucher, Brandon
2018-04-01
Intra-continental shear zones developed during continental collision may experience prolonged magmatism and mineralization. The Cobequid Shear Zone formed part of a NE-SW-trending, orogen-parallel shear system in the late Devonian-early Carboniferous, where syn-tectonic granite-gabbro plutons and volcanic rocks 4 km thick were progressively deformed. In late Carboniferous to Permian, Alleghanian collision of Africa with Laurentia formed the E-W trending Minas Fault Zone, reactivating parts of the Cobequid Shear Zone. The 50 Ma history of hydrothermal mineralization following pluton emplacement is difficult to resolve from field relationships of veins, but SEM study of thin sections provides clear detail on the sequence of mineralization. The general paragenesis is: albite ± quartz ± chlorite ± monazite → biotite → calcite, allanite, pyrite → Fe-carbonates, Fe-oxides, minor sulfides, calcite and synchysite. Chronology was determined from literature reports and new U-Pb LA-ICPMS dating of monazite and allanite in veins. Vein mineralization was closely linked to magmatic events. Vein emplacement occurred preferentially during fault movement recognised from basin-margin inversion, as a result of fractures opening in the damage zone of master faults. The sequence of mineralization, from ca. 355 Ma riebeckite and albite veins to ca. 327 (-305?) Ma siderite-magnetite and sulfide mineralization, resembles Precambrian iron-oxide-copper-gold (IOCG) systems in the literature. The abundant magmatic Na, halogens and CO2 in veins and some magmatic bodies, characteristic of IOCG systems, were derived from the deeply subducted Rheic Ocean slab with little terrigenous sediment. Regional extension of the Magdalen Basin caused asthenospheric upwelling and melting of the previously metasomatized sub-continental lithospheric mantle. Crustal scale strike-slip faulting facilitated the rise of magmas, resulting in high heat flow driving an active hydrothermal system. Table S2
Incidence of Central Vein Stenosis and Occlusion Following Upper Extremity PICC and Port Placement
International Nuclear Information System (INIS)
Gonsalves, Carin F.; Eschelman, David J.; Sullivan, Kevin L.; DuBois, Nancy; Bonn, Joseph
2003-01-01
The purpose of this study was to determine the incidence of central vein stenosis and occlusion following upper extremity placement of peripherally inserted central venous catheters(PICCs) and venous ports. One hundred fifty-four patients who underwent venography of the ipsilateral central veins prior to initial and subsequent venous access device insertion were retrospectively identified. All follow-up venograms were interpreted at the time of catheter placement by one interventional radiologist over a 5-year period and compared to the findings on initial venography. For patients with central vein abnormalities, hospital and home infusion service records and radiology reports were reviewed to determine catheter dwelltime and potential alternative etiologies of central vein stenosis or occlusion. The effect of catheter caliber and dwell time on development of central vein abnormalities was evaluated. Venography performed prior to initial catheter placement showed that 150 patients had normal central veins. Three patients had central vein stenosis, and one had central vein occlusion. Subsequent venograms (n = 154)at the time of additional venous access device placement demonstrated 8 patients with occlusions and 10 with stenoses. Three of the 18 patients with abnormal follow-up venograms were found to have potential alternative causes of central vein abnormalities. Excluding these 3 patients and the 4 patients with abnormal initial venograms, a 7% incidence of central vein stenosis or occlusion was found in patients with prior indwelling catheters and normal initial venograms. Catheter caliber showed no effect on the subsequent development of central vein abnormalities. Patients who developed new or worsened central vein stenosis or occlusion had significantly (p =0.03) longer catheter dwell times than patients without central vein abnormalities. New central vein stenosis or occlusion occurred in 7% of patients following upper arm placement of venous access devices
Research and implementation of finger-vein recognition algorithm
Pang, Zengyao; Yang, Jie; Chen, Yilei; Liu, Yin
2017-06-01
In finger vein image preprocessing, finger angle correction and ROI extraction are important parts of the system. In this paper, we propose an angle correction algorithm based on the centroid of the vein image, and extract the ROI region according to the bidirectional gray projection method. Inspired by the fact that features in those vein areas have similar appearance as valleys, a novel method was proposed to extract center and width of palm vein based on multi-directional gradients, which is easy-computing, quick and stable. On this basis, an encoding method was designed to determine the gray value distribution of texture image. This algorithm could effectively overcome the edge of the texture extraction error. Finally, the system was equipped with higher robustness and recognition accuracy by utilizing fuzzy threshold determination and global gray value matching algorithm. Experimental results on pairs of matched palm images show that, the proposed method has a EER with 3.21% extracts features at the speed of 27ms per image. It can be concluded that the proposed algorithm has obvious advantages in grain extraction efficiency, matching accuracy and algorithm efficiency.
C1-esterase inhibitor protects against early vein graft remodeling under arterial blood pressure.
Krijnen, Paul A J; Kupreishvili, Koba; de Vries, Margreet R; Schepers, Abbey; Stooker, Wim; Vonk, Alexander B A; Eijsman, Leon; Van Hinsbergh, Victor W M; Zeerleder, Sacha; Wouters, Diana; van Ham, Marieke; Quax, Paul H A; Niessen, Hans W M
2012-01-01
Arterial pressure induced vein graft injury can result in endothelial loss, accelerated atherosclerosis and vein graft failure. Inflammation, including complement activation, is assumed to play a pivotal role herein. Here, we analyzed the effects of C1-esterase inhibitor (C1inh) on early vein graft remodeling. Human saphenous vein graft segments (n=8) were perfused in vitro with autologous blood either supplemented or not with purified human C1inh at arterial pressure for 6h. The vein segments and perfusion blood were analyzed for cell damage and complement activation. In addition, the effect of purified C1inh on vein graft remodeling was analyzed in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. Application of C1inh in the in vitro perfusion model resulted in significantly higher blood levels and significantly more depositions of C1inh in the vein wall. This coincided with a significant reduction in endothelial loss and deposition of C3d and C4d in the vein wall, especially in the circular layer, compared to vein segments perfused without supplemented C1inh. Administration of purified C1inh significantly inhibited vein graft intimal thickening in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. C1inh significantly protects against early vein graft remodeling, including loss of endothelium and intimal thickening. These data suggest that it may be worth considering its use in patients undergoing coronary artery bypass grafting. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Günther Grabner
2017-06-01
Full Text Available Background and Objective: Image-guided neurosurgery uses information from a wide spectrum of methods to inform the neurosurgeon's judgement about which tissue to resect and which to spare. Imaging data are registered to the patient's skull so that they correspond to the intraoperative macro- and microscopic view. The correspondence between imaging and optical systems breaks down during surgery, however, as a result of cerebro-spinal fluid drain age, tissue resection, and gravity-based brain shift. In this work we investigate whether a map of surface veins, automatically segmented from MRI, could serve as additional reference system.Methods: Gradient-echo based T2*-weighted imaging was performed on two human cadavers heads using a 7 Tesla MRI scanner. Automatic vessel segmentation was performed using the Frangi vesselness filter, and surface renderings of vessels compared with photographs of the surface of the brain following craniotomy.Results: A high level of correspondence was established between vessel maps and the post autopsy photographs. Corresponding veins, including the prominent superior anastomotic veins, could be identified in all brain lobes.Conclusion: Automatic surface vessel segmentation is feasible and the high correspondence to post autopsy photographs indicates that they could be used as an additional reference system for image-guided neurosurgery in order to maintain the correspondence between imaging and optical systems.This has the advantage over a skull-based reference system that veins are clearly visible to the surgeon and move and deform with the underlying tissue, potentially making this surface net of landmarks robust to brain shift.
Compressed sensing approach for wrist vein biometrics.
Lantsov, Aleksey; Ryabko, Maxim; Shchekin, Aleksey
2018-04-01
The work describes features of the compressed sensing (CS) approach utilized for development of a wearable system for wrist vein recognition with single-pixel detection; we consider this system useful for biometrics authentication purposes. The CS approach implies use of a spatial light modulation (SLM) which, in our case, can be performed differently-with a liquid crystal display or diffusely scattering medium. We show that compressed sensing combined with above-mentioned means of SLM allows us to avoid using an optical system-a limiting factor for wearable devices. The trade-off between the 2 different SLM approaches regarding issues of practical implementation of CS approach for wrist vein recognition purposes is discussed. A possible solution of a misalignment problem-a typical issue for imaging systems based upon 2D arrays of photodiodes-is also proposed. Proposed design of the wearable device for wrist vein recognition is based upon single-pixel detection. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Metabolic effects of portal vein sensing.
Mithieux, G
2014-09-01
The extrinsic gastrointestinal nerves are crucial in the sensing of nutrients and hormones and its translation in terms of control of food intake. Major macronutrients like glucose and protein are sensed by the extrinsic nerves located in the portal vein walls, which signal to the brain and account for the satiety phenomenon they promote. Glucose is sensed in the portal vein by neurons expressing the glucose receptor SGLT3, which activate the main regions of the brain involved in the control of food intake. Proteins indirectly act on food intake by inducing intestinal gluconeogenesis and its sensing by the portal glucose sensor. The mechanism involves a prior antagonism by peptides of the μ-opioid receptors present in the portal vein nervous system and a reflex arc with the brain inducing intestinal gluconeogenesis. In a comparable manner, short-chain fatty acids produced from soluble fibre act via intestinal gluconeogenesis to exert anti-obesity and anti-diabetic effects. In the case of propionate, the mechanism involves a prior activation of the free fatty acid receptor FFAR3 present in the portal nerves and a reflex arc initiating intestinal gluconeogenesis. © 2014 John Wiley & Sons Ltd.
[Transposition of the cephalic vein in free flap breast reconstruction: Technical note].
Silhol, T; Suffee, T; Hivelin, M; Lantieri, L
2018-02-01
Free flaps have become a reliable practice for breast reconstruction. However, the venous congestion is still the most frequent reason of flap failure. It is due to bad quality of the internal mammary veins, a preferential superficial venous outflow of the flap or due to venous thrombosis. The transposition of the cephalic vein could useful in some cases. We describe the surgical technique and suggest an intraoperative algorithm. Seventeen patients (15 DIEP and 2 PAP) were included. Twenty nine point four percent had an unusable internal mammary vein, 23.5% a preferential superficial venous outflow and 47.1% a venous thrombosis. The length of the cephalic vein dissected varied from 15 to 25cm. The mean time of dissection was 39min. There was no flap failure after cephalic vein transposition. The sequelae were one or two scars on the arm without any functional morbidity. The transposition of the cephalic vein is a reliable, less morbid alternative in case of bad quality internal mammary vein with a good quality internal mammary artery, in case of an additional venous outflow necessity or in case of venous thrombosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Portal vein thrombosis after splenectomy for beta-thalassemia major
International Nuclear Information System (INIS)
Al-Hawsawi, Zakaria M.; Tarawah, Ahmed M.; Hassan, Ruhul Amin A.; Haouimi, Ammar S.
2004-01-01
Portal vein thrombosis is a recognized complication after splenectomy for beta-thalassemia major due to the chronic hypercoagulable state which has been recognized to exist in childhood thalassemia and contribute to thromboembolic events. We reporting one patient with beta-thalassemia major developed portal vein thrombosis following splenectomy. (author)
LOCAL LINE BINARY PATTERN FOR FEATURE EXTRACTION ON PALM VEIN RECOGNITION
Directory of Open Access Journals (Sweden)
Jayanti Yusmah Sari
2015-08-01
Full Text Available In recent years, palm vein recognition has been studied to overcome problems in conventional systems in biometrics technology (finger print, face, and iris. Those problems in biometrics includes convenience and performance. However, due to the clarity of the palm vein image, the veins could not be segmented properly. To overcome this problem, we propose a palm vein recognition system using Local Line Binary Pattern (LLBP method that can extract robust features from the palm vein images that has unclear veins. LLBP is an advanced method of Local Binary Pattern (LBP, a texture descriptor based on the gray level comparison of a neighborhood of pixels. There are four major steps in this paper, Region of Interest (ROI detection, image preprocessing, features extraction using LLBP method, and matching using Fuzzy k-NN classifier. The proposed method was applied on the CASIA Multi-Spectral Image Database. Experimental results showed that the proposed method using LLBP has a good performance with recognition accuracy of 97.3%. In the future, experiments will be conducted to observe which parameter that could affect processing time and recognition accuracy of LLBP is needed
Percutaneous sclerotherapy of testicular vein insufficiency in persistent and recurrent varicocele
International Nuclear Information System (INIS)
Sigmund, G.; Baehren, W.; Gall, H.; Thon, W.
1986-01-01
Among 1217 retrograde phlebographies of left-sided idiopathic varicoceles 66 patients presented because of persistence or recurrence of varicocele, 34 of them after operation and 32 after sclerotherapy. After operation without success there was always - except for one case - a reflux passing the site of ligature. If persistence or recurrence of varicocele occured after sclerotherapy, the testicular (internal spermatic) vein was most often found to be obliterated at the junction with the renal vein and the sonographically proven reflux went via collaterals or unidentified veins which prevented a repeat sclerotheraphy. In 12 out of 32 patients after sclerotherapy a persistent main stem of the testicular vein allowed a second attempt of sclerotherapy. If sclerotherapy in patients after operation or previous sclerotherapy could be performed, it was an effective, low risk procedure on an outpatient basis just as in primary sclerotherapy of testicular vein insufficiency causing varicocele. (orig.) [de
Prediction of renovascualar hypertension by captopril-stimulated renal vein renin ratios
International Nuclear Information System (INIS)
Roubidoux, M.A.; Dunnick, N.R.; Svetkey, L.; Newmann, G.E.; Cohan, R.H.; Kadir, S.; Klotman, P.
1989-01-01
The authors have prospectively studied 114 patients with suspected renovascular hypertension to determine whether captopril-stimulated, selective, renal vein renin ratios could be used to predict renovascular hypertension. As judged by the response to correction of renal artery lesions, 14 patients had renovascular hypertension, and renal vein renin ratios were significant in eight (sensitivity 57%). Overall, the positive predictive value of renal vein renin ratios was 33%, and the negative predictive value was 89%. The authors concluded that, in patients with renal artery stenosis, renal vein renin ratios predict neither the need for conventional arteriography nor potential benefit from the correction of vascular insufficiency
van der Wijk, Anne-Eva; Schreurs, Malou P H; Cipolla, Marilyn J
2013-04-01
Pregnancy increases the risk of several complications associated with the cerebral veins, including thrombosis and hemorrhage. In contrast to the cerebral arteries and arterioles, few studies have focused on the effect of pregnancy on the cerebral venous side. Here, we investigated for the first time the effect of pregnancy on the function and structure of the cerebral vein of Galen in rats. Our major finding was that cerebral veins from late-pregnant (LP, n=11) rats had larger lumen diameters and thinner walls than veins from nonpregnant (NP, n=13) rats, indicating that pregnancy caused outward hypotrophic remodeling of the vein of Galen. Moreover, veins from NP animals had a small amount of myogenic tone at 10 mm Hg (3.9±1.0%) that was diminished in veins during pregnancy (0.8±0.3%; Ppregnancy. Using immunohistochemistry, we show that the vein of Galen receives perivascular innervation, and that serotonergic innervation of cerebral veins is significantly higher in veins from LP animals. Outward hypotrophic remodeling and diminished tone of cerebral veins during pregnancy may contribute to the development of venous pathology through elevated wall tension and wall stress, and possibly by promoting venous blood stasis.
Directory of Open Access Journals (Sweden)
Songsong Wu
2017-03-01
Full Text Available Non-self recognition is a common phenomenon among organisms; it often leads to innate immunity to prevent the invasion of parasites and maintain the genetic polymorphism of organisms. Fungal vegetative incompatibility is a type of non-self recognition which often induces programmed cell death (PCD and restricts the spread of molecular parasites. It is not clearly known whether virus infection could attenuate non-self recognition among host individuals to facilitate its spread. Here, we report that a hypovirulence-associated mycoreovirus, named Sclerotinia sclerotiorum mycoreovirus 4 (SsMYRV4, could suppress host non-self recognition and facilitate horizontal transmission of heterologous viruses. We found that cell death in intermingled colony regions between SsMYRV4-infected Sclerotinia sclerotiorum strain and other tested vegetatively incompatible strains was markedly reduced and inhibition barrage lines were not clearly observed. Vegetative incompatibility, which involves Heterotrimeric guanine nucleotide-binding proteins (G proteins signaling pathway, is controlled by specific loci termed het (heterokaryon incompatibility loci. Reactive oxygen species (ROS plays a key role in vegetative incompatibility-mediated PCD. The expression of G protein subunit genes, het genes, and ROS-related genes were significantly down-regulated, and cellular production of ROS was suppressed in the presence of SsMYRV4. Furthermore, SsMYRV4-infected strain could easily accept other viruses through hyphal contact and these viruses could be efficiently transmitted from SsMYRV4-infected strain to other vegetatively incompatible individuals. Thus, we concluded that SsMYRV4 is capable of suppressing host non-self recognition and facilitating heterologous viruses transmission among host individuals. These findings may enhance our understanding of virus ecology, and provide a potential strategy to utilize hypovirulence-associated mycoviruses to control fungal diseases.
Saez, Patricio; Borquez, Aliro; Dantagnan, Patricio; Hernández, Adrián
2015-01-01
A digestibility trial was conducted to assess the effect of dehulling, steam-cooking and microwave-irradiation on the apparent digestibility of nutrients in white lupin (Lupinus albus) seed meal when fed to rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Six ingredients, whole lupin seed meal (LSM), dehulled LSM, dehulled LSM steam-cooked for 15 or 45 min (SC15 and SC45, respectively) and LSM microwave-irradiated at 375 or 750 W (MW375 and MW750, respectively), were evaluated for digestibility of dry matter, crude protein (CP), lipids, nitrogen-free extractives (NFE) and gross energy (GE). The diet-substitution approach was used (70% reference diet + 30% test ingredient). Faeces from each tank were collected using a settlement column. Dehulled LSM showed higher levels of proximate components (except for NFE and crude fibre), GE and phosphorus in comparison to whole LSM. Furthermore, SC15, SC45, MW375 and MW750 showed slight variations of chemical composition in comparison to dehulled LSM. Results from the digestibility trial indicated that dehulled LSM, SC15, SC45 and MW375 are suitable processing methods for the improvement of nutrients' apparent digestibility coefficient (ADC) in whole LSM. MW750 showed a lower ADC of nutrients (except for CP and lipids for rainbow trout) in comparison with MW350 for rainbow trout and Atlantic salmon, suggesting a heat damage of the ingredient when microwave-irradiation exceeded 350 W.
International Nuclear Information System (INIS)
Hruby, W.; Hoelti, W.
1986-01-01
Renal vein abnormalities are an uncommon kind of vascular abnormality. The distribution in the general population is 1.5%-2.5% in unselected pathologic material. In 354 autopsies we have seen six cases of renal vein abnormalities; in 215 cases of major retroperitoneal surgery, seven renal vein abnormalities; and in 4,500 patients who underwent CT examinations of the retroperitoneal areas, 36 cases of atypical renal vein anatomy. The radiologist must be familiar with embryologic details to understand the development of renal vein abnormalities. The authors discuss the value of preoperative diagnosis for preventing a surgical disaster in major retroperitoneal surgery
An unusual presentation of postpartum ovarian vein thrombosis
International Nuclear Information System (INIS)
Hakim, Fayaz A.; Khan, Nadra N.; Qushmaq, Khalid A.; Al-Shami, Sadiq Y.
2007-01-01
Ovarian vein thrombosis is a rare but potentially serious complication following childbirth. The majority of patients present during the first week postpartum, with fever and right lower quadrant abdominal pain. We report an unusual case of postpartum ovarian vein thrombosis who presented with fever, low backache, and painful thighs. A high index of suspicion is crucial to diagnose and treat this condition in order to avoid serious consequences. (author)
Sarpogrelate hydrochloride reduced intimal hyperplasia in experimental rabbit vein graft.
Kodama, Akio; Komori, Kimihiro; Hattori, Keisuke; Yamanouchi, Dai; Kajikuri, Junko; Itoh, Takeo
2009-05-01
The selective 5-HT(2A) receptor antagonist sarpogrelate has been clinically used for treatment in atherosclerotic diseases. However, it remains unknown whether administration of sarpogrelate inhibits intimal hyperplasia seen in autologous vein grafts. Therefore, we sought to clarify this question using an experimental rabbit vein graft model. Male rabbits were divided into two groups: a control group and a sarpogrelate-treated group. The jugular vein was interposed in the carotid artery in reversed fashion for 4 weeks and intimal hyperplasia of the grafted vein was measured (n = 8, in each group). Acetylcholine (ACh)-induced endothelium-dependent relaxation was tested by precontraction with prostaglandin F(2alpha) (PGF(2alpha), 5 muM) (n = 5, in each). endothelial nitric oxide synthase (eNOS) protein expression and superoxide production of these veins were also assessed. The suppression of intimal hyperplasia was significantly greater in the sarpogrelate-treated group than in the control group. ACh induced an endothelium-dependent relaxation in the sarpogrelate-treated group (but not in the control group). In endothelium-intact strips from the sarpogrelate-treated group, the nitric oxide (NO) synthase inhibitor nitroarginine enhanced the PGF(2alpha)-induced contraction and blocked the ACh-induced relaxation. Immunoreactive eNOS protein expression was similar between the two groups but superoxide production (estimated from ethidium fluorescence) in endothelial cells was significantly smaller in the sarpogrelate-treated group. The present results indicate that in vivo blockade of 5-HT(2A) receptors leads to an inhibition of intimal hyperplasia in rabbit vein graft. It is suggested that an increased function of endothelium-derived NO through a reduction in endothelial superoxide production may be a possible underlying mechanism for this. These novel findings support the clinical usefulness of sarpogrelate for preventing intimal hyperplasia in vein graft after bypass
Spoof Detection for Finger-Vein Recognition System Using NIR Camera
Directory of Open Access Journals (Sweden)
Dat Tien Nguyen
2017-10-01
Full Text Available Finger-vein recognition, a new and advanced biometrics recognition method, is attracting the attention of researchers because of its advantages such as high recognition performance and lesser likelihood of theft and inaccuracies occurring on account of skin condition defects. However, as reported by previous researchers, it is possible to attack a finger-vein recognition system by using presentation attack (fake finger-vein images. As a result, spoof detection, named as presentation attack detection (PAD, is necessary in such recognition systems. Previous attempts to establish PAD methods primarily focused on designing feature extractors by hand (handcrafted feature extractor based on the observations of the researchers about the difference between real (live and presentation attack finger-vein images. Therefore, the detection performance was limited. Recently, the deep learning framework has been successfully applied in computer vision and delivered superior results compared to traditional handcrafted methods on various computer vision applications such as image-based face recognition, gender recognition and image classification. In this paper, we propose a PAD method for near-infrared (NIR camera-based finger-vein recognition system using convolutional neural network (CNN to enhance the detection ability of previous handcrafted methods. Using the CNN method, we can derive a more suitable feature extractor for PAD than the other handcrafted methods using a training procedure. We further process the extracted image features to enhance the presentation attack finger-vein image detection ability of the CNN method using principal component analysis method (PCA for dimensionality reduction of feature space and support vector machine (SVM for classification. Through extensive experimental results, we confirm that our proposed method is adequate for presentation attack finger-vein image detection and it can deliver superior detection results compared
Spoof Detection for Finger-Vein Recognition System Using NIR Camera.
Nguyen, Dat Tien; Yoon, Hyo Sik; Pham, Tuyen Danh; Park, Kang Ryoung
2017-10-01
Finger-vein recognition, a new and advanced biometrics recognition method, is attracting the attention of researchers because of its advantages such as high recognition performance and lesser likelihood of theft and inaccuracies occurring on account of skin condition defects. However, as reported by previous researchers, it is possible to attack a finger-vein recognition system by using presentation attack (fake) finger-vein images. As a result, spoof detection, named as presentation attack detection (PAD), is necessary in such recognition systems. Previous attempts to establish PAD methods primarily focused on designing feature extractors by hand (handcrafted feature extractor) based on the observations of the researchers about the difference between real (live) and presentation attack finger-vein images. Therefore, the detection performance was limited. Recently, the deep learning framework has been successfully applied in computer vision and delivered superior results compared to traditional handcrafted methods on various computer vision applications such as image-based face recognition, gender recognition and image classification. In this paper, we propose a PAD method for near-infrared (NIR) camera-based finger-vein recognition system using convolutional neural network (CNN) to enhance the detection ability of previous handcrafted methods. Using the CNN method, we can derive a more suitable feature extractor for PAD than the other handcrafted methods using a training procedure. We further process the extracted image features to enhance the presentation attack finger-vein image detection ability of the CNN method using principal component analysis method (PCA) for dimensionality reduction of feature space and support vector machine (SVM) for classification. Through extensive experimental results, we confirm that our proposed method is adequate for presentation attack finger-vein image detection and it can deliver superior detection results compared to CNN
Pulmonary vein stenosis in patients with Smith-Lemli-Opitz syndrome.
Prosnitz, Aaron R; Leopold, Jane; Irons, Mira; Jenkins, Kathy; Roberts, Amy E
2017-07-01
To describe a group of children with co-incident pulmonary vein stenosis and Smith-Lemli-Opitz syndrome and to generate hypotheses as to the shared pathogenesis of these disorders. Retrospective case series. Five subjects in a pulmonary vein stenosis cohort of 170 subjects were diagnosed with Smith-Lemli-Opitz syndrome soon after birth. All five cases were diagnosed with Smith-Lemli-Opitz syndrome within 6 weeks of life, with no family history of either disorder. All cases had pathologically elevated 7-dehydrocholesterol levels and two of the five cases had previously reported pathogenic 7-dehydrocholesterol reductase mutations. Smith-Lemli-Opitz syndrome severity scores ranged from mild to classical (2-7). Gestational age at birth ranged from 35 to 39 weeks. Four of the cases were male by karyotype. Pulmonary vein stenosis was diagnosed in all cases within 2 months of life, earlier than most published cohorts. All cases progressed to bilateral disease and three cases developed atresia of at least one vein. Despite catheter and surgical interventions, all subjects' pulmonary vein stenosis rapidly recurred and progressed. Three of the subjects died, at 2 months, 3 months, and 11 months. Survival at 16 months after diagnosis was 43%. Patients with pulmonary vein stenosis who have a suggestive syndromic presentation should be screened for Smith-Lemli-Opitz syndrome with easily obtainable serum sterol tests. Echocardiograms should be obtained in all newly diagnosed patients with Smith-Lemli-Opitz syndrome, with a low threshold for repeating the study if new respiratory symptoms of uncertain etiology arise. Further studies into the pathophysiology of pulmonary vein stenosis should consider the role of cholesterol-based signaling pathways in the promotion of intimal proliferation. © 2017 Wiley Periodicals, Inc.
Anatomic relationship of intrahepatic bile ducts to portal veins revisited
International Nuclear Information System (INIS)
Bret, P.M.; Stempel, J.; Atri, M.; Lough, J.O.; Illescas, F.F.
1987-01-01
It is well accepted that intrahepatic bile ducts lie in front of corresponding portal vein branches. Since the authors' clinical experience with US was different, they studied 18 normal necropsy cadaver livers. The common bile duct, main portal vein, and hepatic artery were cannulated and injected respectively with air, dilute contrast medium, and mineral oil. The livers were then examined in anatomic position with CT. In the left lobe of the liver, the bile ducts were anterior to the portal vein in seven cases, posterior in seven cases, and were tortuous both anterior and posterior in three cases. In the right lobe, the bile ducts were anterior in nine cases, posterior in five cases, tortuous in one case, and not seen in two cases. In the porta hepatis, the bile ducts were anterior in eight cases, posterior in one case, tortuous in five cases, and not seen in three cases. Histologic specimens confirmed the anterior and posterior location of the bile ducts relative to the portal veins. In conclusion, intrahepatic bile ducts can be either anterior or posterior to the corresponding portal vein branches
Isolated Subclavian Vein Injury: A Rare and High Mortality Case
Directory of Open Access Journals (Sweden)
Sahin Iscan
2013-01-01
Full Text Available Isolated subclavian vein injuries are rarely seen without concomitant arterial injury, bone fracture, damage to brachial plexus, and thoracal traumas. Our case was brought to the emergency service 6 hours after he had been shot at the shoulder with a firearm. After detection of extravasation from the left axillary and subclavian vein on arteriographic and venographic examinations, he was operated on. An autogenous saphenous vein graft was interposed between subclavian and axillary veins. Cardiac arrest developed twice because of hypovolemia, which was resolved with medical therapy. Subclavian vein injuries have a more mortal course when compared with the injuries to the subclavian arteries. Its most important reason is excessive blood loss and air embolism because of delayed arrival to hospital. As is the case in all vascular injuries, angiography is the most important diagnostic examination. If the general health state of the patient permits, arteriography and venography should be performed in patients potentially exposed to vascular injuries. In patients with extreme blood loss and deteriorated health state, direct surgical exploration of the injury site, containment of the bleeding, and venous repair are life-saving approaches.
Large vein injection alleviates rocuronium-induced pain in gynaecologic patients.
Zhang, Xing-Mei; Wang, Qun; Wang, Wei-Si; Wang, Meng
2017-08-01
Rocuronium-induced pain upon injection is very common in the clinical setting. Using the antecubital rather than the hand vein can avoid pain due to propofol injection. We aimed to investigate whether the use of the antecubital vein for injection would alleviate rocuronium-induced pain in a similar fashion. Sixty patients (ASA classes I and II) scheduled for gynaecologic laparoscopy were randomised into two groups. Rocuronium (0.6mg/kg) was injected either into the vein on the dorsum of the hand (group D) or a large vein in the antecubital fossa (group A). Pain was assessed and recorded using a four-point scale. Compared with group D, the incidence of pain and severe pain was lower in group A patients. The rate of no pain was also higher in group A patients. The incidence and severity of rocuronium-induced injection pain were significantly alleviated via use of a large vein for rocuronium injection. Copyright © 2016 Société française d'anesthésie et de réanimation (Sfar). Published by Elsevier Masson SAS. All rights reserved.
Cerezal Mezquita, P; Acosta Barrientos, E; Rojas Valdivia, G; Romero Palacios, N; Arcos Zavala, R
2012-01-01
This research was aimed at developing a high content protein beverage from the mixture of liquid extracts of a pseudocereal, quinoa (Chenopodium quinoa Willd) and two legumes: mesquite (Prosopis chilensis (Mol.) Stunz) and lupine (Lupinus albus L.), native from the Andean highlands of the Chilean northern macro-zone, flavored with raspberry pulp, to help in the feeding of children between 2 and 5 years of lower socioeconomic status with nutritional deficiencies. The formulation was defined by linear programming, its composition was determined by proximate analysis and physical, microbiological and sensory acceptance tests were performed. After 90 days of storage time, the beverage got a protein content of 1.36%, being tryptophan the limiting amino acid; for its part, the chromaticity coordinates of CIEL*a*b* color space showed no statistical significant differences (p < 0.05) maintaining the "dark pink" tonality, the viscosity and the sensory evaluation were acceptable for drinking.
Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila
2012-01-01
As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.
Mineralization and hydrothermal alteration of the Tajroud vein system, south of Neyshabour
Directory of Open Access Journals (Sweden)
Mohsen Alikhani Banghani
2013-10-01
Full Text Available The Tajroud vein system is located 190 km southwest of Mashhad, and in the southern part of the Sabzevar zone. The vein host rocks consist of Eocene intermediate to silicic volcanic rocks. The mineralization occurs as open space filling, taking place as veins, veinlets and hydrothermal breccias. Based on field geology and textural evidence, three main stages of mineralization were identified. Stage I mainly contains quartz, pyrite, chalcopyrite and magnetite. Stage II, which has the same mineral assemblage as stage I, is the most important stage in terms of volume. Finally, stage III is characterized by repetitive quartz and calcite banding with negligible amounts of sulfide minerals. Hydrothermal alteration is developed around the veins and tends to be more intense in the vicinity of the veins. The plot of the Ishikawa alteration index (AI versus chlorite-carbonate-pyrite index (CCPI, known as alteration box plot, displays three main alteration trends. The hydrothermal alteration assemblage of quartz, adularia, chlorite, illite, calcite, and epidote that envelops the Tajroud vein system formed from the upwelling of near-neutral to weakly alkaline hydrothermal solutions. The mineralogic, alteration and geochemical characteristics of the studied area and comparison with epithermal ore deposits indicate that the Tajroud vein system represents an epithermal system of low-sulfidation type.
CT imaging of collaterals in stenoses of large mediastinal veins
International Nuclear Information System (INIS)
Goerich, J.; Flentje, M.; Gueckel, F.; Beyer-Enke, S.A.; Kaick, G. van; Heidelberg Univ.
1988-01-01
Scans of angio-computed tomography (CT) of 53 patients suffering from mediastinal space-occupying growths were reviewed: 16 patients showed stenosis of mediastinal veins with demonstration of subcutaneous venous channels, 17 showed an obstruction without collateral pathways and 20 patients had normal mediastinal vessels. Two thirds of the cases with external vein compression were caused by bronchogenic carcinoma. The degree of obstruction in patients showing collateral circulation was between 70 and 100 percent and significantly greater than in patients without collaterals (40%). The most important collaterals bypassing the upper mediastinal veins are discussed. (orig.) [de
Classical varicose vein surgery in a diverse ethnic community.
Murli, N L; Navin, I D
2008-08-01
Chronic venous disorders range from telangiactasia or spider veins to varicose veins, venous swellings, skin changes and venous ulcerations. The aim of this study is to assess outcome of varicose vein surgery in the ethnically diverse population of Penang, Malaysia. This study is a retrospective analysis of patients seen from 1999 to 2004. All patients who presented to the outpatient clinic of our surgical department with saphenofemoral junction (SFJ) and/or saphenopopliteal junction (SPJ) reflux associated with incompetence of the great saphenous vein (GSV) or small saphenous vein (SSV) respectively underwent classical varicose varicose vein surgery. A single surgeon at a single institution performed the surgeries. Data from pre-operative, post-operative and follow-up procedures were recorded in case report forms. A total of 202 cases were treated. Of these, 200 were qualified by the inclusion criteria and follow-ups, with 23 who were treated bilaterally. Of those treated, Chinese comprised 47.5%, Indians 27.0%, Malays 12.5% and foreigners 13.0% (largely Indonesian Chinese, British and Americans). The average age was 52.1 years. Indians had the highest average BMI of 29.2, compared to the Chinese who had the lowest of 24.6. Based on occupation, housewives (43.0%), blue collar workers (19.0%), salespersons (12.0%) and factory workers (9.5%) were among those afflicted with varicose veins. While local Chinese predominated in the business groups (salespersons and food-related workers), the Indians and Malays in this study were mainly factory workers and/or blue collar workers. Symptomatology in descending order of severity included pain in 80.0% of cases, swelling in 65.5%, heaviness in 53.5%, cramps in 53.0%, lipodermatosclerosis in 39.0%, superficial thrombophlebitis in 33.5%, venous ulceration in 32.0%, eczema 22.0% and cellulitis in 12.5% of patients. Post surgery pains dropped to 9.9%, cramps 6.4%, heaviness 5.5% and swelling 5.3% (p<0.0001 in all groups
Jugular veins in transient global amnesia: innocent bystanders.
Baracchini, Claudio; Tonello, Simone; Farina, Filippo; Viaro, Federica; Atzori, Matteo; Ballotta, Enzo; Manara, Renzo
2012-09-01
Transient global amnesia (TGA) has been associated with an increased prevalence of internal jugular valve insufficiency and many patients report Valsalva-associated maneuvers before TGA onset. These findings have led to the assumption of hemodynamic alterations in intracranial veins inducing focal hippocampal ischemia. We investigated this hypothesis in patients with TGA and control subjects. Seventy-five patients with TGA and 75 age- and sex-matched healthy subjects were enrolled into a cross-sectional study. Extracranial and transcranial high-resolution venous echo-color-Doppler sonography was performed blindly in all patients and control subjects. Blood flow direction and velocities were recorded at the internal jugular veins, basal veins of Rosenthal, and vein of Galen, both at rest and during Valsalva-associated maneuvers. Mean age of patients with TGA was 60.3±8.0 years (median, 60 years; range, 44-78 years); 44 (59%) were female (female/male ratio: 1.42). Internal jugular valve insufficiency (left, right, or bilateral) was found to be more frequent in patients with TGA than in control subjects: 53 (70.7%) versus 22 (29.3%; P<0.05). Blood flow velocities in the deep cerebral veins of patients with TGA did not differ from control subjects both at rest and during Valsalva-associated maneuvers. Intracranial venous reflux was neither observed in patients with TGA nor in control subjects despite unilateral or bilateral internal jugular valve insufficiency during prolonged and maximal Valsalva-associated maneuvers. This study, although confirming the association between TGA and internal jugular valve insufficiency, challenges the hypothesis that cerebral venous congestion plays a significant role in the pathogenesis of TGA.
The Short Saphenous Vein: A Viable Alternative Conduit for ...
African Journals Online (AJOL)
This novel position allowed for two members of the surgical team to operate at the same time, thus ... along the ultrasound-marked vein positions similar to when harvesting the LSV. Once the veins were harvested and ... occlusion compared to LSV grafts utilized in the same procedure,[8] it was brought back to prominence ...
Bi, Lianxiang; Wacker, Bradley K; Bueren, Emma; Ham, Ervin; Dronadula, Nagadhara; Dichek, David A
2017-12-15
Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd) efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks) persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate-yet significant-pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.
Straight configuration saphenous vein transposition to popliteal artery for vascular access.
Caco, Gentian; Golemi, Dhurata; Likaj, Eriola
2017-03-21
The saphenous vein is commonly used as a vascular graft in peripheral artery surgery but rarely used for vascular access. The literature on straight configuration saphenous vein transposition to the popliteal artery is scarce. Here we present two cases of straight configuration saphenous vein transposition to the popliteal artery for vascular access, the surgical technique and respective follow-up. Two young men, aged 29 and 36 years, were chosen for lower-limb vascular access for hemodialysis. The first patient was paraplegic since birth. He used his arms to move so upper extremity vascular access was avoided. The second patient presented with an infected upper extremity arteriovenous graft (AVG) and after multiple closed AVFs he had no more available arm veins. Both patients received autologous lower extremity straight configuration saphenous vein transpositions to the popliteal artery under spinal anesthesia in May and October 2012, respectively. Cannulation of the fistula was allowed after one month. There were no early complications. Slight swelling on the leg appeared in one of the patients. Both fistulas were still functional after 36 and 32 months, respectively. The straight configuration saphenous vein transposition to popliteal artery is simple to perform, offers a long and straight segment for cannulation and may be a suitable autologous vascular access in selected patients.
Underground geologic evaluation of the Grossschloppen vein-uranium deposit, West Germany
International Nuclear Information System (INIS)
Moore, S.C.; Erickson, A.J.; Kolb, S.G.; Maclean, C.J.
1983-01-01
The Grossschloppen vein-uranium deposit, Bavaria, West Germany, was examined utilizing underground workings during 1980-82 by Esso Er/ZETA/ GMbH, an affiliate of Exxon Minerals Company (EMC). Geologic evaluation entailed dense drilling of a portion of the deposit from workings constructed specifically for the program. Discovered in 1977, the deposit was initially explored by surface diamond drillholes which allowed definition of a 30-60 m wide vein system discontinuously mineralized along a 1000 m strike length and to at least a 450 m depth. The underground program was conceived as a cost effective procedure to answer questions on vein correlation, grade continuity and variability. A 1200 m decline allowed access for detailed sampling of approximately 10% of the known area of mineralization. Fanned drillholes, logged by gamma probe, were spaced to provide intersections of veins at 10 to 20 m intervals. Six cross cuts also penetrate the pitchblende and uranophane mineralization which occurs in 0.1 to 2.5 m thick quartz veins. Detailed cross-sections and level plans were constructed for resource estimates of the intensively studied portion of the vein system. The program resulted in the discovery of local, high grade areas and an average grade in the evaluated area nearly double that expected from surface drilling
(Mis)placed central venous catheter in the left superior intercostal vein
International Nuclear Information System (INIS)
Padovan, Ranka Stern; Paar, Maja Hrabak; Aurer, Igor
2010-01-01
Chest X-ray is routinely performed to check the position of the central venous catheter (CVC) inserted through the internal jugular or subclavian vein, while the further evaluation of CVC malfunction is usually performed by contrast venography. In patients with superior vena cava obstruction, the tip of the catheter is often seen in collateral mediastinal venous pathways, rather than in the superior vena cava. In such cases detailed knowledge of thoracic vessel anatomy is necessary to identify the exact location of the catheter. We report a case of 32-year-old female patient with relapsing mediastinal lymphoma and previous superior vena cava obstruction with collateral azygos-hemiazygos venous pathways. The patient had CVC inserted through the left subclavian vein and its position was detected by CT to be in the dilated left superior intercostal vein and accessory hemiazygos vein. Considering that dilated accessory hemiazygos vein can tolerate infusion, the CVC was left in place and the patient had no complaints related to CVC (mal)position. Furthermore, we present anatomical and radiological observations on the azygos-hemiazygos venous system with the special emphasis on the left superior intercostal vein. Non-contrast CT scans can be a valuable imaging tool in the detection of the CVC position, especially in patients with renal insufficiency and contrast media hypersensitivity
International Nuclear Information System (INIS)
Allibone, A.H.; MacKenzie, D.; Turnbull, R.E.; Tulloch, A.J.; Craw, D.; Palin, M.
2016-01-01
The 140±1 Ma hypersolvus, ferroan, weakly peralkaline to weakly peraluminous North Red Head leucogranite in northwest Stewart Island is cut by quartz-pyrite-rich veins that contain a wide variety of Mo, Ag, Te, Bi, Au, Co, Cu, Pb, Zn, REE, Nb, Y, Th, U, Zr, Ti, Be and F-bearing minerals. Patchy hematite-pyrite alteration locally overprints leucogranite in the vicinity of the mineralised veins. Individual veins are up to 5 m thick and 200+ m long. U-Pb dating and trace-element geochemistry indicate a direct link between leucogranite crystallisation and exsolution of the vein-forming hydrothermal fluid. Mineralised veins developed along transpressional faults within the leucogranite soon after emplacement. Incipiently mineralised quartz?±?pyrite veins at Waituna Bay and the northern end of West Ruggedy Beach several kilometres from North Red Head are probably part of the same hydrothermal system as the veins at North Red Head. Metal and alteration assemblages at North Red Head most closely resemble those in rare hydrothermal systems associated with oxidised fluorine-rich A-type granites. (author).
Prediction of subclavian vein location using plain chest radiography.
Fukutome, T; Shigematsu, A
1986-12-01
The relationship between the right subclavian vein and the thoracic inlet below the clavicle was studied by Venography in 72 patients. The area of the thoracic inlet below the clavicle was defined as a radiolucent area surrounded superiorly by the lower border of the clavicle, inferiorly by the inner margin of the first rib and medially by the lateral margin of the manubrium (CRM area). In 10 patients, the subclavian vein was situated below the axis of the clavicle, and the CRM area was large enough to extend near the top of the first rib arch. In 62 patients, the subclavian vein extended above the axis of the clavicle and the CRM area was small or invisible. The existence of a large thoracic inlet below the clavicle (large CRM area which extends near the top of the first rib arch) may be a useful indicator for predicting the low location of the subclavian vein, and may be used to predict or explain venipuncture failure using the standard infraclavicular approach.
International Nuclear Information System (INIS)
Park, Soon Chan; Kwon, Se Hwan; Oh, Joo Hyeong; Ryu, Kyung Nam; Ahn, Hyung Joon; Park, Ho Chul
2009-01-01
We wanted to evaluate the incidence of Giacomini vein and its association with lower extremity venous insufficiency by performing US. From September 2006 to July 2007, 173 patients (58 males and 115 females, mean age: 52.7 years, age range: 22-72 years) who had been diagnosed with unilateral/bilateral varicose veins or telangiectasias were evaluated with duplex Doppler ultrasonography. The presence of Giacomini vein, superficial/deep vein reflux, the anatomical sites of the venous reflux and the abnormal perforating veins was investigated in 346 legs. Giacomini veins were found in 33 limbs (9.5%) of 21 patients (12.1%). Bilateral Giacomini veins were found in 12 patients. Of the 33 limbs that had Giacomini veins, 20 limbs had great saphenous vein (GSV) reflux and 4 limbs had small saphenous vein (SSV) reflux. The patients with Giacomini veins were classified into two groups according to the presence of Giacomini vein. There was no significant difference of the GSV reflux (p = 0.155), the SSV reflux (p = 0.760) and the mean velocity of the GSV reflux or the SSV reflux (p = 0.685, p = 0.431, respectively) between the two groups. Our results indicated that Giacomini vein is not associated with either GSV or SSV reflux, and this is contrary to conventional belief
SWI enhances vein detection using gadolinium in multiple sclerosis
International Nuclear Information System (INIS)
Maggi, Pietro; Mazzoni, Lorenzo N; Moretti, Marco; Grammatico, Matteo; Chiti, Stefano; Massacesi, Luca
2015-01-01
Susceptibility weighted imaging (SWI) combined with the FLAIR sequence provides the ability to depict in vivo the perivenous location of inflammatory demyelinating lesions – one of the most specific pathologic features of multiple sclerosis (MS). In addition, in MS white matter (WM) lesions, gadolinium-based contrast media (CM) can increase vein signal loss on SWI. This report focuses on two cases of WM inflammatory lesions enhancing on SWI images after CM injection. In these lesions in fact the CM increased the contrast between the parenchyma and the central vein allowing as well, in one of the two cases, the detection of a vein not visible on the same SWI sequence acquired before CM injection
Pulmonary Septic Emboli due to Azygos Vein Septic Thrombosis
Directory of Open Access Journals (Sweden)
Ginius Pradhan
2013-01-01
Full Text Available The triad of extrapulmonary infection, contiguous septic vein thrombosis, and septic pulmonary embolism is a rare complex but associated with significant morbidity and mortality. Septic azygos vein thrombosis is extremely rare and potentially serious since it may also cause pulmonary emboli and sudden death. We report a case of a 32-year-old woman with history of IV drug abuse who presented with epidural abscess and methicillin-resistant S. aureus (MRSA bacteremia. Later she developed signs of septic pulmonary embolism secondary to septic azygos vein thrombosis. With early diagnosis, appropriate antimicrobial therapy, and control of the infectious source, resolution of the illness can be expected for most patients with avoidance of potential complications.