WorldWideScience

Sample records for lupine vein-clearing virus

  1. WRKY71 and TGA1a physically interact and synergistically regulate the activity of a novel promoter isolated from Petunia vein-clearing virus.

    Science.gov (United States)

    Shrestha, Ankita; Khan, Ahamed; Mishra, Dipti Ranjan; Bhuyan, Kashyap; Sahoo, Bhabani; Maiti, Indu B; Dey, Nrisingha

    2018-02-01

    Caulimoviral promoters have become excellent tools for efficient transgene expression in plants. However, the transcriptional framework controlling their systematic regulation is poorly understood. To understand this regulatory mechanism, we extensively studied a novel caulimoviral promoter, PV8 (-163 to +138, 301 bp), isolated from Petunia vein-clearing virus (PVCV). PVCV was found to be Salicylic acid (SA)-inducible and 2.5-3.0 times stronger than the widely used CaMV35S promoter. In silico analysis of the PV8 sequence revealed a unique clustering of two stress-responsive cis-elements, namely, as-1 1 and W-box 1-2 , located within a span of 31 bp (-74 to -47) that bound to the TGA1a and WRKY71 plant transcription factors (TFs), respectively. We found that as-1 (TTACG) and W-box (TGAC) elements occupied both TGA1a and WRKY71 on the PV8 backbone. Mutational studies demonstrated that the combinatorial influence of as-1 (-57) and W-box 1-2 (-74 and -47) on the PV8 promoter sequence largely modulated its activity. TGA1a and WRKY71 physically interacted and cooperatively enhanced the transcriptional activity of the PV8 promoter. Biotic stress stimuli induced PV8 promoter activity by ~1.5 times. We also established the possible pathogen-elicitor function of AtWRKY71 and NtabWRKY71 TFs. Altogether, this study elucidates the interplay between TFs, biotic stress and caulimoviral promoter function. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Characterization of New Isolates of Apricot vein clearing-associated virus and of a New Prunus-Infecting Virus: Evidence for Recombination as a Driving Force in Betaflexiviridae Evolution.

    Directory of Open Access Journals (Sweden)

    Armelle Marais

    Full Text Available Double stranded RNAs from Prunus samples gathered from various surveys were analyzed by a deep-sequencing approach. Contig annotations revealed the presence of a potential new viral species in an Azerbaijani almond tree (Prunus amygdalus and its genome sequence was completed. Its genomic organization is similar to that of the recently described Apricot vein clearing associated virus (AVCaV for which two new isolates were also characterized, in a similar fashion, from two Japanese plums (Prunus salicina from a French germplasm collection. The amino acid identity values between the four proteins encoded by the genome of the new virus have identity levels with those of AVCaV which fall clearly outside the species demarcation criteria. The new virus should therefore be considered as a new species for which the name of Caucasus prunus virus (CPrV has been proposed. Phylogenetic relationships and nucleotide comparisons suggested that together with AVCaV, CPrV could define a new genus (proposed name: Prunevirus in the family Betaflexiviridae. A molecular test targeting both members of the new genus was developed, allowing the detection of additional AVCaV isolates, and therefore extending the known geographical distribution and the host range of AVCaV. Moreover, the phylogenetic trees reconstructed with the amino acid sequences of replicase, movement and coat proteins of representative Betaflexiviridae members suggest that Citrus leaf blotch virus (CLBV, type member of the genus Citrivirus may have evolved from a recombination event involving a Prunevirus, further highlighting the importance of recombination as a driving force in Betaflexiviridae evolution. The sequences reported in the present manuscript have been deposited in the GenBank database under accession numbers KM507061-KM504070.

  3. Molecular strategies towards anthracnose resistance in lupin

    OpenAIRE

    2008-01-01

    The aim of the project was to develop a strategy towards anthracnose resistance in lupin using molecular techniques. Colletotrichum species are considered to be major plant pathogens of cereals and legumes around the world, causing significant crop losses. Colletotrichum acutatum causes anthracnose disease on lupin. Sweet white lupin (Lupinus albus) is a high protein grain crop that could alleviate protein shortage in South Africa, since it has the highest protein levels (34-45%) compared to ...

  4. Functionality-driven fractionation of lupin seeds

    NARCIS (Netherlands)

    Berghout, J.A.M.

    2015-01-01

    Functionality-driven fractionation of lupin seeds

    The growth in the world population requires an increase in the production of protein-rich foods from plant-based materials. Lupin seeds have potential to become a novel plant protein source for food products because they are rich

  5. Sensitization to lupine flour: is it clinically relevant?

    NARCIS (Netherlands)

    de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; Gerth van Wijk, R.

    2010-01-01

    Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. The aim of our study was to

  6. Sensitization to lupine flour : is it clinically relevant?

    NARCIS (Netherlands)

    de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; van Wijk, R. Gerth

    2010-01-01

    Background Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. Objective The aim of our

  7. Patogenic fungi associated with blue lupine seeds

    Directory of Open Access Journals (Sweden)

    Bogdan Nowicki

    2013-12-01

    Full Text Available Over 10% ofseeds harvested in 1991 and 1992 (50 samples, 400 seeds in each sample proved to be infested with various fungi. Fusarium spp. and Botrytis cinerea were the most common pathogens isolated. Fusarium avenaceum was the most common and highIy pathogenic species. Fusarium semitectum and F. tricinctum were highly pathogenic to lupin seedlings but they were the least common Fusarium isolated from seeds. Similarily, Sclerotinia sclerotiorum was isolated only from 0,2% seeds tested but this fungus was highly pathogenic to lupin seedlings. Some other fungi know as lupin pathogens (F. oxysporum, Stemphylium botryosum, Pleiochaeta setosa and Phomopsis leptostromiformis were also noted in tested seeds.

  8. Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin

    International Nuclear Information System (INIS)

    Paananen, M.; Ruskeeniemi, T.

    2003-01-01

    The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)

  9. Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin

    Energy Technology Data Exchange (ETDEWEB)

    Paananen, M.; Ruskeeniemi, T

    2003-07-01

    The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)

  10. Determination of phomopsin-A in lupin seeds and lupin-derived products

    NARCIS (Netherlands)

    Top, van den H.J.; Mol, J.G.J.

    2017-01-01

    An interlaboratory study was performed for the determination of phomopsin A in lupin seeds and lupin derived products. This was done in the frame of the 2nd Standardization Mandate (M/520) in the field of methods of analysis for mycotoxins in food, which had been issued by the European Commission in

  11. Rotational and nematicidal effect of lupine (Lupinus albus L ...

    African Journals Online (AJOL)

    Jane

    2011-10-10

    Oct 10, 2011 ... Key words: Lupine, lupine seed extract, nematodes, nematicidal effect. INTRODUCTION ... alternative in winter and dry land production systems where other ... effects on germination and seedling growth of lettuce. Yorgancilar ...

  12. An evaluation of fababean ( Vicia faba ) and lupin ( Lupinus albus ...

    African Journals Online (AJOL)

    The experiment was carried out to compare fababean with lupin crop residues for summer grazing by young Merino wethers. The crude protein (CP) and dry matter (DM) degradability as well as chemical composition of fababean and lupin seed and stalks were also determined. Sheep which utilized both crop residues ...

  13. Lupine protein enrichment by milling and electrostatic separation

    NARCIS (Netherlands)

    Wang, Jue; Zhao, Jun; Wit, De Martin; Boom, Remko M.; Schutyser, Maarten A.I.

    2016-01-01

    Lupine seeds are excellent source of plant protein. We here report on dry fractionation by combining milling and electrostatic separation providing an alternative to wet extraction of protein from lupine seeds. Relatively coarse milling was preferred as this provides sufficient detached protein

  14. Clinical relevance of sensitization to peanut and lupine

    NARCIS (Netherlands)

    Peeters, K.A.B.M.

    2007-01-01

    This thesis demonstrates that the use of purified allergens and techniques such as NMR spectroscopy has the potential to improve current diagnostic capabilities. It also shows that lupine allergy is fairly common in The Netherlands. Characteristics of lupine allergy such as the eliciting dose and

  15. Lupin sensitization and clinical allergy in food allergic children in Norway.

    Science.gov (United States)

    Lindvik, Helene; Holden, Lise; Løvik, Martinus; Cvancarova, Milada; Halvorsen, Ragnhild

    2008-01-01

    The aim of the present pilot study was to investigate to what extent children in Norway sensitized to lupin had clinical lupin allergy, and to compare sensitization to lupin with sensitization to other legumes. Thirty-five children with food allergy referred to a national referral hospital were evaluated with skin prick test (SPT) and analysis of serum-specific IgE to lupin, peanut, pea and soy. The children with positive SPTs to lupin were offered oral food challenges with lupin flour. Fifteen children (43%) had positive SPT and 17 children (49%) had serum-specific IgE to lupin. Ten SPT-positive children underwent oral food challenges and one experienced an allergic reaction to lupin flour. This child was one of six challenged children with IgE antibodies to peanut >15 kU(A)/L. There was a strong relationship between positive SPT to lupin flour and positive SPT to soy and between positive SPT to lupin and specific IgE to soy, pea and peanut. Children with sensitization to lupin are not likely to have a clinical lupin allergy. Avoidance of lupin on the basis of lupin sensitization or peanut allergy would lead to unnecessarily strict diets. Food challenge is currently necessary to diagnose lupin allergy.

  16. The future of lupin as a protein crop in Europe

    Directory of Open Access Journals (Sweden)

    M. Mercedes eLucas

    2015-09-01

    Full Text Available Europe has become heavily dependent on soya bean imports, entailing trade agreements and quality standards that do not satisfy the European citizen’s expectations. White, yellow and narrow-leafed lupins are native European legumes that can become true alternatives to soya bean, given their elevated and high-quality protein content, potential health benefits, suitability for sustainable production, and acceptability to consumers. Nevertheless, lupin cultivation in Europe remains largely insufficient to guarantee a steady supply to the food industry, which in turn must innovate to produce attractive lupin-based protein-rich foods. Here, we address different aspects of the food supply chain that should be considered for lupin exploitation as a high-value protein source. Advanced breeding techniques are needed to provide new lupin varieties for socio-economically and environmentally sustainable cultivation. Novel processes should be optimized to obtain high-quality, safe lupin protein ingredients, and marketable foods need to be developed and offered to consumers. With such an integrated strategy, lupins can be established as an alternative protein crop, capable of promoting socio-economic growth and environmental benefits in Europe.

  17. Assessment of Antioxidant Properties of Radiation Processed Lupin Seeds

    International Nuclear Information System (INIS)

    El-Niely, H.F.G.

    2011-01-01

    In the present study, the radiation processing of lupin seeds (Lupinus albus spp. Giza 2) were carried out at dose levels of 2.5, 5 and 10 kGy. The chemical composition (protein, fat, total phenolic compounds, total flavonoids and fatty acids) and antioxidant properties of its methanolic extracts were assessed. The result showed that there were non-significant changes observed for protein, fat and ash of processed samples as compared with non-irradiated samples. Meanwhile, the crude fiber was decreased linearly as a function of radiation dose. The total phenolic compounds were increased by 9.92%, 11.75% and 13.82% and flavonoids by 2.5%, 7.1% and 7.5% for the 2.5, 5 and 10 kGy irradiated samples, respectively. Regarding lupin fatty acid contents, the results indicated that gamma irradiation up to 10 kGy did not cause important changes in the percentage of the fatty acids. At 7.5 and 10.0 mg/ml of sample concentration, the antioxidant activities of methanolic extracts for 2.5 to 10 kGy irradiated lupin seeds were significantly higher than those of methanolic extracts of the non-irradiated control. Reducing powers of methanolic extracts from lupin irradiated at 2.5 and 5 kGy were comparable except for 10 kGy irradiated lupin seeds, and had more power than methanolic extracts from non-irradiated lupin. The reducing powers of the methanolic extract from 10 kGy irradiated lupin was decreased at all concentrations (from 0.5 to 10 mg/ml) than of methanolic extracts from non-irradiated or irradiated lupin seeds at 2.5 and 5 kGy. At 2.5 mg/ml, all methanolic extracts showed excellent scavenging abilities of 91.6 to 103.27% against DPPH radicals. The scavenging abilities of methanolic extracts from 2.5 to 10 kGy irradiated lupin were better than that of the non-irradiated control at 10 mg/ml. With irradiation at 2.5-10 kGy, lupin seeds showed higher chelating ability on ferrous ions than did the non-irradiated control. It could be concluded that gamma irradiation of lupin

  18. Chemical and nutritional changes in bitter and sweet lupin seeds (Lupinus albus L.) during bulgur production.

    Science.gov (United States)

    Yorgancilar, Mustafa; Bilgiçli, Nermin

    2014-07-01

    In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p sweet lupin bulgurs were found as 18.8% and 21.3%, respectively. Generally sweet lupin seeds/bulgurs showed rich essential amino acids composition than that of bitter seeds/bulgurs. Linoleic and linolenic acid content of the lupin was negatively affected by bulgur process. Bitter lupin bulgur received lower scores in terms of taste, odor and overall acceptability than sweet lupin bulgur in sensory evaluation. Sweet lupin bulgur can be used as new legume-based product with high nutritional and sensorial properties.

  19. An evaluation of fababean (Vicia faba) and lupin (Lupinus albus ...

    African Journals Online (AJOL)

    Sheep which utilized both crop residues gained in live mass ... live masses than sheep which grazed lupin crop residues at the fourth week .... model of 0rskov & McDonald (1979): p .... Production Laboratory are thanked for chemical analyses.

  20. Lupine Alleviate Hyperglycemia in Streptozotocin Diabetic gamma- Irradiated Rats

    International Nuclear Information System (INIS)

    El-Sayed, S.M.

    2010-01-01

    This study was to examine the regulatory effect of lupine on the diabetic profile developed in Streptozotocin (STZ) induced diabetic albino rats. The effectiveness of lupine against diabetes in gamma irradiated rats was purposed in the present study. Rats were received lupine seeds powder suspension (1 g/kg body weight for 14 consecutive days) before whole body exposure to 8 Gy of gamma radiation and /or STZ (55 mg/kg body weight, single dose) injection. The results pointed out that radiation exposure sustained the diabetic profile in rats received STZ comparing with STZ diabetic not irradiated rats. The prolonged administration of lupine suspension before STZ induction of diabetic and/or irradiated rats reduced the changes in the level of blood glucose, insulin concentration, liver glycogen, and the activity of glucose-6-phosphatase associated with significant amelioration in blood antioxidant status (superoxide dismutase, SOD; catalase, CAT; glucose-6-phosphate dehydrogenase, G-6-PD activities and reduced glutathione concentration GSH). Also, the level of blood lipid peroxides (TBARS) were reduced greatly when compared with its matched value in diabetic and /or gamma irradiated rats. It could be postulated that lupine powder suspension might be attenuate the diabetic profile development throughout reducing oxidative damages and modulating the antioxidant status. In addition, lupine could be considered as one of a remarkable radio protective agent owing to its antioxidants property

  1. Maize-common bean/lupine intercrop productivity and profitability in ...

    African Journals Online (AJOL)

    Phaseolus vulgaris L.), narrow-leaf lupine (Lupinus angustifolius L.), and white lupine (Lupinus albus L.) with maize (Zea mays L.) were conducted under two intercrop planting arrangements (IPA), single row of legume in between maize rows and ...

  2. Citrus tristeza virus: An increasing trend in the virus occurrence and ...

    African Journals Online (AJOL)

    ABC

    2015-07-29

    Jul 29, 2015 ... Citrus tristeza clostervirus (CTV) is one of the most damaging fruit viruses playing havoc in citrus ... diseases of citrus trees reported in Pakistan are tristeza, .... bark. Vein clearing and stem pitting were also observed on sweet orange trees sour ..... disposal of source of inoculum by removing old citrus trees ...

  3. QUALITY AND SENSORY EVALUATIONS OF TEMPE PREPARED FROM VARIOUS PARTICLE SIZES OF LUPIN BEANS [Evaluasi Sensorik dan Kualitas Tempe dari Kacang Lupin Berbagai Ukuran Partikel

    Directory of Open Access Journals (Sweden)

    Sri Priatni*

    2013-12-01

    Full Text Available Tempe is an Indonesian fermented soy bean, produced by using mainly Rhizopus oligosporus. Diversification of tempe raw materials is required for better food security, e.g., using lupin. The potency of lupin bean has been studied as a substitute of soy in tempe production. Nutritionally, lupin bean offers additional advantages over soy bean, i.e., it has a lower level of many anti-nutritional factors (ANFs but contains higher protein (32-36% than most pulses. The objectives of this study were to select the most suitable lupin bean from different particle sizes for tempe production and to characterize the quality of lupin tempe. In this study, the lupin tempe samples were analyzed for moisture content, firmness, aroma, and the total count of colony after 1 and 2 days of fermentation. Sensory evaluation was conducted by 17 Indonesian untrained panelists (hedonic in three different days. The data were evaluated statistically using General Linear Model (GLM and Tukey’s Honest Significant Difference (HSD. Results showed that the moisture content of lupin tempe ranged from 60 to 66%, higher than that of soy tempe (58.90%. Meanwhile, the firmness of lupin tempe was between 21.38-30.89 N. Mostly, tempes which were produced from ≤50% of particles sized ≥5 mm (L3, L5 and L6 exhibited poor quality in terms of firmness and aroma. The mean of total count of colony in lupin tempe were 3.0x104 CFU/g, lower than that of soy tempe (218x103 CFU/g, indicating a slower growth of mycelia on lupin beans. However, the overall acceptability of lupin tempe which was prepared from whole beans (L4 and L7 was not significantly different from that of soy tempe. Based on these quality and sensory tests, lupin tempe using whole lupin beans was recommended for substitute of soy bean in tempe production.

  4. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  5. Evaluation of total polyphenol content and antioxidant capacity of different verity lupin seeds

    Directory of Open Access Journals (Sweden)

    Ismael Sulaiman Dalaram

    2017-01-01

    Full Text Available Legumes, including lupins, beans, lentil and chickpea, are one of the most important crops in the world because of their nutritional quality. Lupin seeds have been used as human food and animal feed since ancient times. It was known that antioxidant photochemical in foods have many health benefits including prevention of various diseases associated with oxidative stress such as cancer, cardiovascular disease, neuro-degeneration and diabetes. Lupin grains are rich sources of complex carbohydrates, protein, vitamins and minerals. Antioxidants can be found naturally in foods. Total polyphenols content and antioxidant activity were measured in four varieties of lupin, namely in white lupin, blue lupin, yellow lupin and Mutabilis lupin species. A majority of antioxidants naturally present in foods occur in phenolic structures and especially in flavonoid structures. The content of the total polyphenols was determined by using the Folin-Ciocalteu reagent (FCR. Antioxidant activity was measured by using a compound DPPH˙ (2.2-diphenyl-1-picrylhydrazyl. In the present experiment according to the average contents of total polyphenols (TPC in dry matter of lupin seeds there was the following line: L. Angustifolius (blue lupin (696.212 mg GAE.100g-1 > L. Albus (white lupin (614.13 mg GAE.100g-1 > L. Luteus (yellow lupin (467.78 mg GAE.100g-1 > L. Mutabilis (pearl lupin (367.36 mg GAE.100g-1. Based on the measured values of total antioxidant capacity (TAC of lupin samples can be classified as follows: L. Albus (white lupin (43.44% >L. Angustifolius (blue lupin (38.27% >L. Luteus (yellow lupin (22.29% >L. Mutabilis (Pearl lupin (20.80%. The relationship of antioxidant capacity with total polyphenolic was discussed. According to used statistical analyzes. Correlation between the phenolic contents and antioxidant capacity was significantly positive (r = 0.88. Our results confirmed that legumes can be a good source of bioactive compounds in the human nutrition

  6. Preparation of functional lupine protein fractions by dry separation

    NARCIS (Netherlands)

    Pelgrom, P.J.M.; Berghout, J.A.M.; Goot, van der A.J.; Boom, R.M.; Schutyser, M.A.I.

    2014-01-01

    Lupine protein concentrate is a promising ingredient that can be obtained by a combination of milling and air classification, generally called dry fractionation. This is a more sustainable route than conventional wet extraction and delivers a protein concentrate with native functional properties.

  7. Development and validation of an LC-MS/MS method for the detection of phomopsin A in lupin and lupin-containing retail food samples from the Netherlands

    NARCIS (Netherlands)

    Nijs, de W.C.M.; Pereboom-de Fauw, D.P.K.H.; Dam, van R.C.J.; Rijk, de T.C.; Egmond, van H.P.; Mol, J.G.J.

    2013-01-01

    Phomopsins (PHO) are mycotoxins produced by the fungus Diaporthe toxica (also referred to as Phomopsis leptostromiformis). Lupin is the most important host crop for this fungus and PHO are suspected as cause of lupinosis, a deadly liver disease, in sheep. Lupin is currently in use to replace

  8. Chemical and nutritional changes in bitter and sweet lupin seeds (Lupinus albus L.) during bulgur production

    OpenAIRE

    Yorgancilar, Mustafa; Bilgiçli, Nermin

    2012-01-01

    In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p 

  9. Effect of Chernobyl radionuclides accumulation on the photosynthetic processes and nitrogen metabolism of Lupines Luteus L

    International Nuclear Information System (INIS)

    Zabolotnyj, A.I.; Goncharova, N.V.; Domash, V.I.; Sheverdov, V.V.; Akadehmiya Navuk Belarusi, Minsk

    1995-01-01

    The 134 Cs, 137 Cs and chlorophyll content activity of photochemical reaction in chloroplasts and symbiotic nitrogen fixation in root modules, activity of neutral protease, BAPAse and trypsin inhibitors were investigated for seeds to yellow lupine (Lupines luteus L). The level of radioactive contamination induced a tendency to change the activity of photosynthetic reaction and nitrogen fixation, significant changes in a set of trypsin inhibitors were found in nature lupine seeds

  10. Bread making properties of wheat flour supplemented with thermally processed hypoallergenic lupine flour

    Energy Technology Data Exchange (ETDEWEB)

    Guillamon, E.; Cuadrado, C.; Pedrosa, M. M.; Varela, A.; Cabellos, B.

    2010-07-01

    In recent years there has been increased interest in using lupine for human nutrition due to its nutritional properties and health benefits. Moreover, lupine is used as an ingredient in bread making because of its functional and technological properties. However, a higher number of allergic reactions to this legume have recently been reported as a consequence of a more widespread consumption of lupine-based foods. In a previous study, several thermal treatments were applied to lupine seeds and flours resulting in reduced allergenicity. In order to study how this thermal processing (autoclaving and boiling) affects the bread making properties, raw and thermally processed lupine flours were used to replace 10% of wheat flour. The effect of supplementing wheat flour with lupine flour on physical dough properties, bread structure and sensory characteristics were analysed. The results indicated that thermally-treated lupine flours, had similar bread making and sensorial properties as untreated lupine flour. These thermal treatments could increase the potential use of lupine flour as a food ingredient while reducing the risk to provoke allergic reactions. (Author) 36 refs.

  11. Phenotypic, Molecular, and Pathological Characterization of Colletotrichum acutatum Associated with Andean Lupine and Tamarillo in the Ecuadorian Andes

    NARCIS (Netherlands)

    Falconi, C.; Visser, R.G.F.; Heusden, van A.W.

    2013-01-01

    Anthracnose is a serious problem of both Andean lupine and tamarillo in Ecuador. Morphological features, internal transcribed spacer (ITS) sequences, and host specificity were used to characterize Colletotrichum isolates from lupine and tamarillo. Based on phenotypic and molecular characterization,

  12. Lupin seed meal (Lupinus albus cv. Buttercup) as a source of ...

    African Journals Online (AJOL)

    (teen 'n 8%-insluitingspell) as gedeeltelike vervanger vir volvetsojabone, te evalueer. Die ... lupins, digestibility, N retention, growth, alkaloids, pigs. Introduction. Lupin-seed has been used extensively in pig diets ... meal, but at higher levels both growth rate and feed conversion efficiency were significantly depressed. Feed.

  13. Evaluation of thermal, chemical, and mechanical seed scarification methods for 4 Great Basin lupine species

    Science.gov (United States)

    Covy D. Jones; Mikel R. Stevens; Von D. Jolley; Bryan G. Hopkins; Scott L. Jensen; Dave Turner; Jason M. Stettler

    2016-01-01

    Seeds of most Great Basin lupine (Lupinus spp. [Fabaceae]) species are physically dormant and thus, difficult to establish in uniform stands in seed production fields. We designed this study to examine 5 seed scarification techniques, each with 11 levels of application (including a non-scarified control), to reduce the physical seed dormancy of longspur lupine...

  14. Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice

    Directory of Open Access Journals (Sweden)

    Alexandra Schutkowski

    2015-03-01

    A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein (p < 0.05. Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups (p < 0.05. In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.

  15. Hereditary dwarfism in yellow lupin (Lupinus luteus L

    Directory of Open Access Journals (Sweden)

    Tadeusz Kazimierski

    2015-01-01

    Full Text Available A dwarf plant was found in the F4 generation of a hybrid between two yellow lupin subspecies. Genetic analysis demonstrated that the dwarf grwoth is conditioned by one recessive factor which was named nanus. This factor acts pleiotroipically since it reduces the height, changes the morphological structure and some anatomical traits and reduces fertility in the dwarf plants. It is believed that in the chromosome with translocation a gene block arose in the F4, plant. These genes acting as a compact system cause dwarfism, changes in the anatomical structure and reduce fertility.

  16. Congenital deformity in calves induced by the maternal consumption of lupin

    Energy Technology Data Exchange (ETDEWEB)

    Shupe, J.L.; Binns, W.; James, L.F.; Keeler, R.F.

    1968-01-01

    A congenital skeletal deformity called crooked calf syndrome occurs in many of the beef cattle-producing areas of the western United States. This deformity is characterized by arthrogryposis, torticollis, scoliosis, and cleft palate. The condition is non-hereditary, and is due to the consumption of lupin by the dam. The most severe and characteristic deformities are produced between the 40th and 70th days of gestation. Experimental analyses were performed to ascertain the teratogenic effect of lupin plants, lupin and lead, and lead alone upon cattle.

  17. Lupines, manganese, and devil-sickness: an Anglo-Saxon medical response to epilepsy.

    Science.gov (United States)

    Dendle, P

    2001-01-01

    The most frequently prescribed herb for "devil-sickness" in the vernacular medical books from Anglo-Saxon England, the lupine, is exceptionally high in manganese. Since manganese depletion has been linked with recurring seizures in both clinical and experimental studies, it is possible that lupine administration responded to the particular pathophysiology of epilepsy. Lupine is not prescribed for seizures in classical Mediterranean medical sources, implying that the Northern European peoples (if not the Anglo-Saxons themselves) discovered whatever anticonvulsive properties the herb may exhibit.

  18. Effect of lupine as cheese base substitution on technological and nutritional properties of processed cheese analogue.

    Science.gov (United States)

    Awad, Rezik Azab; Salama, Wafaa Mohammed; Farahat, Azza Mahmoud

    2014-01-01

    Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artificial, extruded, synthetic and/or filled. Processed cheese can be formulated using different types of cheese with different degree of maturation, flavorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). Matured Ras cheese (3 months old) was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fine paste and kept frozen until used. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and firmness of products. Feeding rats a balanced diet containing processed cheese

  19. Nutritional, Health, and Technological Functionality of Lupin Flour Addition to Bread and Other Baked Products: Benefits and Challenges.

    Science.gov (United States)

    Villarino, C B J; Jayasena, V; Coorey, R; Chakrabarti-Bell, S; Johnson, S K

    2016-01-01

    Lupin is an undervalued legume despite its high protein and dietary fiber content and potential health benefits. This review focuses on the nutritional value, health benefits, and technological effects of incorporating lupin flour into wheat-based bread. Results of clinical studies suggest that consuming lupin compared to wheat bread and other baked products reduce chronic disease risk markers; possibly due to increased protein and dietary fiber and bioactive compounds. However, lupin protein allergy has also been recorded. Bread quality has been improved when 10% lupin flour is substituted for refined wheat flour; possibly due to lupin-wheat protein cross-linking assisting bread volume and the high water-binding capacity (WBC) of lupin fiber delaying staling. Above 10% substitution appears to reduce bread quality due to lupin proteins low elasticity and the high WBC of its dietary fiber interrupting gluten network development. Gaps in understanding of the role of lupin flour in bread quality include the optimal formulation and processing conditions to maximize lupin incorporation, role of protein cross-linking, antistaling functionality, and bioactivity of its γ-conglutin protein.

  20. Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice.

    Science.gov (United States)

    Schutkowski, Alexandra; Hirche, Frank; Geissler, Stefanie; Radtke, Juliane; Stangl, Gabriele I

    2015-03-01

    Lupin proteins have repeatedly been shown to exhibit lipid lowering properties and reduce aortic calcification in atherosclerosis models. Despite many efforts on its identification, the component which is responsible for the observed effects is still under debate. Phytic acid which is generally associated with lupin protein isolates has currently been described as bioactive plant compound. The objective of the study was to determine the role of associated phytic acid for the described lupin protein effects. A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein ( p  < 0.05). Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups ( p  < 0.05). In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.

  1. Introduction of novel legume crops in Serbia: White lupin (Lupinus albus

    Directory of Open Access Journals (Sweden)

    Mikić Aleksandar

    2010-01-01

    Full Text Available The renewed interest in introducing white lupin in Serbia is its high crude protein content in grain dry matter of nearly 400 g kg-1, which makes it a potential supplement for soybean meal in animal feeding. The only collection of white and other lupins in Serbia is maintained at Institute of Field and Vegetable Crops in Novi Sad, with about 200 accessions of 10 species, containing about 70 accessions of white lupin. The accessions with high tolerance to alkaline soil reaction of about pH=8 in a carbonated chernozem in Novi Sad regularly formed two orders of pods and grains and produced grain yields of more than 5 t ha-1, 45 t ha-1 of green forage and 8 t ha-1 of forage dry matter. The first Serbian white lupin breeding programme carried out at Institute of Field and Vegetable Crops in Novi Sad has resulted in developing cultivars Vesna and Panorama, registered in 2008. .

  2. Lupin seed (Lupinus albus and Lupinus luteus) as a protein source for fermentation use

    DEFF Research Database (Denmark)

    Jul, L.B.; Flengmark, Poul Kristiansen; Gylling, M.

    2003-01-01

    and substances known to inhibit or activate fermentation processes. For three chosen varieties (Juno, Borsaja (yellow lupins) and Amiga (white lupin)) fermentation tests were performed each year in laboratory fermentors. Three different fermentation models were applied: production of amylase by Aspergillus...... led to yields similar to those of soybean meal as a protein source though there were minor differences between the model fermentations with regard to the best protein source. The conclusion of the fermentation tests is that dehulled and ground lupin seed is a suitable substitute for soybean meal...... oryzae and by Bacillus amyloliquefaciens, and production of protease by B. amyloliquefaciens. In all cases the fermentation yields were compared with the yields of similar fermentations carried out with soybean meal as the source of protein. The use of lupins as a protein source in fermentation trials...

  3. LUPIN, a new instrument for pulsed neutron fields

    Energy Technology Data Exchange (ETDEWEB)

    Caresana, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); Ferrarini, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); CNAO, Via Privata Campeggi, 27100 Pavia (Italy); Manessi, G.P., E-mail: giacomo.paolo.manessi@cern.ch [CERN, 1211 Geneva 23 (Switzerland); University of Liverpool, Department of Physics, L69 7ZE Liverpool (United Kingdom); Silari, M. [CERN, 1211 Geneva 23 (Switzerland); Varoli, V. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy)

    2013-06-01

    A number of studies focused in the last decades on the development of survey meters to be used in pulsed radiation fields. This is a topic attracting widespread interest for applications such as radiation protection and beam diagnostics in accelerators. This paper describes a new instrument specifically conceived for applications in pulsed neutron fields (PNF). The detector, called LUPIN, is a rem counter type instrument consisting of a {sup 3}He proportional counter placed inside a spherical moderator. It works in current mode with a front-end electronics consisting of a current–voltage logarithmic amplifier, whose output signal is acquired with an ADC and processed on a PC. This alternative signal processing allows the instrument to be used in PNF without being affected by saturation effects. Moreover, it has a measurement capability ranging over many orders of burst intensity. Despite the fact that it works in current mode, it can measure a single neutron interaction. The LUPIN was first calibrated in CERN's calibration laboratory with a PuBe source. Measurements were carried out under various experimental conditions at the Helmholtz-Zentrum in Berlin, in the stray field at various locations of the CERN Proton Synchrotron complex and around a radiotherapy linear accelerator at the S. Raffaele hospital in Milan. The detector can withstand single bursts with values of H⁎(10) up to 16 nSv/burst without showing any saturation effect. It efficiently works in pulsed stray fields, where a conventional rem-counter underestimates by a factor of 2. It is also able to reject the very intense and pulsed photon contribution that often accompanies the neutron field with good reliability. -- Highlights: ► LUPIN is a new detector specifically conceived to work in neutron pulsed fields. ► The detector is a rem counter type instrument working in current mode. ► The performances of the detectors were studied under various experimental conditions. ► The detector

  4. Shaping of the fungal communities isolated from yellow lupin seeds (Lupinus luteus L. throughout storage time

    Directory of Open Access Journals (Sweden)

    Bożena Cwalina-Ambroziak

    2012-12-01

    Full Text Available The object of the experiment were seeds of two traditional cultivars of yellow lupin (Juno and Amulet cultivated in 1999 in two crop-rotation with 20% and 33% yellow lupine contribution. The quantitative and qualitative composition of the fungal community colonizing the seeds were determined in the laboratory conditions after 0.5-, 1.5- and 2.5-year of storage time. In total 1077 fungal colonies were isolated from the lupin seeds. Fungi representing the species of Penicillium - 29.3%, Alternaria alternata - 26.7% and Rhizopus nigricans - 12.7% were isolated most widely. Among the fungi pathogenic to lupin, the species of Colletotrichum gloeosporioides (16.3% isolates was dominant. The crop rotation with 20% lupin reduced the number of fungal colonies colonizing the seeds including the pathogens from the species of C. gloeosporioides. Seed disinfection decreased the total number of fungal colonies isolated from both cultivars. Higher number of C. gloeosporioides isolates was found in the combination with disinfected seeds. More fungal colonies were obtained from seeds of cv. Amulet than from those of cv. Juno. The storage duration had an effect on the population and the composition of species of fungi isolated from seeds of yellow lupine. With longer storage population of Penicillium spp. and Rhizopus spp. increased, whereas the population of C. gloeosporioides decreased.

  5. Proteomics for exploiting diversity of lupin seed storage proteins and their use as nutraceuticals for health and welfare.

    Science.gov (United States)

    Cabello-Hurtado, Francisco; Keller, Jean; Ley, José; Sanchez-Lucas, Rosa; Jorrín-Novo, Jesús V; Aïnouche, Abdelkader

    2016-06-30

    Lupins have a variety of both traditional and modern uses. In the last decade, reports assessing the benefits of lupin seed proteins have proliferated and, nowadays, the pharmaceutical industry is interested in lupin proteins for human health. Modern genomics and proteomics have hugely contributed to describing the diversity of lupin storage genes and, above all, proteins. Most of these studies have been centered on few edible lupin species. However, Lupinus genus comprises hundreds of species spread throughout the Old and New Worlds, and these resources have been scarcely explored and exploited. We present here a detailed review of the literature on the potential of lupin seed proteins as nutraceuticals, and the use of -omic tools to analyze seed storage polypeptides in main edible lupins and their diversity at the Lupinus inter- and intra-species level. In this sense, proteomics, more than any other, has been a key approach. Proteomics has shown that lupin seed protein diversity, where post-translational modifications yield a large number of peptide variants with a potential concern in bioactivity, goes far beyond gene diversity. The future extended use of second and third generation proteomics should definitely help to go deeper into coverage and characterization of lupin seed proteome. Some important topics concerning storage proteins from lupin seeds are presented and analyzed in an integrated way in this review. Proteomic approaches have been essential in characterizing lupin seed protein diversity, which goes far beyond gene diversity since the protein level adds to the latter differential proteolytic cleavage of conglutin pro-proteins and a diverse array of glycosylation forms and sites. Proteomics has also proved helpful for screening and studying Lupinus germplasm with the future aim of exploiting and improving food production, quality, and nutritional values. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. A first glimpse of wild lupin karyotype variation as revealed by comparative cytogenetic mapping

    Directory of Open Access Journals (Sweden)

    Karolina Susek

    2016-07-01

    Full Text Available Insight into plant genomes at the cytomolecular level provides useful information about their karyotype structure, enabling inferences about taxonomic relationships and evolutionary origins. The Old World lupins demonstrate a high level of genomic diversification involving variation in chromosome numbers (2n=32-52, basic chromosome numbers (x=5-7, 9, 13 and in nuclear genome size (2C DNA=0.97-2.68 pg. Lupins comprise both crop and wild species and provide an intriguing system to study karyotype evolution.In order to investigate lupin chromosome structure, heterologous FISH was used. Sixteen BACs that had been generated as chromosome markers for the reference species, Lupinus angustifolius, were used to identify chromosomes in the wild species and explore karyotype variation. While all ‘single-locus’ in L. angustifolius, in the wild lupins these clones proved to be ‘single-locus’, ‘single-locus’ with additional signals, ‘repetitive’ or had no detectable BAC-FISH signal. The diverse distribution of the clones in the targeted genomes suggests a complex evolution history, which possibly involved multiple chromosomal changes such as fusions/fissions and repetitive sequence amplification. Twelve BACs were sequenced and we found numerous transposable elements including DNA transposons as well as LTR and non-LTR retrotransposons with varying quantity and composition among the different lupin species. However, at this preliminary stage, no correlation was observed between the pattern of BAC-FISH signals and the repeat content in particular BACs. Here, we describe the first BAC-based chromosome-specific markers for the wild species: L. cosentinii, L. cryptanthus, L. pilosus, L. micranthus and one New World lupin, L. multiflorus. These BACs could constitute the basis for an assignment of the chromosomal and genetic maps of other lupins, e.g. L. albus and L. luteus. Moreover, we identified karyotype variation that helps illustrate the

  7. Comparison of fermentation profiles between lupine and soybean by Aspergillus oryzae and Aspergillus sojae in solid-state culture systems

    NARCIS (Netherlands)

    Sardjono; Zhu, Y.; Knol, W.

    1998-01-01

    To explore the possibilities of using lupine as a soybean replacement in fermented foods, fermentation profiles of lupine and soybean by Aspergillus oryzae and A. sojae, respectively, in a solid-state culture were compared. Biomass, spore concentration, oxygen consumption rate, carbon dioxide

  8. Transcript and proteomic analysis of developing white lupin (Lupinus albus L. roots

    Directory of Open Access Journals (Sweden)

    Watson Bonnie

    2009-01-01

    Full Text Available Abstract Background White lupin (Lupinus albus L. roots efficiently take up and accumulate (heavy metals, adapt to phosphate deficiency by forming cluster roots, and secrete antimicrobial prenylated isoflavones during development. Genomic and proteomic approaches were applied to identify candidate genes and proteins involved in antimicrobial defense and (heavy metal uptake and translocation. Results A cDNA library was constructed from roots of white lupin seedlings. Eight thousand clones were randomly sequenced and assembled into 2,455 unigenes, which were annotated based on homologous matches in the NCBInr protein database. A reference map of developing white lupin root proteins was established through 2-D gel electrophoresis and peptide mass fingerprinting. High quality peptide mass spectra were obtained for 170 proteins. Microsomal membrane proteins were separated by 1-D gel electrophoresis and identified by LC-MS/MS. A total of 74 proteins were putatively identified by the peptide mass fingerprinting and the LC-MS/MS methods. Genomic and proteomic analyses identified candidate genes and proteins encoding metal binding and/or transport proteins, transcription factors, ABC transporters and phenylpropanoid biosynthetic enzymes. Conclusion The combined EST and protein datasets will facilitate the understanding of white lupin's response to biotic and abiotic stresses and its utility for phytoremediation. The root ESTs provided 82 perfect simple sequence repeat (SSR markers with potential utility in breeding white lupin for enhanced agronomic traits.

  9. Intercropping with white lupin (Lupinus albus L.); a promising tool for phytoremediation and phytomining research

    Science.gov (United States)

    Wiche, Oliver; Székely, Balazs; Moschner, Christin; Heilmeier, Hermann

    2015-04-01

    In recent studies root-soil interactions of white lupine (Lupinus albus L.) have drawn special attention to researchers due to its particularly high potential to increase bioavailability of phosphorous (P) and trace nutrients in soils. In mixed cultures, white lupine has the ability to mobilize P and trace nutrients in soil in excess of its own need and make this excess available for other intercropped companion species. While improved acquisition of P and improved yield parameters have mostly been documented in cereal-lupine intercrops, compared to sole crops, only a few recent studies have evidenced similar effects for trace elements e.g. Fe, Zn and Mn. In this preliminary study we tried to obtain more information about the mobilization of trace elements due to intercropping under field conditions. We hypothesize, that processes that lead to a better acquisition of trace nutrients might also affect other trace elements what could be useful for phytoremediation and phytomining research. Here we report the results of a semi-field experiment were we investigated the effects of an intercropping of white lupine with oat (Avena sativa L.) on the concentrations of trace metals in shoots of oat. We investigated the effects on 12 trace elements, including 4 elements with relevance for plant nutrition (P, Fe, Mn, Zn) and 8 trace elements, belonging to the group of metalloids, lanthanides and actinides with high relevance in phytoremediation (Cd, Pb Th, U) and phytomining research (Sc, La, Nd, Ge). The experiment was carried out on a semi-field lysimer at the off-site soil recycling and remediation center in Hirschfeld (Saxony, Germany). To test the intercropping-dependent mobilization of trace metals in soil and enhanced uptake of elements by oat, white lupine and oat were cultivated on 20 plots (4 m² each) in monocultures and mixed cultures and two different white lupin /oat-ratios (11% and 33%, respectively) applying various treatments. The geometrical arrangement of

  10. Ileal digestibility of sunfl ower meal, pea, rapeseed cake, and lupine in pigs

    DEFF Research Database (Denmark)

    Nørgaard, Jan Værum; Fernández, José Adalberto; Jørgensen, Henry

    2012-01-01

    .05) for soybean meal and pea compared to sunfl ower meal, rapeseed cake, and lupine. The SID of Lys and His were lowest (P pea to be a high-digestible protein source relative to sunfl ower......The standardized ileal digestibility (SID) of CP and AA was evaluated in soybean (Glycine max) meal, sunfl ower (Helianthus annuus) meal, rapeseed cake, and fi eld pea (Pisum sativum) using 10 pigs and in lupine (Lupinus angustifolius) using 7 pigs. Pigs were fi tted with either a T...

  11. Molecular genetic diversity and population structure of Ethiopian white lupin landraces: Implications for breeding and conservation

    Science.gov (United States)

    Yao, Nasser; Martina, Kyalo; Dagne, Kifle; Wegary, Dagne; Tesfaye, Kassahun

    2017-01-01

    White lupin is one of the four economically important species of the Lupinus genus and is an important grain legume in the Ethiopian farming system. However, there has been limited research effort to characterize the Ethiopian white lupin landraces. Fifteen polymorphic simple sequence repeat (SSR) markers were used to assess the genetic diversity and population structure of 212 Ethiopian white lupin (Lupinus albus) landraces and two genotypes from different species (Lupinus angustifolius and Lupinus mutabilis) were used as out-group. The SSR markers revealed 108 different alleles, 98 of them from 212 landraces and 10 from out-group genotypes, with an average of 6.5 alleles per locus. The average gene diversity was 0.31. Twenty eight landraces harbored one or more private alleles from the total of 28 private alleles identified in the 212 white lupin accessions. Seventy-seven rare alleles with a frequency of less than 5% were identified and accounted for 78.6% of the total alleles detected. Analysis of molecular variance (AMOVA) showed that 92% of allelic diversity was attributed to individual accessions within populations while only 8% was distributed among populations. At 70% similarity level, the UPGMA dendrogram resulted in the formation of 13 clusters comprised of 2 to 136 landraces, with the out-group genotypes and five landraces remaining distinct and ungrouped. Population differentiation and genetic distance were relatively high between Gondar and Ethiopian white lupin populations collected by Australians. A model-based population structure analysis divided the white lupin landraces into two populations. All Ethiopian white lupin landrace populations, except most of the landraces collected by Australians (77%) and about 44% from Awi, were grouped together with significant admixtures. The study also suggested that 34 accessions, as core collections, were sufficient to retain 100% of SSR diversity. These accessions (core G-34) represent 16% of the whole 212

  12. NODULATION OF YELLOW LUPIN (Lupinus luteus L. DEPENDING ON THE FORECROP, SEED INOCULATION WITH Bradyrhizobium lupini AND GENISTEIN

    Directory of Open Access Journals (Sweden)

    Janusz PRUSIŃSKI

    2012-12-01

    Full Text Available A strict two-factor field ‘Mister’ yellow lupin experiment was made in a split-plot design in poor rye complex soil (soil valuation class IVb at the Experiment Station of the Faculty of Agriculture and Biotechnology, the University of Technology and Life Sciences at Mochełek over 2008-2011. The experiment design covered 2 factors: growing yellow lupin after intercrops of ‘Bardena’ white mustard and ‘Pastar’ winter rye as well as seed inoculation with Bradyrhizobium lupini with or without genistein added. Growing intercrops in the poor rye complex soil considerably decreased neither the Nmin content in early spring nor the size of nodulation in yellow lupin. After lupin harvest, slightly more Nmin was noted for the treatments where intercrops were applied, especially rye in the 0-30 cm layer. The weather pattern, especially moisture conditions, pointed to a special sensitivity of nodulation to water deficit or excess in the rhizosphere. The method of preparing seeds for sowing did not play a greater role in developing the Nmin content in both soil profile layers analysed. White mustard showed a negative effect on the dry weight of nodules and the total N content in the plants and the seeds of yellow lupin as well as created the least favourable conditions for the survival and the capacity for symbiosis by symbiotic bacteria remaining in soil after lupin harvest. The state of yellow lupin plant nitrogen nutrition did not depend on the experimental factors.

  13. Hypocholesterolaemic effects of lupin protein and pea protein/fibre combinations in moderately hypercholesterolaemic individuals.

    Science.gov (United States)

    Sirtori, Cesare R; Triolo, Michela; Bosisio, Raffaella; Bondioli, Alighiero; Calabresi, Laura; De Vergori, Viviana; Gomaraschi, Monica; Mombelli, Giuliana; Pazzucconi, Franco; Zacherl, Christian; Arnoldi, Anna

    2012-04-01

    The present study was aimed to evaluate the effect of plant proteins (lupin protein or pea protein) and their combinations with soluble fibres (oat fibre or apple pectin) on plasma total and LDL-cholesterol levels. A randomised, double-blind, parallel group design was followed: after a 4-week run-in period, participants were randomised into seven treatment groups, each consisting of twenty-five participants. Each group consumed two bars containing specific protein/fibre combinations: the reference group consumed casein+cellulose; the second and third groups consumed bars containing lupin or pea proteins+cellulose; the fourth and fifth groups consumed bars containing casein and oat fibre or apple pectin; the sixth group and seventh group received bars containing combinations of pea protein and oat fibre or apple pectin, respectively. Bars containing lupin protein+cellulose ( - 116 mg/l, - 4·2%), casein+apple pectin ( - 152 mg/l, - 5·3%), pea protein+oat fibre ( - 135 mg/l, - 4·7%) or pea protein+apple pectin ( - 168 mg/l, - 6·4%) resulted in significant reductions of total cholesterol levels (Ppea protein+cellulose. The present study shows the hypocholesterolaemic activity and potential clinical benefits of consuming lupin protein or combinations of pea protein and a soluble fibre, such as oat fibre or apple pectin.

  14. The Effect of Lupin (Lupinus Angustifolius Supplementation on Adaptation of Ewes after Short Transport Stress

    Directory of Open Access Journals (Sweden)

    Sopková D.

    2016-03-01

    Full Text Available Vehicle transportation represents acute stress to animals with release of catecholamines and glucocorticoids from the adrenal gland resulting in impaired metabolic state. Such changes in metabolism may be reduced by the application of suitable feed supplement. The aim of this study was to test the effects of lupin supplementation applied after 1-hour transportation. Ewes in the control group (n = 7 were fed on trefoil-grass silage and hay, while the diet of the experimental group (n = 7 was supplemented with lupin groats (Lupinus angustifolius, var. SONET; 500 g per head per day for 8 days. In both groups, blood was collected on the day of transportation and on Days 6 and 11 thereafter. Total blood parameters were assayed using spectrophotometry and fractions of protein, cholesterol, and lactate dehydrogenase using agarose electrophoresis. Lupin increased the albumin: globulin (ALB : GLB ratio and beta-hydroxybutyrate (BHB concentration and reduced serum cholesterol and lactate, however it had no effect on body weight, body condition score (BCS, plasma glucose, serum protein, high-density lipoprotein (HDL, low-density lipoprotein (LDL, and very low-density lipoprotein (VLDL cholesterol, lactate dehydrogenase (LDH or alkaline phosphatise (ALP. Lupin may therefore be used as suitable feed supplement for sheep at times of high nutrient requirement.

  15. Influence of bitter lupin on consumption and digestibility in organic dairy cattle soya bean free diets

    Directory of Open Access Journals (Sweden)

    R. Tocci

    2010-04-01

    Full Text Available One of the main principles of organic husbandry is that animal feed must be GMO free, and soya bean is well-known as a high risk GMO alimentary source. About 25 dry dairy cattle of the Italian Holstein breed, from the Cooperativa Emilio Sereni of Borgo S. Lorenzo (FI, were fed in two successive diets: the first with extruded soya bean (A, and the second in which bitter lupin, faba bean and proteinic pea substituted the soya bean (B. We evaluated both the consumption and the apparent digestibility (using acid insoluble ash as internal marker of the two diets, repeating the trial twice. The presence of bitter lupin did not influence either the consumption of other feed, or the faecal water content. The apparent digestibility of the organic matter resulted satisfactory in both the diets, but was significantly higher in diet (A than in diet (B (71,6% vs 67,3%. In conclusion, even though we wish the cultivation of sweet lupin would be increase in Italy, we retain that also bitter lupin (mixed with other feed to increase the palatability could be used as alternative protein source in dairy cattle diets.

  16. Lupines, poison-hemlock and Nicotiana spp: toxicity and teratogenicity in livestock.

    Science.gov (United States)

    Panter, K E; James, L F; Gardner, D R

    1999-02-01

    Many species of lupines contain quinolizidine or piperidine alkaloids known to be toxic or teratogenic to livestock. Poison-hemlock (Conium maculatum) and Nicotiana spp. including N. tabacum and N. glauca contain toxic and teratogenic piperidine alkaloids. The toxic and teratogenic effects from these plant species have distinct similarities including maternal muscular weakness and ataxia and fetal contracture-type skeletal defects and cleft palate. It is believed that the mechanism of action of the piperidine and quinolizidine alkaloid-induced teratogenesis is the same; however, there are some differences in incidence, susceptible gestational periods, and severity between livestock species. Wildlife species have also been poisoned after eating poison-hemlock but no terata have been reported. The most widespread problem for livestock producers in recent times has been lupine-induced "crooked calf disease." Crooked calf disease is characterized as skeletal contracture-type malformations and occasional cleft palate in calves after maternal ingestion of lupines containing the quinolizidine alkaloid anagyrine during gestation days 40-100. Similar malformations have been induced in cattle and goats with lupines containing the piperidine alkaloids ammodendrine, N-methyl ammodendrine, and N-acetyl hystrine and in cattle, sheep, goats, and pigs with poison-hemlock containing predominantly coniine or gamma-coniceine and N. glauca containing anabasine. Toxic and teratogenic effects have been linked to structural aspects of these alkaloids, and the mechanism of action is believed to be associated with an alkaloid-induced inhibition of fetal movement during specific gestational periods. This review presents a historical perspective, description and distribution of lupines, poison-hemlock and Nicotiana spp., toxic and teratogenic effects and management information to reduce losses.

  17. The role of acid anion on the inhibition of the acidic corrosion of steel by lupine extract

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Gaber, A.M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)], E-mail: ashrafmoustafa@yahoo.com; Abd-El-Nabey, B.A.; Saadawy, M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)

    2009-05-15

    The inhibitive effect of lupine (Lupinous albus L.) extract on the corrosion of steel in aqueous solution of 1 M sulphuric and 2 M hydrochloric acids was investigated by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques. Potentiodynamic polarization curves indicated that the lupine extract acts as a mixed-type inhibitor. EIS measurements showed that the dissolution process is under activation control. The inhibition efficiency of the extract obtained from impedance and polarization measurements was in a good agreement and was found to increase with increasing concentration of the extract. The obtained results showed that, the lupine extract could serve as an effective inhibitor for the corrosion of steel in acid media and the extract was more effective in case of hydrochloric acid. Theoretical fitting of the corrosion data to the kinetic-thermodynamic model was tested to show the nature of adsorption.

  18. Solid state fermentation with lactic acid bacteria to improve the nutritional quality of lupin and soya bean.

    Science.gov (United States)

    Bartkiene, Elena; Krungleviciute, Vita; Juodeikiene, Grazina; Vidmantiene, Daiva; Maknickiene, Zita

    2015-04-01

    The ability of bacteriocin-like inhibitory substance (BLIS)-producing lactic acid bacteria (LAB) to degrade biogenic amines as well as to produce L(+) and D(-)-lactic acid during solid state fermentation (SSF) of lupin and soya bean was investigated. In addition, the protein digestibility and formation of organic acids during SSF of legume were investigated. Protein digestibility of fermented lupin and soya bean was found higher on average by 18.3% and 15.9%, respectively, compared to untreated samples. Tested LAB produced mainly L-lactic acid in soya bean and lupin (D/L ratio 0.38-0.42 and 0.35-0.54, respectively), while spontaneous fermentation gave almost equal amounts of both lactic acid isomers (D/L ratio 0.82-0.98 and 0.92, respectively). Tested LAB strains were able to degrade phenylethylamine, spermine and spermidine, whereas they were able to produce putrescine, histamine and tyramine. SSF improved lupin and soya bean protein digestibility. BLIS-producing LAB in lupin and soya bean medium produced a mixture of D- and L-lactic acid with a major excess of the latter isomer. Most toxic histamine and tyramine in fermented lupin and soya bean were found at levels lower those causing adverse health effects. Selection of biogenic amines non-producing bacteria is essential in the food industry to avoid the risk of amine formation. © 2014 Society of Chemical Industry.

  19. Characterization and mapping of LanrBo: a locus conferring anthracnose resistance in narrow-leafed lupin (Lupinus angustifolius L.).

    Science.gov (United States)

    Fischer, Kristin; Dieterich, Regine; Nelson, Matthew N; Kamphuis, Lars G; Singh, Karam B; Rotter, Björn; Krezdorn, Nicolas; Winter, Peter; Wehling, Peter; Ruge-Wehling, Brigitte

    2015-10-01

    A novel and highly effective source of anthracnose resistance in narrow-leafed lupin was identified. Resistance was shown to be governed by a single dominant locus. Molecular markers have been developed, which can be used for selecting resistant genotypes in lupin breeding. A screening for anthracnose resistance of a set of plant genetic resources of narrow-leafed lupin (Lupinus angustifolius L.) identified the breeding line Bo7212 as being highly resistant to anthracnose (Colletotrichum lupini). Segregation analysis indicated that the resistance of Bo7212 is inherited by a single dominant locus. The corresponding resistance gene was given the designation LanrBo. Previously published molecular anchor markers allowed us to locate LanrBo on linkage group NLL-11 of narrow-leafed lupin. Using information from RNAseq data obtained with inoculated resistant vs. susceptible lupin entries as well as EST-sequence information from the model genome Lotus japonicus, additional SNP and EST markers linked to LanrBo were derived. A bracket of two LanrBo-flanking markers allows for precise marker-assisted selection of the novel resistance gene in narrow-leafed lupin breeding programs.

  20. Short-Term Effects of Lupin vs. Whey Supplementation on Glucose and Insulin Responses to a Standardized Meal in a Randomized Cross-Over Trial.

    Science.gov (United States)

    Schopen, Kathrin; Ewald, Ann C; Johannes, Bernd W; Bloch, Wilhelm; Rittweger, Jörn; Frings-Meuthen, Petra

    2017-01-01

    Background: Whey protein is known to reduce postprandial glycaemia in people with type 2 diabetes mellitus. Lupin as a vegetable source of protein could be considered as an alternative, as the percentage of vegetarian and vegan consumers is raising. The present study compares the acute glycemic effects of whey and lupin in healthy volunteers following a carbohydrate-rich reference meal. Methods In cross-over design, three standardized meals (reference meal; reference meal + whey; reference meal + lupin) were provided to 12 healthy male and female volunteers, aged between 23 and 33, in a balanced, randomized order. Volunteers' blood glucose and insulin concentrations were analyzed at baseline and at seven time points following the ingestion of the meals. Results: The supplementation of whey or lupin significantly blunted the postprandial increase in blood glucose concentrations compared to the reference meal ( p AUC whey-lupin = 8%, 0-60 min area under the curve (0-60 min AUC), p = 0.937], with a blunting effect of -46% by whey ( p = 0.005, 0-60 min AUC) and of -54% by lupin ( p AUC). When comparing whey and lupin data only, the insulin increase was found to be more pronounced for whey protein than for lupin supplementation (Δ AUC whey-lupin = 39%, 0-60 min AUC, p = 0.022). However, when comparing the insulin response of each supplementation to the one of the reference meal, no differences could be detected (whey p = 0.259, 0-60 min AUC; lupin p = 0.275, 0-60 min AUC). Conclusions: Results suggest that lupin and whey can both lower the increase of postprandial blood glucose concentrations to a comparable extent, implying the usability of lupin to reduce postprandial glycaemia. However, the insulin response following the supplementations to a carbohydrate-rich meal seems to differ for these two protein sources.

  1. Effects of intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) on the mobility of target elements for phytoremediation and phytomining in soil solution.

    Science.gov (United States)

    Wiche, Oliver; Székely, Balazs; Kummer, Nicolai-Alexeji; Moschner, Christin; Heilmeier, Hermann

    2016-09-01

    This study aims to investigate how intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) affects the mobile fractions of trace metals (Fe, Mn, Pb, Cd, Th, U, Sc, La, Nd, Ge) in soil solution. Oat and white lupin were cultivated in monocultures and mixed cultures with differing oat/white lupin ratios (11% and 33% lupin, respectively). Temporal variation of soil solution chemistry was compared with the mobilization of elements in the rhizosphere of white lupin and concentrations in plant tissues. Relative to the monocrops, intercropping of oat with 11% white lupin significantly increased the concentrations of Fe, Pb, Th, La and Nd in soil solution as well as the concentrations of Fe, Pb, Th, Sc, La and Nd in tissues of oat. Enhanced mobility of the mentioned elements corresponded to a depletion of elements in the rhizosphere soil of white lupin. In mixed cultures with 33% lupin, concentrations in soil solution only slightly increased. We conclude that intercropping with 11% white lupin might be a promising tool for phytoremediation and phytomining research enhancing mobility of essential trace metals as well as elements with relevance for phytoremediation (Pb, Th) and phytomining (La, Nd, Sc) in soil.

  2. Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ...

    African Journals Online (AJOL)

    Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ( Lupizus albus cv. Kiev) as protein sources for ... P igsi n the metabolisrna ndN balance trial consurned5 % less( P < 0.01)o 1'thel upind ietc omparedto the fabab eand iet (l 370 vs. | 440 gld).N o significandt ift'erenceisn the digestiblee nergy( DE) contenta nd ...

  3. Microencapsulation by spray drying of nitrogen-fixing bacteria associated with lupin nodules.

    Science.gov (United States)

    Campos, Daniela C; Acevedo, Francisca; Morales, Eduardo; Aravena, Javiera; Amiard, Véronique; Jorquera, Milko A; Inostroza, Nitza G; Rubilar, Mónica

    2014-09-01

    Plant growth promoting bacteria and nitrogen-fixing bacteria (NFB) used for crop inoculation have important biotechnological potential as a sustainable fertilization tool. However, the main limitation of this technology is the low inoculum survival rate under field conditions. Microencapsulation of bacterial cells in polymer matrices provides a controlled release and greater protection against environmental conditions. In this context, the aim of this study was to isolate and characterize putative NFB associated with lupin nodules and to evaluate their microencapsulation by spray drying. For this purpose, 21 putative NFB were isolated from lupin nodules and characterized (16S rRNA genes). Microencapsulation of bacterial cells by spray drying was studied using a mixture of sodium alginate:maltodextrin at different ratios (0:15, 1:14, 2:13) and concentrations (15 and 30% solids) as the wall material. The microcapsules were observed under scanning electron microscopy to verify their suitable morphology. Results showed the association between lupin nodules of diverse known NFB and nodule-forming bacteria belonging to Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Bacteroidetes. In microencapsulation assays, the 1:14 ratio of sodium alginate:maltodextrin (15% solids) showed the highest cell survival rate (79%), with a microcapsule yield of 27% and spherical microcapsules of 5-50 µm in diameter. In conclusion, diverse putative NFB genera and nodule-forming bacteria are associated with the nodules of lupine plants grown in soils in southern Chile, and their microencapsulation by spray drying using sodium alginate:maltodextrin represents a scalable process to generate a biofertilizer as an alternative to traditional nitrogen fertilization.

  4. Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth

    Energy Technology Data Exchange (ETDEWEB)

    Shelp, B J; Kitheka, A M; Cauwenberghe, O.R. Van [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [Grand Forks Human Nutrition Research Center, Agricultural Research service, Grand Forks, ND (United States); Spiers, G A [Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)

    1998-12-01

    The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 {mu}M to 3.5 mM, with B being present at 2.9-3.5 {mu}M. For each element assayed, the concentration was higher in phloem exudate (1.6 {mu}M to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched {sup 10}B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both {sup 10}B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au) 35 refs.

  5. Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth

    International Nuclear Information System (INIS)

    Shelp, B.J.; Kitheka, A.M.; Cauwenberghe, O.R. Van; Vanderpool, R.A.; Spiers, G.A.

    1998-01-01

    The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 μM to 3.5 mM, with B being present at 2.9-3.5 μM. For each element assayed, the concentration was higher in phloem exudate (1.6 μM to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched 10 B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both 10 B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au)

  6. KINETICS OF EXTRACTION OF EXTRACTIVE SUBSTANCES FROM A LUPINE WITH VARIOUS GEOMETRICAL FORM

    Directory of Open Access Journals (Sweden)

    S. S. Ivanov

    2014-01-01

    Full Text Available Summary. Relevance of a subject is proved and the main directions of researches are defined. The research problem is formulated – to predict rate of decrease in a mass-containingf a firm phase and to establish functional connection of concentration of extract over time. Soy and lupine, as sources of valuable nutritious components are analysed. The soy shortcomings which chemical components are inhibitors of a number of digestive enzymes, such as pepsin and chymotrypsin are convincingly shown. The carbohydrate fraction of soy is rich with the oligosaccharides causing an intestinal meteorism. Therefore topical issue about replacement of soy with perspective leguminous culture – the lupine, deprived of the shortcomings inherent in soy. The structure and physical and chemical properties of subcheese serum is presented. The method of calculation of the average sizes of particles of raw materials of a sphere having a geometrical form, the cylinder and an unlimited plate is received. Results of research of kinetics of extraction from a lupine are given at various geometrical form of raw materials. The preferable shape of a body is defined at exhausting course of process of extraction of raw materials in the form of a plate. At the same time, other geometrical forms aren't denied as the form of crumbled, for example, is more technological in production. Graphic dependences are in details described and the analysis of the obtained data is made. Composition use – dairy plant extract in various industries and, in particular, in dairy for receiving lactic products is offered. Further work is determination of coefficients of molecular diffusion, creation of mathematical models with use of the received extraction dependences, and also the process software. This material, in its cumulative analysis, gives the chance to choose hardware and technological registration of process of extraction which will provide the maximum extraction from a lupine of a

  7. Effect of Germination and Fermentation on Carbohydrate Composition of Australian Sweet Lupin and Soybean Seeds and Flours.

    Science.gov (United States)

    Kaczmarska, Kornelia T; Chandra-Hioe, Maria V; Zabaras, Dimitrios; Frank, Damian; Arcot, Jayashree

    2017-11-22

    This study investigated the effect of germination and fermentation on the composition of carbohydrates in Australian sweet lupin. Specifically, the amount of sugars (sucrose, fructose, and glucose), starch, oligosaccharides (verbascose, stachyose, and raffinose), and dietary fiber were measured in germinated lupin seeds and fermented lupin flour, and compared with those in soy. High performance liquid chromatography coupled with refractive index was employed for quantitation of sugars, starch, and oligosaccharides, and gas chromatography coupled with a flame ionization detector was used for quantitation of simple sugars in total, and soluble, and insoluble dietary fiber. The enzyme activities of α-amylase and α-glucosidase were compared before and after germination or fermentation. The α-amylase activity in germinated lupin increased to  ∼17 nmol/mL/min/0.1 g and in germinated soy∼32; in fermented lupin, the activity increased to ∼52, while in fermented soy it decreased to ∼20. In general, germination or fermentation decreased the oligosaccharide content, and increased the total sugar in samples (p Fermentation with yogurt culture lowered the content of total oligosaccharides due to 94% decrease in stachyose. Total oligosaccharides in soy flour prior to fermentation were 180 mg/g and significantly decreased to ∼124 mg/g in fermented soy. Germination did not affect the starch content. There was no significant change in the amounts of total, soluble, and insoluble dietary fiber after germination or fermentation of lupin except for galactose, which was significantly reduced in germinated lupin seeds. Soluble dietary fiber in germinated soy significantly increased. Germination and fermentation are simple and effective techniques to reduce the oligosaccharides while maintaining the composition of dietary fibers.

  8. Development of a testing system for the documentation and evaluation of the weed-suppressing ability of blue lupins

    Directory of Open Access Journals (Sweden)

    Böhm, Herwart

    2016-02-01

    Full Text Available Within the framework of a joint research project for breeding advancement of blue and yellow lupins, which is being conducted in cooperation with the Julius Kühn-Institute, Institute for Breeding Research on Agricultural Crops (coordinator, Saatzucht Steinach and the IPK Gatersleben, in a sub-project at the Thünen-Institute of Organic Farming 1. a test system for detection and assessment of weed-suppressing effect of blue lupins will be developed, and 2. this test system will be tested to pre-breeding lines of blue lupin. In the first year of the project, plot trials were conducted in 3-fold field repetition with two phenological widely differing varieties (cv. Boruta [terminated type], cv. Boregine [branched type] in combination with selected partners with four different seed rates. As partners, monocotyledonous species (e.g., cereals and dicotyledonous species (false flax or resp., a mixture of oil seed rape, phacelia and buckwheat, are used. Twice during the growing season and at harvest, the aboveground biomass, separated by lupin, partners and weeds, were recorded. The results of the first project year show that all the partner plants which should serve as artificial weeds were successfully established. False flax leads to the strongest effect on the development of lupins, which showed the lowest biomass production in these variants. In comparison to the sown partners, the false flax variants also showed the highest biomass production, while the lowest biomass production was recorded for the natural weeds occurring at the site. The species mixture of oil seed rape, phacelia and buckwheat, however, led to the lowest biomass production; contemporaneously the biomass production of lupins in these variants was only affected slightly. Comparing the two cultivated lupin varieties, Boruta showed a better weed suppressive effect.

  9. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    Science.gov (United States)

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella. PMID:16269740

  10. European origin of Bradyrhizobium populations infecting lupins and serradella in soils of Western Australia and South Africa.

    Science.gov (United States)

    Stepkowski, Tomasz; Moulin, Lionel; Krzyzańska, Agnieszka; McInnes, Alison; Law, Ian J; Howieson, John

    2005-11-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella.

  11. Distribution of radionuclides in leaf-stem biomass of lupine and clover under production of protein concentrates

    International Nuclear Information System (INIS)

    Novikov, Yu.F.; Lobach, G.A.; Buzenko, T.A.; Zaretskaya, T.P.

    1993-01-01

    The basic regularities of radionuclide distribution between the obtained products have been studied using the fractionation of lupine and clover phytomass as an example. The content of radionuclides in protein concentrates has been shown to be strongly related to the crop species. A scheme and a regime of the fractionation of leaf-stem lupine biomass contaminated with cesium radioisotopes and strontium-90 which ensured the minimizing of their residual content in protein-vitaminic and protein concentrates have been selected with due accout of experimental data

  12. Lupin seeds lower plasma lipid concentrations and normalize antioxidant parameters in rats

    Directory of Open Access Journals (Sweden)

    Osman, M.

    2011-06-01

    Full Text Available This study was designed to test bitter and sweet lupin seeds for lipid-lowering and for their antioxidative activities in hypercholesterolemic rats. The levels of plasma lipid, malondialdehyde (MDA and whole blood reduced glutathione (GSH, as well as the activities of transaminases (ALT and AST, lactate dehydrogenase (LDH in plasma, superoxide dismutase (SOD, glutathione peroxidase (GPx in erythrocytes and plasma glutathione reductase (GR, glutathione-S-transferase (GST and catalase (CAT were examined. A hypercholesterolemia-induced diet manifested in the elevation of total lipids (TL, total cholesterol (TC, triglycerides (TG, LDL-C and MDA levels, ALT, AST, LDH activities and the depletion of GSH and enzymic antioxidants. The supplementation of a hypercholesterolemia-induced diet with bitter and sweet lupin seeds significantly lowered the plasma levels of TL, TC, TG and LDL-C. ALT, AST and LDH activities slightly decreased in treated groups compared with the hypercholesterolemic group (HC. Furthermore, the content of GSH significantly increased while MDA significantly decreased in treated groups compared with the HC group. In addition, the bitter lupin seed group improved enzymic antioxidants compared with the HC group. In general, the results indicated that the bitter lupin seed supplements are better than those containing sweet lupin seeds. These results suggested that the hypocholesterolemic effect of bitter and sweet lupin seed supplements might be due to their abilities to lower the plasma cholesterol level as well as to slow down the lipid peroxidation process and to enhance the antioxidant enzyme activity.

    Este estudio fue diseñado para evaluar semillas de altramuces dulces y amargas como agentes que bajan los lípidos y estudiar su efecto en la actividad antioxidante en ratas hipercolesterolémicas. El nivel de lípidos en plasma, malondialdehido (MDA y glutatión reducido (GSH, así como la actividad transaminasa (ALT y AST

  13. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  14. Comparing of organic nutrients digestibility in the feed rations containing lupin and peas in horses

    OpenAIRE

    Pavel Šajdler; Ladislav Zeman

    2005-01-01

    The aim of this study was to find out and compare organic nutrients digestibility in feed rations containing different forage legumes in balance trials on horses. The trials were always performed on a group of six sports horses (weight of 495 to 742 kg). Six feed rations were tested, which contained different proportion of certain forage legume in empirical feed mixtures. Three feed mixtures contained white lupine seeds (WLS) – Lu 0 (0.01% WLS), Lu 7 (7% WLS), Lu 14 (14% WLS) and surplus thre...

  15. Effect of extrusion, espansion and toasting on the nutritional value of peas, faba beans and lupins

    Directory of Open Access Journals (Sweden)

    Filippo Rossi

    2010-01-01

    Full Text Available An assessment was made of the effect that different treatments (toasting, expansion, extrusion have on the nutritionalvalue of protein plants (pea, faba bean, lupin. In a randomized block design, feeds were screened for enzymaticdigestibility of starch and protein, N solubility and in vitro protein degradability. Expansion and extrusion cause increasedstarch enzymatic degradability while toasting produced virtually no effects. In peas this value increased from 11.80% inmeal to 39.70% in the extruded product; 85.37% is the percentage for the expanded product, while 10.90% is the starchdigestibility value for toasted peas. In faba beans the extrusion process increased starch digestibility from 11.39% to85.05%, while in extruded lupins a complete starch hydrolysis was obtained, while in the meal the polysaccharide digestionwas 54.48%.The expansion and extrusion processes significantly decreased rumen degradability during the first 8 hours of incubation.Toasted peas had lower degradability if compared with controls but not with the other treatments. The onlypotentially alternative source to soybean is the extruded faba bean. In spite of its lower protein content, this feed ischaracterized by a considerably lower in vitro protein degradability than soybean. This implies that the digestible foodprotein content is comparable (124.90 g/kg DM to that of soybean (109.78 g/kg DM and definitely higher than thatof all other protein plants.

  16. A novel technique for compensation of space charge effects in the LUPIN-II detector

    Energy Technology Data Exchange (ETDEWEB)

    Cassell, C., E-mail: cc878@uowmail.edu.au [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy); University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Ferrarini, M. [Fondazione CNAO, via Caminadella16, 20123 Milano (Italy); Rosenfeld, A. [University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Caresana, M. [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy)

    2015-12-21

    A new method for improving REM counter performance in Pulsed Neutron Fields (PNFs) has been developed. This method uses an analysis of the build-up of space charge in the counter to compensate for an underestimation of Ambient Dose Equivalent (H*(10)) in intense pulsed fields. It was applied to three sets of experimental data acquired using the LUPIN-II REM counter device, which is designed for use in PNFs. The data was acquired using the cyclotron at Helmholtz-Zentrum Berlin für Materialien und Energie GmbH (HZB), at the HiRadMat facility at CERN and at the ‘Elettra Sincrotrone Trieste’ (ELETTRA), Italy. A comparison of the data with and without this compensation method is used to highlight its effectiveness. The LUPIN-II performance, which has already been shown to be able to cope with fields of up to hundreds of nSv/burst, is improved by at least one order of magnitude, with further potential for improvement.

  17. Evaluation of antihyperglycemic effect of trigonella foenum-graecum (fenugreek) and lupinus albus (lupine) in alloxan-induced diabetic rats

    Energy Technology Data Exchange (ETDEWEB)

    Noaman, E; Mansour, S Z; Ibrahim, N K [Radiation Biology Dept., National Centre for Radiation Research and Technology, Atomic Energy Authority, Cairo (Egypt)

    2007-07-01

    Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)

  18. Plasma membrane H+-ATPase-dependent citrate exudation from cluster roots of phosphate-deficient white lupin

    DEFF Research Database (Denmark)

    Tomasi, Nicola; Kretzschmar, Tobias; Espen, Luca

    2009-01-01

    ABSTRACT White lupin (Lupinus albus L.) is able to grow on soils with sparingly available phosphate (P) by producing specialized structures called cluster roots.To mobilize sparingly soluble P forms in soils, cluster roots release substantial amounts of carboxylates and concomitantly acidify the ...

  19. Intermittent grazing: A management tool to reduce the impact of lupine-induced Crooked Calf Syndrome (CCS)

    Science.gov (United States)

    The Lupinus genus is a large group of legumes, some of which cause a congenital condition in cattle referred to as “Crooked Calf Syndrome” (CCS). Only Lupines that contain the alkaloids anagyrine or ammodendrine are problematic to cattle producers. The syndrome is manifest by a series of multiple ...

  20. Crooked Calf Syndrome: Managing Lupines on Rangelands of the Channel Scablands of East-Central Washington State

    Science.gov (United States)

    “Crooked calf syndrome”, the contracture-type skeletal defects and cleft palate caused by velvet lupine (Lupinus leucophyllus) on the channel Scablands of east-central Washington State are the same as those defects induced by Conium maculatum (poison-hemlock) and Nicotiana spp. (wild tobacco) in rum...

  1. Evaluation of antihyperglycemic effect of trigonella foenum-graecum (fenugreek) and lupinus albus (lupine) in alloxan-induced diabetic rats

    International Nuclear Information System (INIS)

    Noaman, E.; Mansour, S.Z.; Ibrahim, N.K.

    2007-01-01

    Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)

  2. Plant nucleoside 5'-phosphoramidate hydrolase; simple purification from yellow lupin (Lupinus luteus) seeds and properties of homogeneous enzyme.

    Science.gov (United States)

    Guranowski, Andrzej; Wojdyła, Anna M; Rydzik, Anna M; Stepiński, Janusz; Jemielity, Jacek

    2011-01-01

    Adenosine 5'-phosphoramidate (NH₂-pA) is an uncommon natural nucleotide of poorly understood biochemistry and function. We studied a plant enzyme potentially involved in the catabolism of NH₂-pA. A fast and simple method comprising extraction of yellow lupin (Lupinus luteus) seed-meal with a low ionic strength buffer, ammonium sulfate and acetone fractionations, removal of contaminating proteins by heat denaturation, and affinity chromatography on AMP-agarose, yielded homogenous nucleoside 5'-phosphoramidase. Mass spectrometric analysis showed that the lupin hydrolase exhibits closest similarity to Arabidopsis thaliana Hint1 protein. The substrate specificity of the lupin enzyme, in particular its ability to split the P-S bond in adenosine 5'-phosphorothioate, is typical of known Hint1 proteins. Adenosine 5'-phosphofluoride and various derivatives of guanosine 5'-phosphoramidate were also substrates. Neither common divalent metal cations nor 10 mM EDTA or EGTA affected the hydrolysis of NH₂-pA. The enzyme functions as a homodimer (2 x 15,800 Da). At the optimum pH of 7.0, the K(m) for NH₂-pA was 0.5 µM and k(cat) 0.8 s⁻¹ (per monomer active site). The properties of the lupin nucleoside 5'-phosphoramidase are compared with those of its counterparts from other organisms.

  3. An RNA-Seq transcriptome analysis of orthophosphate-deficient white lupin reveals novel insights into phosphorus acclimation in plants.

    Science.gov (United States)

    O'Rourke, Jamie A; Yang, S Samuel; Miller, Susan S; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W; Vance, Carroll P

    2013-02-01

    Phosphorus, in its orthophosphate form (P(i)), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to P(i) deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in P(i)-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to P(i) supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to P(i) deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to P(i) deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the P(i) status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in P(i) deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to P(i) deficiency.

  4. Effects of Different Amounts of Blue Lupine (L. Angustifolius L. in The Diets of Heavy-Type Turkeys on Their Growth Rate, Carcass and Meat Qualities

    Directory of Open Access Journals (Sweden)

    R Juodka

    Full Text Available ABSTRACT A study was carried out to determine the effects of soybean meal replacement with different amounts of blue lupine in the diets of turkeys on the growth rate, anatomic carcass dissection data, chemical indicators of breast and thigh muscles and the content of tryptophan and oxyprolin. In total three hundred and sixty cross BIG-6 turkeys were allotted to two control and ten experimental groups of 30 one-day-old turkeys. The control group of turkeys was fed the diet containing soybean meal, whereas the trial groups were offered different amounts (from 20 to 30% of lupines. Group 4 and 5 were additionally given probiotic mixture Bio Plus 2B and allzyme SSF, respectively. Soybean oil replacement from 20 to 30% lupine in the diet had no influence on the growth rate, dressing percentage, edible parts and abdominal fat content of turkeys. The study indicated that lupines in the diet of turkeys had a different effect on the meat quality of different genders. Lupines did not have any negative effect on the meat quality of female turkeys and 30% lupines even improved the protein value index of breast muscles. However, 20-30 and 25-30% lupines in male turkey diets lowered dry matter and protein contents in breast muscles but had no negative influence on the main quality indicators in thigh muscles. The results of the study showed that the negative effect on the male breast muscle quality might be avoided using Bio Plus 2B or allzyme SSF additives in the male diets containing 30% lupines.

  5. Effect of a traditional processing method on the chemical composition of local white lupin (Lupinus albus L.) seed in North-Western Ethiopia.

    Science.gov (United States)

    Yeheyis, Likawent; Kijora, Claudia; Wink, Michael; Peters, Kurt J

    2011-01-01

    The effect of a traditional Ethiopian lupin processing method on the chemical composition of lupin seed samples was studied. Two sampling districts, namely Mecha and Sekela, representing the mid- and high-altitude areas of north-western Ethiopia, respectively, were randomly selected. Different types of traditionally processed and marketed lupin seed samples (raw, roasted, and finished) were collected in six replications from each district. Raw samples are unprocessed, and roasted samples are roasted using firewood. Finished samples are those ready for human consumption as snack. Thousand seed weight for raw and roasted samples within a study district was similar (P > 0.05), but it was lower (P seed sample from Mecha was lower (P 0.05). The crude protein and crude fat contents of finished samples within a study district were higher (P seed samples. The crude ash content of raw and roasted lupin samples within a study district was higher (P processing method of lupin seeds in Ethiopia has a positive contribution improving the crude protein and crude fat content, and lowering the alkaloid content of the finished product. The study showed the possibility of adopting the traditional processing method to process bitter white lupin for the use as protein supplement in livestock feed in Ethiopia, but further work has to be done on the processing method and animal evaluation.

  6. Studies on soluble carbohydrates in yellow lupin (Lupinus luteus L. seeds of different age

    Directory of Open Access Journals (Sweden)

    Kazimierz Zalewski

    2011-01-01

    Full Text Available Yellow lupin seeds cv. Juno were stored under laboratory conditions for 2 month, 4, 6 and 8 years. Eighteen soluble carbohydrates were identified in embryonic axes and cotyledons of different age seeds. The concentration of soluble carbohydrates in analysed seeds ranged from 25 to 34% of dry mass. Axes contained more carbohydrates than cotyledons. Stachyose dominated in axes, and verbascose - in cotyledons. Other detected galactosides were: galactinol, galactosyl pinitols and galactosyl chiro-inositols (fagopyritols, but their content was several-fold lower than that of RFOs (in both axes and cotyledons tissues. The concentration of soluble carbohydrates indicated, that sucrose to RFOs mass ratio, or other changes in sugars composition are not indicators of seed storage.

  7. Re-translocation of boron in broccoli and lupin during early reproductive growth

    Energy Technology Data Exchange (ETDEWEB)

    Marentes, E; Shelp, B J [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [USDA, Human Nutrition Research Center, Agricultural Research Service, ND (United States); [Spiers, G.A. Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)

    1997-06-01

    The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable {sup 10}B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether {sup 10}B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was {sup 10}B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs.

  8. Re-translocation of boron in broccoli and lupin during early reproductive growth

    International Nuclear Information System (INIS)

    Marentes, E.; Shelp, B.J.; Vanderpool, R.A.

    1997-01-01

    The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable 10 B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether 10 B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was 10 B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs

  9. IDENTIFICATION AND OCCURRENCE OF FUSARIUM SPECIES ON SEEDS OF COMMON WETCH, WHITE LUPINE AND SOME WILD LEGUMES

    Directory of Open Access Journals (Sweden)

    Tihomir Miličević

    2013-06-01

    Full Text Available The presence and occurrence of Fusarium species was examined on the seeds of cultivated legumes – common vetch (Vicia sativa, white lupine (Lupinus albus, and wild legumes: bird’s-foot trefoil (Lotus corniculatus, wild alfalfa (Medicago sativa, black locust (Robinia pseudoacacia, honey locust (Gleditsia triacanthos, sweet clover (Melilotus officinalis, bird vetch (Vicia cracca and meadow vetchling (Lathyrus pratensis. Thirteen Fusarium species were identified - F. verticillioides, F. acuminatum, F. avenaceum, F. tricinctum F. oxysporum, F. scirpi, F. semitectum, F. culmorum, F. proliferatum, F. pseudograminearum, F. sporotrichioides, F. sambucinum and F. heterosporum. Species F. verticillioides and F. proliferatum were determined on seeds of the cultivated legumes (common vetch and white lupine. Other 11 Fusarium species were determined on seeds of wild legumes (bird’s-foot trefoil, wild alfalfa, sweet clover and bird vetch among which the most prevalent were species F. avenaceum and F. acuminatum.

  10. Vegetative growth of raspberry (Rubus idaeus L. ‘Autumn Bliss’ with vermicompost application intercropped with lupine (Lupinus mutabilis Sweet.

    Directory of Open Access Journals (Sweden)

    Enoc Jara-Peña

    2013-06-01

    Full Text Available The present investigation was carried out with objective to determine the response of red raspberry to vermicompost application and lupine (intercropped or not in the phase of vegetative growth under greenhouse conditions in Montecillo, Mexico. In the experiment 11 treatments were studied with 9 replications per treatment, with a complete factorial (5 × 2 plus an additional treatment consisting of a chemical fertilization with N100 P80 K80. As vegetable material adventitious buds of raspberry were used, statistically significant differences were found between treatments in number of leaves, plant height, cane diameter, fresh and dry matter in raspberry. The biggest response was obtained with 90 and 120 g pot–1 of vermicompost. In general, the lupine intercropped with raspberry permitted a slight competion but favored the biggest development in the foliar area.

  11. Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan

    International Nuclear Information System (INIS)

    Elamin, Malik El Mubarak Mohamed

    1996-12-01

    Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 μg/g. Pb 9-10 μg/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in the

  12. Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan

    Energy Technology Data Exchange (ETDEWEB)

    Elamin, Malik El Mubarak Mohamed [Department of Biochemistry and Soil Science, Faculty of Agriculture, University of Khartoum, Khartoum (Sudan)

    1996-12-01

    Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 {mu}g/g. Pb 9-10 {mu}g/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in

  13. Ternary diagram of extract proteins / solvent systems: Sesame, soybean and lupine proteins

    Directory of Open Access Journals (Sweden)

    Mohamed, S. S.

    2004-09-01

    Full Text Available Solvent extraction as a method of extracting protein from oilseed meals offers the advantage of higher efficiency. Unfortunately, the published literature points to the gap in the work concerned with the necessary equilibrium diagram to design due process equipment for such extracts. Initiated by this lack of basic knowledge, the present study has been undertaken to provide the equilibrium data for three different ternary systems, namely: sesame protein / sodium hydroxide solution system, soybean protein / sodium hydroxide solution system and lupine protein / sodium hydroxide solution system. These oilseed meals were selected because of their high protein content (53.4 %, 46.2 % and 42.3 % protein, respectively. The study also concentrated on the evaluation of the major parameters affecting the extraction process, i.e. the normality of the sodium hydroxide solution used as extracting solvent and the initial oilseed solvent to meal feeding ratio. The results obtained indicate that the best normality of sodium hydroxide solution used for extracting soybean and lupine protein is 0.02N, while 0.04N solution is required for extracting sesame protein. Also, operating at a liquid to solid feed ratio of 30:1 and 50:1 for soybean, sesame and lupine, respectively, is enough to reach a high protein extract. Correlations were presented for each locus of under flow compositions, graphically acquired, and the data are compared with those calculated by analytical solutions.La extracción con disolventes es un método de extracción de proteínas de las harinas de semillas oleaginosas que ofrece la ventaja de su elevada eficacia. Desafortunadamente, la bibliografía coincide en el vacío existente con respecto a los diagramas de equilibrio necesarios para el diseño de los equipos adecuados. Debido a esta falta de conocimientos, el presente estudio se ha llevado a cabo para obtener datos de tres sistemas ternarios: sistema proteína de sésamo / disolución de

  14. Effect of Replacing Soybean Meal with Lupin Seed-based Meal in Chicken Diet on Performance, Carcass Value and Meat Quality

    Directory of Open Access Journals (Sweden)

    Pavel Suchý

    2010-01-01

    Full Text Available The main objective of this experimental study was to determine how diets containing lupin meal affect the performance indicators, carcass value, and chemical composition of breast and thigh muscles in broiler chickens. The diets tested in experimental groups E1 and E2 differed as follows: in group E1, one third of nitrogen-containing substances (NSs from extracted soybean meal was replaced with NSs from lupin meal; in group E2, two thirds were replaced compared to the control group. The replacement of soybean meal with lupin meal in experimental diets failed to produce any significant effect on the average live weight of chickens on Day 42 of the fattening period compared to the control group. The replacement of soybean meal with lupin meal resulted in decreased average weight of carcass and breast muscles and in decreased yield of breast muscles. Differences between the control group (C and group E2 were significant (P ⪬ 0.01. Chickens in group E2 also showed a significant increase (P ⪬ 0.01 in the yield of the heart and stomach compared to the control group. The differences in weight and yield of thigh muscles between the control group and the experimental groups (E1 and E2 were not significantly affected. As far as chemical composition is concerned, chickens receiving the lupin-containing feed showed a significant (P ⪬ 0.01 increase in the ash content in breast muscles. On the contrary, in thigh muscles in group E2, the ash content decreased significantly (P ⪬ 0.01. The content of calcium showed an increasing trend in both breast and thigh muscles in both experimental groups. In contrast, the content of magnesium in chicken muscles in both experimental groups decreased. These differences were significant (P ⪬ 0.01 only in thigh muscles. Our results show that lupin seed is a suitable substitute for NSs contained in soybean extracted meal. It is considered optimal to replace up to one third of NSs contained in

  15. Effects of toasting blue lupins, soybeans or barley as supplement for high-yielding organic dairy cows fed grass-clover silage ad libitum

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Lund, Peter; Kristensen, Troels

    2008-01-01

    . The supplement under investigation was: lupins in experiment 1, barley in experiment 2 and soybeans in experiment 3. The same forage mixture of grass-clover silage (84% of DM), grass pellets (11% of DM) and straw (5% of DM) was fed ad libitum in all the experiments. Toasting decreased effective rumen protein...... degradability determined in situ for all three supplements. Compared to untreated lupins toasting of lupins tended (P = 0.10) to increase milk yield, whereas toasting of soybeans did not affect milk yield. Toasting of lupins decreased (P = 0.03) milk protein content (32.2 versus 32.7 g/kg), whereas toasting...... of soybeans did not affect milk protein content. ECM yield was significantly higher (P = 0.002) for cows fed toasted soybeans than for cows fed untreated soybeans (28.1 versus 26.4 kg ECM) whereas there was no significant effect on ECM yield from toasting lupins or barley. It can be concluded...

  16. Total phenolic and phytosterol compounds and the radical scavenging activity of germinated Australian sweet lupin flour.

    Science.gov (United States)

    Rumiyati; Jayasena, Vijay; James, Anthony P

    2013-12-01

    In addition to their favourable nutritional profile, legumes also contain a range of bioactive compounds such as phenolic compounds and phytosterols which may protect against chronic diseases including cancer and cardiovascular disease. Germination of some legume seeds has been previously reported to increase the concentration of the bioactive compounds. In this study, the effect of germination of Australian Sweet Lupin (ASL) seeds for 9 days on the concentration of some bioactive compounds and the radical scavenging activity in the resulting flour was determined. The concentration of total phenolic compounds in methanolic extracts of germinated ASL flour was determined using Folin Ciocalteu reagent and phytosterols in oil extracts were analyzed by gas-liquid chromatography. The methanolic and oil extracts were also used to determine radical scavenging activity toward 2,2-diphenyl-1-picrylhydrazyl. In the methanolic extracts of germinated ASL flour, phenolic contents and the antioxidant activity were significantly increased following germination (700 and 1400 %, respectively). Analysis of the oil extracts of germinated ASL flour revealed that the concentration of phytosterols and the antioxidant activity were also increased significantly compared to ungerminated ASL flour (300 and 800 %, respectively). The relative proportion of phytosterols in germinated ASL flour was: β-sitosterol (60 %), stigmasterol (30 %) and campesterol (10 %). Germination increases the concentration of bioactive compounds and the radical scavenging activity in the germinated ASL flour.

  17. Effect of pre-sowing gamma irradiated lupin seeds on growth characters and yield components

    International Nuclear Information System (INIS)

    Ragab, M.A.

    1988-01-01

    Selected seeds of lupin were exposed to Co 60 -source to achieve doses of 2.5, 5, 10, 20, 40, 80, 160, or 320 Grey, beside the control treatment, irradiated and unirradiated seeds were sown and the raised plants were grown under field condition at Agric. Dept. of Soil and Water Res. A.E.A. Representative plant samples were taken at early growth stage 15-days-old seedling at flowering and at harvest. The gained results could be summarized as follows: Plant growth parameters: Plant height, particularly at early stages and at flowering and the produced dry matter were statistically affected by the treatments. Leaf pigment content was intensified by almost 14-28% over control treatment. Total carbohydrates and soluble protein in plant leaves were statistically influenced by the applied irradiation doses. Number of pods was materially affected by the treatments while no remarkable effect was noted as far as a number of seeds/plant and dry weight of seeds/plant were considered: consequently: seed index was not materially affected

  18. Instability of chlorophyll in yellow lupin seedlings grown in soil contaminated with ciprofloxacin and tetracycline.

    Science.gov (United States)

    Rydzyński, Dariusz; Piotrowicz-Cieślak, Agnieszka I; Grajek, Hanna; Michalczyk, Dariusz J

    2017-10-01

    With increasing soil concentrations of ciprofloxacin and tetracycline a decrease of leaf chlorophyll content was observed. Tetracycline was more detrimental than ciprofloxacin. The chlorophyll content in plants growing for ten days on a tetracycline containing soil decreased by 68%. The decrease of chlorophyll concentration was even sharper in new leaves that formed after application of the antibiotic (up to 81% drop). The comparison of absorption spectra of commercial, reagent grade chlorophyll, alone and incubated with antibiotics, has shown that ciprofloxacin and tetracycline can react directly with chlorophyll and decrease its concentration by 47.7% and 48.5%, respectively. The changes in fluorescence spectra confirmed the formation of chlorophyll degradation product. The chlorophyll decay was a second order reaction and depended on antibiotic concentration and duration of exposure. Reaction rate constants differed with antibiotics and their soil concentrations. With increasing contents of antibiotics in soil the constant of chlorophyll degradation rate in lupin plants increased from k = 870 M -1 day -1 for 3 mg ciprofloxacin to k = 2490 M -1 day -1 for 90 mg ciprofloxacin, and in the case of tetracycline the reaction rate constant increased from k = 1330 M -1 day -1 to k = 2910 M -1 day -1 . The sensitivity of chlorophyll to ciprofloxacin and tetracycline was confirmed by determining EC and TU indices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Histological evaluation of brain damage caused by crude quinolizidine alkaloid extracts from lupines.

    Science.gov (United States)

    Bañuelos Pineda, J; Nolasco Rodríguez, G; Monteon, J A; García López, P M; Ruiz Lopez, M A; García Estrada, J

    2005-10-01

    The effects of the intracerebroventricular (ICV) administration of crude extracts of lupin quinolizidine alkaloids (LQAs) were studied in adult rat brain tissue. Mature L. exaltatus and L. montanus seeds were collected in western Mexico, and the LQAs from these seeds were extracted and analyzed by capillary gas chromatography. This LQA extract was administered to the right lateral ventricle of adult rats through a stainless steel cannula on five consecutive days. While control animals received 10 microl of sesame oil daily (vehicle), the experimental rats (10 per group) received 20 ng of LQA from either L. exaltatus or from L. montanus. All the animals were sacrificed 40 h after receiving the last dose of alkaloids, and their brains were removed, fixed and coronal paraffin sections were stained with haematoxylin and eosin. Immediately after the administration of LQA the animals began grooming and suffered tachycardia, tachypnea, piloerection, tail erection, muscular contractions, loss of equilibrium, excitation, and unsteady walk. In the brains of the animals treated with LQA damaged neurons were identified. The most frequent abnormalities observed in this brain tissue were "red neurons" with shrunken eosinophilic cytoplasm, strongly stained pyknotic nuclei, neuronal swelling, spongiform neuropil, "ghost cells" (hypochromasia), and abundant neuronophagic figures in numerous brain areas. While some alterations in neurons were observed in control tissues, unlike those found in the animals treated with LQA these were not significant. Thus, the histopathological changes observed can be principally attributed to the administration of sparteine and lupanine present in the alkaloid extracts.

  20. Comparing of organic nutrients digestibility in the feed rations containing lupin and peas in horses

    Directory of Open Access Journals (Sweden)

    Pavel Šajdler

    2005-01-01

    Full Text Available The aim of this study was to find out and compare organic nutrients digestibility in feed rations containing different forage legumes in balance trials on horses. The trials were always performed on a group of six sports horses (weight of 495 to 742 kg. Six feed rations were tested, which contained different proportion of certain forage legume in empirical feed mixtures. Three feed mixtures contained white lupine seeds (WLS – Lu 0 (0.01% WLS, Lu 7 (7% WLS, Lu 14 (14% WLS and surplus three feed mixtures contained field pea seeds (FPS – Hr 0 (0.01% FPS, Hr 10 (10% FPS, Hr 20 (20% FPS. Amount of WLS in feed mixtures Lu 0 and Lu 7 was completed with starch to value 14% and amount of FPS in feed mixtures Hr 0 and Hr 10 was completed with starch to value 20%. Indicator method was used to predict dietary nutrients digestibility. Apparent digestibility values of all organic nutrients were higher at the feed rations with the content of FPS. Average values of apparent digestibility coefficient of those feed rations were: dry matter (77.79%; SD = 2.91, organic matter (78.43%; SD = 2.78, crude protein (79.89%; SD = 3.43, fat (66.57%; SD = 2.40, crude fiber (68.97%; SD = 3.21 and nitrogen-free extract (83.30%; SD = 2.71.

  1. Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa.

    Science.gov (United States)

    Shaw, Jane; Love, Andrew J; Makarova, Svetlana S; Kalinina, Natalia O; Harrison, Bryan D; Taliansky, Michael E

    2014-01-01

    Cajal bodies (CBs) are distinct nuclear bodies physically and functionally associated with the nucleolus. In addition to their traditional function in coordinating maturation of certain nuclear RNAs, CBs participate in cell cycle regulation, development, and regulation of stress responses. A key "signature" component of CBs is coilin, the scaffolding protein essential for CB formation and function. Using an RNA silencing (loss-of-function) approach, we describe here new phenomena whereby coilin also affects, directly or indirectly, a variety of interactions between host plants and viruses that have RNA or DNA genomes. Moreover, the effects of coilin on these interactions are manifested differently: coilin contributes to plant defense against tobacco rattle virus (tobravirus), tomato black ring virus (nepovirus), barley stripe mosaic virus (hordeivirus), and tomato golden mosaic virus (begomovirus). In contrast, with potato virus Y (potyvirus) and turnip vein clearing virus (tobamovirus), coilin serves to increase virus pathogenicity. These findings show that interactions with coilin (or CBs) may involve diverse mechanisms with different viruses and that these mechanisms act at different phases of virus infection. Thus, coilin (CBs) has novel, unexpected natural functions that may be recruited or subverted by plant viruses for their own needs or, in contrast, are involved in plant defense mechanisms that suppress host susceptibility to the viruses.

  2. Influence of diets to Wistar rats supplemented with soya, flaxseed and lupine products treated by lactofermentation to improve their gut health.

    Science.gov (United States)

    Bartkiene, E; Juodeikiene, G; Vidmantiene, D; Zdunczyk, Z; Zdunczyk, P; Juskiewicz, J; Cizeikiene, D; Matusevicius, P

    2013-09-01

    The present study proposes the contribution of lactic acid bacteria and plants rich in bioactive substances and high-quality proteins as alternative products for human diets in improving the gut environment as potential against pathogenic bacteria. The effect of diets supplemented with soya, flaxseed and lupine flours fermented with a Pediococcus acidilactici KTU05-7 probiotic strain in the gastrointestinal tract (GIT) of Wistar rats were analyzed. In vivo experiments showed a positive effect of long time lactofermentation of plant material on the body weight of rats. Diets with fermented yellow lupine resulted in enhanced activities of α-glucosidase, β-galactosidases, as well as high levels of lactic acid bacteria, bifidobacteria and enterococci in the GIT were determined. Lactofermentation of analyzed plant products had a significantly lowering effect on Escherichia coli compared with the control group. The dominant flora of large intestines like Bifidobacterium and anaerobic cocci were found in high levels after diets with fermented lupine.

  3. Use of lupin, Lupinus perennis, mango, Mangifera indica, and stinging nettle, Urtica dioica, as feed additives to prevent Aeromonas hydrophila infection in rainbow trout, Oncorhynchus mykiss (Walbaum).

    Science.gov (United States)

    Awad, E; Austin, B

    2010-05-01

    Feeding rainbow trout, Oncorhynchus mykiss (Walbaum), with 1% lupin, Lupinus perennis, mango, Mangifera indica, or stinging nettle, Urtica dioica, for 14 days led to reductions in mortality after challenge with Aeromonas hydrophila. In addition, there was significant enhancement in serum bactericidal activity, respiratory burst and lysozyme activity in the treatment groups compared to the controls. Use of lupin and mango led to the highest number of red blood and white blood cells in recipient fish, with use of stinging nettle leading to the highest haematocrit and haemoglobin values; the highest value of mean corpuscular volume and haemoglobin was in the control groups and those fed with stinging nettle.

  4. Putrescine catabolism via DAO contributes to proline and GABA accumulation in roots of lupine seedlings growing under salt stress

    Directory of Open Access Journals (Sweden)

    Jolanta Legocka

    2017-09-01

    Full Text Available The levels of polyamines (PAs, proline (Pro, and γ-aminobutyric acid (GABA as well as the activity of diamine oxidase (DAO; EC 1.4.3.6 were studied in the roots of 2-day-old lupine (Lupinus luteus L. ‘Juno’ seedlings treated with 200 mM NaCl for 24 h. The effect of adding 1 mM aminoguanidine (AG, an inhibitor of DAO activity, was also analyzed. It was found that in roots of lupine seedlings growing under salt stress, a negative correlation between Pro accumulation and putrescine (Put content takes place. Pro level increased in roots by about 160% and, at the same time, Put content decreased by about 60%, as a result of ca. twofold increase of DAO activity. The AG added to the seedlings almost totally inhibited the activity of DAO, increased Put accumulation to control level, decreased Pro content by about 25%, and reduced GABA level by about 22%. Addition of 50 mM GABA to the lupine seedlings growing in the presence of AG and NaCl restored Pro content in roots to its level in NaCl-treated plants. In this research, the clear correlation between Put degradation and GABA and Pro accumulation was shown for the first time in the roots of seedlings growing under salt stress. This could be considered as a short-term response of a plant to high salt concentration. Our findings indicate that during intensive Pro accumulation in roots induced by salt stress, the pool of this amino acid is indirectly supported by GABA production as a result of Put degradation.

  5. Assessment of Bioavailable Concentrations of Germanium and Rare Earth Elements in the Rhizosphere of White Lupin (Lupinus albus L.)

    Science.gov (United States)

    Wiche, Oliver; Fischer, Ronny; Moschner, Christin; Székely, Balázs

    2015-04-01

    Concentrations of Germanium (Ge) and Rare Earth Elements in soils are estimated at 1.5 mg kg -1 (Ge), 25 mg kg -1 (La) and 20 mg kg -1 (Nd), which are only roughly smaller than concentrations of Pb and Zn. Germanium and rare earth elements are thus not rare but widely dispersed in soils and therefore up to date, only a few minable deposits are available. An environmental friendly and cost-effective way for Ge and rare earth element production could be phytomining. However, the most challenging part of a phytomining of these elements is to increase bioavailable concentrations of the elements in soils. Recent studies show, that mixed cultures with white lupine or other species with a high potential to mobilize trace metals in their rhizosphere due to an acidification of the soil and release of organic acids in the root zone could be a promising tool for phytomining. Complexation of Ge and rare earth elements by organic acids might play a key role in controlling bioavailability to plants as re-adsorption on soil particles and precipitation is prevented and thus, concentrations in the root zone of white lupine increase. This may also allow the complexes to diffuse along a concentration gradient to the roots of mixed culture growing species leading to enhanced plant uptake. However, to optimize mixed cultures it would be interesting to know to which extend mobilization of trace metals is dependent from chemical speciation of elements in soil due to the interspecific interaction of roots. A method for the identification of complexes of germanium and rare earth elements with organic acids, predominantly citric acid in the rhizosphere of white lupine was developed and successfully tested. The method is based on coupling of liquid chromatography with ICP-MS using a zic-philic column (SeQuant). As a preliminary result, we were able to show that complexes of germanium with citric acid exist in the rhizosphere of white lupin, what may contribute to the bioavailability of this

  6. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    OpenAIRE

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA inter...

  7. Effect of pre-sowing laser biostimulation on seeds on white lupine growth under differentiated temperature conditions

    International Nuclear Information System (INIS)

    Podleśny, J.

    1999-01-01

    The experiment went on over 6 weeks. Plants emergence depended on the temperature and pre-sowing laser irradiation of seeds. White lupine seeds germinated better under normal thermal conditions than in chilling stress. Triple irradiation of seeds showed the best advantageous effect improving the quality of plant emergence, irrespective of thermal conditions. The plants sprouted about 3-4 days earlier in comparison to plants from not irradiated seeds. Laser light positively affected also the height of plants, root length and dry matter yield of roots and aboveground parts

  8. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L.

    Directory of Open Access Journals (Sweden)

    Mann Anthea J

    2011-02-01

    Full Text Available Abstract Background Members of the legume genus Lupinus exude phloem 'spontaneously' from incisions made to the vasculature. This feature was exploited to document macromolecules present in exudate of white lupin (Lupinus albus [L.] cv Kiev mutant, in particular to identify proteins and RNA molecules, including microRNA (miRNA. Results Proteomic analysis tentatively identified 86 proteins from 130 spots collected from 2D gels analysed by partial amino acid sequence determination using MS/MS. Analysis of a cDNA library constructed from exudate identified 609 unique transcripts. Both proteins and transcripts were classified into functional groups. The largest group of proteins comprised those involved in metabolism (24%, followed by protein modification/turnover (9%, redox regulation (8%, cell structural components (6%, stress and defence response (6% with fewer in other groups. More prominent proteins were cyclophilin, ubiquitin, a glycine-rich RNA-binding protein, a group of proteins that comprise a glutathione/ascorbate-based mechanism to scavenge oxygen radicals, enzymes of glycolysis and other metabolism including methionine and ethylene synthesis. Potential signalling macromolecules such as transcripts encoding proteins mediating calcium level and the Flowering locus T (FT protein were also identified. From around 330 small RNA clones (18-25 nt 12 were identified as probable miRNAs by homology with those from other species. miRNA composition of exudate varied with site of collection (e.g. upward versus downward translocation streams and nutrition (e.g. phosphorus level. Conclusions This is the first inventory of macromolecule composition of phloem exudate from a species in the Fabaceae, providing a basis to identify systemic signalling macromolecules with potential roles in regulating development, growth and stress response of legumes.

  9. Influence of organic N Sources on N transformation and uptake by lupine plants using 15N technique

    International Nuclear Information System (INIS)

    Abdel-Salam, A.A.; Gadalla, A.M.; Abdel- Aziz, H.A.; Galal, Y.G.M.; EL-degwy, S.M.

    2008-01-01

    A pot experiment was carried out under greenhouse conditions to evaluate the comparative efficiency and transformation of nitrogen applied either as mineral or organic forms. The obtained data showed that shoot dry weight was enhanced by compost and its mixture with leucaena. When organic sources were combined with 15 N, the leucaena.compost mixture (LC p ) gave the highest yield, and the other two were not significantly different from each other. Reinforcing the organic N with mineral N caused an average greater N.uptake over the non reinforced treatment. Similar trend was noticed with root system. Nitrogen uptake by roots was increased according to the order of LC > L > C. N derived from fertilizer (% Ndff) by lupine shoots was significantly affected by fertilizer addition either alone or reinforced with organic plant residues. Both, the portions (%) or absolute values (mg pot -1 ) of Ndff were increased by adding the organic residues. The highest value of Ndfs was recorded with application of leucaena followed by compost, then Leucaena + compost. Portion Ndfa reflected an effective response of lupines plants to Rhizobium inoculation. Addition of LC mixture combined with 15 N-fertilizer had enhanced the N 2 fixation and increased Ndfa value by about 66.7 % over those recorded with 15 N0 treatment. Organic amendment of leucaena could be an efficient source for N to infertile sandy soils

  10. Testing of Two Varieties of Lupin Seeds as Substitutes for Soya Extracted Meal in Vegetable Diets Designed for Young Broilers

    Directory of Open Access Journals (Sweden)

    P. Suchý

    2006-01-01

    Full Text Available The main aim of this experiment was to verify the suitability of two Polish varieties of dehulled lupin seed (the low-protein SONET variety and the high-protein JUNO variety as protein components to replace 50% of soya extract meal in feeding mixtures designed for the feeding of young broilers. The results of this experiment demonstrate that suitable treatment of lupin seed (dehulling may significantly increase its nutritional value. Dehulling provides a product (core in which the level of nitrogen-containing substances is by 27% higher than that in the original seed, providing an important protein component to be added in feeding mixtures for chickens. The experiment has also shown that production performance depends on the particular Lupinus variety used. Chickens fed on the JUNO variety seed (Group E1 reached a live weight of 2.332 kg on Day 40, which is comparable with the control group of chickens (2.337 kg; Group C. However, chickens in Group E2 fed on the SONET variety seed had a conclusively lower average weight (2.280 kg (P Lupinus genus is a major source of the amino acid arginine, which is often deficient in the feeding mixtures.

  11. Biosynthesis and characterization of ¹⁵N₆-labeled phomopsin A, a lupin associated mycotoxin produced by Diaporthe toxica.

    Science.gov (United States)

    Schloß, Svenja; Wedell, Ines; Koch, Matthias; Rohn, Sascha; Maul, Ronald

    2015-06-15

    The hepatotoxin phomopsin A (PHO-A), a secondary metabolite mainly produced by the fungus Diaporthe toxica, occurs predominantly on sweet lupins. Along with the growing interest in sweet lupins for food and feed commodities, concerns have been raised about fungal infestations, and consequently, about the determination of PHO-A. High performance liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) represents the most suitable analytical technique for sensitive and selective detection of mycotoxins including PHO-A. However, isotopic labeled substances are needed as internal standards for a reliable and convenient quantification. As no isotope standard for PHO-A is currently available, a biosynthesis of fully (15)N6-labeled PHO-A was established by cultivation of D. toxica on defined media containing Na(15)NO3 and (15)N-labeled yeast extract as the only nitrogen sources. The identity of (15)N6-PHO-A was confirmed by high resolution mass spectrometry. The new (15)N6-labeled standard will facilitate the method development for PHO-A including a more accurate quantification by LC-MS/MS. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Haematological indicators in hybrid mallard ducks (Anas platyrhynchos with regard to the use of meal from whole white lupin seeds in their diet

    Directory of Open Access Journals (Sweden)

    David Zapletal

    2017-01-01

    Full Text Available The objective of our study was to assess the effect of replacing soybean meal with the meal from whole white lupin seeds (Lupinus albus of the Zulika variety in diets on selected haematological indicators in 40-day-old fattened hybrid mallard ducks. A total of 180 Cherry Valley ducks were divided into three groups (E1, E2, and control. The control group was fed a diet containing soybean meal. Soybean meal replaced with 50% and 100% meal of white lupin seeds were used in group E1 and group E2, respectively. At the end of the fattening, 12 ducks (6 males and 6 females were randomly selected from each group for a haematological examination. From the result of this study, it is clear that the effect of the diet was found only on the slightly varying number of white blood cells and on the proportion of monocytes. Ducks of group E2 showed a slight increase in the total number of leukocytes which was accompanied by a decrease in the percentage share of monocytes (P < 0.05. Based on the results, it can be claimed that the replacement of soybean meal with meal from the Zulika variety of whole white lupin seeds in the diet did not have a negative effect on the determined blood indicators. Therefore, whole white lupin seeds were successfully used as the important protein component of the diet for fattening hybrid mallard ducks.

  13. Lupin kernel fiber consumption modifies fecal microbiota in healthy men as determined by rRNA gene fluorescent in situ hybridization

    NARCIS (Netherlands)

    Smith, Stuart C.; Choy, Rachel; Johnson, Stuart K.; Hall, Ramon S.; Wildeboer-Veloo, Alida C. M.; Welling, Gjalt W.

    Background: Changes in the composition of gastrointestinal microbiota by dietary interventions using pro- and prebiotics provide opportunity for improving health and preventing disease. However, the capacity of lupin kernel fiber (LKFibre), a novel legume-derived food ingredient, to act as a

  14. The effect of dehulling and a-glactosidase supplementation on the ileal digestibility of lupin based diets in broiler chickens and adult roosters

    NARCIS (Netherlands)

    Mieczkowska, A.; Jansman, A.J.M.; Kwakkel, R.P.; Smulikowski, S.

    2005-01-01

    Two hundred fifty six broiler chickens, 22-days-old, allocated to four groups of four replicate pens with 16 birds each, and six adult ileostomized roosters were used. Four diets containing maize starch and 550 g/kg whole or 458 g/kg dehulled lupin seeds (Lupinus luteus L. cv. Amulet) as the only

  15. The influence of narrow-leafed lupin seed fermentation on their chemical composition and ileal digestibility and microbiota in growing pigs.

    Science.gov (United States)

    Zaworska, Anita; Frankiewicz, Andrzej; Kasprowicz-Potocka, Małgorzata

    2017-08-01

    The aims of this study were to provide a controlled fermentation process of blue lupin seeds (Lupinus angustifolius, cv. Neptun), monitor the changes in seed composition and determine the influence of the fermentation on the apparent ileal digestibility (AID) of crude protein (CP) and amino acids in growing pigs, compared with raw lupin seeds. The fermentation with bacteria and yeast was conducted for 24 h at 25ºC under aerobic conditions. Seed fermentation increased the contents of CP, fibre, fat and ash and most of the analysed amino acids but reduced the levels of the nitrogen-free extractives. Furthermore, fermentation decreased the contents of raffinose family oligosaccharides and phytic acids but increased the alkaloid content. The AID was estimated on three barrows (mean initial body weight 25 kg), surgically fitted with a T-cannula in the distal ileum. The pigs received three diets, each for 6 d, within three experimental periods (3 × 3 Latin Square design). The diets contained soybean meal (Group SBM), raw lupin seeds (Group RL) or fermented lupin seeds (Group FL) as solely protein sources. Fermentation had a positive impact on the AID of CP and methionine, cysteine, isoleucine, leucine, phenylalanine and valine (p fermented lupin seeds did not affect the microbial status of the ileal digesta. Moreover, ammonia content in the caecal digesta did not differ between Groups RL and FL, although it was significantly higher than in Group SBM. It can be concluded that the fermentation process modified the chemical composition of nutrients in seeds, which can influence the digestibility and utilisation of the fermentation product in animal diets compared to raw seeds.

  16. An RNA-Seq Transcriptome Analysis of Orthophosphate-Deficient White Lupin Reveals Novel Insights into Phosphorus Acclimation in Plants1[W][OA

    Science.gov (United States)

    O’Rourke, Jamie A.; Yang, S. Samuel; Miller, Susan S.; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W.; Vance, Carroll P.

    2013-01-01

    Phosphorus, in its orthophosphate form (Pi), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to Pi deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in Pi-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to Pi supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to Pi deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to Pi deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the Pi status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in Pi deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to Pi deficiency. PMID:23197803

  17. [Development of a high content protein beverage from Chilean mesquite, lupine and quinoa for the diet of pre-schoolers].

    Science.gov (United States)

    Cerezal Mezquita, P; Acosta Barrientos, E; Rojas Valdivia, G; Romero Palacios, N; Arcos Zavala, R

    2012-01-01

    This research was aimed at developing a high content protein beverage from the mixture of liquid extracts of a pseudocereal, quinoa (Chenopodium quinoa Willd) and two legumes: mesquite (Prosopis chilensis (Mol.) Stunz) and lupine (Lupinus albus L.), native from the Andean highlands of the Chilean northern macro-zone, flavored with raspberry pulp, to help in the feeding of children between 2 and 5 years of lower socioeconomic status with nutritional deficiencies. The formulation was defined by linear programming, its composition was determined by proximate analysis and physical, microbiological and sensory acceptance tests were performed. After 90 days of storage time, the beverage got a protein content of 1.36%, being tryptophan the limiting amino acid; for its part, the chromaticity coordinates of CIEL*a*b* color space showed no statistical significant differences (p < 0.05) maintaining the "dark pink" tonality, the viscosity and the sensory evaluation were acceptable for drinking.

  18. Enrichment of gluten-free cakes with lupin (Lupinus albus L.) or buckwheat (Fagopyrum esculentum M.) flours.

    Science.gov (United States)

    Levent, Hacer; Bilgiçli, Nermin

    2011-11-01

    In the present study, the effect of debittered lupin flour (LF) and whole buckwheat flour (BF) on the nutritional and sensory quality of gluten-free cake was studied. LF (10, 20, 30 and 40%) and BF (5, 10, 15 and 20%) were partially replaced with corn starch and rice flour mixture (1:1 w/w) in the gluten-free cake recipe. LF increased the protein, calcium, iron, manganese, phosphorus and zinc contents of the cakes, while BF caused a significant increase (P cakes. According to the overall acceptability rating, it was concluded that gluten-free cake could be produced with satisfactory results by the addition of LF and BF up to 30% and 10%, respectively.

  19. Response of lupine plants irrigated with saline water to rhizobium inoculation using 15N-isotope dilution

    International Nuclear Information System (INIS)

    Gadalla, A.M.; El-Ghandour, I.A.; Abdel Aziz, H.A.; Hamdy, A.; Aly, M.M.

    2002-01-01

    The lupine Rhizobium symbiosis and contribution of N 2 fixation under different levels of irrigation water salinity were examined. Lysimeter experiment was established under greenhouse conditions during the year 2002-2003. In this experiment, inoculated plants were imposed to different salinity levels of irrigation water and N-fertilizer treatment. Plant height was decreased under different salinity levels, nitrogen treatments and bacterial inoculation. Similar trend was noticed with leaf area. The highest leaf area was recorded with salt tolerant bacterial inoculation (SBI) and splitting N-treatment. Highest values of N-uptake occurred after 100 day intervals under the tested factors. Relative decrease in N-uptake did not exceed 40% of those recorded with the fresh water treatment as affected by experimental factors. Nitrogen uptake by the whole plant reflected an increase at 3 dS/m salinity level of irrigation water. Relative increases were 5% and 15% for normal bacteria inoculation under single dose (NI) and splitting

  20. Effects of feeding finisher pigs with chicory or lupine feed for one week or two weeks before slaughter with respect to levels of Bifidobacteria and Campylobacter

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hansen, L. L.; Baggesen, Dorte Lau

    2013-01-01

    This study aimed to assess whether inclusion of chicory or lupine (prebiotics) in the diet of pre-slaughter pigs for just 1 or 2 weeks could change the composition of their intestinal microbiota, stimulate the growth of bifidobacteria and help to lower the amount of thermoplilic Campylobacter spp...... values >5% relative to the intensity of total abundance differed between the feed treatments (P prebiotics in the diet of pre-slaughter pigs elicited changes in the composition of the intestinal microbiota...

  1. Diverse accumulation of several dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress.

    Science.gov (United States)

    Rurek, Michal

    2010-08-18

    Dehydrins represent hydrophilic proteins acting mainly during cell dehydration and stress response. Dehydrins are generally thermostable; however, the so-called dehydrin-like (dehydrin-related) proteins show variable thermolability. Both groups immunoreact with antibodies directed against the K-segment of dehydrins. Plant mitochondrial dehydrin-like proteins are poorly characterized. The purpose of this study was to extend previous reports on plant dehydrins by comparing the level of immunoprecipitated dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress. All the analyzed plant species showed constitutive accumulation of thermostable mitochondrial putative dehydrins ranging from 50 to 70 kDa. The mitochondrial dehydrin-like proteins observed in cauliflower and Arabidopsis ranged from 10 to 100 kDa and in lupin imbibed seeds and hypocotyls--from 20 to 90 kDa. Cold treatment increased mainly the accumulation of 10-100 kDa cauliflower and Arabidopsis dehydrin-like proteins, in the patterns different in cauliflower leaf and inflorescence mitochondria. However, in lupin mitochondria, cold affected mainly 25-50 kDa proteins and seemed to induce the appearance of some novel dehydrin-like proteins. The influence of frost stress on cauliflower leaf mitochondrial dehydrin- like proteins was less significant. The impact of heat stress was less significant in lupin and Arabidopsis than in cauliflower inflorescence mitochondria. Cauliflower mitochondrial dehydrin-like proteins are localized mostly in the mitochondrial matrix; it seems that some of them may interact with mitochondrial membranes. All the results reveal an unexpectedly broad spectrum of dehydrin-like proteins accumulated during some abiotic stress in the mitochondria of the plant species analyzed. They display only limited similarity in size to those reported previously in maize, wheat and rye

  2. Prick by Prick Induced Anaphylaxis in a Patient with Peanuts and Lupine Allergy: Awareness of Risks and Role of Component Resolved Diagnosis

    Science.gov (United States)

    Ciccarelli, Anna; Calabrò, Claudia; Imperatore, Clara; Scala, Guglielmo

    2014-01-01

    A case of anaphylaxis is reported in the course of a prick by prick with Lupinus albus and roasted peanut in a 20-year-old woman. We focused on some main topics. First of all it seems important to underscore the potential risks connected to the practice of the prick-by-prick with fresh foods in allergic patients, especially when testing cross-reactive substances, such as White Lupine, peanuts, or soy. It is important that clinicians who perform prick tests be aware of the risk related with in vivo tests in allergic patients. Second, we discuss the problem of the hidden allergens, such as White Lupine flour, or soy flour which are utilized to improve wheat flour because of their lower cost. Patients with a demonstrated allergy to peanuts should be assessed for lupine allergy and informed about the “hidden allergens” issue. Finally, we believe that component resolved diagnosis, the serum specific IgE against molecular components, that is normally considered a second-level diagnostic step has an important role even as a first line approach at least in some selected cases. PMID:25477973

  3. Internalisation and multiple phosphorylation of γ-Conglutin, the lupin seed glycaemia-lowering protein, in HepG2 cells

    International Nuclear Information System (INIS)

    Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello

    2013-01-01

    Highlights: •A glycaemia-reducing lupin seed protein is internalized by HepG2 cells. •The protein accumulates in the cytosol in an intact form. •The internalized protein is multiply phosphorylated. -- Abstract: Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity

  4. FERMENTATION BY Lactobacillus paracasei OF GALACTOOLIGOSACCHARIDES AND LOW-MOLECULAR-WEIGHT CARBOHYDRATES EXTRACTED FROM SQUASH (Curcubita maxima AND LUPIN (Lupinus albus SEEDS

    Directory of Open Access Journals (Sweden)

    María I. Palacio

    2014-02-01

    Full Text Available The in vitro prebiotic activity of galactooligosaccharides (GOS and low-molecular-weight carbohydrates (LMWC extracted from lupin and squash seeds on the growth of Lactobacillus paracasei BGP1 was studied. To this end, the change in cell density after 24 h of L. paracasei growth on 1% (w/v glucose, 1% (w/v raffinose, 1% (w/v commercial inulin GR, 1% (w/v lupin extract, and 1% (w/v squash extract relative to the change in cell density of a mixture of enteric strains under the same culture conditions were evaluated. Additionally, the principal components of GOS and LMWC in the extracts were identified using Thin Layer Chromatography. The highest prebiotic activity score was for L. paracasei grown on squash extract (0.55±0.03, followed by lupin extract (0.49±0.02, inulin (0.38±0.05 and raffinose (0.37±0.05. These results will contribute to selecting plant species as potential sources of prebiotic ingredients for the development of functional foods.

  5. Effect of Enzyme Preparation with Activity Directed Towards Degradation of Non Starch Polysaccharides on Yellow Lupine Seed Based Diet for Young Broilers

    Directory of Open Access Journals (Sweden)

    Bogusław I Olkowski

    2010-01-01

    Full Text Available This work examined the impact of enzyme preparation with specific activity towards non starch polysaccharides on performance, morphological characteristics of gastrointestinal tract organs, microscopic evaluation of jejunal mucosa, and microbial status of ileum, caeca, and excreta in broilers fed a diet containing a high content of lupine meal. One-day-old chickens (Ross 308, mixed sex were randomly divided into control and experimental groups. Each group consisted of 36 birds, with 6 replications,and with 6 chickens per replication. The control group was fed the basal diet (consisting of maize and 40% of lupine, while the experimental treatment group was fed the basal diet supplemented with 0.06% commercial enzyme (Ronozyme VP. Chickens were fed diets in mash form for 4 weeks. Enzyme preparation significantly (P P P Enterobacteriaceae in caeca and excreta, and coliforms in excreta only (P < 0.01. Appropriate combination of enzyme preparations with activity towards degrading carbohydrates may offer a potential to reduce the deleterious impact of lupine in broilers.

  6. In vitro fermentation of lupin seeds (Lupinus albus) and broad beans (Vicia faba): dynamic modulation of the intestinal microbiota and metabolomic output.

    Science.gov (United States)

    Gullón, Patricia; Gullón, Beatriz; Tavaria, Freni; Vasconcelos, Marta; Gomes, Ana Maria

    2015-10-01

    Broad beans (Vicia faba) and lupin seeds (Lupinus albus) are legumes rich in a wide range of compounds, which may represent a useful dietary approach for modulating the human gut microbiome. In this work, after in vitro digestion, legume samples were used as carbon sources in anaerobic batch cultures to evaluate their impact on the intestinal microbiota composition and on their metabolic products. The fermentations were monitored by a decrease in pH, generation of short chain fatty acids (SCFA) and lactate and the changes in the dynamic bacterial populations by fluorescence in situ hybridization (FISH). The total SCFA at the end of fermentation was 81.52 mM for lupin seeds and 78.41 mM for broad beans accompanied by a decrease of the pH for both legumes. The microbial groups that increased significantly (P spp., Lactobacillus-Enterococcus, Atopobium, Bacteroides-Pretovella, Clostridium coccoides-Eubacterium rectale, Faecalibacterium prausnitzii and Roseburia intestinalis. This impact on the intestinal microbiota suggests that lupin seeds and broad beans may be used in the development of novel functional foods, which can be included in dietary strategies for human health promotion.

  7. Effect of food matrix and thermal processing on the performance of a normalised quantitative real-time PCR approach for lupine (Lupinus albus) detection as a potential allergenic food.

    Science.gov (United States)

    Villa, Caterina; Costa, Joana; Gondar, Cristina; Oliveira, M Beatriz P P; Mafra, Isabel

    2018-10-01

    Lupine is widely used as an ingredient in diverse food products, but it is also a source of allergens. This work aimed at proposing a method to detect/quantify lupine as an allergen in processed foods based on a normalised real-time PCR assay targeting the Lup a 4 allergen-encoding gene of Lupinus albus. Sensitivities down to 0.0005%, 0.01% and 0.05% (w/w) of lupine in rice flour, wheat flour and bread, respectively, and 1 pg of L. albus DNA were obtained, with adequate real-time PCR performance parameters using the ΔCt method. Both food matrix and processing affected negatively the quantitative performance of the assay. The method was successfully validated with blind samples and applied to processed foods. Lupine was estimated between 4.12 and 22.9% in foods, with some results suggesting the common practice of precautionary labelling. In this work, useful and effective tools were proposed for the detection/quantification of lupine in food products. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  9. Adaptation of H+-pumping and plasma membrane H+ ATPase activity in proteoid roots of white lupin under phosphate deficiency.

    Science.gov (United States)

    Yan, Feng; Zhu, Yiyong; Müller, Caroline; Zörb, Christian; Schubert, Sven

    2002-05-01

    White lupin (Lupinus albus) is able to adapt to phosphorus deficiency by producing proteoid roots that release a huge amount of organic acids, resulting in mobilization of sparingly soluble soil phosphate in rhizosphere. The mechanisms responsible for the release of organic acids by proteoid root cells, especially the trans-membrane transport processes, have not been elucidated. Because of high cytosolic pH, the release of undissociated organic acids is not probable. In the present study, we focused on H+ export by plasma membrane H+ ATPase in active proteoid roots. In vivo, rhizosphere acidification of active proteoid roots was vanadate sensitive. Plasma membranes were isolated from proteoid roots and lateral roots from P-deficient and -sufficient plants. In vitro, in comparison with two types of lateral roots and proteoid roots of P-sufficient plants, the following increase of the various parameters was induced in active proteoid roots of P-deficient plants: (a) hydrolytic ATPase activity, (b) Vmax and Km, (c) H+ ATPase enzyme concentration of plasma membrane, (d) H+-pumping activity, (e) pH gradient across the membrane of plasmalemma vesicles, and (f) passive H+ permeability of plasma membrane. In addition, lower vanadate sensitivity and more acidic pH optimum were determined for plasma membrane ATPase of active proteoid roots. Our data support the hypothesis that in active proteoid root cells, H+ and organic anions are exported separately, and that modification of plasma membrane H+ ATPase is essential for enhanced rhizosphere acidification by active proteoid roots.

  10. Liking of health-functional foods containing lupin kernel fibre following repeated consumption in a dietary intervention setting.

    Science.gov (United States)

    Hall, Ramon S; Baxter, Amynta L; Fryirs, Cathy; Johnson, Stuart K

    2010-10-01

    Liking of a particular food after repeated consumption may be reduced, limiting the effectiveness of health-functional foods requiring on-going consumption to deliver their benefits. This study examined the effect of repeated consumption of foods containing the novel ingredient, Australian sweet lupin (Lupinus angustifolius) kernel fibre (LKFibre) on sensory acceptability in the dietary intervention setting. In a single-blind randomised crossover 4-week intervention, participants consumed both control and equivalent LKFibre-containing products daily on separate interventions separated by a 4-week period on habitual diet. Seven products: muesli, bread, muffin, chocolate brownie, chocolate milk drink, pasta and instant mashed potato were assessed twice (days 4 and 18 of intervention), by 38 participants for appearance, texture, flavour and general acceptability using a structured graphic hedonic scale. Overall the results showed there was no reduction (P=0.594) in general acceptability of LKFibre foods after repeated consumption, suggesting potential for long-term consumption. The control food products were however generally preferred (P<0.001) over the LKFibre foods; the mean difference for general acceptability between being <6% (0.82cm) of the 15cm hedonic scale used, suggesting LKF addition did not severely affect product palatability.

  11. The Arabidopsis synaptotagmin SYTA regulates the cell-to-cell movement of diverse plant viruses

    Directory of Open Access Journals (Sweden)

    Asako eUchiyama

    2014-11-01

    Full Text Available Synaptotagmins are a large gene family in animals that have been extensively characterized due to their role as calcium sensors to regulate synaptic vesicle exocytosis and endocytosis in neurons, and dense core vesicle exocytosis for hormone secretion from neuroendocrine cells. Thought to be exclusive to animals, synaptotagmins have recently been characterized in Arabidopsis thaliana, in which they comprise a five gene family. Using infectivity and leaf-based functional assays, we have shown that Arabidopsis SYTA regulates endocytosis and marks an endosomal vesicle recycling pathway to regulate movement protein-mediated trafficking of the Begomovirus Cabbage leaf curl virus (CaLCuV and the Tobamovirus Tobacco mosaic virus (TMV through plasmodesmata (Lewis and Lazarowitz, 2010. To determine whether SYTA has a central role in regulating the cell-to-cell trafficking of a wider range of diverse plant viruses, we extended our studies here to examine the role of SYTA in the cell-to-cell movement of additional plant viruses that employ different modes of movement, namely the Potyvirus Turnip mosaic virus (TuMV, the Caulimovirus Cauliflower mosaic virus (CaMV and the Tobamovirus Turnip vein clearing virus (TVCV, which in contrast to TMV does efficiently infect Arabidopsis. We found that both TuMV and TVCV systemic infection, and the cell-to-cell trafficking of the their movement proteins, were delayed in the Arabidopsis Col-0 syta-1 knockdown mutant. In contrast, CaMV systemic infection was not inhibited in syta-1. Our studies show that SYTA is a key regulator of plant virus intercellular movement, being necessary for the ability of diverse cell-to-cell movement proteins encoded by Begomoviruses (CaLCuV MP, Tobamoviruses (TVCV and TMV 30K protein and Potyviruses (TuMV P3N-PIPO to alter PD and thereby mediate virus cell-to-cell spread.

  12. LegumeDB1 bioinformatics resource: comparative genomic analysis and novel cross-genera marker identification in lupin and pasture legume species.

    Science.gov (United States)

    Moolhuijzen, P; Cakir, M; Hunter, A; Schibeci, D; Macgregor, A; Smith, C; Francki, M; Jones, M G K; Appels, R; Bellgard, M

    2006-06-01

    The identification of markers in legume pasture crops, which can be associated with traits such as protein and lipid production, disease resistance, and reduced pod shattering, is generally accepted as an important strategy for improving the agronomic performance of these crops. It has been demonstrated that many quantitative trait loci (QTLs) identified in one species can be found in other plant species. Detailed legume comparative genomic analyses can characterize the genome organization between model legume species (e.g., Medicago truncatula, Lotus japonicus) and economically important crops such as soybean (Glycine max), pea (Pisum sativum), chickpea (Cicer arietinum), and lupin (Lupinus angustifolius), thereby identifying candidate gene markers that can be used to track QTLs in lupin and pasture legume breeding. LegumeDB is a Web-based bioinformatics resource for legume researchers. LegumeDB analysis of Medicago truncatula expressed sequence tags (ESTs) has identified novel simple sequence repeat (SSR) markers (16 tested), some of which have been putatively linked to symbiosome membrane proteins in root nodules and cell-wall proteins important in plant-pathogen defence mechanisms. These novel markers by preliminary PCR assays have been detected in Medicago truncatula and detected in at least one other legume species, Lotus japonicus, Glycine max, Cicer arietinum, and (or) Lupinus angustifolius (15/16 tested). Ongoing research has validated some of these markers to map them in a range of legume species that can then be used to compile composite genetic and physical maps. In this paper, we outline the features and capabilities of LegumeDB as an interactive application that provides legume genetic and physical comparative maps, and the efficient feature identification and annotation of the vast tracks of model legume sequences for convenient data integration and visualization. LegumeDB has been used to identify potential novel cross-genera polymorphic legume

  13. Structure, expression profile and phylogenetic inference of chalcone isomerase-like genes from the narrow-leafed lupin (Lupinus angustifolius L. genome

    Directory of Open Access Journals (Sweden)

    Łucja ePrzysiecka

    2015-04-01

    Full Text Available Lupins, like other legumes, have a unique biosynthesis scheme of 5-deoxy-type flavonoids and isoflavonoids. A key enzyme in this pathway is chalcone isomerase (CHI, a member of CHI-fold protein family, encompassing subfamilies of CHI1, CHI2, CHI-like (CHIL, and fatty acid-binding (FAP proteins. Here, two Lupinus angustifolius (narrow-leafed lupin CHILs, LangCHIL1 and LangCHIL2, were identified and characterized using DNA fingerprinting, cytogenetic and linkage mapping, sequencing and expression profiling. Clones carrying CHIL sequences were assembled into two contigs. Full gene sequences were obtained from these contigs, and mapped in two L. angustifolius linkage groups by gene-specific markers. Bacterial artificial chromosome fluorescence in situ hybridization approach confirmed the localization of two LangCHIL genes in distinct chromosomes. The expression profiles of both LangCHIL isoforms were very similar. The highest level of transcription was in the roots of the third week of plant growth; thereafter, expression declined. The expression of both LangCHIL genes in leaves and stems was similar and low. Comparative mapping to reference legume genome sequences revealed strong syntenic links; however, LangCHIL2 contig had a much more conserved structure than LangCHIL1. LangCHIL2 is assumed to be an ancestor gene, whereas LangCHIL1 probably appeared as a result of duplication. As both copies are transcriptionally active, questions arise concerning their hypothetical functional divergence. Screening of the narrow-leafed lupin genome and transcriptome with CHI-fold protein sequences, followed by Bayesian inference of phylogeny and cross-genera synteny survey, identified representatives of all but one (CHI1 main subfamilies. They are as follows: two copies of CHI2, FAPa2 and CHIL, and single copies of FAPb and FAPa1. Duplicated genes are remnants of whole genome duplication which is assumed to have occurred after the divergence of Lupinus, Arachis

  14. Morphological aspects of starch and cell wall material mobilization in developing lupine cotyledons and the effect of kinetin on these processes

    Directory of Open Access Journals (Sweden)

    Fortunat Młodzianowski

    2015-01-01

    Full Text Available In the cotyledons of dry lupine seeds the presence of starch was not demonstrated. Its formation during seed imbibition in darkness is accompanied by a reduction in the thickness of cell walls containing hemicelluloses. It is believed that the products of hemicellulose hydrolysis, particullarily in isolated cotyledons, arę the main source of materials for the synthesis of starch, In the process of cell wall decomposition the invaginations of plasmalemma appear to be involved. Kinetin enhance the hydrolysis of cell walls and the mobilization of starch in isolated cotyledons.

  15. Digestion of polysaccharides, protein and lipids by adult cockerels fed on diets containing a pectic cell-wall material from white lupin (Lupinus albus L.) cotyledon.

    Science.gov (United States)

    Carré, B; Leclercq, B

    1985-11-01

    1. The cell-wall material of white lupin (Lupinus albus L.) cotyledon is characterized by low contents of cellulose (47 g/kg) and lignin (17 g/kg) and a high content of pectic substances (710 g/kg). The digestion of lupin cell-wall material by adult cockerels was estimated using gas-liquid chromatographic analyses of alditol acetates derived from polysaccharide sugars. The analyses were performed in the destarched water-insoluble fractions of feed and excreta. Digestibility measurements were carried out using a 3 d balance period including a 2 d feeding period and a 24 h final starvation period. 2. In the first experiment, six animals were given a diet containing 510 g white lupin cotyledon flour/kg which was the only source of protein and cell walls in the diet. The apparent digestibility of cell-wall components was near zero. 3. In the second experiment, three diets were prepared by diluting a fibre-free basal diet (diet A) by a semi-purified cell-wall preparation introduced at two different levels: 100 g/kg (diet B) and 200 g/kg (diet C). The semi-purified cell walls were prepared from the white lupin cotyledon flour used in the first experiment. The true digestibilities of polysaccharides measured in birds given diets B and C were near zero. It is suggested that the measurement of the neutral-detergent fibre (NDF) content according to Van Soest & Wine (1967) is not a suitable procedure for estimating the undigestible fibre content in poultry nutrition as the cell-wall pectic substances are not included in the NDF measurement. 4. Addition of the semi-purified cell-wall preparation (Expt 2) resulted in a slight decrease in the apparent protein digestibility. This decrease might be explained by the addition of undigestible cell-wall protein. 5. Addition of the semi-purified cell-wall preparation (Expt 2) had no effect on the apparent lipid digestibility. 6. The metabolizable energy values of the basal diet fraction of diets B and C were calculated assuming that

  16. CREATION OF MATHEMATICAL MODEL OF EXTRACTION BY CHEESE WHEY FROM A LUPINE IN THE FORM OF A PLATE

    Directory of Open Access Journals (Sweden)

    Y. I. Shishatskii

    2015-01-01

    Full Text Available Prerequisites for creation of model are stated. At a problem definition consideration of a particle of a lupine as unlimited plate is proved. The main assumptions are formulated, regional conditions are written out. Partial solutions of the differential equation, and also the common decision for the current value of a concentration pressure С'(x,у. Distribution of concentration is symmetric concerning ordinate axis. Final expression for a field of concentration at extraction of a flat plate in a dimensionless look is written out. It is shown that distribution of concentration is rather precisely described by the first member of a row. Th e conclusion is drawn that for any timepoint under the set boundary conditions the field of concentration has an appearance of a symmetric curve with a maximum on a plate axis (Х=0. For each subsequent timepoint there will be the curve which is monotonously decreasing to a plate surface. It is proved that it is possible to define nature of change of concentration in a body at a preset value the case when strives for infinity at the set physical parameters, thickness of a plate and the organization of high intensity of branch of extractive substances from a surface Is considered. For this case the equations of rather dimensionless concentration and Fourier's numb er are received. Also the equation for definition of final time of extraction is written out. It is shown that the received solutions of the eq uations of model are found in a good consent with experimental data.

  17. Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia.

    Science.gov (United States)

    Al-Shahwan, I M; Abdalla, O A; Al-Saleh, M A; Amer, M A

    2017-09-01

    A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus , Convolvulus arvensis , Malva parviflora , Rubus fruticosus , Hippuris vulgaris , and Flaveria trinervia . These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata , Solanum tuberosum , Solanum melongena , Phaseolus vulgaris , Cucurbita maxima , Capsicum annuum , and Vicia faba . The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV) {12.5 and 4.5%}, Lucerne transient streak virus (LTSV) {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV) {1.4 and 4.5%}, Bean common mosaic virus (BCMV) {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV) {1.2 and 4%}, White clover mosaic virus (WCIMV) {1.0 and 5%}, Cucumber mosaic virus (CMV) {0.8 and 3%}, Pea streak virus (PeSV) {0.4 and 4.5%} and Tobacco streak virus (TSV) {0.3 and 2.5%}. Alfalfa mosaic virus (AMV), the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV) was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

  18. Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    I.M. Al-Shahwan

    2017-09-01

    Full Text Available A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus, Convolvulus arvensis, Malva parviflora, Rubus fruticosus, Hippuris vulgaris, and Flaveria trinervia. These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata, Solanum tuberosum, Solanum melongena, Phaseolus vulgaris, Cucurbita maxima, Capsicum annuum, and Vicia faba. The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV {12.5 and 4.5%}, Lucerne transient streak virus (LTSV {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV {1.4 and 4.5%}, Bean common mosaic virus (BCMV {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV {1.2 and 4%}, White clover mosaic virus (WCIMV {1.0 and 5%}, Cucumber mosaic virus (CMV {0.8 and 3%}, Pea streak virus (PeSV {0.4 and 4.5%} and Tobacco streak virus (TSV {0.3 and 2.5%}. Alfalfa mosaic virus (AMV, the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

  19. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  20. Internalisation and multiple phosphorylation of γ-Conglutin, the lupin seed glycaemia-lowering protein, in HepG2 cells.

    Science.gov (United States)

    Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello

    2013-08-09

    Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Identification of a low digestibility δ-Conglutin in yellow lupin (Lupinus luteus L.) seed meal for atlantic salmon (Salmo salar L.) by coupling 2D-PAGE and mass spectrometry.

    Science.gov (United States)

    Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J

    2013-01-01

    The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.

  2. Transcriptome analysis of Nicotiana tabacum infected by Cucumber mosaic virus during systemic symptom development.

    Directory of Open Access Journals (Sweden)

    Jie Lu

    Full Text Available Virus infection of plants may induce a variety of disease symptoms. However, little is known about the molecular mechanism of systemic symptom development in infected plants. Here we performed the first next-generation sequencing study to identify gene expression changes associated with disease development in tobacco plants (Nicotiana tabacum cv. Xanthi nc induced by infection with the M strain of Cucumber mosaic virus (M-CMV. Analysis of the tobacco transcriptome by RNA-Seq identified 95,916 unigenes, 34,408 of which were new transcripts by database searches. Deep sequencing was subsequently used to compare the digital gene expression (DGE profiles of the healthy plants with the infected plants at six sequential disease development stages, including vein clearing, mosaic, severe chlorosis, partial and complete recovery, and secondary mosaic. Thousands of differentially expressed genes were identified, and KEGG pathway analysis of these genes suggested that many biological processes, such as photosynthesis, pigment metabolism and plant-pathogen interaction, were involved in systemic symptom development. Our systematic analysis provides comprehensive transcriptomic information regarding systemic symptom development in virus-infected plants. This information will help further our understanding of the detailed mechanisms of plant responses to viral infection.

  3. Kisaran Inang dan Keragaman Gejala Infeksi Turnip Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Eliza Suryati Rusli

    2007-07-01

    Full Text Available The incidence of mosaic disease on vegetable crops in Indonesia has been reported recently. The disease is caused by TuMV which is considered as a new and important virus on caisin and turnip in Indonesia. Field survey has been conducted to determine disease incidence in vegetable growing areas. Symptom variability and host range of TuMV was further studied through mechanical inoculation to cruciferae and solanaceae plants. Observation during field survey has proved that TuMV has infected caisin and turnip in Java and Bali. The highest intensity of mosaic disease i.e. 63,3% occurs in Tumpangan-Malang, followed by Denpasar Selatan and Bandungan-Semarang with the intensity of 30,5% and 19,0% respectively. TuMV infection causes different types of symptoms, such as: wrinkled leaf, blistered leaf, vein banding, vein clearing, leaf distortion and proliferation. The host range of TuMV involves those plants belong to cruciferae (cabbage, broccoli, caisin, turnip, cauliflower, chinese cabbage, pak coy; solanaceae (N. tabacum, N. benthamiana, N. glutinosa; and chenopodiaceae (C. amaranticolor. Furthermore, N. glutinosa can be used as differential host for TuMV isolates.

  4. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  5. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  6. Molecular characterization of a divergent strain of calla lily chlorotic spot virus infecting celtuce (Lactuca sativa var. augustana) in China.

    Science.gov (United States)

    Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei

    2018-05-01

    Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].

  7. Identification of a Low Digestibility δ-Conglutin in Yellow Lupin (Lupinus luteus L.) Seed Meal for Atlantic Salmon (Salmo salar L.) by Coupling 2D-PAGE and Mass Spectrometry

    Science.gov (United States)

    Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J.

    2013-01-01

    The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein. PMID:24278278

  8. Identification of a low digestibility δ-Conglutin in yellow lupin (Lupinus luteus L. seed meal for atlantic salmon (Salmo salar L. by coupling 2D-PAGE and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Takahiro Ogura

    Full Text Available The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.

  9. Chikungunya virus

    Science.gov (United States)

    Chikungunya virus infection; Chikungunya ... Where Chikungunya is Found Before 2013, the virus was found in Africa, Asia, Europe, and the Indian and Pacific oceans. In late 2013, outbreaks occurred for the first time in the ...

  10. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  11. Zika Virus

    Science.gov (United States)

    ... Funding CDC Activities For Healthcare Providers Clinical Evaluation & Disease Sexual Transmission HIV Infection & Zika Virus Testing for Zika Test Specimens – At Time of Birth Diagnostic Tests Understanding Zika Virus Test Results ...

  12. Raw and extruded pea (Pisum sativum and lupin (Lupinus albusvar. Multitalia seeds as protein sources in weaned piglets’ diets: effect on growth rate and blood parameters

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The 42 days trial was carried out using 140 piglets weaned at 28 days of age. The piglets were allocated according to  weight and sex to the 5 dietary treatments with 7 replicates for each treatments (4 pens x 4 castrated males and 3 pens  x 4 females. The piglets were fed according to the following experimental design: 1 control diet (CTR with soybean  meal (SBM 44% c.p. as protein source; 2 CRT diets with 200 g/kg of raw pea (Pisum sativum (RP; 3 CTR diet with  200 g/kg extruded pea (EP; 4 CRT diet with 170 g/kg raw lupin (Lupinus albusvar. Multitalia (RL; 5 CTR diet with  170 g/kg of extruded lupin (EL. During the trial, animals were weighed at 0 - 21 and 42 days from the start of the trial.  Feed intake was monitored and feed conversion ratio was calculated for the periods 0-21 d and 22-42 d. At the end of  the trial, blood samples were taken for 14 animals for each dietary treatment (2 animals per replicate and analysed for  total protein, urea and liver activity (ALT, AST and ALP parameters. Average daily weight gain and feed intake did not  differ according to dietary treatments whereas during the total experimental period (0-42 d, feed conversion ratio was  higher for EP vsCTR diet (2.35 vs2.09, respectively; P   compared with diets containing the raw ingredients did not differ. Feed conversion ratio for the RP was numerically high-  er than for the EP (2.35 vs2.16 and 2.76 vs2.32, respectively during 22-42 d and 0-42 d periods. Blood parameters  did not show significant difference among dietary treatments except for higher total protein for CTR diet vsRL diet, EL  and RP (67.3 vs62.2, 62.8 and 63.6 g/l, respectively; PvsRL  and RL (4.7 vs3.7 and 3.8 mmol/l respectively; P 

  13. Screening for sweet potato (Ipomoea batatas (L.)) viruses and their elimination using thermotheraphy-meristem tip culture technique

    International Nuclear Information System (INIS)

    Arkorful, E.

    2012-11-01

    Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were

  14. Transcriptome sequencing of different narrow-leafed lupin tissue types provides a comprehensive uni-gene assembly and extensive gene-based molecular markers

    Science.gov (United States)

    Kamphuis, Lars G; Hane, James K; Nelson, Matthew N; Gao, Lingling; Atkins, Craig A; Singh, Karam B

    2015-01-01

    Narrow-leafed lupin (NLL; Lupinus angustifolius L.) is an important grain legume crop that is valuable for sustainable farming and is becoming recognized as a human health food. NLL breeding is directed at improving grain production, disease resistance, drought tolerance and health benefits. However, genetic and genomic studies have been hindered by a lack of extensive genomic resources for the species. Here, the generation, de novo assembly and annotation of transcriptome datasets derived from five different NLL tissue types of the reference accession cv. Tanjil are described. The Tanjil transcriptome was compared to transcriptomes of an early domesticated cv. Unicrop, a wild accession P27255, as well as accession 83A:476, together being the founding parents of two recombinant inbred line (RIL) populations. In silico predictions for transcriptome-derived gene-based length and SNP polymorphic markers were conducted and corroborated using a survey assembly sequence for NLL cv. Tanjil. This yielded extensive indel and SNP polymorphic markers for the two RIL populations. A total of 335 transcriptome-derived markers and 66 BAC-end sequence-derived markers were evaluated, and 275 polymorphic markers were selected to genotype the reference NLL 83A:476 × P27255 RIL population. This significantly improved the completeness, marker density and quality of the reference NLL genetic map. PMID:25060816

  15. Linking development and determinacy with organic acid efflux from proteoid roots of white lupin grown with low phosphorus and ambient or elevated atmospheric CO{sub 2} concentration

    Energy Technology Data Exchange (ETDEWEB)

    Watt, M.; Evans, J.R.

    1999-07-01

    White lupin (Lupinus albus L.) was grown in hydroponic culture with 1 {micro}M phosphorus to enable the development of proteoid roots to be observed in conjunction with organic acid exudation. Discrete regions of closely spaced, determinate secondary laterals emerged in near synchrony on the same plant. One day after reaching their final length, citrate exudation occurred over a 3-d pulse. The rate of exudation varied diurnally, with maximal rates during the photoperiod. At the onset of citrate efflux, rootlets had exhausted their apical meristems and had differentiated root hairs and vascular tissues along their lengths. Neither in vitro phosphoenolpyruvate carboxylase nor citrate synthase activity was correlated with the rate of citrate exudation. The authors suggest that an unidentified transport process, presumably at the plasma membrane, regulates citrate efflux. Growth with elevated atmospheric [CO{sub 2}] promoted earlier onset of rootlet determinacy by 1 d, resulting in shorter rootlets and citrate export beginning 1 d earlier as a 2-d diurnal pulse. Citrate was the dominant organic acid exported, and neither the rate of exudation per unit length of root nor the composition of exudate was altered by atmospheric [CO{sub 2}].

  16. The First Genetic and Comparative Map of White Lupin (Lupinus albus L.): Identification of QTLs for Anthracnose Resistance and Flowering Time, and a Locus for Alkaloid Content

    Science.gov (United States)

    Phan, Huyen T. T.; Ellwood, Simon R.; Adhikari, Kedar; Nelson, Matthew N.; Oliver, Richard P.

    2007-01-01

    Abstract We report the first genetic linkage map of white lupin (Lupinus albus L.). An F8 recombinant inbred line population developed from Kiev mutant × P27174 was mapped with 220 amplified fragment length polymorphism and 105 gene-based markers. The genetic map consists of 28 main linkage groups (LGs) that varied in length from 22.7 cM to 246.5 cM and spanned a total length of 2951 cM. There were seven additional pairs and 15 unlinked markers, and 12.8% of markers showed segregation distortion at P anthracnose resistance, flowering time, and alkaloid content allowed loci governing these traits to be defined. Two quantitative trait loci (QTLs) with significant effects were identified for anthracnose resistance on LG4 and LG17, and two QTLs were detected for flowering time on the top of LG1 and LG3. Alkaloid content was mapped as a Mendelian trait to LG11. PMID:17526914

  17. A label-free internal standard method for the differential analysis of bioactive lupin proteins using nano HPLC-Chip coupled with Ion Trap mass spectrometry.

    Science.gov (United States)

    Brambilla, Francesca; Resta, Donatella; Isak, Ilena; Zanotti, Marco; Arnoldi, Anna

    2009-01-01

    Quantitative proteomics based on MS is useful for pointing out the differences in some food proteomes relevant to human nutrition. Stable isotope label-free (SIF) techniques are suitable for comparing an unlimited number of samples by the use of relatively simple experimental workflows. We have developed an internal standard label-free method based on the intensities of peptide precursor ions from MS/MS spectra, collected in data dependent runs, for the simultaneous qualitative characterization and relative quantification of storage proteins of Lupinus albus seeds in protein extracts of four lupin cultivars (cv Adam, Arés, Lucky, Multitalia). The use of an innovative microfluidic system, the HPLC-Chip, coupled with a classical IT mass spectrometer, has allowed a complete qualitative characterization of all proteins. In particular, the homology search mode has permitted to identify single amino acid substitutions in the sequences of vicilins (beta-conglutin precursor and vicilin-like protein). The MS/MS sequencing of substituted peptides confirms the high heterogeneity of vicilins according to the peculiar characteristics of the vicilin-encoding gene family. Two suitable bioinformatics parameters were optimized for the differential analyses of the main bioactive proteins: the "normalized protein average of common reproducible peptides" (N-ACRP) for gamma-conglutin, which is a homogeneous protein, and the "normalized protein mean peptide spectral intensity" (N-MEAN) for the highly heterogenous class of the vicilins.

  18. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    explore the potential of this infection crossing the species barrier and thereby .... The virus targets mainly the brain of the unborn animal resulting in neurological ... The virus is located in the blood of the adult infected animal or in the central ...

  20. Zika Virus

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Zika Virus Credit: NIAID A female Aedes mosquito. This type of mosquito can transmit Zika, ... transmitted to humans through the bite of infected Aedes aegypti mosquitoes. Zika virus can be transmitted from an infected pregnant woman ...

  1. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  2. Pea seeds (Pisum sativum, faba beans (Vicia fabavar. minor and lupin seeds (Lupinus albus var. multitalia as protein sources in broiler diets: effect of extrusion on growth performance

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The effect of extrusion of pea seeds (Pisum sativum (PS, faba bean (Vicia faba, variety minor (FB and lupin seeds (Lupinus albus, variety multitalia (LS on broiler performance were evaluated. Four hundred sixty two 1d-old Ross male chicks, Marek vaccinated, were randomly assigned to seven dietary treatments (3 pens per treatment/22 birds per pen. Chicks were floor housed, ad libitum fed isocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the base diet (control diet was corn (48.8%, 53.7% and 57%, solvent-extracted soy- bean meal (42.8%, 37.3% and 33.4%, corn oil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The amounts of PS, FB and LS used on an as fed basis were: PS and extruded PS (EPS: 353 (1-10d-old, 356 (11-28d-old and 350 (29- 42d-old g/kg; FB and extruded FB (EFB: 479 (1-10d-old, 497 (11-28d-old and 500 (29-42d old g/kg; LS and extrud- ed LS (ELS: 360 (1-10d-old and 300 (11-42d-old g/kg. High levels of pea (350 g/kg and faba bean (500 g/kg did not show negative effects on body weight gain (BWG and bird feed intake compared to control. Lupin at the 300 g/kg level reduced (P< 0.05 the BWG during the finishing period (22 to 42 d, however the effect disappeared over the whole experimental period (1-42 d compared to the control group. The ELS group had a lower (P< 0.01 feed intake com- pared to the control group and to the LS group. The feed conversion rate (FCR was similar among groups for the whole experimental period; however during the grower period the FCR was higher (P< 0.05 for the PS, FB and EFB groups com- pared to the control group. Birds consuming the PS diet had a reduced (P< 0.05 eviscerated carcass yield compared to the control group. The breast meat percent yield was higher (P< 0.01 for birds consuming the FB and EFB diets compared to the control

  3. Potato virus Y (PVY) Isolates from Physalis peruviana are Unable to Systemically Infect Potato or Pepper and Form a Distinct New Lineage Within the PVYC Strain Group.

    Science.gov (United States)

    Green, Kelsie J; Chikh-Ali, Mohamad; Hamasaki, Randall T; Melzer, Michael J; Karasev, Alexander V

    2017-11-01

    Poha, or cape gooseberry (Physalis peruviana L.), is a plant species cultivated in Hawaii for fresh fruit production. In 2015, an outbreak of virus symptoms occurred on poha farms in the South Kohala District of the island of Hawaii. The plants displayed mosaic, stunting, and leaf deformation, and produced poor fruit. Initial testing found the problem associated with Potato virus Y (PVY) infection. Six individual PVY isolates, named Poha1 to Poha6, were collected from field-grown poha plants and subjected to biological and molecular characterization. All six isolates induced mosaic and vein clearing in tobacco, and three of them exhibited O-serotype while the other three reacted only with polyclonal antibodies and had no identifiable serotype. Until now, PVY isolates have been broadly divided into pepper or potato adapted; however, these six PVY isolates from poha were unable to establish systemic infection in pepper and in four tested potato cultivars. Whole-genome sequences for the six isolates were determined, and no evidence of recombination was found in any of them. Phylogenetic analysis placed poha PVY isolates in a distinct, monophyletic "Poha" clade within the PVY C lineage, suggesting that they represented a novel, biologically and evolutionarily unique group. The genetic diversity within this poha PVY C clade was unusually high, suggesting a long association of PVY C with this solanaceous host or a prolonged geographical separation of PVY C in poha in Hawaii.

  4. Effects of dehulling, steam-cooking and microwave-irradiation on digestive value of white lupin (Lupinus albus) seed meal for rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar).

    Science.gov (United States)

    Saez, Patricio; Borquez, Aliro; Dantagnan, Patricio; Hernández, Adrián

    2015-01-01

    A digestibility trial was conducted to assess the effect of dehulling, steam-cooking and microwave-irradiation on the apparent digestibility of nutrients in white lupin (Lupinus albus) seed meal when fed to rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Six ingredients, whole lupin seed meal (LSM), dehulled LSM, dehulled LSM steam-cooked for 15 or 45 min (SC15 and SC45, respectively) and LSM microwave-irradiated at 375 or 750 W (MW375 and MW750, respectively), were evaluated for digestibility of dry matter, crude protein (CP), lipids, nitrogen-free extractives (NFE) and gross energy (GE). The diet-substitution approach was used (70% reference diet + 30% test ingredient). Faeces from each tank were collected using a settlement column. Dehulled LSM showed higher levels of proximate components (except for NFE and crude fibre), GE and phosphorus in comparison to whole LSM. Furthermore, SC15, SC45, MW375 and MW750 showed slight variations of chemical composition in comparison to dehulled LSM. Results from the digestibility trial indicated that dehulled LSM, SC15, SC45 and MW375 are suitable processing methods for the improvement of nutrients' apparent digestibility coefficient (ADC) in whole LSM. MW750 showed a lower ADC of nutrients (except for CP and lipids for rainbow trout) in comparison with MW350 for rainbow trout and Atlantic salmon, suggesting a heat damage of the ingredient when microwave-irradiation exceeded 350 W.

  5. Ganjam virus.

    Science.gov (United States)

    Sudeep, A B; Jadi, R S; Mishra, A C

    2009-11-01

    Ganjam virus (GANV), a member of genus Nairovirus of family Bunyavirdae is of considerable veterinary importance in India. Though, predominantly tick borne, GANV was also isolated from mosquitoes, man and sheep. Neutralizing and complement fixing antibodies to GANV have been detected in animal and human sera collected from different parts of the country. Thirty three strains of GANV have been isolated from India, mainly from Haemaphysalis ticks. The virus replicated in certain vertebrate and mosquito cell lines and found pathogenic to laboratory animals. One natural infection and five laboratory-acquired infections in men were also reported. GANV is antigenically related to Nairobi sheep disease virus (NSDV) of Africa, which is highly pathogenic for sheep and goats causing 70-90 per cent mortality among the susceptible population. Recent molecular studies have demonstrated that GANV is an Asian variant of NSDV and both these viruses are related to the dreaded Crimean Congo haemorrhagic fever (CCHF) group viruses. The versatility of the virus to replicate in different arthropod species, its ability to infect sheep, goat and man makes it an important zoonotic agent.

  6. Powassan (POW) Virus Basics

    Science.gov (United States)

    ... Health Professionals Related Topics For International Travelers Powassan Virus Disease Basics Download this fact sheet formatted for ... Virus Disease Fact Sheet (PDF) What is Powassan virus? Powassan virus is a tickborne flavivirus that is ...

  7. Raw Pea (Pisum sativum, raw Faba bean (Vicia faba var. minor and raw Lupin (Lupinus albus var. multitalia as alternative protein sources in broiler diets

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The ban of the meat and bone meal for entering animal diets and the concern of transgenic feeds poses a challenge toanimal nutritionists in Europe. The challenge is to find homegrown protein-rich feedstuffs, making sure no antinutritionalfactors are present which could interfere in the animals’ performance. The raw Pea (Pisum sativum (RP, raw Fababean (Vicia faba, variety minor (RFb and raw Lupin (Lupinus albus, variety multitalia (RL were evaluated as alternativeprotein sources into broiler diets. Six hundred thirty 1d-old Ross male chicks, Marek vaccinated, were randomlyassigned to seven dietary treatments (5 pens per treatment/18 birds per pen. Chicks were floor housed, ad libitum fedisocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the basediet (control diet was corn (48.7%, 56.6% and 57%, solvent-extracted soybean meal (42.8%, 37.3% and 33.4%, cornoil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The RP, RFb and RL entered diets in substitution of the soybeanand corn according to the cost optimization (P100, Fb100 and L100, respectively for RP, RFb and RL and at half of theoptimized quantity (RP50, RFb50 and RL50, respectively for RP, RFb and RL. The amount used as fed basis for the higherlevel of inclusion were: P100: 350 g/kg for all diets; Fb100: 480 g/kg (1-10d-old and 500 g/kg (11-42d-old; L100:360 g/kg (1-10d-old and 300 g/kg (11-42d-old. The average daily gain (ADG were lower (P compared to the control group. Over the whole period of growth, the RFb group had similar ADG compared to the controlgroup and for both levels of inclusion, whereas reduced (P (P growth. Birds performance was improved (P and breast and leg quarter cuts. The RFb and RL could represent valuable protein feeds in broilers diet formulation.

  8. Ebola Virus

    Directory of Open Access Journals (Sweden)

    Anusha Rangare Lakshman

    2015-09-01

    Full Text Available The disease Ebola takes its name from the Ebola River situated near a village in the Democratic Republic of Congo, where the disease first appeared in 1976. It is caused by a virus from the Filoviridae family (filovirus. The present outbreak of Ebola Virus Disease (EVD concerns four countries in West Africa, namely Guinea, Liberia, Sierra Leone and Nigeria till date. Further to widespread transmission of the disease, it has been declared as a Public Health Emergency of International Concern by the World Health Organisation on 8 August 2014. As of 4 August 2014, countries have reported 1,711 cases (1,070 confirmed, 436 probable, 205 suspect, including 932 deaths. This review paper enlightens about the awareness of Ebola virus and its preventive measures. [Archives Medical Review Journal 2015; 24(3.000: 296-305

  9. SARS virus

    Indian Academy of Sciences (India)

    ... consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion. < 300 compounds screened. Glycyrrhizin (liquorics/mullatha) seems attractive. Antivirals not effective. Vaccines – animal model only in monkeys. Killed corona or knockout weakened virus as targets.

  10. Influenza (Flu) Viruses

    Science.gov (United States)

    ... Types Seasonal Avian Swine Variant Pandemic Other Influenza (Flu) Viruses Language: English (US) Español Recommend on Facebook ... influenza circulate and cause illness. More Information about Flu Viruses Types of Influenza Viruses Influenza A and ...

  11. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  12. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  13. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  14. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  15. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  16. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  17. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  18. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  19. Determination of the complete nucleotide sequence of a lupine potyvirus isolate from the Czech Republic reveals that it belongs to a new member of the genus Potyvirus

    Czech Academy of Sciences Publication Activity Database

    Sarkisova, Tatiana; Petrzik, Karel

    2011-01-01

    Roč. 156, č. 1 (2011), s. 167-169 ISSN 0304-8608 R&D Projects: GA MZe QH71145 Institutional research plan: CEZ:AV0Z50510513 Keywords : plants * virus * motif Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

  20. Epstein - Barr Virus

    OpenAIRE

    Štorkánová, Lenka

    2011-01-01

    Epstein-Barr virus Bachelor thesis summarizes the findings of Epstein-Barr virus (EBV), its general characteristics, transmission and spread of the virus, symptoms of disease and subsequent therapy and recovery. More specifically, it focuses on infectious mononucleosis, as well as more generally to other diseases, which the Epstein-Barr virus causes. It includes details of the vaccine against EB virus. There are the statistics on the incidence of infectious mononucleosis.

  1. Virus-Vectored Influenza Virus Vaccines

    Science.gov (United States)

    Tripp, Ralph A.; Tompkins, S. Mark

    2014-01-01

    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  2. Viruses infecting reptiles.

    Science.gov (United States)

    Marschang, Rachel E

    2011-11-01

    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  3. Viruses Infecting Reptiles

    Directory of Open Access Journals (Sweden)

    Rachel E. Marschang

    2011-11-01

    Full Text Available A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  4. Zika virus disease

    Directory of Open Access Journals (Sweden)

    Adel I Al-Afaleq

    2017-01-01

    Full Text Available The Zika virus is an arbovirus belonging to the virus family Flaviviridae. The virus was isolated in 1947 from a rhesus monkey in the Zika Forest of Uganda. The virus causes sporadic mild human infections in Africa and later in Asia. However, by 2007 a major shift in its infection pattern was noticed and thousands of human infections were reported in the State of Yap and Federated States of Micronesia. In the last 3 years, major outbreaks have continued to occur and the virus has spread to several Pacific and American countries. These outbreaks were mostly asymptomatic; however, there were more severe clinical signs associated with the infections. Those signs included microcephaly and Guillain–Barre syndrome. It is believed that various species of mosquitoes can biologically transmit the virus. However, Aedes aegypti is most widely associated with the Zika virus. Recently, new modes of virus transmission have been reported, including mother-to-fetus, sexual, blood transfusion, animal bites, laboratory exposure and breast milk. Differential diagnosis is very important as some other arboviruses such as yellow fever virus, West Nile virus, dengue virus, and chikungunya virus have similar clinical manifestations to the Zika virus infection as well as relating serologically to some of these viruses. Established laboratory diagnostic tests to detect the Zika virus are limited, with reverse transcription polymerase chain reaction being the most widely used test. Taking into consideration the quickness of the spread of infection, size of the infected population and change of the infection severity pattern, the Zika virus infection merits collective efforts on all levels to prevent and control the disease. Limited research work and data, concurrent infection with other arboviruses, involvement of biological vectors, mass crowd events, human and trade movements and lack of vaccines are some of the challenges that we face in our efforts to prevent and

  5. Ebola (Ebola Virus Disease)

    Science.gov (United States)

    ... Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is not ... gov . Recommend on Facebook Tweet Share Compartir Ebola Virus Disease (EVD) is a rare and deadly disease ...

  6. Hepatitis virus panel

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003558.htm Hepatitis virus panel To use the sharing features on this page, please enable JavaScript. The hepatitis virus panel is a series of blood tests used ...

  7. Viruses and Breast Cancer

    Science.gov (United States)

    Lawson, James S.; Heng, Benjamin

    2010-01-01

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix. PMID:24281093

  8. Zika virus disease

    Science.gov (United States)

    ... May 2015, the virus was discovered for the first time in Brazil. It has now spread to many territories, states, and countries in: Caribbean Islands Central America Mexico South America Pacific Islands Africa The virus ...

  9. Respiratory Syncytial Virus

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Respiratory Syncytial Virus (RSV) Credit: CDC This is the ... the United States. Why Is the Study of Respiratory Syncytial Virus (RSV) a Priority for NIAID? In ...

  10. Respiratory syncytial virus (RSV)

    Science.gov (United States)

    RSV; Palivizumab; Respiratory syncytial virus immune globulin; Bronchiolitis - RSV ... Crowe JE. Respiratory syncytial virus. In: Kliegman RM, Stanton BF, St. Geme JW, Schor NF, eds. Nelson Textbook of Pediatrics . 20th ...

  11. Viruses and Breast Cancer

    International Nuclear Information System (INIS)

    Lawson, James S.; Heng, Benjamin

    2010-01-01

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix

  12. Viruses and Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, James S., E-mail: james.lawson@unsw.edu.au; Heng, Benjamin [School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney (Australia)

    2010-04-30

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix.

  13. Zika Virus - Multiple Languages

    Science.gov (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Zika Virus URL of this page: https://medlineplus.gov/languages/ ... V W XYZ List of All Topics All Zika Virus - Multiple Languages To use the sharing features on ...

  14. VIRUS FAMILIES – contd

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. VIRUS FAMILIES – contd. Minus strand RNA viruses. Rhabdovirus e.g. rabies. Paramyxovirus e.g. measles, mumps. Orthomyxovirus e.g. influenza. Retroviruses. RSV, HTLV, MMTV, HIV. Notes:

  15. Human Parainfluenza Viruses

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Parainfluenza Viruses (HPIVs) Note: Javascript is disabled or ... CDC.gov . Recommend on Facebook Tweet Share Compartir Human parainfluenza viruses (HPIVs) commonly cause respiratory illnesses in ...

  16. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ACOG Pregnancy ...

  17. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ...

  18. [Mumps vaccine virus transmission].

    Science.gov (United States)

    Otrashevskaia, E V; Kulak, M V; Otrashevskaia, A V; Karpov, I A; Fisenko, E G; Ignat'ev, G M

    2013-01-01

    In this work we report the mumps vaccine virus shedding based on the laboratory confirmed cases of the mumps virus (MuV) infection. The likely epidemiological sources of the transmitted mumps virus were children who were recently vaccinated with the mumps vaccine containing Leningrad-Zagreb or Leningrad-3 MuV. The etiology of the described cases of the horizontal transmission of both mumps vaccine viruses was confirmed by PCR with the sequential restriction analysis.

  19. Nairobi sheep disease virus/Ganjam virus.

    Science.gov (United States)

    M D, Baron; B, Holzer

    2015-08-01

    Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

  20. What's West Nile Virus?

    Science.gov (United States)

    ... for Educators Search English Español What's West Nile Virus? KidsHealth / For Kids / What's West Nile Virus? Print en español ¿Qué es el Virus del Nilo Occidental? What exactly is the West ...

  1. Characteristic of pandemic virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Characteristic of pandemic virus. The virus was highly transmissible. Risk of hospitalization was 2X and risk of death was about 11X more in comparison to seasonal influenza. Virus continues to be susceptible to Osaltamivir, the only drug available. Vaccines are available but ...

  2. Zika Virus Fact Sheet

    Science.gov (United States)

    ... is caused by a virus transmitted primarily by Aedes mosquitoes. People with Zika virus disease can have symptoms including mild fever, skin ... framework. Q&A: Zika virus and complication ... mosquito from the Aedes genus, mainly Aedes aegypti in tropical regions. Aedes ...

  3. Blueberry (Vaccinium corymbosum)-Virus Diseases

    Science.gov (United States)

    At least six viruses have been found in highbush blueberry plantings in the Pacific Northwest: Blueberry mosaic virus, Blueberry red ringspot virus, Blueberry scorch virus, Blueberry shock virus, Tobacco ringspot virus, and Tomato ringspot virus. Six other virus and virus-like diseases of highbush b...

  4. Viruses of asparagus.

    Science.gov (United States)

    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef

    2012-01-01

    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Understanding Ebola Virus Transmission

    Directory of Open Access Journals (Sweden)

    Seth Judson

    2015-02-01

    Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  6. Ruminal Degradability of Dry Matter and Crude Protein from Moist Dehulled Lupin and Extruded Rapeseed Meal Degradabilidad Ruminal de la Materia Seca y de la Proteína Cruda de Lupino Descascarado y Torta de Raps Extruidos

    Directory of Open Access Journals (Sweden)

    Claudia Barchiesi-Ferrari

    2011-09-01

    Full Text Available The flow of ruminal undegradable protein (RUP to the small intestine can be increased if ruminal degradation of dietary protein is reduced. The objective of this study was to evaluate the effect of extrusion on ruminal degradability of dry matter (DM and crude protein (CP from dehulled lupin (Lupinus albus L. (DL and rapeseed (Brassica napus L. meal (RM. Unextruded soybean (Glicine max L. meal (SBM was used as a control. The DL was extruded at 130 ºC with 20% moisture and RM was extruded at 120 ºC with 20% moisture. Ruminal degradability was evaluated in situ by incubating feed samples for 2, 4, 8, 12, 24, and 48 h of fermentation in the rumen using three rumen-fistulated dairy cows. Values of CP soluble fraction (“a” in SBM, DL, extruded dehulled lupin (EDL, RM, and extruded rapeseed meal (ERM was lower in the extruded feeds (P El flujo de proteína no degradable en el rumen (RUP hacia el intestino delgado puede ser incrementado si se reduce la degradación ruminal de la proteína dietaria. El objetivo de este trabajo fue evaluar el efecto de la extrusión sobre la degradabilidad ruminal de la materia seca (DM y proteína cruda (CP de lupino (Lupinus albus L. descascarado (DL y torta de raps (Brassica napus L. (RM. Se utilizó afrecho de soya (Glicine max L. sin extruir (SBM como control. El DL fue extruido a 130 ºC con 20% de humedad y la RM fue extruida a 120 ºC con 20% de humedad. La degradabilidad ruminal se evaluó in situ incubando las muestras de alimentos a 2, 4, 8, 12, 24 y 48 h de fermentación en tres vacas lecheras con fístula ruminal. Los valores de la fracción soluble de la CP (“a” en SBM, en DL, lupino descascarado extruido (EDL, RM y torta de raps extruida (ERM fue menor en los extruidos (P < 0.05. La fracción lentamente degradable (“b” de SBM, DL, EDL, RM y de ERM fue 858; 593; 622 y 451 y 457 g kg-1, respectivamente, y se incrementó por extrusión (P < 0.05. La extrusión redujo la degradabilidad efectiva

  7. Protoplasts and plant viruses

    International Nuclear Information System (INIS)

    Murakishi, H.; Lesney, M.S.; Carlson, P.

    1984-01-01

    The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible

  8. [The great virus comeback].

    Science.gov (United States)

    Forterre, Patrick

    2013-01-01

    Viruses have been considered for a long time as by-products of biological evolution. This view is changing now as a result of several recent discoveries. Viral ecologists have shown that viral particles are the most abundant biological entities on our planet, whereas metagenomic analyses have revealed an unexpected abundance and diversity of viral genes in the biosphere. Comparative genomics have highlighted the uniqueness of viral sequences, in contradiction with the traditional view of viruses as pickpockets of cellular genes. On the contrary, cellular genomes, especially eukaryotic ones, turned out to be full of genes derived from viruses or related elements (plasmids, transposons, retroelements and so on). The discovery of unusual viruses infecting archaea has shown that the viral world is much more diverse than previously thought, ruining the traditional dichotomy between bacteriophages and viruses. Finally, the discovery of giant viruses has blurred the traditional image of viruses as small entities. Furthermore, essential clues on virus history have been obtained in the last ten years. In particular, structural analyses of capsid proteins have uncovered deeply rooted homologies between viruses infecting different cellular domains, suggesting that viruses originated before the last universal common ancestor (LUCA). These studies have shown that several lineages of viruses originated independently, i.e., viruses are polyphyletic. From the time of LUCA, viruses have coevolved with their hosts, and viral lineages can be viewed as lianas wrapping around the trunk, branches and leaves of the tree of life. Although viruses are very diverse, with genomes encoding from one to more than one thousand proteins, they can all be simply defined as organisms producing virions. Virions themselves can be defined as infectious particles made of at least one protein associated with the viral nucleic acid, endowed with the capability to protect the viral genome and ensure its

  9. Postmortem stability of Ebola virus.

    Science.gov (United States)

    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J

    2015-05-01

    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

  10. Zika virus infection.

    Science.gov (United States)

    Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle

    2016-12-01

    A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

  11. Ebola (Ebola Virus Disease): Diagnosis

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  12. Ebola (Ebola Virus Disease): Transmission

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  13. Ebola (Ebola Virus Disease): Treatment

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  14. Yeast for virus research

    Science.gov (United States)

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  15. Viruses infecting marine molluscs.

    Science.gov (United States)

    Arzul, Isabelle; Corbeil, Serge; Morga, Benjamin; Renault, Tristan

    2017-07-01

    Although a wide range of viruses have been reported in marine molluscs, most of these reports rely on ultrastructural examination and few of these viruses have been fully characterized. The lack of marine mollusc cell lines restricts virus isolation capacities and subsequent characterization works. Our current knowledge is mostly restricted to viruses affecting farmed species such as oysters Crassostrea gigas, abalone Haliotis diversicolor supertexta or the scallop Chlamys farreri. Molecular approaches which are needed to identify virus affiliation have been carried out for a small number of viruses, most of them belonging to the Herpesviridae and birnaviridae families. These last years, the use of New Generation Sequencing approach has allowed increasing the number of sequenced viral genomes and has improved our capacity to investigate the diversity of viruses infecting marine molluscs. This new information has in turn allowed designing more efficient diagnostic tools. Moreover, the development of experimental infection protocols has answered some questions regarding the pathogenesis of these viruses and their interactions with their hosts. Control and management of viral diseases in molluscs mostly involve active surveillance, implementation of effective bio security measures and development of breeding programs. However factors triggering pathogen development and the life cycle and status of the viruses outside their mollusc hosts still need further investigations. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. PR-10 proteins as potential mediators of melatonin-cytokinin cross-talk in plants: crystallographic studies of LlPR-10.2B isoform from yellow lupine.

    Science.gov (United States)

    Sliwiak, Joanna; Sikorski, Michal; Jaskolski, Mariusz

    2018-04-06

    LlPR-10.2B, a Pathogenesis-related class 10 (PR-10) protein from yellow lupine (Lupinus luteus) was crystallized in complex with melatonin, an emerging important plant regulator and antioxidant. The structure reveals two molecules of melatonin bound in the internal cavity of the protein, plus a very well-defined electron density near the cavity entrance, corresponding to an unknown ligand molecule comprised of two flat rings, which is most likely a product of melatonin transformation. In a separate LlPR-10.2B co-crystallization experiment with an equimolar mixture of melatonin and trans-zeatin, which is a cytokinin phytohormone well recognized as a PR-10-binding partner, a quaternary 1 : 1 : 1 : 1 complex was formed, in which one of the melatonin-binding sites has been substituted with trans-zeatin, whereas the binding of melatonin at the second binding site and binding of the unknown ligand are undisturbed. This unusual complex, when compared with the previously described PR-10/trans-zeatin complexes and with the emerging structural information about melatonin binding by PR-10 proteins, provides intriguing insights into the role of PR-10 proteins in phytohormone regulation in plants, especially with the involvement of melatonin, and implicates the PR-10 proteins as low-affinity melatonin binders under the conditions of elevated melatonin concentration. Atomic coordinates and processed structure factors corresponding to the final models of the LlPR-10.2B/melatonin and LlPR-10.2B/melatonin + trans-zeatin complexes have been deposited with the Protein Data Bank (PDB) under the accession codes 5MXB and 5MXW. The corresponding raw X-ray diffraction images have been deposited in the RepOD Repository at the Interdisciplinary Centre for Mathematical and Computational Modelling (ICM) of the University of Warsaw, Poland, and are available for download with the following Digital Object Identifiers (DOI): https://doi.org/10.18150/repod.9923638 and https://doi.org/10

  17. Pepino mosaic virus

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.

    2009-01-01

    Pepino mosaic virus (PepMV) is a relatively new plant virus that has become a signifi cant agronomical problem in a relatively short period of time. It is a member of the genus Potexvirus within the family Flexiviridae and is readily mechanically transmissible. It is capable of infecting tomato

  18. Avian influenza virus

    Science.gov (United States)

    Avian influenza virus (AIV) is type A influenza that is adapted to avian host species. Although the virus can be isolated from numerous avian species, the natural host reservoir species are dabbling ducks, shorebirds and gulls. Domestic poultry species (poultry being defined as birds that are rais...

  19. Hepatitis viruses overview

    African Journals Online (AJOL)

    Hepatitis is major cause of morbidity or mortality worldwide, particularly in the developing world. The major causes of infective hepatitis are hepatitis viruses. A, B, C, D or E. In the acute phase, there are no clinical features that can reliably differentiate between these viruses. Infection may be asymptomatic or can present as.

  20. Viral Haemorrhagic Septicaemia Virus

    DEFF Research Database (Denmark)

    Olesen, Niels Jørgen; Skall, Helle Frank

    2013-01-01

    This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus.......This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus....

  1. Tobacco ringspot virus

    Science.gov (United States)

    Tobacco ringspot virus (TRSV), and its vector, the dagger nematodes (Xiphinema americanum and related species) are widely distributed throughout the world. Cucumber, melon, and watermelon are particularly affected by TRSV. Symptoms can vary with plant age, the strain of the virus, and environment...

  2. Respiratory Syncytial Virus (RSV)

    Centers for Disease Control (CDC) Podcasts

    Respiratory Syncytial Virus, or RSV, causes cold-like symptoms but can be serious for infants and older adults. In this podcast, CDC’s Dr. Eileen Schneider discusses this common virus and offers tips to prevent its spread.

  3. Viruses in reptiles.

    Science.gov (United States)

    Ariel, Ellen

    2011-09-21

    The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself.

  4. ICTV Virus Taxonomy Profile

    DEFF Research Database (Denmark)

    Simmonds, Peter; Becher, Paul; Bukh, Jens

    2017-01-01

    The Flaviviridae is a family of small enveloped viruses with RNA genomes of 9000-13 000 bases. Most infect mammals and birds. Many flaviviruses are host-specific and pathogenic, such as hepatitis C virus in the genus Hepacivirus. The majority of known members in the genus Flavivirus are arthropod...

  5. ICTV virus taxonomy profile

    NARCIS (Netherlands)

    Purdy, Michael A.; Harrison, Tim J.; Jameel, S.; Meng, X.J.; Okamoto, H.; Poel, Van Der W.H.M.; Smith, Donald B.; Lefkowitz, Elliot J.; Davison, Andrew J.; Siddell, Stuart G.; Simmonds, Peter; Adams, Michael J.; Smith, Donald B.; Orton, Richard J.; Knowles, Nick J.

    2017-01-01

    The family Hepeviridae includes enterically transmitted small non-enveloped positive-sense RNA viruses. It includes the genera Piscihepevirus, whose members infect fish, and Orthohepevirus, whose members infect mammals and birds. Members of the genus Orthohepevirus include hepatitis E virus, which

  6. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Prangishvili,, David; Basta, Tamara; Garrett, Roger Antony

    2016-01-01

    Viruses infecting members of Archaea, the third domain of life, constitute an integral, yet unique part of the virosphere. Many of these viruses, specifically the species that infect hyperthermophilic hosts, display morphotypes – for example, bottle shaped, spindle shaped, droplet shaped, coil sh...

  7. Strategy as a Virus

    DEFF Research Database (Denmark)

    Obed Madsen, Søren

    This article is based on virus theory (Røvik, 2007, 2011), and proposes to develop a framework that defines technology as a virus that penetrates the organism of an organization. The framework develops a new vocabulary, which can help in analyzing technologies and their negative effects on actors...... and organizations. In this paper, the virus theory is used to analyze a strategy process in an organization as an example of a technology. It shows how the strategy over time creates a memory loss, where the managers who are exposed to the virus forget their critique of the new strategy concept. The article also...... shows how resistant can be understood as being immune to a virus, since the strategy concepts bears resemblance to a former strategy concept. The article also argues that there should be more focus on the negative impacts of management tool and especially how organizations and managers are dealing...

  8. Computer Viruses: Pathology and Detection.

    Science.gov (United States)

    Maxwell, John R.; Lamon, William E.

    1992-01-01

    Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

  9. Zika virus infection: a public health emergency!

    OpenAIRE

    Qureshi, Muhammad Salman Haider; Qureshi, Bakhtawar Wajeeha; Khan, Ramsha

    2017-01-01

    Zika virus belongs to the family of Flaviviridae. The Flaviviridae family also includes other human pathogens like West Nile virus (WNV), Yellow fever virus (YFV), mosquito transmitted Dengue virus (DENV), Tick borne encephalitic virus (TBEV) and Japanese encephalitis virus (JEV). Zika virus is a mosquito-borne disease and is transmitted by Aedes aegypti mosquito.

  10. Hepatitis A virus antibody

    International Nuclear Information System (INIS)

    Novak, J.; Kselikova, M.; Urbankova, J.

    1980-01-01

    A description is presented of a radioimmunoassay designed to prove the presence of the antibody against the hepatitis A virus (HA Ab, anti-Ha) using an Abbott HAVAB set. This proof as well as the proof of the antibody against the nucleus of the hepatitis B virus is based on competition between a normal antibody against hepatitis A virus and a 125 I-labelled antibody for the binding sites of a specific antigen spread all over the surface of a tiny ball; this is then indirect proof of the antibody under investigation. The method is described of reading the results from the number of impulses per 60 seconds: the higher the titre of the antibody against the hepatitis A virus in the serum examined, the lower the activity of the specimen concerned. The rate is reported of incidence of the antibody against the hepatitis A virus in a total of 68 convalescents after hepatitis A; the antibody was found in 94.1%. The immunoglobulin made from the convalescents' plasma showed the presence of antibodies in dilutions as high as 1:250 000 while the comparable ratio for normal immunoglobulin Norga was only 1:2500. Differences are discussed in the time incidence of the antibodies against the hepatitis A virus, the antibodies against the surface antigen of hepatitis B, and the antibody against the nucleus of the hepatitis V virus. (author)

  11. Ocular Tropism of Respiratory Viruses

    Science.gov (United States)

    Rota, Paul A.; Tumpey, Terrence M.

    2013-01-01

    SUMMARY Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism. PMID:23471620

  12. VHS virus - present situation

    DEFF Research Database (Denmark)

    Skall, Helle Frank; Olesen, Niels Jørgen

    2015-01-01

    of the worldwide distribution of the disease will be given. Virus evolution: Recent studies indicate that only a few amino acid changes in the structural proteins of VHSV can change the virulence patterns significantly, thereby coming closer to assessing the risk of none to low virulent viruses becoming high...... virulent. Virulence factors both depend on the ability of VHSV to enter a cell and on the speed and efficiencyof virus replication in the cells. Apparently the viral nucleocapsid protein plays a very important role for the later and seems to be the target for determination of a virulence marker....

  13. Zika virus in Asia

    Directory of Open Access Journals (Sweden)

    Veasna Duong

    2017-01-01

    Full Text Available Zika virus (ZIKV is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored.

  14. Zika virus in Asia

    OpenAIRE

    Veasna Duong; Philippe Dussart; Philippe Buchy

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of...

  15. Zika virus in Asia.

    Science.gov (United States)

    Duong, Veasna; Dussart, Philippe; Buchy, Philippe

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  16. Viruses in reptiles

    Directory of Open Access Journals (Sweden)

    Ariel Ellen

    2011-09-01

    Full Text Available Abstract The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself. 1. Introduction 2. Methods for working with reptilian viruses 3. Reptilian viruses described by virus families 3.1. Herpesviridae 3.2. Iridoviridae 3.2.1 Ranavirus 3.2.2 Erythrocytic virus 3.2.3 Iridovirus 3.3. Poxviridae 3.4. Adenoviridae 3.5. Papillomaviridae 3.6. Parvoviridae 3.7. Reoviridae 3.8. Retroviridae and inclusion body disease of Boid snakes 3.9. Arboviruses 3.9.1. Flaviviridae 3

  17. BS-virus-finder

    DEFF Research Database (Denmark)

    Gao, Shengjie; Hu, Xuesong; Xu, Fengping

    2018-01-01

    Background: DNA methylation plays a key role in the regulation of gene expression and carcinogenesis. Bisulfite sequencing studies mainly focus on calling SNP, DMR, and ASM. Until now, only a few software tools focus on virus integration using bisulfite sequencing data. Findings: We have developed...... a new and easy-to-use software tool, named BS-virus-finder (BSVF, RRID:SCR_015727), to detect viral integration breakpoints in whole human genomes. The tool is hosted at https://github.com/BGI-SZ/BSVF. Conclusions: BS-virus-finder demonstrates high sensitivity and specificity. It is useful in epigenetic...

  18. Ebola Virus Disease

    Centers for Disease Control (CDC) Podcasts

    This podcast provides general information about Ebola virus disease and the outbreak in West Africa. The program contains remarks from CDC Director Dr. Tom Frieden, as well as a brief description of CDC’s response efforts.

  19. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG ... Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal Clinical Updates Practice ...

  20. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Dues Follow us: Women's Health Care Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  1. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ... pregnant. Related: Zika Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal ...

  2. CLASSIFICATION OF VIRUSES

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CLASSIFICATION OF VIRUSES. On basis of morphology. On basis of chemical composition. On basis of structure of genome. On basis of mode of replication. Notes:

  3. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and ... on Patient Safety For Patients Patient FAQs Spanish Pamphlets Teen Health About ACOG About Us Leadership & Governance ...

  4. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ... and Pregnancy Page Navigation ▼ ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September ...

  5. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ... Infographic Resources & Publications Committee Opinions Practice ... Coding Health Info Technology Professional Liability Managing Your ...

  6. Hepatitis B virus (image)

    Science.gov (United States)

    Hepatitis B is also known as serum hepatitis and is spread through blood and sexual contact. It is ... population. This photograph is an electronmicroscopic image of hepatitis B virus particles. (Image courtesy of the Centers for ...

  7. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ... pregnant. Related: Zika Virus and Pregnancy ... Committee Opinions Practice Bulletins Patient Education Green Journal ...

  8. Hepatitis E Virus

    African Journals Online (AJOL)

    Before the discovery of hepatitis E virus (HEV), many epidemics of hepatitis in ... HEV was discovered in 1983 in the ... HEV infection is increased by HIV infection in pregnancy. (Caron et al. .... immunosuppressive therapy on the natural history.

  9. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy ... Council on Patient Safety For Patients Patient FAQs Spanish Pamphlets Teen Health About ACOG About Us Leadership & ...

  10. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Login My ACOG Join Pay Dues Follow us: Women's Health Care Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  11. VIRUS instrument enclosures

    Science.gov (United States)

    Prochaska, T.; Allen, R.; Mondrik, N.; Rheault, J. P.; Sauseda, M.; Boster, E.; James, M.; Rodriguez-Patino, M.; Torres, G.; Ham, J.; Cook, E.; Baker, D.; DePoy, Darren L.; Marshall, Jennifer L.; Hill, G. J.; Perry, D.; Savage, R. D.; Good, J. M.; Vattiat, Brian L.

    2014-08-01

    The Visible Integral-Field Replicable Unit Spectrograph (VIRUS) instrument will be installed at the Hobby-Eberly Telescope† in the near future. The instrument will be housed in two enclosures that are mounted adjacent to the telescope, via the VIRUS Support Structure (VSS). We have designed the enclosures to support and protect the instrument, to enable servicing of the instrument, and to cool the instrument appropriately while not adversely affecting the dome environment. The system uses simple HVAC air handling techniques in conjunction with thermoelectric and standard glycol heat exchangers to provide efficient heat removal. The enclosures also provide power and data transfer to and from each VIRUS unit, liquid nitrogen cooling to the detectors, and environmental monitoring of the instrument and dome environments. In this paper, we describe the design and fabrication of the VIRUS enclosures and their subsystems.

  12. The virus of management

    DEFF Research Database (Denmark)

    Kjær, Peter; Frankel, Christian

    2003-01-01

    The virus metaphor may be used in studies of management knowledge not only as a way ofdescribing diffusion processes but also as a way of thinking about viral elements of knowledgeproduction. In the present article, organizational viruses are viewed as ensembles of basicdistinctions...... that are constitutive of concrete bodies of knowledge and which form mutable enginesof organizational self-descriptions. Organizational viruses, we contend, are both characterized bystability in terms of their basic productive configuration, while at the same time allowing for a highdegree of variation in terms...... of concrete management knowledge and practice. The article isstructured as follows. After the introduction, we first develop the notion of organizational virus asinto an analytical approach. Second, we discern in the work of Frederick Taylor on scientificmanagement and Max Weber on bureaucracy, two quite...

  13. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and ... Bulletins Patient Education Green Journal Clinical Updates ... Annual Meeting CME Overview CREOG Meetings Calendar Congressional ...

  14. Respiratory Syncytial Virus (RSV)

    Centers for Disease Control (CDC) Podcasts

    2013-02-04

    Respiratory Syncytial Virus, or RSV, causes cold-like symptoms but can be serious for infants and older adults. In this podcast, CDC’s Dr. Eileen Schneider discusses this common virus and offers tips to prevent its spread.  Created: 2/4/2013 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Viral Diseases (DVD).   Date Released: 2/13/2013.

  15. Genome packaging in viruses

    OpenAIRE

    Sun, Siyang; Rao, Venigalla B.; Rossmann, Michael G.

    2010-01-01

    Genome packaging is a fundamental process in a viral life cycle. Many viruses assemble preformed capsids into which the genomic material is subsequently packaged. These viruses use a packaging motor protein that is driven by the hydrolysis of ATP to condense the nucleic acids into a confined space. How these motor proteins package viral genomes had been poorly understood until recently, when a few X-ray crystal structures and cryo-electron microscopy structures became available. Here we discu...

  16. Viruses and Multiple Sclerosis

    Science.gov (United States)

    Virtanen, Jussi Oskari; Jacobson, Steve

    2016-01-01

    Multiple sclerosis (MS) is a heterogeneous disease that develops as an interplay between the immune system and environmental stimuli in genetically susceptible individuals. There is increasing evidence that viruses may play a role in MS pathogenesis acting as these environmental triggers. However, it is not known if any single virus is causal, or rather several viruses can act as triggers in disease development. Here, we review the association of different viruses to MS with an emphasis on two herpesviruses, Epstein-Barr virus (EBV) and human herpesvirus 6 (HHV-6). These two agents have generated the most impact during recent years as possible co-factors in MS disease development. The strongest argument for association of EBV with MS comes from the link between symptomatic infectious mononucleosis and MS and from seroepidemiological studies. In contrast to EBV, HHV-6 has been found significantly more often in MS plaques than in MS normal appearing white matter or non-MS brains and HHV-6 re-activation has been reported during MS clinical relapses. In this review we also suggest new strategies, including the development of new infectious animal models of MS and antiviral MS clinical trials, to elucidate roles of different viruses in the pathogenesis of this disease. Furthermore, we introduce the idea of using unbiased sequence-independent pathogen discovery methodologies, such as next generation sequencing, to study MS brain tissue or body fluids for detection of known viral sequences or potential novel viral agents. PMID:22583435

  17. Transmission of Influenza A Viruses

    Science.gov (United States)

    Neumann, Gabriele; Kawaoka, Yoshihiro

    2015-01-01

    Influenza A viruses cause respiratory infections that range from asymptomatic to deadly in humans. Widespread outbreaks (pandemics) are attributable to ‘novel’ viruses that possess a viral hemagglutinin (HA) gene to which humans lack immunity. After a pandemic, these novel viruses form stable virus lineages in humans and circulate until they are replaced by other novel viruses. The factors and mechanisms that facilitate virus transmission among hosts and the establishment of novel lineages are not completely understood, but the HA and basic polymerase 2 (PB2) proteins are thought to play essential roles in these processes by enabling avian influenza viruses to infect mammals and replicate efficiently in their new host. Here, we summarize our current knowledge of the contributions of HA, PB2, and other viral components to virus transmission and the formation of new virus lineages. PMID:25812763

  18. Evolutionary ecology of virus emergence.

    Science.gov (United States)

    Dennehy, John J

    2017-02-01

    The cross-species transmission of viruses into new host populations, termed virus emergence, is a significant issue in public health, agriculture, wildlife management, and related fields. Virus emergence requires overlap between host populations, alterations in virus genetics to permit infection of new hosts, and adaptation to novel hosts such that between-host transmission is sustainable, all of which are the purview of the fields of ecology and evolution. A firm understanding of the ecology of viruses and how they evolve is required for understanding how and why viruses emerge. In this paper, I address the evolutionary mechanisms of virus emergence and how they relate to virus ecology. I argue that, while virus acquisition of the ability to infect new hosts is not difficult, limited evolutionary trajectories to sustained virus between-host transmission and the combined effects of mutational meltdown, bottlenecking, demographic stochasticity, density dependence, and genetic erosion in ecological sinks limit most emergence events to dead-end spillover infections. Despite the relative rarity of pandemic emerging viruses, the potential of viruses to search evolutionary space and find means to spread epidemically and the consequences of pandemic viruses that do emerge necessitate sustained attention to virus research, surveillance, prophylaxis, and treatment. © 2016 New York Academy of Sciences.

  19. [Zika virus infection during pregnancy].

    Science.gov (United States)

    Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S

    2016-05-01

    A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. Recombinant Vaccinia Virus: Immunization against Multiple Pathogens

    Science.gov (United States)

    Perkus, Marion E.; Piccini, Antonia; Lipinskas, Bernard R.; Paoletti, Enzo

    1985-09-01

    The coding sequences for the hepatitis B virus surface antigen, the herpes simplex virus glycoprotein D, and the influenza virus hemagglutinin were inserted into a single vaccinia virus genome. Rabbits inoculated intravenously or intradermally with this polyvalent vaccinia virus recombinant produced antibodies reactive to all three authentic foreign antigens. In addition, the feasibility of multiple rounds of vaccination with recombinant vaccinia virus was demonstrated.

  1. Viruses, definitions and reality

    Directory of Open Access Journals (Sweden)

    Libia Herrero-Uribe

    2011-09-01

    Full Text Available Viruses are known to be abundant, ubiquitous, and to play a very important role in the health and evolution of life organisms. However, most biologists have considered them as entities separate from the realm of life and acting merely as mechanical artifacts that can exchange genes between different organisms. This article reviews some definitions of life organisms to determine if viruses adjust to them, and additionally, considers new discoveries to challenge the present definition of viruses. Definitions of life organisms have been revised in order to validate how viruses fit into them. Viral factories are discussed since these mini-organelles are a good example of the complexity of viral infection, not as a mechanical usurpation of cell structures, but as a driving force leading to the reorganization and modification of cell structures by viral and cell enzymes. New discoveries such as the Mimivirus, its virophage and viruses that produce filamentous tails when outside of their host cell, have stimulated the scientific community to analyze the current definition of viruses. One way to be free for innovation is to learn from life, without rigid mental structures or tied to the past, in order to understand in an integrated view the new discoveries that will be unfolded in future research. Life processes must be looked from the complexity and trans-disciplinarity perspective that includes and accepts the temporality of the active processes of life organisms, their interdependency and interrelation among them and their environment. New insights must be found to redefine life organisms, especially viruses, which still are defined using the same concepts and knowledge of the fifties. Rev. Biol. Trop. 59 (3: 993-998. Epub 2011 September 01.Los virus son abundantes, ubicuos, y juegan un papel muy importante en la salud y en la evolución de los organismos vivos. Sin embargo, la mayoría de los biólogos los siguen considerado como entidades separadas

  2. Prevalence of human immunodeficiency virus, hepatitis C virus ...

    African Journals Online (AJOL)

    Background. Human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV) and syphilis remain major infections around the world. In Angola, about 166 000 individuals are living with HIV, representing a prevalence of 1.98% in adults between 15 and 49 years of age. In a 2003 study in Luanda, 4.5% ...

  3. Sweet lupins as a feedstuff for broilers

    African Journals Online (AJOL)

    Iyn is gebruik. Elke groep het bestaan uit 10haantjies of 10hennetjies. Daar was vier herhalings van elke behandeling wat neerkom op 40 kuikens per behandeling. Die resultate het getoon dat die insluiting van soveel as 400 g/kg soet lupiene ( ...

  4. [Viruses and civilization].

    Science.gov (United States)

    Chastel, C

    1999-01-01

    A few million years ago, when primates moved from the east African forest to the savannah, they were already infected with endogenous viruses and occultly transmitted them to the prime Homo species. However it was much later with the building of the first large cities in Mesopotamia that interhuman viral transmission began in earnest. Spreading was further enhanced with the organization of the Egyptian, Greek, Roman, and Arab empires around the Mediterranean. Discovery of the New World in 1492 led to an unprecedented clash of civilizations and the destruction of pre-Columbian Indian civilizations. It also led to a rapid spread of viruses across the Atlantic Ocean with the emergence of yellow fever and appearance of smallpox and measles throughout the world. However the greatest opportunities for worldwide viral development have been created by our present, modern civilization. This fact is illustrated by epidemic outbreaks of human immunodeficiency virus, Venezuela hemorrhagic fever, Rift valley fever virus, and monkey pox virus. Close analysis underscores the major role of human intervention in producing these events.

  5. Nipah Virus (NiV)

    Science.gov (United States)

    ... Form Controls Cancel Submit Search the CDC Nipah Virus (NiV) Note: Javascript is disabled or is not ... gov . Recommend on Facebook Tweet Share Compartir Nipah virus (NiV) is a member of the family Paramyxoviridae , ...

  6. Epstein-Barr virus test

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003513.htm Epstein-Barr virus antibody test To use the sharing features on this page, please enable JavaScript. Epstein-Barr virus antibody test is a blood test to detect ...

  7. Special Issue: Honey Bee Viruses

    Directory of Open Access Journals (Sweden)

    Sebastian Gisder

    2015-10-01

    Full Text Available Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus, or a so far neglected virus species (Apis mellifera filamentous virus, and cutting edge technologies (mass spectrometry, RNAi approach applied in the field.

  8. Special Issue: Honey Bee Viruses

    Science.gov (United States)

    Gisder, Sebastian; Genersch, Elke

    2015-01-01

    Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field. PMID:26702462

  9. Ebola (Ebola Virus Disease): Prevention

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014- ...

  10. Zika virus: An overview

    Directory of Open Access Journals (Sweden)

    Gautam Rawal

    2016-01-01

    Full Text Available The Zika virus has been in the news for quite some time due to the ongoing recent outbreak in the Southern America, which started in December 2015. It has been declared a public health emergency by the World Health Organization in February 2016 owing to its association with the congenital deformities, particularly microcephaly in infants borne to the infected mothers. The rapid spread of the virus throughout the United States of America and subsequently to Asia has raised serious international concerns. Its spread to countries neighboring India is a serious threat to the Indian population. This review article gives an overview about the virus, its diagnosis, clinical features, and the management.

  11. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.

    2013-01-01

    The work presented in this thesis provides novel insights in several aspects of the molecular

    biology of archaea, bacteria and their viruses.

    Three fundamentally different groups of viruses are associated with the three domains of life.

    Archaeal viruses are

  12. Rhabdomyolysis Associated with Parainfluenza Virus

    Directory of Open Access Journals (Sweden)

    Miltiadis Douvoyiannis

    2013-01-01

    Full Text Available Influenza virus is the most frequently reported viral cause of rhabdomyolysis. A 7-year-old child is presented with rhabdomyolysis associated with parainfluenza type 2 virus. Nine cases of rhabdomyolysis associated with parainfluenza virus have been reported. Complications may include electrolyte disturbances, acute renal failure, and compartment syndrome.

  13. Global emergence of Zika virus

    Directory of Open Access Journals (Sweden)

    Richard Tjan

    2016-05-01

    Full Text Available Zika virus (ZIKV belongs to the flaviviruses (family Flaviviridae, which includes dengue, yellow fever, West Nile, and Japanese encephalitis viruses. Zika virus was isolated in 1947, in the Zika forest near Kampala, Uganda, from one of the rhesus monkeys used as sentinel animals in a yellow fever research program.

  14. Control of Newcastle disease virus

    Science.gov (United States)

    Newcastle disease virus (NDV), also know as avian paramyxovirus serotype 1, is an important poultry pathogen worldwide. In naive poultry, the virulent forms of the virus cause high mortality. Because of this the virus is reportable to the World Organization for Animal Health and can be an important ...

  15. An introduction to computer viruses

    Energy Technology Data Exchange (ETDEWEB)

    Brown, D.R.

    1992-03-01

    This report on computer viruses is based upon a thesis written for the Master of Science degree in Computer Science from the University of Tennessee in December 1989 by David R. Brown. This thesis is entitled An Analysis of Computer Virus Construction, Proliferation, and Control and is available through the University of Tennessee Library. This paper contains an overview of the computer virus arena that can help the reader to evaluate the threat that computer viruses pose. The extent of this threat can only be determined by evaluating many different factors. These factors include the relative ease with which a computer virus can be written, the motivation involved in writing a computer virus, the damage and overhead incurred by infected systems, and the legal implications of computer viruses, among others. Based upon the research, the development of a computer virus seems to require more persistence than technical expertise. This is a frightening proclamation to the computing community. The education of computer professionals to the dangers that viruses pose to the welfare of the computing industry as a whole is stressed as a means of inhibiting the current proliferation of computer virus programs. Recommendations are made to assist computer users in preventing infection by computer viruses. These recommendations support solid general computer security practices as a means of combating computer viruses.

  16. SARS – virus jumps species

    Indian Academy of Sciences (India)

    SARS – virus jumps species. Coronavirus reshuffles genes; Rotteir et al, Rotterdam showed the virus to jump from cats to mouse cells after single gene mutation ? Human disease due to virus jumping from wild or domestic animals; Present favourite animal - the cat; - edible or domestic.

  17. Computer Bytes, Viruses and Vaccines.

    Science.gov (United States)

    Palmore, Teddy B.

    1989-01-01

    Presents a history of computer viruses, explains various types of viruses and how they affect software or computer operating systems, and describes examples of specific viruses. Available vaccines are explained, and precautions for protecting programs and disks are given. (nine references) (LRW)

  18. Monoclonal antibodies against plant viruses

    International Nuclear Information System (INIS)

    Sandler, E.; Dietzgen, R.G.

    1984-01-01

    Ever since antigenic properties of plant viruses were discovered antisera have been raised and used for plant virus diagnosis and for the analysis of virus structure as well. From the early qualitative diagnosis method of precipitating the virus in clarified sap of an infected plant and the first quantitative application of the precipitin test vast progress has been made with regard to the development of highly sensitive and highly quantitative methods for virus detection. Of equal importance was the improvement of methods for separating virus from host cell components since the specificity of antisera raised against a virus could be increased by using an antigen for immunization highly concentrated and largely freed from contaminating host substances. The introduction of the enzyme-linked immunosorbent assay (ELISA) into plant virology allows detection of virus in nanogram quantities. Still, the conventionally raised antisera, no matter how pure an antigen was used for immunization, are polyclonal. They contain products of thousands of different antibody-secreting plasma cell clones which can be directed against all antigenic determinants (epitopes) of the virus, but also against antigens of the host plant that may not have been entirely separated from the immunizing virus during the purification procedure. Even after cross adsorption of polyclonal antisera some residual heterogeneity can be expected to remain. Within these boundaries the information gained with polyclonal antisera on virus structure and on virus diagnosis has to be interpreted

  19. Virus Nilam: Identifikasi, Karakter Biologi dan Fisik, Serta Upaya Pengendaliannya

    OpenAIRE

    Miftakhurohmah, Miftakhurohmah; Noveriza, Rita

    2015-01-01

    Infeksi virus pada tanaman nilam dapat menyebabkan penurunan produksi dan kualitas minyak. Sembilan jenis virus diidentifikasi menginfeksi tanaman nilam, yaitu Patchouli mosaic virus (PatMoV), Patchouli mild mosaic virus (PatMMV), Telosma mosaic virus (TeMV), Peanut stripe virus (PStV), Patchouli yellow mosaic virus (PatYMV), Tobacco necrosis virus (TNV), Broad bean wilt virus 2 (BBWV2), Cucumber mosaic virus (CMV), dan Cymbidium mosaic virus (CymMV). Kesembilan virus tersebut memiliki genom ...

  20. Bovine Virus Diarrhea (BVD)

    OpenAIRE

    Hoar, Bruce R.

    2004-01-01

    Bovine virus diarrhea (BVD) is a complicated disease to discuss as it can result in a wide variety of disease problems from very mild to very severe. BVD can be one of the most devastating diseases cattle encounter and one of the hardest to get rid of when it attacks a herd. The viruses that cause BVD have been grouped into two genotypes, Type I and Type II. The disease syndrome caused by the two genotypes is basically the same, however disease caused by Type II infection is often more severe...

  1. Virus en Endodoncia

    OpenAIRE

    Hernández Vigueras, Scarlette; Salazar Navarrete, Luis; Pérez Tomás, Ricardo; Segura Egea, Juan José; Viñas, Miguel; López-López, José

    2014-01-01

    La infección endodóntica es la infección que afecta al sistema de conductos radiculares y, sin duda, es el principal agente etiológico de las periodontitis apicales. Además, de las bacterias patógenas endodónticas, se ha buscado en los últimos años asociar la presencia de virus en distintos tipos de patología endodóntica. Los virus que más se han buscado y asociado son los pertenecientes a la familia herpesvirus, los cuales se han encontrado presentes en patologías periapicales principalmente...

  2. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup

    2012-01-01

    pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways.......Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...

  3. [ZIKA--VIRUS INFECTION].

    Science.gov (United States)

    Velev, V

    2016-01-01

    This review summarizes the knowledge of the scientific community for Zika-virus infection. It became popular because of severe congenital damage causes of CNS in newborns whose mothers are infected during pregnancy, as well as the risk of pandemic distribution. Discusses the peculiarities of the biology and ecology of vectors--blood-sucking mosquitoes Aedes; stages in the spread of infection and practical problems which caused during pregnancy. Attention is paid to the recommendations that allow leading national and international medical organizations to deal with the threat Zika-virus infection.

  4. Epidemiology of Zika Virus.

    Science.gov (United States)

    Younger, David S

    2016-11-01

    Zika virus is an arbovirus belonging to the Flaviviridae family known to cause mild clinical symptoms similar to those of dengue and chikungunya. Zika is transmitted by different species of Aedes mosquitoes. Nonhuman primates and possibly rodents play a role as reservoirs. Direct interhuman transmission has also been reported. Human cases have been reported in Africa and Asia, Easter Island, the insular Pacific region, and Brazil. Its clinical profile is that of a dengue-like febrile illness, but recently associated Guillain-Barre syndrome and microcephaly have appeared. There is neither a vaccine nor prophylactic medications available to prevent Zika virus infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Viruses in renovated waters

    CSIR Research Space (South Africa)

    Nupen, EM

    1974-06-01

    Full Text Available , for permission to present this paper. ?8? References 1. REPORT. CONMITTEE ON ENVIRONMENTAL QUALITY ANAGEMEZIT OF PME SANITARY ENGINEERING DIVISION (1970). Engineering evaluation of virus hazard in water. Jour. Eng. Div. Proc. Am. Soc. Civ. Eng. SA 1, 7112... Water Systems, Austin, Texas, 1974 13. CARESON, G.F., WOODA.RD, F.E., WENTWORTII, D.P. and SPRODI, O.J. (1968) Virus inactivation on clay particles in natural waters. Journ. Wat. Pollut. Cont. Fed., 4Q R39, 7116. 14. MOSJ~EY, J.W. (1967...

  6. Tenosinovitis por virus Chikungunya

    Directory of Open Access Journals (Sweden)

    Alfredo Seijo

    2014-12-01

    Full Text Available Se presenta a la consulta un hombre proveniente de la República Dominicana con una tenosinovitis del extensor del dedo medio derecho; en la convalecencia inmediata, segunda curva febril luego de 48 horas de permanecer asintomático de una enfermedad febril aguda, y marcada astenia, exantema pruriginoso, poliartralgias con impotencia funcional y rigidez articular generalizada. Los exámenes bioquímicos no aportaron datos de interés para el diagnóstico. La serología para virus dengue fue negativa. La detección de IgM y de anticuerpos neutralizantes para virus Chikungunya (CHIKV fueron positivos.

  7. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-02-01

    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  8. Resistance to Two Heterologous Neurotropic Oncolytic Viruses, Semliki Forest Virus and Vaccinia Virus, in Experimental Glioma

    Science.gov (United States)

    Le Boeuf, Fabrice; Lemay, Chantal; De Silva, Naomi; Diallo, Jean-Simon; Cox, Julie; Becker, Michelle; Choi, Youngmin; Ananth, Abhirami; Sellers, Clara; Breton, Sophie; Roy, Dominic; Falls, Theresa; Brun, Jan; Hemminki, Akseli; Hinkkanen, Ari; Bell, John C.

    2013-01-01

    Attenuated Semliki Forest virus (SFV) may be suitable for targeting malignant glioma due to its natural neurotropism, but its replication in brain tumor cells may be restricted by innate antiviral defenses. We attempted to facilitate SFV replication in glioma cells by combining it with vaccinia virus, which is capable of antagonizing such defenses. Surprisingly, we found parenchymal mouse brain tumors to be refractory to both viruses. Also, vaccinia virus appears to be sensitive to SFV-induced antiviral interference. PMID:23221568

  9. RNA viruses in the sea.

    Science.gov (United States)

    Lang, Andrew S; Rise, Matthew L; Culley, Alexander I; Steward, Grieg F

    2009-03-01

    Viruses are ubiquitous in the sea and appear to outnumber all other forms of marine life by at least an order of magnitude. Through selective infection, viruses influence nutrient cycling, community structure, and evolution in the ocean. Over the past 20 years we have learned a great deal about the diversity and ecology of the viruses that constitute the marine virioplankton, but until recently the emphasis has been on DNA viruses. Along with expanding knowledge about RNA viruses that infect important marine animals, recent isolations of RNA viruses that infect single-celled eukaryotes and molecular analyses of the RNA virioplankton have revealed that marine RNA viruses are novel, widespread, and genetically diverse. Discoveries in marine RNA virology are broadening our understanding of the biology, ecology, and evolution of viruses, and the epidemiology of viral diseases, but there is still much that we need to learn about the ecology and diversity of RNA viruses before we can fully appreciate their contributions to the dynamics of marine ecosystems. As a step toward making sense of how RNA viruses contribute to the extraordinary viral diversity in the sea, we summarize in this review what is currently known about RNA viruses that infect marine organisms.

  10. Zika Virus: An Emerging Worldwide Threat

    OpenAIRE

    Irfan A. Rather; Jameel B. Lone; Vivek K. Bajpai; Woon K. Paek; Jeongheui Lim

    2017-01-01

    ZIKA virus (ZIKV) poses a severe threat to the world. Recent outbreaks of ZIKV after 2007 along with its quick transmission have made this virus a matter of international concern. The virus shows symptoms that are similar to those caused in the wake of dengue virus (DENV) and other flaviviruses, which makes it difficult to discern the viral infection. Diagnosis is further complicated as the virus cross-reacts with antibodies of other viruses. Currently, molecular diagnosis of the virus is bei...

  11. Ebola virus acceptors

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... genome sequencing centre; HSP, High scoring Segment pair;. NHGRI, National ... the genome of the rhesus monkey (rhesus macaque, Macaca mulatta). The sequencing and comparative analysis was funded by the National ... Definition. Accession ..... Marburg virus genomics and association with a large.

  12. Zika virus and placenta

    Institute of Scientific and Technical Information of China (English)

    Beuy Joob; Viroj Wiwanitkit

    2016-01-01

    Zika virus infection is the new arboviral infection problem. The serious outcome of infection and induction of abnormal infant become the big issue in reproductive medicine. The pathogenesis and pathology of the placenta in the affected case is an interesting issue. Here, the authors focus and discuss on this topic in this short article.

  13. Viruses of haloarchaea.

    Science.gov (United States)

    Luk, Alison W S; Williams, Timothy J; Erdmann, Susanne; Papke, R Thane; Cavicchioli, Ricardo

    2014-11-13

    In hypersaline environments, haloarchaea (halophilic members of the Archaea) are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages). Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems.

  14. Viruses of Haloarchaea

    Directory of Open Access Journals (Sweden)

    Alison W. S. Luk

    2014-11-01

    Full Text Available In hypersaline environments, haloarchaea (halophilic members of the Archaea are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages. Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems.

  15. Apple mosaic virus

    Science.gov (United States)

    Apple mosaic virus (ApMV), a member of the ilarvirus group, naturally infects Betula, Aesculus, Humulus, and several crop genera in the family Rosaceae (Malus, Prunus, Rosa and Rubus). ApMV was first reported in Rubus in several blackberry and raspberry cultivars in the United States and subsequentl...

  16. ICTV virus taxonomy profile

    NARCIS (Netherlands)

    García, María Laura; Bó, Dal Elena; Graça, da John V.; Gago-Zachert, Selma; Hammond, John; Moreno, Pedro; Natsuaki, Tomohide; Pallás, Vicente; Navarro, Jose A.; Reyes, Carina A.; Luna, Gabriel Robles; Sasaya, Takahide; Tzanetakis, Ioannis E.; Vaira, Anna María; Verbeek, Martin; Lefkowitz, Elliot J.; Davison, Andrew J.; Siddell, Stuart G.; Simmonds, Peter; Adams, Michael J.; Smith, Donald B.; Orton, Richard J.; Sanfaçon, Hélène

    2017-01-01

    The Ophioviridae is a family of filamentous plant viruses, with single-stranded negative, and possibly ambisense, RNA genomes of 11.3-12.5 kb divided into 3-4 segments, each encapsidated separately. Virions are naked filamentous nucleocapsids, forming kinked circles of at least two different contour

  17. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Basta, T.; Garrett, Roger Antony; Prangishvili,, David

    2009-01-01

    Double-stranded deoxyribonucleic acid (DNA) viruses that infect members of the third domain of life, the Archaea, are diverse and exceptional in both their morphotypes and their genomic properties. The majority of characterized species infect hyperthermophilic hosts and carry morphological featur...

  18. Animal Models of Zika Virus

    Science.gov (United States)

    Bradley, Michael P; Nagamine, Claude M

    2017-01-01

    Zika virus has garnered great attention over the last several years, as outbreaks of the disease have emerged throughout the Western Hemisphere. Until quite recently Zika virus was considered a fairly benign virus, with limited clinical severity in both people and animals. The size and scope of the outbreak in the Western Hemisphere has allowed for the identification of severe clinical disease that is associated with Zika virus infection, most notably microcephaly among newborns, and an association with Guillian–Barré syndrome in adults. This recent association with severe clinical disease, of which further analysis strongly suggested causation by Zika virus, has resulted in a massive increase in the amount of both basic and applied research of this virus. Both small and large animal models are being used to uncover the pathogenesis of this emerging disease and to develop vaccine and therapeutic strategies. Here we review the animal-model–based Zika virus research that has been performed to date. PMID:28662753

  19. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony

    2015-01-01

    in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...... with an environmental virus mixture isolated from Yellowstone National Park (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012). Experimental studies of isolated genetic elements from this mixture revealed that SMV1 (S ulfolobus Monocauda Virus 1), a tailed spindle-shaped virus, can induce spacer acquisition...... and the techniques used both to infect laboratory strains with these virus mixtures and to obtain purified virus particles. Secondly, we present the experimental conditions required for activating SMV1-induced spacer acquisition in two different Sulfolobus species....

  20. Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus

    OpenAIRE

    Savithri, HS; Murthy, MRN

    1983-01-01

    The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

  1. Hepatitis E virus coinfection with hepatotropic viruses in Egyptian children.

    Science.gov (United States)

    Zaki, Maysaa El Sayed; Salama, Osama Saad; Mansour, Fathy Awaad; Hossein, Shaimaa

    2008-06-01

    Major hepatotropic viruses continue to be important causes of acute viral hepatitis in developing countries. This work was carried out to detect the seroprevalence of hepatitis E virus (HEV) markers in children with acute viral hepatitis due to hepatotropic viruses (A, B and C) and non-A, non-B, non-C acute hepatitis, and to ascertain the influence of HEV superinfection in individuals infected with hepatitis viruses (A, B and C). We studied prospectively 162 children with sporadic acute hepatitis who reported to our hospital. Thirteen healthy controls were also included in the study. Laboratory investigations were performed, including complete liver function tests. Complete serological profiles for hepatitis viruses A, B, C and E were evaluated. HEV immunoglobulin G was detected with highest percentage among patients with hepatitis B (56.7%), followed by patients with hepatitis C virus (52.0%), hepatitis A virus (34.1%) and combined hepatitis B and C viruses (30.0%). The detection rate among patients with non-A, non-B, non-C hepatitis was 7.1%. HEV immunoglobulin M was found in 4.5% of hepatitis A virus patients and in 3.3% of hepatitis B patients. The prevalence of HEV immunoglobulin G and immunoglobulin M correlated with the levels of hepatic aspartate aminotransferase and alanine aminotransferase in patients with dual markers of infection with hepatitis E and other viruses compared to patients with acute hepatitis due to A and C viruses. HEV serological markers are common among children with acute viral hepatitis, especially from hepatitis C and B viruses. There may be increased sensitivity to HEV coinfection in association with hepatitis B and C infections. Dual infection with HEV and other hepatotropic viruses was associated with greater elevation of aspartate and alanine aminotransferases.

  2. Avian influenza viruses in humans.

    Science.gov (United States)

    Malik Peiris, J S

    2009-04-01

    Past pandemics arose from low pathogenic avian influenza (LPAI) viruses. In more recent times, highly pathogenic avian influenza (HPAI) H5N1, LPAI H9N2 and both HPAI and LPAI H7 viruses have repeatedly caused zoonotic disease in humans. Such infections did not lead to sustained human-to-human transmission. Experimental infection of human volunteers and seroepidemiological studies suggest that avian influenza viruses of other subtypes may also infect humans. Viruses of the H7 subtype appear to have a predilection to cause conjunctivitis and influenza-like illness (ILI), although HPAI H7N7 virus has also caused fatal respiratory disease. Low pathogenic H9N2 viruses have caused mild ILI and its occurrence may be under-recognised for this reason. In contrast, contemporary HPAI H5N1 viruses are exceptional in their virulence for humans and differ from human seasonal influenza viruses in their pathogenesis. Patients have a primary viral pneumonia progressing to acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndrome. Over 380 human cases have been confirmed to date, with an overall case fatality of 63%. The zoonotic transmission of avian influenza is a rare occurrence, butthe greater public health concern is the adaptation of such viruses to efficient human transmission, which could lead to a pandemic. A better understanding of the ecology of avian influenza viruses and the biological determinants of transmissibility and pathogenicity in humans is important for pandemic preparedness.

  3. Detection of selected plant viruses by microarrays

    OpenAIRE

    HRABÁKOVÁ, Lenka

    2013-01-01

    The main aim of this master thesis was the simultaneous detection of four selected plant viruses ? Apple mosaic virus, Plum pox virus, Prunus necrotic ringspot virus and Prune harf virus, by microarrays. The intermediate step in the process of the detection was optimizing of multiplex polymerase chain reaction (PCR).

  4. Virus-host interaction in feline immunodeficiency virus (FIV) infection.

    Science.gov (United States)

    Taniwaki, Sueli Akemi; Figueiredo, Andreza Soriano; Araujo, João Pessoa

    2013-12-01

    Feline immunodeficiency virus (FIV) infection has been the focus of several studies because this virus exhibits genetic and pathogenic characteristics that are similar to those of the human immunodeficiency virus (HIV). FIV causes acquired immunodeficiency syndrome (AIDS) in cats, nevertheless, a large fraction of infected cats remain asymptomatic throughout life despite of persistent chronic infection. This slow disease progression may be due to the presence of factors that are involved in the natural resistance to infection and the immune response that is mounted by the animals, as well as due to the adaptation of the virus to the host. Therefore, the study of virus-host interaction is essential to the understanding of the different patterns of disease course and the virus persistence in the host, and to help with the development of effective vaccines and perhaps the cure of FIV and HIV infections. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Single virus genomics: a new tool for virus discovery.

    Directory of Open Access Journals (Sweden)

    Lisa Zeigler Allen

    Full Text Available Whole genome amplification and sequencing of single microbial cells has significantly influenced genomics and microbial ecology by facilitating direct recovery of reference genome data. However, viral genomics continues to suffer due to difficulties related to the isolation and characterization of uncultivated viruses. We report here on a new approach called 'Single Virus Genomics', which enabled the isolation and complete genome sequencing of the first single virus particle. A mixed assemblage comprised of two known viruses; E. coli bacteriophages lambda and T4, were sorted using flow cytometric methods and subsequently immobilized in an agarose matrix. Genome amplification was then achieved in situ via multiple displacement amplification (MDA. The complete lambda phage genome was recovered with an average depth of coverage of approximately 437X. The isolation and genome sequencing of uncultivated viruses using Single Virus Genomics approaches will enable researchers to address questions about viral diversity, evolution, adaptation and ecology that were previously unattainable.

  6. Understanding Zika virus.

    Science.gov (United States)

    Murray, John S

    2017-01-01

    This article describes what pediatric healthcare professionals should know about Zika virus (ZIKV). ZIKV is classified as an arthropod-borne, single-stranded RNA virus of the Flaviviridae family and genus Flavivirus. ZIKV is not new. The virus was first discovered almost 70 years ago in Uganda. The first isolate of the virus was found in rhesus monkeys in the Zika Forrest, hence the nomenclature. The primary route of ZIKV transmission to humans is through the bite of an infected Aedes species mosquito-primarily Aedes aegypti. When the mosquito bites individuals infected with the virus, mosquitos then become the vector of transmitting the infection to others. Women can also pass ZIKV to their fetus during pregnancy and at the time of delivery. ZIKV can also be transmitted through sexual activity from an individual who is infected with the virus to his or her partners. It is estimated that approximately 18% of individuals infected with ZIKV will go on to develop symptoms. When symptoms develop, it is usually within 3-12 days, although this may vary. Most often, symptoms are mild and self-limited. The most common symptoms are fever, arthralgia, maculopapular rash, and conjunctivitis lasting up to seven days. Less frequent symptoms include headache, vertigo, myalgia, vomiting, and diarrhea. At present, there is no vaccine available to prevent ZIKV and no specific antiviral treatment. Supportive care consisting of rest, hydration, analgesics, antihistamines, and antipyretics is recommended as needed. Given that there is no vaccine or treatment for ZIKV, considerable efforts must be focused on prevention. One of the most effective ways of preventing ZIKV infection is through avoiding mosquito bites, especially when traveling to or residing in areas where transmission is present. Precautions should include wearing appropriate attire with the objective of having as little skin exposed as possible, use of screens for windows and doors, and use of insect repellent. What is

  7. Dengue Virus and Autophagy

    Directory of Open Access Journals (Sweden)

    Nicholas S. Heaton

    2011-08-01

    Full Text Available Several independent groups have published that autophagy is required for optimal RNA replication of dengue virus (DENV. Initially, it was postulated that autophagosomes might play a structural role in replication complex formation. However, cryo-EM tomography of DENV replication complexes showed that DENV replicates on endoplasmic reticulum (ER cisternae invaginations and not on classical autophagosomes. Recently, it was reported that autophagy plays an indirect role in DENV replication by modulating cellular lipid metabolism. DENV-induced autophagosomes deplete cellular triglycerides that are stored in lipid droplets, leading to increased β-oxidation and energy production. This is the first example of a virus triggering autophagy to modulate cellular physiology. In this review, we summarize these data and discuss new questions and implications for autophagy during DENV replication.

  8. Eastern Equine Encephalitis Virus

    Energy Technology Data Exchange (ETDEWEB)

    Borucki, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2010-08-05

    Eastern equine encephalitis virus (EEEV) is a mosquito-borne virus capable of causing large outbreaks of encephalitis in humans and horses. In North America, EEEV infection has a very high mortality rate in humans, and survivors often suffer severe neurological sequelae. Interestingly, EEEV infections from South American isolates are generally subclinical. Although EEEV is divided into two antigenic varieties and four lineages, only eleven isolates have been sequenced and eight of these are from the North American variety (Lineage I). Most sequenced strains were collected from mosquitoes and only one human isolate has been sequenced. EEEV isolates exist from a variety of hosts, vectors, years, and geographical locations and efforts should focus on sequencing strains that represent this diversity.

  9. Uukuniemi virus, Czech Republic.

    Science.gov (United States)

    Papa, Anna; Zelená, Hana; Papadopoulou, Elpida; Mrázek, Jakub

    2018-04-20

    Following the identification of severe fever with thrombocytopenia syndrome and Heartland viruses, the interest on tick-borne phleboviruses has increased rapidly. Uukuniemi virus has been proposed as a model for tick-borne phleboviruses. However, the number of available sequences is limited. In the current study we performed whole-genome sequencing on two Uukuniemi viral strains isolated in 2000 and 2004 from Ixodes ricinus ticks in the Czech Republic. Both strains cluster together with Potepli63 strain isolated in the country in 1963. Although the Czech strains were isolated many years apart, a high identity was seen at the nucleotide and amino acid levels, suggesting that UUKV has a relatively stable genome. Copyright © 2018 Elsevier GmbH. All rights reserved.

  10. Respiratory Syncytial Virus Vaccines

    OpenAIRE

    Dudas, Robert A.; Karron, Ruth A.

    1998-01-01

    Respiratory syncytial virus (RSV) is the most important cause of viral lower respiratory tract illness (LRI) in infants and children worldwide and causes significant LRI in the elderly and in immunocompromised patients. The goal of RSV vaccination is to prevent serious RSV-associated LRI. There are several obstacles to the development of successful RSV vaccines, including the need to immunize very young infants, who may respond inadequately to vaccination; the existence of two antigenically d...

  11. Ebola Virus Disease

    Centers for Disease Control (CDC) Podcasts

    2014-08-08

    This podcast provides general information about Ebola virus disease and the outbreak in West Africa. The program contains remarks from CDC Director Dr. Tom Frieden, as well as a brief description of CDC’s response efforts.  Created: 8/8/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/8/2014.

  12. Thermoactivation of viruses by microwaves

    Energy Technology Data Exchange (ETDEWEB)

    Mahnel, H.; von Brodorotti, H.S.

    1981-01-01

    Eight different viruses, suspended in drinking water, were examined for their ability to be inactivated by microwaves from a microwave oven. Up to a virus content of 10/sup 5/ TCID/sub 50//ml inactivation was successful within a few minutes of microwave treatment and occurred in parallel to the heat stability of the viruses. Evidence for direct effects of microwaves on viruses could not be detected. 7 of the viruses studied were inactivated rapidly when temperatures of 50 to 65/sup 0/C under microwave treatment were reached in the flowing water, while a bovine parvovirus was only inactivated by temperatures above 90/sup 0/C. The advantages of a thermal virus-decontamination of fluids and material by microwaves are discussed.

  13. [Nosocomial virus infections].

    Science.gov (United States)

    Eggers, H J

    1986-12-01

    Enveloped viruses, e.g. influenza- or varicella viruses may cause highly contagious airborne infections. Their spread is difficult to control, also in hospitals. In the case of influenza and varicella immune prophylaxis and chemotherapy/chemoprophylaxis are possible. This is of particular significance, since varicella and zoster are of increasing importance for immunocompromized patients. Diarrhea is caused to a large extent by viruses. Rotavirus infections play an important role in infancy, and are frequently acquired in the hospital. In a study on infectious gastroenteritis of infants in a hospital we were able to show that 30 percent of all rotavirus infections were of nosocomial origin. Admission of a rotavirus-excreting patient (or personnel) may start a long chain of rotavirus infections on pediatric wards. Even careful hygienic measures in the hospital can hardly prevent the spread of enterovirus infections. Such infections may be severe and lethal for newborns, as shown by us in a study on an outbreak of echovirus 11 disease on a maternity ward. We have recently obtained data on the "stickiness" of enteroviruses on human skin. This could explain essential features of the spread of enteroviruses in the population.

  14. Viruses manipulate the marine environment.

    Science.gov (United States)

    Rohwer, Forest; Thurber, Rebecca Vega

    2009-05-14

    Marine viruses affect Bacteria, Archaea and eukaryotic organisms and are major components of the marine food web. Most studies have focused on their role as predators and parasites, but many of the interactions between marine viruses and their hosts are much more complicated. A series of recent studies has shown that viruses have the ability to manipulate the life histories and evolution of their hosts in remarkable ways, challenging our understanding of this almost invisible world.

  15. Virus Information Update CIAC-2301

    Science.gov (United States)

    1998-05-21

    a tune through a sound card. Byway is reported to be in the wild internationally, especially in Venezuela, Mexico , Bulgaria, UK and USA. REMOVAL NOTE...1482, Varicella Type: Program. Disk Location: Features: Damage: Size: See Also: Notes: v6-146: This virus was written to hurt users of the TBCLEAN...antivirus package. If you have a file infected with the Varicella virus, and if you tried to clean this virus infected file with tbclean, what would

  16. Advances in virus research. Volume 29

    International Nuclear Information System (INIS)

    Lauffer, M.A.; Maramorosch, K.

    1984-01-01

    This book contains nine chapters. Some of the titles are: Molecular Biology of Wound Tumor Virus; The Application of Monoclonal Antibodies in the Study of Viruses; Prions: Novel Infectious Pathogens; and Monoclonal Antibodies Against Plant Viruses

  17. RECOVIR Software for Identifying Viruses

    Science.gov (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  18. About Human Parainfluenza Viruses (HPIVs)

    Science.gov (United States)

    ... Healthcare Professionals Clinical Overview Laboratory Diagnosis HPIV Seasons Resources & References About Human Parainfluenza Viruses (HPIVs) Recommend on Facebook Tweet Share Compartir Symptoms & Illnesses Lists symptoms and ...

  19. Virus Diseases Infecting Almond Germplasm in Lebanon

    OpenAIRE

    Adeeb Saad; Yusuf Abou-Jawdah; Zahi Kanaan-Atallah

    2000-01-01

    Cultivated and wild almond species were surveyed for virus diseases. Four viruses infected cultivated almonds (Prunus dulcis): Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Apple chlorotic leaf spot virus (ACLSV) and Apple mosaic virus (ApMV). Only ACLSV and ApMV were detected on wild almonds, (Prunus orientalis and P. korschinskii). The occurence of PNRSV or PDV on seeds used for the production of rootstocks, on seedlings in nurseries, and on mother plants reve...

  20. Computer virus information update CIAC-2301

    Energy Technology Data Exchange (ETDEWEB)

    Orvis, W.J.

    1994-01-15

    While CIAC periodically issues bulletins about specific computer viruses, these bulletins do not cover all the computer viruses that affect desktop computers. The purpose of this document is to identify most of the known viruses for the MS-DOS and Macintosh platforms and give an overview of the effects of each virus. The authors also include information on some windows, Atari, and Amiga viruses. This document is revised periodically as new virus information becomes available. This document replaces all earlier versions of the CIAC Computer virus Information Update. The date on the front cover indicates date on which the information in this document was extracted from CIAC`s Virus database.

  1. Avaliação das silagens de capim-elefante aditivadas com nabo forrageiro, pinhão manso e tremoço, pela técnica de produção de gases Evaluation of elephant grass silages with forage radish, jatropha and lupine cakes as additives by the gas production technique

    Directory of Open Access Journals (Sweden)

    Arnaldo Prata Neiva Júnior

    2010-08-01

    Full Text Available Objetivou-se, na condução deste trabalho, a avaliação das silagens de capim-elefante aditivadas com tortas de nabo forrageiro, pinhão manso e tremoço pela técnica de produção de gás. O experimento foi desenvolvido no Laboratório de Nutrição Animal do Centro de Energia Nuclear na Agricultura da Universidade de São Paulo (LANA/CENA/USP. Como doadores de líquido de rúmen, foram utilizados 2 ovinos da raça Santa Inês, machos, adultos, castrados e providos de cânula ruminal permanente. A alimentação dos animais doadores foi constituída de forragem de gramínea cultivada e uma suplementação, ao final do dia, com feno de Tifton, concentrado comercial e sal mineral à vontade. Os substratos foram secos a 60ºC, moídos em moinho do tipo Willey, provido de peneira com perfurações de 2 mm. Os gases produzidos durante os diferentes períodos de fermentação (0, 4, 8, 12, 24, 36, 48, 72 e 96 h foram medidos com um transducer - medidor de pressão.O experimento foi instalado segundo um delineamento de blocos ao acaso em que os tratamentos foram arranjados em um esquema de parcelas subdivididas no tempo. Os maiores valores de produção de gás observados para os tratamentos em que adicionou-se torta de tremoço quando comparados com as outras tortas, decorreu do fato da torta de tremoço apresentar menor teor de fibras, propiciando assim, uma maior fermentação ruminal e, consequentemente, maior produção de gás em relação a outros alimentos com maior proporção de carboidratos estruturais (parede celular.As taxas de degradação da fração solúvel da matéria seca foi menor para NF 8% e PM 11% em relação às outras silagens estudadas. Foram encontradas diferenças significativas para as TNF, TPM e TT, nos diferentes níveis, em relação ao volume de gases em 96 h de incubação (PThe objective of this work was to evaluate elephant grass silages with forage radish, Jatropha and lupine cakes as additives by the gas

  2. Prevention of Hepatitis B Virus and Hepatitis C Virus Transmission ...

    African Journals Online (AJOL)

    Introduction: Hepatitis B virus (HBV) and hepatitis C virus (HCV) infections in hemodialysis (HD) patients are associated with adverse outcomes, especially after kidney transplantation. Review: In the HD setting, cross-contamination to patients via environmental surfaces, supplies, equipment, multiple-dose medication vials ...

  3. Human Immunodeficiency Virus and Hepatitis C Virus Co-infection ...

    African Journals Online (AJOL)

    Human Immunodeficiency Virus and Hepatitis C Virus Co-infection in Cameroon: Investigation of the Genetic Diversity and Virulent ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... DNA sequencing, and bioinformatics tools for sequence management and analysis.

  4. Human immunodeficiency virus and hepatitus B virus co-infection ...

    African Journals Online (AJOL)

    Human immunodeficiency virus and hepatitus B virus co-infection amog patients in Kano Nigeria. EE Nwokedi, MA Emokpae, AI Dutse. Abstract. No Abstract. Nigerian Journal of Medicine Vol. 15(3) July-September 2006: 227-229. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD ...

  5. General properties of grapevine viruses occurring in Hungary

    OpenAIRE

    Eszter Cseh; András Takács; László Kocsis; Richard Gáborjányi

    2012-01-01

    The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Alfalfa mosaic virus (AMV), Grapevine Bulgarian latent virus (GBLV), Grapevine fleck virus (GFkV), Grapevine leafroll- associated viruses (GLRaV1-4), Grapevine virus A (GVA), Grape...

  6. Blood transfusion and hepatitis viruses

    African Journals Online (AJOL)

    virus in blood donors: investigation of type-specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion 1993;. 33: 7-13. 45. McFarlane IG, Smith HM, Johnson PJ, Bray GP, Vergani 0, Williams R. Hepatitis. C virus antibodies in chronic active hepatitis: pathogenetic factor or false-.

  7. Autophagy in Measles Virus Infection

    Directory of Open Access Journals (Sweden)

    Aurore Rozières

    2017-11-01

    Full Text Available Autophagy is a biological process that helps cells to recycle obsolete cellular components and which greatly contributes to maintaining cellular integrity in response to environmental stress factors. Autophagy is also among the first lines of cellular defense against invading microorganisms, including viruses. The autophagic destruction of invading pathogens, a process referred to as xenophagy, involves cytosolic autophagy receptors, such as p62/SQSTM1 (Sequestosome 1 or NDP52/CALCOCO2 (Nuclear Dot 52 KDa Protein/Calcium Binding And Coiled-Coil Domain 2, which bind to microbial components and target them towards growing autophagosomes for degradation. However, most, if not all, infectious viruses have evolved molecular tricks to escape from xenophagy. Many viruses even use autophagy, part of the autophagy pathway or some autophagy-associated proteins, to improve their infectious potential. In this regard, the measles virus, responsible for epidemic measles, has a unique interface with autophagy as the virus can induce multiple rounds of autophagy in the course of infection. These successive waves of autophagy result from distinct molecular pathways and seem associated with anti- and/or pro-measles virus consequences. In this review, we describe what the autophagy–measles virus interplay has taught us about both the biology of the virus and the mechanistic orchestration of autophagy.

  8. antibodies against Herpes simplex virus

    African Journals Online (AJOL)

    171. 5. Celum, C. L. The Interaction between Herpes Sim- plex Virus and Human Immunodeficiency Virus. Her- pes, 2004; 1: 36A-44A. 6. Brown, Z.A., Selke, S., Zeh, J., Kopelman, J., Maslow,. A., Ashley, R.L., Watts, D.H., Berry, S., Herd, M. and.

  9. Crenarchaeal Viruses: Morphotypes and Genomes,

    DEFF Research Database (Denmark)

    Prangishvili, P.; Basta, P.; Garrett, Roger Antony

    2008-01-01

    In this article we present our current knowledge about double-stranded (dsDNA) viruses infecting hyperthermophilic Crenarchaeaota, the organisms which predominate in hot terrestrial springs with temperatures over 80 °C. These viruses exhibit extraordinary diversity of morphotypes most of which have...

  10. Epidemic of cell phone virus

    Science.gov (United States)

    Wang, Pu; González, Marta; Barabási, Albert-László.

    2008-03-01

    Standard operating systems and Bluetooth technology will be a trend for future cell phone features. These will enable cell phone viruses to spread either through SMS or by sending Bluetooth requests when cell phones are physically close enough. The difference in spreading methods gives these two types of viruses' different epidemiological characteristics. SMS viruses' spread is mainly based on people's social connections, whereas the spreading of Bluetooth viruses is affected by people's mobility patterns and population distribution. Using cell phone data recording calls, SMS and locations of more than 6 million users, we study the spread of SMS and Bluetooth viruses and characterize how the social network and the mobility of mobile phone users affect such spreading processes.

  11. Release of Virus from Lymphoid Tissue Affects Human Immunodeficiency Virus Type 1 and Hepatitis C Virus Kinetics in the Blood

    NARCIS (Netherlands)

    Müller, Viktor; Marée, Athanasius F.M.; Boer, R.J. de

    2000-01-01

    Kinetic parameters of human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) infections have been estimated from plasma virus levels following perturbation of the chronically infected (quasi-) steady state. We extend previous models by also considering the large pool of virus

  12. [Ebola virus disease: Update].

    Science.gov (United States)

    de la Calle-Prieto, Fernando; Arsuaga-Vicente, Marta; Mora-Rillo, Marta; Arnalich-Fernandez, Francisco; Arribas, Jose Ramon

    2016-01-01

    The first known Ebola outbreak occurred in 1976. Since then, 24 limited outbreaks had been reported in Central Africa, but never affecting more than 425 persons. The current outbreak in Western Africa is the largest in history with 28,220 reported cases and 11,291 deaths. The magnitude of the epidemic has caused worldwide alarm. For the first time, evacuated patients were treated outside Africa, and secondary cases have occurred in Spain and the United States. Since the start of the current epidemic, our knowledge about the epidemiology, clinical picture, laboratory findings, and virology of Ebola virus disease has considerably expanded. For the first time, experimental treatment has been tried, and there have been spectacular advances in vaccine development. A review is presented of these advances in the knowledge of Ebola virus disease. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  13. Genome Sequence of Bivens Arm Virus, a Tibrovirus Belonging to the Species Tibrogargan virus (Mononegavirales: Rhabdoviridae).

    Science.gov (United States)

    Lauck, Michael; Yú, Shu Qìng; Caì, Yíngyún; Hensley, Lisa E; Chiu, Charles Y; O'Connor, David H; Kuhn, Jens H

    2015-03-19

    The new rhabdoviral genus Tibrovirus currently has two members, Coastal Plains virus and Tibrogargan virus. Here, we report the coding-complete genome sequence of a putative member of this genus, Bivens Arm virus. A genomic comparison reveals Bivens Arm virus to be closely related to, but distinct from, Tibrogargan virus. Copyright © 2015 Lauck et al.

  14. Viruses in the Oceanic Basement.

    Science.gov (United States)

    Nigro, Olivia D; Jungbluth, Sean P; Lin, Huei-Ting; Hsieh, Chih-Chiang; Miranda, Jaclyn A; Schvarcz, Christopher R; Rappé, Michael S; Steward, Grieg F

    2017-03-07

    Microbial life has been detected well into the igneous crust of the seafloor (i.e., the oceanic basement), but there have been no reports confirming the presence of viruses in this habitat. To detect and characterize an ocean basement virome, geothermally heated fluid samples (ca. 60 to 65°C) were collected from 117 to 292 m deep into the ocean basement using seafloor observatories installed in two boreholes (Integrated Ocean Drilling Program [IODP] U1362A and U1362B) drilled in the eastern sediment-covered flank of the Juan de Fuca Ridge. Concentrations of virus-like particles in the fluid samples were on the order of 0.2 × 10 5 to 2 × 10 5  ml -1 ( n = 8), higher than prokaryote-like cells in the same samples by a factor of 9 on average (range, 1.5 to 27). Electron microscopy revealed diverse viral morphotypes similar to those of viruses known to infect bacteria and thermophilic archaea. An analysis of virus-like sequences in basement microbial metagenomes suggests that those from archaeon-infecting viruses were the most common (63 to 80%). Complete genomes of a putative archaeon-infecting virus and a prophage within an archaeal scaffold were identified among the assembled sequences, and sequence analysis suggests that they represent lineages divergent from known thermophilic viruses. Of the clustered regularly interspaced short palindromic repeat (CRISPR)-containing scaffolds in the metagenomes for which a taxonomy could be inferred (163 out of 737), 51 to 55% appeared to be archaeal and 45 to 49% appeared to be bacterial. These results imply that the warmed, highly altered fluids in deeply buried ocean basement harbor a distinct assemblage of novel viruses, including many that infect archaea, and that these viruses are active participants in the ecology of the basement microbiome. IMPORTANCE The hydrothermally active ocean basement is voluminous and likely provided conditions critical to the origins of life, but the microbiology of this vast habitat is not

  15. Sensitive radioimmunosorbent assay for the detection of plant viruses. [Cauliflower mosaic virus, lettuce mosaic virus

    Energy Technology Data Exchange (ETDEWEB)

    Ghabrial, S A; Shepherd, R J [Kentucky Univ., Lexington (USA); California Univ., Davis (USA))

    1980-06-01

    A simple and highly sensitive radioimmunosorbent assay (RISA) for the detection of plant viruses is described. The RISA procedure is a microplate method based on the principle of 'double-antibody sandwich' and follows essentially the protocol of the enzyme-linked immunosorbent assay (ELISA) (Clark and Adams, 1977), with the exception that /sup 125/I-labelled ..gamma..-globulin is substituted for the ..gamma..-globulin enzyme conjugate; the bound /sup 125/I-..gamma..-globulin is dissociated by acidification from the double-antibody sandwich. The radioactivity is proportional to virus concentration, and cauliflower mosaic virus (CaMV) and lettuce mosaic virus (LMV) could be detected at concentrations as low as 5 and 2 ng/ml, respectively. Direct evidence of the adverse effects of conjugation with enzyme on the binding abilities of antibodies is presented. The RISA procedure should prove valuable with viruses for which the ELISA values are too low to be dependable.

  16. Plant virus sensitivity to gamma irradiation

    International Nuclear Information System (INIS)

    Gyoergyne Czeck, B.

    1979-01-01

    Preliminary experiments for prevention were conducted with weakened plant viruses, namely with Arabis mosaic virus isolated from strawberries and tobacco mosaic virus. Treatment 24 hours prior to the infection with the radiation-weakened virus resulted in a 60-70% infection prevention. (author)

  17. Pandemic swine influenza virus: Preparedness planning | Ojogba ...

    African Journals Online (AJOL)

    The novel H1N1 influenza virus that emerged in humans in Mexico in early 2009 and transmitted efficiently in the human population with global spread was declared a pandemic strain. The introduction of different avian and human influenza virus genes into swine influenza viruses often result in viruses of increased fitness ...

  18. Getah Virus Infection among Racehorses, Japan, 2014

    Science.gov (United States)

    Bannai, Hiroshi; Tsujimura, Koji; Kobayashi, Minoru; Kikuchi, Takuya; Yamanaka, Takashi; Kondo, Takashi

    2015-01-01

    An outbreak of Getah virus infection occurred among racehorses in Japan during September and October 2014. Of 49 febrile horses tested by reverse transcription PCR, 25 were positive for Getah virus. Viruses detected in 2014 were phylogenetically different from the virus isolated in Japan in 1978. PMID:25898181

  19. Ebola virus host cell entry.

    Science.gov (United States)

    Sakurai, Yasuteru

    2015-01-01

    Ebola virus is an enveloped virus with filamentous structure and causes a severe hemorrhagic fever in human and nonhuman primates. Host cell entry is the first essential step in the viral life cycle, which has been extensively studied as one of the therapeutic targets. A virus factor of cell entry is a surface glycoprotein (GP), which is an only essential viral protein in the step, as well as the unique particle structure. The virus also interacts with a lot of host factors to successfully enter host cells. Ebola virus at first binds to cell surface proteins and internalizes into cells, followed by trafficking through endosomal vesicles to intracellular acidic compartments. There, host proteases process GPs, which can interact with an intracellular receptor. Then, under an appropriate circumstance, viral and endosomal membranes are fused, which is enhanced by major structural changes of GPs, to complete host cell entry. Recently the basic research of Ebola virus infection mechanism has markedly progressed, largely contributed by identification of host factors and detailed structural analyses of GPs. This article highlights the mechanism of Ebola virus host cell entry, including recent findings.

  20. DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

    Directory of Open Access Journals (Sweden)

    Július Rozák

    2013-02-01

    Full Text Available The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen and molecular diagnostic by mRT-PCR were applied. Five samples with Plum pox virus were infected. The two samples positive for Prunus necrotic ringspot virus and one sample for Prunus dwarf virus were confirmed. The two samples were found to be infected with two viruses Prunus necrotic ringspot virus and Prunus dwarf virus. This work focuses on two techniques, their application to the diagnosis of stone fruit viruses and their routinely used for sanitary and certification programmes.

  1. Viruses in the Oceanic Basement

    Directory of Open Access Journals (Sweden)

    Olivia D. Nigro

    2017-03-01

    Full Text Available Microbial life has been detected well into the igneous crust of the seafloor (i.e., the oceanic basement, but there have been no reports confirming the presence of viruses in this habitat. To detect and characterize an ocean basement virome, geothermally heated fluid samples (ca. 60 to 65°C were collected from 117 to 292 m deep into the ocean basement using seafloor observatories installed in two boreholes (Integrated Ocean Drilling Program [IODP] U1362A and U1362B drilled in the eastern sediment-covered flank of the Juan de Fuca Ridge. Concentrations of virus-like particles in the fluid samples were on the order of 0.2 × 105 to 2 × 105 ml−1 (n = 8, higher than prokaryote-like cells in the same samples by a factor of 9 on average (range, 1.5 to 27. Electron microscopy revealed diverse viral morphotypes similar to those of viruses known to infect bacteria and thermophilic archaea. An analysis of virus-like sequences in basement microbial metagenomes suggests that those from archaeon-infecting viruses were the most common (63 to 80%. Complete genomes of a putative archaeon-infecting virus and a prophage within an archaeal scaffold were identified among the assembled sequences, and sequence analysis suggests that they represent lineages divergent from known thermophilic viruses. Of the clustered regularly interspaced short palindromic repeat (CRISPR-containing scaffolds in the metagenomes for which a taxonomy could be inferred (163 out of 737, 51 to 55% appeared to be archaeal and 45 to 49% appeared to be bacterial. These results imply that the warmed, highly altered fluids in deeply buried ocean basement harbor a distinct assemblage of novel viruses, including many that infect archaea, and that these viruses are active participants in the ecology of the basement microbiome.

  2. A new looming of Zika virus

    Institute of Scientific and Technical Information of China (English)

    Nirav R Soni

    2016-01-01

    Zika virus (ZIKV) is a member of the virus family Flaviviridae and the genus Flavivirus, transmitted by daytime-active Aedes mosquitoes, such as A. aegypti. ZIKV will continue to spread and it will be difficult to determine how the virus will spread over time. Sign and symptoms of ZIKAVD (Zika virus disease) were conjunctivitis (red eyes), back pain, birth defect-abnormal brain development known as microcephaly and it is diagnosed through PCR (polymerase chain reaction) and virus isolation from blood samples.

  3. Ebola virus: bioterrorism for humans

    Directory of Open Access Journals (Sweden)

    Pramodkumar Pyarelal Gupta

    2015-01-01

    Full Text Available Ebola virus disease is a severe, often fatal, zoonotic infection caused by a virus of the Filoviridae family (genus Ebolavirus. Ebola virus (EBOV spreads by human to human transmission through contacts with body fluids from infected patients. Initial stages of EBOV are non-specific which makes the differential diagnosis broad. Here in this review article we focused on to show the details of EBOV, from its first case right up to the possible targets to cure this lethal disease. In this study we have shown the statistical survey, epidemiology, disease ontology, different genes coding for different proteins in EBOV and future aspects of it.

  4. Marburg Virus Reverse Genetics Systems

    Directory of Open Access Journals (Sweden)

    Kristina Maria Schmidt

    2016-06-01

    Full Text Available The highly pathogenic Marburg virus (MARV is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

  5. "The evil virus cell": Students‘ knowledge and beliefs about viruses

    Science.gov (United States)

    Enzinger, Sonja M.; Fink, Andreas

    2017-01-01

    Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

  6. "The evil virus cell": Students' knowledge and beliefs about viruses.

    Science.gov (United States)

    Simon, Uwe K; Enzinger, Sonja M; Fink, Andreas

    2017-01-01

    Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

  7. Das Epstein-Barr-Virus ( = Epstein-Barr virus)

    OpenAIRE

    Niller, H. H.; Wolf, Hans J.

    1993-01-01

    Epstein-Barr virus is an ubiquitous humanpathogenic herpesvirus. It has been identified as the etiologic agent of infectious mononucleosis. In addition it is associated with the cancers nasopharyngeal carcinoma and Burkitt's lymphoma. Like other herpesviruses it infects cells in a lytic way or it persists in a latent state. Classically, the serologic diagnosis of Epstein-Barr virus infections is done by the agglutination of sheep erythrocytes according to Paul and Bunnell as a rapid testing m...

  8. Human immunodeficiency virus endocrinopathy

    Directory of Open Access Journals (Sweden)

    Uma Sinha

    2011-01-01

    Full Text Available Human immunodeficiency virus (HIV endocrinopathy encompasses a broad spectrum of disorders. Almost all the endocrine organs are virtually affected by HIV infection. HIV can directly alter glandular function. More commonly secondary endocrine dysfunction occurs due to opportunistic infections and neoplasms in immunocompromised state. The complex interaction between HIV infection and endocrine system may be manifested as subtle biochemical and hormonal perturbation to overt glandular failure. Antiretroviral therapy as well as other essential medications often result in adverse endocrinal consequences. Apart from adrenal insufficiency, hypogonadism, diabetes and bone loss, AIDS wasting syndrome and HIV lipodystrophy need special reference. Endocrinal evaluation should proceed as in other patients with suspected endocrine dysfunction. Available treatment options have been shown to improve quality of life and long-term mortality in AIDS patients.

  9. A REVIEW ON ZIKA VIRUS (ZIKV) -A DREADFUL MEMBER OF THE VIRUS FAMILY FLAVIVIRIDAE

    OpenAIRE

    1Rafiya Begum, 2 Raafia Aseena, 3Nuha Rasheed and 4 Abdul Saleem Mohammad

    2017-01-01

    Research on zika virus examine the virus that is spread to humans through a mosquito bite, with symptoms that include fever, rash, joint pain, and conjuctivities. For most people zika virus is not necessarily anything to worry, as it is not fatal and symptoms are generally mild for period up to a week. Hospitalization because of zika virus is almost always not necessary. However, the zika virus can be extremely dangerous to pregnant womes. Key Words: Zika, virus, transmission, fatal, flavivir...

  10. Electron microscopic identification of Zinga virus as a strain of Rift Valley fever virus.

    Science.gov (United States)

    Olaleye, O D; Baigent, C L; Mueller, G; Tomori, O; Schmitz, H

    1992-01-01

    Electron microscopic examination of a negatively stained suspension of Zinga virus showed particles 90-100 nm in diameter, enveloped with spikes 12-20 nm in length and 5 nm in diameter. Further identification of the virus by immune electron microscopy showed the reactivity of human Rift Valley fever virus-positive serum with Zinga virus. Results of this study are in agreement with earlier reports that Zinga virus is a strain of Rift Valley fever virus.

  11. Isolamento da globulina majoritária, digestibilidade in vivo e in vitro das proteínas do tremoço-doce (Lupinus albus L., var. Multolupa Isolation of major globulin, in vivo and in vitro digestibility of proteins from sweet lupin (Lupinus albus L. var. Multolupa

    Directory of Open Access Journals (Sweden)

    Valdir Augusto Neves

    2006-12-01

    Full Text Available Os objetivos do trabalho foram isolar, purificar e estudar algumas propriedades da fração globulina majoritária de tremoço-doce, var. Multolupa; assim como avaliar as características de digestibilidade da farinha e frações isoladas. As frações protéicas foram separadas por fracionamento diferencial com uso de diferentes solventes. A globulina majoritária de tremoço-doce foi isolada, purificada por cromatografia em Q-Sepharose, revelando um único pico de proteína. Apresentou um peso molecular de 162,5 ± 10,0 kDa, determinado por cromatografia em Sephacryl S-300, e subunidades entre 20-70 kDa em PAGE-SDS. A solubilidade em função do pH e concentrações de NaCl revelaram curva típica dessa fração. A digestibilidade da proteína da farinha e das frações albumina, globulina e glutelina foi avaliada por experimentos in vitro e in vivo e se revelou alta para a fração globulina, seguida pela glutelina, albumina e farinha. A digestibilidade in vivo da fração globulina, tanto aparente quanto verdadeira, não diferiu significativamente daquela determinada para a caseína. Apesar da alta digestibilidade da fração majoritária e frações protéicas, a utilização como única fonte de proteína nas dietas revelou valores baixos de RPLR (razão protéica líquida relativa, indicando ser insuficiente para sustentar o crescimento dos animais, comparativamente à caseína.The aim of the present work was to isolate, purify and study some properties of the major globulin fraction from sweet lupin, var. Multolupa; as well as to evaluate the digestibility features of flour and isolated fractions. The protein fractions were separated by differential fractionation with different solvents. The lupin major globulin was isolated, purified by Q-Sepharose chromatography when it showed only one protein peak. The major protein presented a molecular weight of 162.5 ± 10.0 kDa, determined on Sephacryl S-300 chromatography; and subunits between 20

  12. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  13. ICTV Virus Taxonomy Profile: Pneumoviridae.

    Science.gov (United States)

    Rima, Bert; Collins, Peter; Easton, Andrew; Fouchier, Ron; Kurath, Gael; Lamb, Robert A; Lee, Benhur; Maisner, Andrea; Rota, Paul; Wang, Linfa; Ictv Report Consortium

    2017-12-01

    The family Pneumoviridae comprises large enveloped negative-sense RNA viruses. This taxon was formerly a subfamily within the Paramyxoviridae, but was reclassified in 2016 as a family with two genera, Orthopneumovirus and Metapneumovirus. Pneumoviruses infect a range of mammalian species, while some members of the Metapneumovirus genus may also infect birds. Some viruses are specific and pathogenic for humans, such as human respiratory syncytial virus and human metapneumovirus. There are no known vectors for pneumoviruses and transmission is thought to be primarily by aerosol droplets and contact. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Pneumoviridae, which is available at www.ictv.global/report/pneumoviridae.

  14. ICTV Virus Taxonomy Profile: Hepeviridae.

    Science.gov (United States)

    Purdy, Michael A; Harrison, Tim J; Jameel, S; Meng, X-J; Okamoto, H; Van der Poel, W H M; Smith, Donald B; Ictv Report Consortium

    2017-11-01

    The family Hepeviridae includes enterically transmitted small non-enveloped positive-sense RNA viruses. It includes the genera Piscihepevirus, whose members infect fish, and Orthohepevirus, whose members infect mammals and birds. Members of the genus Orthohepevirus include hepatitis E virus, which is responsible for self-limiting acute hepatitis in humans and several mammalian species; the infection may become chronic in immunocompromised individuals. Extrahepatic manifestations of Guillain-Barré syndrome, neuralgic amyotrophy, glomerulonephritis and pancreatitis have been described in humans. Avian hepatitis E virus causes hepatitis-splenomegaly syndrome in chickens. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Hepeviridae, which is available at www.ictv.global/report/hepeviridae.

  15. Herpes Simplex Virus (Cold Sores)

    Science.gov (United States)

    ... Print Share Cold Sores in Children: About the Herpes Simplex Virus Page Content ​A child's toddler and ... Cold sores (also called fever blisters or oral herpes) start as small blisters that form around the ...

  16. Mayaro virus: the jungle flu

    Directory of Open Access Journals (Sweden)

    Izurieta RO

    2018-04-01

    Full Text Available Ricardo O Izurieta,1 David A DeLacure,1 Andres Izurieta,2 Ismael A Hoare,1 Miguel Reina Ortiz,1,3 1Department of Global Health, College of Public Health, University of South Florida, Tampa, FL, USA; 2Department of Computer Science and Engineering, College of Engineering, University of South Florida, Tampa, FL, USA; 3Fundación Raíces, Esmeraldas, Ecuador Abstract: Mayaro fever is an emerging acute viral disease endemic in Central and South America. Mayaro virus (MAYV is classified in the Semliki Forest virus antigenic complex and shares similarities with the alphavirus Chikungunya virus and the flavivirus Dengue virus. MAYV is an arbovirus transmitted by Haemagogus janthinomys, with competence also demonstrated in Aedes aegypti, Aedes scapularis, and Anopheles quadrimaculatus. Outbreaks and small epidemics of Mayaro fever have occurred in several countries in northern South America and the Caribbean. In addition, travel-associated cases have been reported in European nationals returning from endemic areas. Clinical features of Mayaro fever include fever, chills, persistent arthralgia, retro-orbital pain, maculopapular rash, itching, dizziness, and, rarely, lymphadenopathy. Methods of control for MAYV are similar to those used for other sylvatic arboviruses. Although MAYV was discovered as long ago as the 1950s and continues to be prevalent in the tropical areas of the Americas, it remains neglected and under-studied. This paper provides a thorough and current review of the published MAYV literature ranging from its original description to modern outbreaks, and from the basic virus characteristics to the clinical and epidemiological aspects of this disease. Keywords: Mayaro virus, emerging arbovirus, dengue-like virus, arthrogenic virus

  17. Zika virus and assisted reproduction.

    Science.gov (United States)

    Cordeiro, Christina N; Bano, Rashda; Washington Cross, Chantel I; Segars, James H

    2017-06-01

    Due to the fact that the Zika virus can be sexually transmitted, there is a potential risk for disease transmission at several stages of assisted reproduction. Such a possibility poses a serious challenge to couples pursing fertility with reproductive technologies. Here, we discuss what is known regarding Zika virus infection with respect to sexual transmission and correlate this knowledge with recent recommendations in the realm of infertility treatment. Zika virus can be transmitted from infected men and women through vaginal, oral or anal intercourse. Zika virus RNA has been detected in blood, semen, cervical mucus and vaginal fluid. Currently, the Centers for Disease Control recommends that infected men wait 6 months, and infected women 8 weeks, prior to attempting pregnancy. Reproductive tissue donors should wait 6 months before giving a specimen. Further study of Zika virus transmission in different reproductive tissues and establishment of validated testing methods for viral disease transmissibility are urgently needed. Reproductive technologists need to establish screening, testing and laboratory protocols aimed to reduce the risk of Zika virus transmission during assisted reproduction.

  18. Archaeal Viruses from High-Temperature Environments.

    Science.gov (United States)

    Munson-McGee, Jacob H; Snyder, Jamie C; Young, Mark J

    2018-02-27

    Archaeal viruses are some of the most enigmatic viruses known, due to the small number that have been characterized to date. The number of known archaeal viruses lags behind known bacteriophages by over an order of magnitude. Despite this, the high levels of genetic and morphological diversity that archaeal viruses display has attracted researchers for over 45 years. Extreme natural environments, such as acidic hot springs, are almost exclusively populated by Archaea and their viruses, making these attractive environments for the discovery and characterization of new viruses. The archaeal viruses from these environments have provided insights into archaeal biology, gene function, and viral evolution. This review focuses on advances from over four decades of archaeal virology, with a particular focus on archaeal viruses from high temperature environments, the existing challenges in understanding archaeal virus gene function, and approaches being taken to overcome these limitations.

  19. Archaeal Viruses from High-Temperature Environments

    Directory of Open Access Journals (Sweden)

    Jacob H. Munson-McGee

    2018-02-01

    Full Text Available Archaeal viruses are some of the most enigmatic viruses known, due to the small number that have been characterized to date. The number of known archaeal viruses lags behind known bacteriophages by over an order of magnitude. Despite this, the high levels of genetic and morphological diversity that archaeal viruses display has attracted researchers for over 45 years. Extreme natural environments, such as acidic hot springs, are almost exclusively populated by Archaea and their viruses, making these attractive environments for the discovery and characterization of new viruses. The archaeal viruses from these environments have provided insights into archaeal biology, gene function, and viral evolution. This review focuses on advances from over four decades of archaeal virology, with a particular focus on archaeal viruses from high temperature environments, the existing challenges in understanding archaeal virus gene function, and approaches being taken to overcome these limitations.

  20. Hepatitis E Virus and Related Viruses in Animals.

    Science.gov (United States)

    Thiry, D; Mauroy, A; Pavio, N; Purdy, M A; Rose, N; Thiry, E; de Oliveira-Filho, E F

    2017-02-01

    Hepatitis E is an acute human liver disease in healthy individuals which may eventually become chronic. It is caused by the hepatitis E virus (HEV) and can have a zoonotic origin. Nearly 57,000 people die yearly from hepatitis E-related conditions. The disease is endemic in both developing and developed countries with distinct epidemiologic profiles. In developing countries, the disease is associated with inadequate water treatment, while in developed countries, transmission is associated with animal contact and the ingestion of raw or uncooked meat, especially liver. All human HEV are grouped into at least four genotypes, while HEV or HEV-related viruses have been identified in an increasing number of domestic and wild animal species. Despite a high genetic diversity, only one single HEV serotype has been described to date for HEV genotypes 1-4. The discovery of new HEV or HEV-related viruses leads to a continuing increase in the number of genotypes. In addition, the genome organization of all these viruses is variable with overlapping open reading frames (ORF) and differences in the location of ORF3. In spite of the role of some domestic and wild animals as reservoir, the origin of HEV and HEV-related viruses in humans and animals is still unclear. This review discusses aspects of the detection, molecular virology, zoonotic transmission and origin of HEV and HEV-related viruses in the context of 'One Health' and establishes a link between the previous and the new taxonomy of this growing virus family. © 2015 Blackwell Verlag GmbH.

  1. Circulating avian influenza viruses closely related to the 1918 virus have pandemic potential

    Science.gov (United States)

    Watanabe, Tokiko; Zhong, Gongxun; Russell, Colin A.; Nakajima, Noriko; Hatta, Masato; Hanson, Anthony; McBride, Ryan; Burke, David F.; Takahashi, Kenta; Fukuyama, Satoshi; Tomita, Yuriko; Maher, Eileen A.; Watanabe, Shinji; Imai, Masaki; Neumann, Gabriele; Hasegawa, Hideki; Paulson, James C.; Smith, Derek J.; Kawaoka, Yoshihiro

    2014-01-01

    Summary Wild birds harbor a large gene pool of influenza A viruses that have the potential to cause influenza pandemics. Foreseeing and understanding this potential is important for effective surveillance. Our phylogenetic and geographic analyses revealed the global prevalence of avian influenza virus genes whose proteins differ only a few amino acids from the 1918 pandemic influenza virus, suggesting that 1918-like pandemic viruses may emerge in the future. To assess this risk, we generated and characterized a virus composed of avian influenza viral segments with high homology to the 1918 virus. This virus exhibited higher pathogenicity in mice and ferrets than an authentic avian influenza virus. Further, acquisition of seven amino acid substitutions in the viral polymerases and the hemagglutinin surface glycoprotein conferred respiratory droplet transmission to the 1918-like avian virus in ferrets, demonstrating that contemporary avian influenza viruses with 1918 virus-like proteins may have pandemic potential. PMID:24922572

  2. Ocorrência do vírus do mosqueado do morangueiro no estado de São Paulo Occurrence of the strawberry mottle virus in São Paulo

    Directory of Open Access Journals (Sweden)

    Ana Maria B. Carvalho

    1961-01-01

    tornou-se vírulífero quando alimentado em planta infetada por 30 minutos. Com o aumento no período de alimentação na fonte de vírus aumentou a eficiência de transmissão. Insetos virulíferos foram capazes de infetar plantas sadias quando alimentados sôbre elas por 15 minutos. Insetos virulíferos alimentados por 1 hora em planta sadia ainda retinham o vírus. Após 6 horas de alimentação já não mais o retinham.The ocurrence of virus strains similar to those of the strawberry mottle virus has been recorded in several strawberry plantings in the state of São Paulo. Old, standard varieties are symptomless carriers and are usually 100 per cent infected. Some new clones, representing various crosses, were partly infected after a Few plantings in the field. The symptoms induced by die virus on Fragaria uesca seedlings were vein clearing, crinkling, and stunting. Most of the virus isolates seemed to resemble curly dwarf. Studies on host range carried out by means of the vector gave mostly negative results, but symptoms were obtained on Cassia occidentalis, Chenopodium quinoa, Leonotis nepaetifolia, and Leonorus sibiricus Although this happened when inoculations were made with different sources of the strawberry mottle virus, it cannot be stated with certainty that the symptoms obtained on these four species were really caused by the mottle virus, since it was possible that the original sources contained another virus. The strawberry mottle virus was transmitted efficiently by Pentatrichopus fragaefolii and only occasionally by Aphis gossypii. Seed transmission was negative. Tests on mechanical inoculation were also negative. However, the virus obtained on Chenopodium quinoa plants by means of the vector could be transmitted mechanically to seedlings of the same species, but not to Fragaria vesca. A local species of Cuscuta did not transmit the mottle virus and transmission with leaf scions grafted on leaves was generally low because of poor take. Pentatrichopus

  3. Contact Mechanics of a Small Icosahedral Virus

    Science.gov (United States)

    Zeng, Cheng; Hernando-Pérez, Mercedes; Dragnea, Bogdan; Ma, Xiang; van der Schoot, Paul; Zandi, Roya

    2017-07-01

    A virus binding to a surface causes stress of the virus cage near the contact area. Here, we investigate the potential role of substrate-induced structural perturbation in the mechanical response of virus particles to adsorption. This is particularly relevant to the broad category of viruses stabilized by weak noncovalent interactions. We utilize atomic force microscopy to measure height distributions of the brome mosaic virus upon adsorption from solution on atomically flat substrates and present a continuum model that captures our observations and provides estimates of elastic properties and of the interfacial energy of the virus, without recourse to indentation.

  4. Structure of viruses: a short history.

    Science.gov (United States)

    Rossmann, Michael G

    2013-05-01

    This review is a partially personal account of the discovery of virus structure and its implication for virus function. Although I have endeavored to cover all aspects of structural virology and to acknowledge relevant individuals, I know that I have favored taking examples from my own experience in telling this story. I am anxious to apologize to all those who I might have unintentionally offended by omitting their work. The first knowledge of virus structure was a result of Stanley's studies of tobacco mosaic virus (TMV) and the subsequent X-ray fiber diffraction analysis by Bernal and Fankuchen in the 1930s. At about the same time it became apparent that crystals of small RNA plant and animal viruses could diffract X-rays, demonstrating that viruses must have distinct and unique structures. More advances were made in the 1950s with the realization by Watson and Crick that viruses might have icosahedral symmetry. With the improvement of experimental and computational techniques in the 1970s, it became possible to determine the three-dimensional, near-atomic resolution structures of some small icosahedral plant and animal RNA viruses. It was a great surprise that the protecting capsids of the first virus structures to be determined had the same architecture. The capsid proteins of these viruses all had a 'jelly-roll' fold and, furthermore, the organization of the capsid protein in the virus were similar, suggesting a common ancestral virus from which many of today's viruses have evolved. By this time a more detailed structure of TMV had also been established, but both the architecture and capsid protein fold were quite different to that of the icosahedral viruses. The small icosahedral RNA virus structures were also informative of how and where cellular receptors, anti-viral compounds, and neutralizing antibodies bound to these viruses. However, larger lipid membrane enveloped viruses did not form sufficiently ordered crystals to obtain good X-ray diffraction

  5. Hepatitis A Virus and Hepatitis E Virus: Emerging and Re-Emerging Enterically Transmitted Hepatitis Viruses.

    Science.gov (United States)

    Lemon, Stanley M; Walker, Christopher M

    2018-05-07

    Over the past two decades, progress in understanding human infections with hepatitis A virus (HAV) and hepatitis E virus (HEV) has been eclipsed by the priority of combating persistent hepatitis B virus (HBV) and hepatitis C virus (HCV) infections. During that time, the global burden of liver disease caused by enteric hepatitis viruses has not abated. Because of vaccines, hepatitis A has become increasingly a disease of adults instead of early childhood in many regions of the world, resulting in an age-related shift toward more severe disease. HEV has remained endemic in many developing countries, and in well-developed, economically advanced countries it is now recognized as a cause of chronic, progressive liver disease in individuals with compromised immunity. The goal of this collection of articles is to review recent progress and to shine a bright light on gaps in our understanding of how these viruses replicate, cause disease, interact with the liver and host immune system, and are transmitted, along with prospects for improved control in human populations. Renewed efforts to study and compare HAV and HEV biology in humans and animal models have high potential to enhance our understanding of host-pathogen balance in the liver, and may contribute ultimately to the control of other infectious diseases of the liver. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  6. Ebola virus: recommendations

    CERN Multimedia

    CERN Medical Service

    2014-01-01

    The CERN Medical Service has been closely following, in particular via the WHO, the development of the Ebola virus outbreak currently affecting some African countries. This infectious disease may be passed on through direct contact with the bodily fluids of a sick person.   Based on the recommendations of the WHO and the two Host States, Switzerland and France, as updated on their respective websites, so far there has been no ban on travel to the countries concerned. However, unless it is absolutely essential, you are advised not to visit any of the countries affected by Ebola (Guinea, Republic of Sierra Leone, Liberia, Nigeria). The two Host States have established an alert system, and a check is carried out on departure from the airports of those countries. It is strongly recommended that you contact the Medical Service if you are travelling to those countries. We remind you to observe the basic rules of hygiene such as frequent hand washing, whatever your destination. The Medical Service is...

  7. Autophagic machinery activated by dengue virus enhances virus replication

    International Nuclear Information System (INIS)

    Lee, Y.-R.; Lei, H.-Y.; Liu, M.-T.; Wang, J.-R.; Chen, S.-H.; Jiang-Shieh, Y.-F.; Lin, Y.-S.; Yeh, T.-M.; Liu, C.-C.; Liu, H.-S.

    2008-01-01

    Autophagy is a cellular response against stresses which include the infection of viruses and bacteria. We unravel that Dengue virus-2 (DV2) can trigger autophagic process in various infected cell lines demonstrated by GFP-LC3 dot formation and increased LC3-II formation. Autophagosome formation was also observed under the transmission electron microscope. DV2-induced autophagy further enhances the titers of extracellular and intracellular viruses indicating that autophagy can promote viral replication in the infected cells. Moreover, our data show that ATG5 protein is required to execute DV2-induced autophagy. All together, we are the first to demonstrate that DV can activate autophagic machinery that is favorable for viral replication

  8. [Bats and Viruses: complex relationships].

    Science.gov (United States)

    Rodhain, F

    2015-10-01

    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  9. Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV), Bovine Leukemia Virus (BLV), Human Papilloma Virus (HPV), and Epstein-Barr Virus (EBV).

    Science.gov (United States)

    Lawson, James S; Salmons, Brian; Glenn, Wendy K

    2018-01-01

    Although the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV), bovine leukemia virus (BLV), human papilloma viruses (HPVs), and Epstein-Barr virus (EBV-also known as human herpes virus type 4). Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence. MMTV and human breast cancer-the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer-the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer-the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer-the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal. The influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

  10. Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV, Bovine Leukemia Virus (BLV, Human Papilloma Virus (HPV, and Epstein–Barr Virus (EBV

    Directory of Open Access Journals (Sweden)

    James S. Lawson

    2018-01-01

    Full Text Available BackgroundAlthough the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV, bovine leukemia virus (BLV, human papilloma viruses (HPVs, and Epstein–Barr virus (EBV-also known as human herpes virus type 4. Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence.The evidenceMMTV and human breast cancer—the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer—the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer—the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer—the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal.ConclusionThe influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

  11. Designing herpes viruses as oncolytics

    Directory of Open Access Journals (Sweden)

    Cole Peters

    Full Text Available Oncolytic herpes simplex virus (oHSV was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity.

  12. Viruses and thyroiditis: an update

    Directory of Open Access Journals (Sweden)

    Hober Didier

    2009-01-01

    Full Text Available Abstract Viral infections are frequently cited as a major environmental factor involved in subacute thyroiditis and autoimmune thyroid diseases This review examines the data related to the role of viruses in the development of thyroiditis. Our research has been focused on human data. We have reviewed virological data for each type of thyroiditis at different levels of evidence; epidemiological data, serological data or research on circulating viruses, direct evidence of thyroid tissue infection. Interpretation of epidemiological and serological data must be cautious as they don't prove that this pathogen is responsible for the disease. However, direct evidence of the presence of viruses or their components in the organ are available for retroviruses (HFV and mumps in subacute thyroiditis, for retroviruses (HTLV-1, HFV, HIV and SV40 in Graves's disease and for HTLV-1, enterovirus, rubella, mumps virus, HSV, EBV and parvovirus in Hashimoto's thyroiditis. However, it remains to determine whether they are responsible for thyroid diseases or whether they are just innocent bystanders. Further studies are needed to clarify the relationship between viruses and thyroid diseases, in order to develop new strategies for prevention and/or treatment.

  13. Viruses and thyroiditis: an update

    Science.gov (United States)

    Desailloud, Rachel; Hober, Didier

    2009-01-01

    Viral infections are frequently cited as a major environmental factor involved in subacute thyroiditis and autoimmune thyroid diseases This review examines the data related to the role of viruses in the development of thyroiditis. Our research has been focused on human data. We have reviewed virological data for each type of thyroiditis at different levels of evidence; epidemiological data, serological data or research on circulating viruses, direct evidence of thyroid tissue infection. Interpretation of epidemiological and serological data must be cautious as they don't prove that this pathogen is responsible for the disease. However, direct evidence of the presence of viruses or their components in the organ are available for retroviruses (HFV) and mumps in subacute thyroiditis, for retroviruses (HTLV-1, HFV, HIV and SV40) in Graves's disease and for HTLV-1, enterovirus, rubella, mumps virus, HSV, EBV and parvovirus in Hashimoto's thyroiditis. However, it remains to determine whether they are responsible for thyroid diseases or whether they are just innocent bystanders. Further studies are needed to clarify the relationship between viruses and thyroid diseases, in order to develop new strategies for prevention and/or treatment. PMID:19138419

  14. Quantitative nanoscale electrostatics of viruses.

    Science.gov (United States)

    Hernando-Pérez, M; Cartagena-Rivera, A X; Lošdorfer Božič, A; Carrillo, P J P; San Martín, C; Mateu, M G; Raman, A; Podgornik, R; de Pablo, P J

    2015-11-07

    Electrostatics is one of the fundamental driving forces of the interaction between biomolecules in solution. In particular, the recognition events between viruses and host cells are dominated by both specific and non-specific interactions and the electric charge of viral particles determines the electrostatic force component of the latter. Here we probe the charge of individual viruses in liquid milieu by measuring the electrostatic force between a viral particle and the Atomic Force Microscope tip. The force spectroscopy data of co-adsorbed ϕ29 bacteriophage proheads and mature virions, adenovirus and minute virus of mice capsids is utilized for obtaining the corresponding density of charge for each virus. The systematic differences of the density of charge between the viral particles are consistent with the theoretical predictions obtained from X-ray structural data. Our results show that the density of charge is a distinguishing characteristic of each virus, depending crucially on the nature of the viral capsid and the presence/absence of the genetic material.

  15. Fungal transmission of plant viruses.

    Science.gov (United States)

    Campbell, R N

    1996-01-01

    Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.

  16. Designing herpes viruses as oncolytics

    Science.gov (United States)

    Peters, Cole; Rabkin, Samuel D

    2015-01-01

    Oncolytic herpes simplex virus (oHSV) was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity. PMID:26462293

  17. Viruses: agents of coral disease?

    Science.gov (United States)

    Davy, S K; Burchett, S G; Dale, A L; Davies, P; Davy, J E; Muncke, C; Hoegh-Guldberg, O; Wilson, W H

    2006-03-23

    The potential role of viruses in coral disease has only recently begun to receive attention. Here we describe our attempts to determine whether viruses are present in thermally stressed corals Pavona danai, Acropora formosa and Stylophora pistillata and zoanthids Zoanthus sp., and their zooxanthellae. Heat-shocked P. danai, A. formosa and Zoanthus sp. all produced numerous virus-like particles (VLPs) that were evident in the animal tissue, zooxanthellae and the surrounding seawater; VLPs were also seen around heat-shocked freshly isolated zooxanthellae (FIZ) from P. danai and S. pistillata. The most commonly seen VLPs were tail-less, hexagonal and about 40 to 50 nm in diameter, though a diverse range of other VLP morphotypes (e.g. rounded, rod-shaped, droplet-shaped, filamentous) were also present around corals. When VLPs around heat-shocked FIZ from S. pistillata were added to non-stressed FIZ from this coral, they resulted in cell lysis, suggesting that an infectious agent was present; however, analysis with transmission electron microscopy provided no clear evidence of viral infection. The release of diverse VLPs was again apparent when flow cytometry was used to enumerate release by heat-stressed A. formosa nubbins. Our data support the infection of reef corals by viruses, though we cannot yet determine the precise origin (i.e. coral, zooxanthellae and/or surface microbes) of the VLPs seen. Furthermore, genome sequence data are required to establish the presence of viruses unequivocally.

  18. Coping with Computer Viruses: General Discussion and Review of Symantec Anti-Virus for the Macintosh.

    Science.gov (United States)

    Primich, Tracy

    1992-01-01

    Discusses computer viruses that attack the Macintosh and describes Symantec AntiVirus for Macintosh (SAM), a commercial program designed to detect and eliminate viruses; sample screen displays are included. SAM is recommended for use in library settings as well as two public domain virus protection programs. (four references) (MES)

  19. How Hepatitis D Virus Can Hinder the Control of Hepatitis B Virus

    NARCIS (Netherlands)

    Xiridiou, M.; Borkent-Raven, B.; Hulshof, J.; Wallinga, J.

    2009-01-01

    Background: Hepatitis D (or hepatitis delta) virus is a defective virus that relies on hepatitis B virus (HBV) for transmission; infection with hepatitis D can occur only as coinfection with HBV or superinfection of an existing HBV infection. Because of the bond between the two viruses, control

  20. Zika Virus and Complications: Questions and Answers

    Science.gov (United States)

    ... do if they have been exposed to unprotected sex but do not wish to become pregnant because ... A's Zika virus and complications » Zika digital timeline Video Zika virus - Questions and answers (Q&A) Related ...

  1. Archaeal Viruses: Diversity, Replication, and Structure.

    Science.gov (United States)

    Dellas, Nikki; Snyder, Jamie C; Bolduc, Benjamin; Young, Mark J

    2014-11-01

    The Archaea-and their viruses-remain the most enigmatic of life's three domains. Once thought to inhabit only extreme environments, archaea are now known to inhabit diverse environments. Even though the first archaeal virus was described over 40 years ago, only 117 archaeal viruses have been discovered to date. Despite this small number, these viruses have painted a portrait of enormous morphological and genetic diversity. For example, research centered around the various steps of the archaeal virus life cycle has led to the discovery of unique mechanisms employed by archaeal viruses during replication, maturation, and virion release. In many instances, archaeal virus proteins display very low levels of sequence homology to other proteins listed in the public database, and therefore, structural characterization of these proteins has played an integral role in functional assignment. These structural studies have not only provided insights into structure-function relationships but have also identified links between viruses across all three domains of life.

  2. New Lineage of Lassa Virus, Togo, 2016

    Science.gov (United States)

    Whitmer, Shannon L.M.; Strecker, Thomas; Cadar, Daniel; Dienes, Hans-Peter; Faber, Kelly; Patel, Ketan; Brown, Shelley M.; Davis, William G.; Klena, John D.; Rollin, Pierre E.; Schmidt-Chanasit, Jonas; Fichet-Calvet, Elisabeth; Noack, Bernd; Emmerich, Petra; Rieger, Toni; Wolff, Svenja; Fehling, Sarah Katharina; Eickmann, Markus; Mengel, Jan Philipp; Schultze, Tilman; Hain, Torsten; Ampofo, William; Bonney, Kofi; Aryeequaye, Juliana Naa Dedei; Ribner, Bruce; Varkey, Jay B.; Mehta, Aneesh K.; Lyon, G. Marshall; Kann, Gerrit; De Leuw, Philipp; Schuettfort, Gundolf; Stephan, Christoph; Wieland, Ulrike; Fries, Jochen W.U.; Kochanek, Matthias; Kraft, Colleen S.; Wolf, Timo; Nichol, Stuart T.; Becker, Stephan; Ströher, Ute

    2018-01-01

    We describe a strain of Lassa virus representing a putative new lineage that was isolated from a cluster of human infections with an epidemiologic link to Togo. This finding extends the known range of Lassa virus to Togo. PMID:29460758

  3. Zika Virus: Protecting Pregnant Women and Babies

    Science.gov (United States)

    ... Digital Press Kit Read the MMWR Science Clips Zika Virus Protecting Pregnant Women and Babies Language: English (US) ... Spanish) Recommend on Facebook Tweet Share Compartir Overview Zika virus infection (Zika) during pregnancy can cause damage to ...

  4. A Literature Review of Zika Virus.

    Science.gov (United States)

    Plourde, Anna R; Bloch, Evan M

    2016-07-01

    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus's vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic.

  5. General properties of grapevine viruses occurring in Hungary

    Directory of Open Access Journals (Sweden)

    Eszter Cseh

    2012-03-01

    Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.

  6. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    including measles virus (MeV), mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV), rinderpest virus, canine distemper virus (CDV), human...Institute of Health, Bethesda, MD. Hut 102, MT2, MT4, and CEM human T cell lines were provided by Chou-Zen Giam, USUHS, Bethesda, MD. The human osteosarcoma

  7. Bluetongue virus in Lebanon.

    Science.gov (United States)

    El Hage, J; Lorusso, A; Carmine, I; Di Gennaro, A; Portanti, O; Olivieri, S; Casaccia, C; Pisciella, M; Teodori, L; Sghaier, S; Savini, G

    2013-10-01

    Since 2000, several incursions of bluetongue virus (BTV) occurred in the Mediterranean Basin involving European and surrounding Countries. The Middle East represents one of the most important gateways for the access of BTV in Europe. Limited data on the BTV situation in this area are available. In this perspective, an epidemiological survey on the presence of BTV in Lebanon was conducted. Of the 181 serum samples tested, 97 (mean = 53.6%; 95% CI: 46.3-60.7) resulted positive when tested for the presence of BTV antibodies by c-ELISA, of these 42 (mean = 42%; 95% CI: 32.8-51.8) serum samples were from sheep and 55 (mean = 67.9%; 95% CI: 57.1-77.1) serum samples were from goats. Fourteen blood samples (14/110; mean = 12.7%; 95% CI: 7.8-20.3), 6 (6/66; mean = 9.1%; 95% CI: 4.4-18.5) from sheep and 8 (8/44; mean = 18.2%; 95% CI: 9.6-32.0) from goats, were positive by qRT-PCR. The results with serum-neutralization assay and typing performed by RT-PCR confirmed that six BTV serotypes are currently circulating in Lebanon, and these serotypes are as follows: 1, 4, 6, 8, 16 and 24. This study is the first report that confirms the presence and circulation of BTV in Lebanon. © 2013 Blackwell Verlag GmbH.

  8. Persistent hepatitis virus infection and immune homeostasis

    OpenAIRE

    ZHOU Yun

    2014-01-01

    Homeostasis between the host and viruses is naturally maintained. On the one hand, the immune system activates the immune response to kill or eliminate viruses; on the other hand, the immune system controls the immune response to maintain immune homeostasis. The cause of persistent infections with hepatitis viruses such as HBV and HCV is that viral molecules damage the immune system of the host and their variants escape immune clearance. Long-term coexistence of the host and viruses is the pr...

  9. Characteristics of Filoviridae: Marburg and Ebola Viruses

    Science.gov (United States)

    Beer, Brigitte; Kurth, Reinhard; Bukreyev, Alexander

    Filoviruses are enveloped, nonsegmented negative-stranded RNA viruses. The two species, Marburg and Ebola virus, are serologically, biochemically, and genetically distinct. Marburg virus was first isolated during an outbreak in Europe in 1967, and Ebola virus emerged in 1976 as the causative agent of two simultaneous outbreaks in southern Sudan and northern Zaire. Although the main route of infection is known to be person-to-person transmission by intimate contact, the natural reservoir for filoviruses still remains a mystery.

  10. Avaliação de algumas propriedades funcionais das farinhas de tremoço doce (Lupinus albus e feijão guandu (Cajanus cajan (L Millsp e sua utilização na produção de fiambre Evaluation of some functional properties of lupin sweet flour (Lupinus albus and faba bean flour (Cajanus cajan (L Millsp and their utilization in cooked ham production

    Directory of Open Access Journals (Sweden)

    Fernando Castilho

    2010-03-01

    Full Text Available O aumento na demanda de alimentos no mundo tem motivado pesquisadores a buscarem fontes alternativas a fim de enriquecer nutricionalmente alimentos industrializados e torná-los viáveis economicamente às populações menos favorecidas. O tremoço doce e o feijão guandu são leguminosas com elevado conteúdo proteico e grande potencial de utilização no enriquecimento nutricional de alimentos industrializados, além de desempenharem funcionalidades. Os resultados obtidos neste trabalho permitiram observar que a farinha de tremoço doce é capaz de absorver de 172 a 186% do seu peso em água e de ~62% em óleo, enquanto que a farinha de feijão guandu absorve cerca de 100% de seu peso em água e 50% em óleo. Boa atividade e estabilidade foram observadas para as emulsões obtidas com estas farinhas, indicando potencial de aplicação na produção de embutidos. Objetivou-se neste trabalho, avaliar algumas propriedades funcionais das farinhas de tremoço doce e feijão guandu e sua utilização na fabricação de fiambres. Os fiambres foram elaborados no Laboratório de Controle de Qualidade de Alimentos da Faculdade de Ciências Farmacêuticas da Universidade Estadual Paulista (UNESP, na cidade de Araraquara, com o intuito de oferecer um alimento enriquecido nutricionalmente. Quando comparados ao fiambre elaborado com a adição de concentrado proteico de soja, estes fiambres não apresentaram diferenças significativas nos atributos sensoriais aparência, cor, aroma, textura e impressão global, embora tivessem pouca aceitabilidade sensorial.The increase in food demand worldwide has motivated researchers to seek alternative food crops to nutritionally enrich industrialized foods and make them economically viable to poorer populations. Sweet lupin and faba bean are high protein content legumes of great potential for nutritional enrichment of industrialized foods, besides performing a functional purpose. The results obtained in this work

  11. Viruses, Vaccines and the Public.

    Science.gov (United States)

    Diamond, Judy; McQuillan, Julia; Spiegel, Amy N; Hill, Patricia Wonch; Smith, Rebecca; West, John; Wood, Charles

    Current research in virology is changing public conceptions about vaccines and infectious disease. The University of Nebraska State Museum collaborated with research virologists, science writers, artists and learning researchers to create public outreach materials about viruses and infectious disease. The project, funded by the National Institute of Health's SEPA program, developed comics, a book with Carl Zimmer, and other materials and programs. The project launched three kinds of learning research: 1) a survey of Nebraska adults on their opinions about vaccines and infectious disease; 2) a study comparing the mental models of viruses, vaccines and infection from virologists, teachers, and students; and 3) a controlled study 873 high school students randomly assigned to read either a comic or a text-based essay with the same virus information.

  12. Viruses & kidney disease: beyond HIV

    Science.gov (United States)

    Waldman, Meryl; Marshall, Vickie; Whitby, Denise; Kopp, Jeffrey B.

    2008-01-01

    HIV-infected patients may acquire new viral co-infections; they may also experience the reactivation or worsening of existing viral infections, including active, smoldering, or latent infections. HIV-infected patients may be predisposed to these viral infections due to immunodeficiency or to risk factors common to HIV and other viruses. A number of these affect the kidney, either by direct infection or by deposition of immune complexes. In this review we discuss the renal manifestations and treatment of hepatitis C virus, BK virus, adenovirus, cytomegalovirus, and parvovirus B19 in patients with HIV disease. We also discuss an approach to the identification of new viral renal pathogens, using a viral gene chip to identify viral DNA or RNA. PMID:19013331

  13. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit

    2011-12-01

    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  14. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  15. Characterization of pseudorabies viruses produced in mammalian ...

    African Journals Online (AJOL)

    Yomi

    2012-02-28

    Feb 28, 2012 ... for influenza A and B viruses (Govorkova et al., 1996). In addition, the propagation of porcine epidemic diarrhea virus (PEDV), a porcine coronavirus had been unsuccessful until serial passage of the virus in Vero cells. (Hofmann and Wyler, 1988; Song et al., 2003). There- fore, this cell line is being widely ...

  16. Contact Mechanics of a Small Icosahedral Virus

    NARCIS (Netherlands)

    Zeng, Cheng; Hernando-Pérez, Mercedes; Ma, Xiang; Schoot, Paul van der; Zandi, Roya; Dragnea, Bogdan

    2017-01-01

    Virus binding to a surface results at least locally, at the contact area, in stress and potential structural perturbation of the virus cage. Here we address the question of the role of substrate-induced deformation in the overall virus mechanical response to the adsorption event. This question may

  17. Emerging viruses in the genus Comovirus

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Koloniuk, Igor

    2010-01-01

    Roč. 40, č. 2 (2010), s. 290-292 ISSN 0920-8569 R&D Projects: GA ČR GA522/07/0053 Institutional research plan: CEZ:AV0Z50510513 Keywords : Capsid proteins * plant virus * Radish mosaic virus * Turnip ringspot virus Subject RIV: EE - Microbiology, Virology Impact factor: 1.693, year: 2010

  18. Ebola Virus Persistence in Semen Ex Vivo.

    Science.gov (United States)

    Fischer, Robert J; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J

    2016-02-01

    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions.

  19. Virus detection and quantification using electrical parameters

    Science.gov (United States)

    Ahmad, Mahmoud Al; Mustafa, Farah; Ali, Lizna M.; Rizvi, Tahir A.

    2014-10-01

    Here we identify and quantitate two similar viruses, human and feline immunodeficiency viruses (HIV and FIV), suspended in a liquid medium without labeling, using a semiconductor technique. The virus count was estimated by calculating the impurities inside a defined volume by observing the change in electrical parameters. Empirically, the virus count was similar to the absolute value of the ratio of the change of the virus suspension dopant concentration relative to the mock dopant over the change in virus suspension Debye volume relative to mock Debye volume. The virus type was identified by constructing a concentration-mobility relationship which is unique for each kind of virus, allowing for a fast (within minutes) and label-free virus quantification and identification. For validation, the HIV and FIV virus preparations were further quantified by a biochemical technique and the results obtained by both approaches corroborated well. We further demonstrate that the electrical technique could be applied to accurately measure and characterize silica nanoparticles that resemble the virus particles in size. Based on these results, we anticipate our present approach to be a starting point towards establishing the foundation for label-free electrical-based identification and quantification of an unlimited number of viruses and other nano-sized particles.

  20. Influenza Virus Infection in Nonhuman Primates

    Science.gov (United States)

    Karlsson, Erik A.; Engel, Gregory A.; Feeroz, M.M.; San, Sorn; Rompis, Aida; Lee, Benjamin P. Y.-H.; Shaw, Eric; Oh, Gunwha; Schillaci, Michael A.; Grant, Richard; Heidrich, John; Schultz-Cherry, Stacey

    2012-01-01

    To determine whether nonhuman primates are infected with influenza viruses in nature, we conducted serologic and swab studies among macaques from several parts of the world. Our detection of influenza virus and antibodies to influenza virus raises questions about the role of nonhuman primates in the ecology of influenza. PMID:23017256

  1. Influenza B viruses : not to be discounted

    NARCIS (Netherlands)

    van de Sandt, Carolien E; Bodewes, Rogier; Rimmelzwaan, Guus F; de Vries, Rory D

    2015-01-01

    In contrast to influenza A viruses, which have been investigated extensively, influenza B viruses have attracted relatively little attention. However, influenza B viruses are an important cause of morbidity and mortality in the human population and full understanding of their biological and

  2. Chikungunya Virus: What You Need to Know

    Science.gov (United States)

    Chikungunya Virus: What you need to know Chikungunya (pronunciation: \\chik-en-gun-ye) is: ŠŠ A virus spread through Aedes species mosquito bites. Aedes mosquitoes also spread dengue and Zika viruses. ŠŠ A risk to anyone traveling to a region ...

  3. Engineering resistance against potato virus Y

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.

    1993-01-01

    Potato virus Y is the type species of the potyvirus genus, the largest genus of the plant virus family Potyviridae. The virus causes serious problems in the cultivation of several Solanaceous crops and although certain poly- and monogenic resistances are available,

  4. Inhibition of Interferon Induction and Action by the Nairovirus Nairobi Sheep Disease Virus/Ganjam Virus

    OpenAIRE

    Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D.

    2011-01-01

    The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type ...

  5. Characterization of Ebola Virus Entry by Using Pseudotyped Viruses: Identification of Receptor-Deficient Cell Lines

    OpenAIRE

    Wool-Lewis, Rouven J.; Bates, Paul

    1998-01-01

    Studies analyzing Ebola virus replication have been severely hampered by the extreme pathogenicity of this virus. To permit analysis of the host range and function of the Ebola virus glycoprotein (Ebo-GP), we have developed a system for pseudotyping these glycoproteins into murine leukemia virus (MLV). This pseudotyped virus, MLV(Ebola), can be readily concentrated to titers which exceed 5 × 106 infectious units/ml and is effectively neutralized by antibodies specific for Ebo-GP. Analysis of ...

  6. ICTV Virus Taxonomy Profile: Rhabdoviridae.

    Science.gov (United States)

    Walker, Peter J; Blasdell, Kim R; Calisher, Charles H; Dietzgen, Ralf G; Kondo, Hideki; Kurath, Gael; Longdon, Ben; Stone, David M; Tesh, Robert B; Tordo, Noël; Vasilakis, Nikos; Whitfield, Anna E; Nbsp Ictv Report Consortium

    2018-04-01

    The family Rhabdoviridae comprises viruses with negative-sense (-) single-stranded RNA genomes of 10.8-16.1 kb. Virions are typically enveloped with bullet-shaped or bacilliform morphology but can also be non-enveloped filaments. Rhabdoviruses infect plants and animals including mammals, birds, reptiles and fish, as well as arthropods which serve as single hosts or act as biological vectors for transmission to animals or plants. Rhabdoviruses include important pathogens of humans, livestock, fish and agricultural crops. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of Rhabdoviridae, which is available at www.ictv.global/report/rhabdoviridae.

  7. Systematic analysis of protein identity between Zika virus and other arthropod-borne viruses.

    Science.gov (United States)

    Chang, Hsiao-Han; Huber, Roland G; Bond, Peter J; Grad, Yonatan H; Camerini, David; Maurer-Stroh, Sebastian; Lipsitch, Marc

    2017-07-01

    To analyse the proportions of protein identity between Zika virus and dengue, Japanese encephalitis, yellow fever, West Nile and chikungunya viruses as well as polymorphism between different Zika virus strains. We used published protein sequences for the Zika virus and obtained protein sequences for the other viruses from the National Center for Biotechnology Information (NCBI) protein database or the NCBI virus variation resource. We used BLASTP to find regions of identity between viruses. We quantified the identity between the Zika virus and each of the other viruses, as well as within-Zika virus polymorphism for all amino acid k -mers across the proteome, with k ranging from 6 to 100. We assessed accessibility of protein fragments by calculating the solvent accessible surface area for the envelope and nonstructural-1 (NS1) proteins. In total, we identified 294 Zika virus protein fragments with both low proportion of identity with other viruses and low levels of polymorphisms among Zika virus strains. The list includes protein fragments from all Zika virus proteins, except NS3. NS4A has the highest number (190 k -mers) of protein fragments on the list. We provide a candidate list of protein fragments that could be used when developing a sensitive and specific serological test to detect previous Zika virus infections.

  8. Virus isolation for diagnosing dengue virus infections in returning travelers

    NARCIS (Netherlands)

    Teichmann, D.; Göbels, K.; Niedrig, M.; Sim-Brandenburg, J.-W.; Làge-Stehr, J.; Grobusch, M. P.

    2003-01-01

    Dengue fever is recognized as one of the most frequent imported acute febrile illnesses affecting European tourists returning from the tropics. In order to assess the value of virus isolation for the diagnosis of dengue fever, 70 cases of dengue fever confirmed in German travelers during the period

  9. [Epidemiologic aspects of human immunodeficiency virus and hepatitis virus infections].

    Science.gov (United States)

    Diarra, M; Konate, A; Minta, D; Sounko, A; Dembele, M; Toure, C S; Kalle, A; Traore, H H; Maiga, M Y

    2006-01-01

    In order to determinate the prevalence of hepatitis B virus and hepatitis C virus among patients infected by the HIV, We realized a transverse survey case--control in hepato-gastro-enterological ward and serology unity of National Institute of Research in Public health (INRSP). Our sample was constituted with 100 patients HIV positive compared to 100 controls HIV negative. The viral markers research has been made by methods immuno-enzymatiqueses of ELISA 3rd generation. Tests permitted to get the following results: Hepatitis B surface antigen (HBs Ag) was positive among 21% with patients HIV positive versus 23% among control (p = 0,732); Antibody to hepatitis C virus (anti-HCV ab) was present among 23% with patients HIV positive versus 0% among control (p <0,05). Female was predominant among co-infections patient, but without statistic link (p = 0,9 and p = 0,45); The co-infection HBV- HCV was significatively linked to age beyond 40 years (p = 0,0005). Co-infections with HIV infection and hepatitis virus are not rare and deserve to be investigated.

  10. Hepatitis B Virus, Hepatitis C Virus and Human Immunodeficiency ...

    African Journals Online (AJOL)

    Background: The epidemiology of viral hepatitis and Human immunodeficiency virus (HIV) during pregnancy is of great importance for health planners and program managers. However, few published data on viral hepatitis and HIV are available in Sudan especially during pregnancy. Objectives: The current study was ...

  11. Herpes Simplex Virus Type-2 and Human Immunodeficiency Virus ...

    African Journals Online (AJOL)

    Objectives: To estimate the seroprevalence of Herpes Simplex Type 2 (HSV-2) and its association with Human Immunodeficiency Virus type 1 (HIV-1) infections in rural Kilimanjaro Tanzania. Methods: A cross-sectional survey was conducted in Oria village from March to June 2005 involving all individuals aged 15-44 years ...

  12. Citrus Tristeza Virus: An Increasing Trend in the Virus Occurrence ...

    African Journals Online (AJOL)

    Citrus tristeza clostervirus (CTV) is one of the most damaging fruit viruses playing havoc in citrus orchards around the world. Here, we report, an ELISA-based indexing of citrus trees over a period of eight years (2002 to 2010) in Northwest Pakistan, revealing that the incidence of CTV is increasing mainly with the distribution ...

  13. Phomopsis longicolla RNA virus 1 - Novel virus at the edge of myco- and plant viruses.

    Science.gov (United States)

    Hrabáková, Lenka; Koloniuk, Igor; Petrzik, Karel

    2017-06-01

    The complete nucleotide sequence of a new RNA mycovirus in the KY isolate of Phomopsis longicolla Hobbs 1985 and its protoplasts subcultures p5, p9, and ME711 was discovered. The virus, provisionally named Phomopsis longicolla RNA virus 1 (PlRV1), was localized in mitochondria and was determined to have a genome 2822 nucleotides long. A single open reading frame could be translated in silico by both standard and mitochondrial genetic codes into a product featuring conservative domains for an RNA-dependent RNA polymerase (RdRp). The RdRp of PlRV1 has no counterpart among mycoviruses, but it is about 30% identical with the RdRp of plant ourmiaviruses. Recently, new mycoviruses related to plant ourmiaviruses and forming one clade with PlRV1 have been discovered. This separate clade could represent the crucial link between plant and fungal viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Herpes simplex virus following stab phlebectomy.

    Science.gov (United States)

    Hicks, Caitlin W; Lum, Ying Wei; Heller, Jennifer A

    2017-03-01

    Herpes simplex virus infection following surgery is an unusual postoperative phenomenon. Many mechanisms have been suggested, with the most likely explanation related to latent virus reactivation due to a proinflammatory response in the setting of local trauma. Here, we present a case of herpes simplex virus reactivation in an immunocompetent female following a conventional right lower extremity stab phlebectomy. Salient clinical and physical examination findings are described, and management strategies for herpes simplex virus reactivation are outlined. This is the first known case report of herpes simplex virus reactivation following lower extremity phlebectomy.

  15. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    Viruses are the most abundant biological entities on earth, and with an estimated 1031 virus-like particles in the biosphere, viruses are virtually everywhere. Traditionally, the study of viruses has focused on their roles as infectious agents. However, over the last decades with the development...... presents an in depth investigation of the hyperthermophilic archaeal virus SMV. Decisive steps in the viral life-cycle are studied with focus on the early stages of infection. TEM observations suggest that SMV1 virions enter into host cells via a fusion entry mechanism, involving three distinct stages...

  16. A new looming of Zika virus

    Directory of Open Access Journals (Sweden)

    Nirav R. Soni

    2016-05-01

    Full Text Available Zika virus (ZIKV is a member of the virus family Flaviviridae and the genus Flavivirus, transmitted by daytime-active Aedes mosquitoes, such as A. aegypti. ZIKV will continue to spread and it will be difficult to determine how the virus will spread over time. Sign and symptoms of ZIKAVD (Zika virus disease were conjunctivitis (red eyes, back pain, birth defect-abnormal brain development known as microcephaly and it is diagnosed through PCR (polymerase chain reaction and virus isolation from blood samples.

  17. Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

    Science.gov (United States)

    Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

    2015-06-01

    The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

  18. Zika virus en seksuele transmissie.

    NARCIS (Netherlands)

    Duijster, J W; Brandwagt, D A H; Timen, A; van der Eijk, A A; Vennema, H; Te Wierik, M J M

    2017-01-01

    - More evidence has become available concerning the sexual transmission of Zika virus and viral shedding in semen, which has led to the expansion of international guidelines for prevention of sexual transmission; Dutch guidelines have not been altered.- Internationally, the use of condoms during sex

  19. Nucleoside Inhibitors of Zika Virus

    Czech Academy of Sciences Publication Activity Database

    Eyer, L.; Nencka, Radim; Huvarová, I.; Palus, Martin; Alves, M. J.; Gould, E. A.; De Clercq, E.; Růžek, Daniel

    2016-01-01

    Roč. 214, č. 5 (2016), s. 707-711 ISSN 0022-1899 Institutional support: RVO:61388963 ; RVO:60077344 Keywords : Zika virus * flavivirus * nucleoside analogue * antiviral * therapy Subject RIV: CC - Organic Chemistry; EE - Microbiology, Virology (BC-A) Impact factor: 6.273, year: 2016

  20. ICTV virus taxonomy profile: Baculoviridae

    Science.gov (United States)

    The Baculoviridae is a family of large viruses with circular dsDNA genomes ranging from 80 to 180 kbp. Virions consist of enveloped rod-shaped nucleocapsids and are embedded in distinctive occlusion bodies measuring 0.15 to 15 µm. The occlusion bodies consist of a matrix composed of a single viral...

  1. ICTV Virus Taxonomy Profile: Pleolipoviridae

    Czech Academy of Sciences Publication Activity Database

    Bamford, D.H.; Pietila, M.K.; Roine, E.; Atanasova, N.S.; Dienstbier, Ana; Oksanen, H.M.

    2017-01-01

    Roč. 98, č. 12 (2017), s. 2916-2917 ISSN 0022-1317 Institutional support: RVO:61388971 Keywords : Pleolipoviridae * taxonomy * Halorubrum pleomorphic virus 1 Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.838, year: 2016

  2. A Case of Ebola Virus

    Centers for Disease Control (CDC) Podcasts

    2012-10-01

    Dr. Adam MacNeil, an epidemiologist at CDC, discusses Ebola virus.  Created: 10/1/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 10/1/2012.

  3. Threat from Emerging Vectorborne Viruses

    Centers for Disease Control (CDC) Podcasts

    2016-06-09

    Reginald Tucker reads an abridged version of the commentary by CDC author Ronald Rosenberg, Threat from Emerging Vectorborne Viruses.  Created: 6/9/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/9/2016.

  4. Bat Flight and Zoonotic Viruses

    Centers for Disease Control (CDC) Podcasts

    2014-05-30

    Reginald Tucker reads an abridged version of the EID perspective Bat Flight and Zoonotic Viruses.  Created: 5/30/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/2/2014.

  5. Hepatitis A Virus in Transplants

    Centers for Disease Control (CDC) Podcasts

    2017-05-17

    Dr. Monique Foster, a CDC epidemiologist, discusses an unusual case of hepatitis A virus in a transplant patient.  Created: 5/17/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/17/2017.

  6. West Nile Virus Neuroinvasive Disease

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2009-07-01

    Full Text Available Epidemiological features of West Nile Virus (WNV disease among children (<18 years of age reported to the Centers for Disease Control and Prevention from 1999 through 2007 were analyzed and compared with those of adult WNV neuroinvasive disease (WNND, in a study at CDC&P, Fort Collins, CO.

  7. Recombination in hepatitis C virus.

    Science.gov (United States)

    González-Candelas, Fernando; López-Labrador, F Xavier; Bracho, María Alma

    2011-10-01

    Hepatitis C virus (HCV) is a Flavivirus with a positive-sense, single-stranded RNA genome of about 9,600 nucleotides. It is a major cause of liver disease, infecting almost 200 million people all over the world. Similarly to most RNA viruses, HCV displays very high levels of genetic diversity which have been used to differentiate six major genotypes and about 80 subtypes. Although the different genotypes and subtypes share basic biological and pathogenic features they differ in clinical outcomes, response to treatment and epidemiology. The first HCV recombinant strain, in which different genome segments derived from parentals of different genotypes, was described in St. Petersburg (Russia) in 2002. Since then, there have been only a few more than a dozen reports including descriptions of HCV recombinants at all levels: between genotypes, between subtypes of the same genotype and even between strains of the same subtype. Here, we review the literature considering the reasons underlying the difficulties for unequivocally establishing recombination in this virus along with the analytical methods necessary to do it. Finally, we analyze the potential consequences, especially in clinical practice, of HCV recombination in light of the coming new therapeutic approaches against this virus.

  8. Control of feline leukaemia virus.

    NARCIS (Netherlands)

    K. Weijer (Kees); F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1989-01-01

    textabstractFeline leukaemia virus (FeLV) usually occurs in its natural species, the domestic cat. FeLV is also important to human individuals as a comparative model, as it may cause a variety of diseases, some malignant and some benign, such as immunosuppression, which bears a resemblance to AIDS

  9. Molecular phylogeny of Duvenhage virus

    Directory of Open Access Journals (Sweden)

    Louis H. Nel

    2011-11-01

    Full Text Available The Duvenhage virus (DUVV constitutes one of the 11 species in the Lyssavirus genus and causes fatal rabies encephalitis. The virus is associated with insectivorous bat species and three human cases have been reported, all of which were linked to contact with bats. Few of these isolates have been studied and thus little is known about the phylogeny and epidemiology of this lyssavirus. Until 2007, when an isolate was made from the East African country of Kenya, all isolations of this virus had been from southern Africa. This discovery led to many questions regarding the spread and diversity of this lyssavirus. Phylogenetic analysis indicated that the DUVV isolates constitute two different lineages, in which the southern African isolates group together to form one lineage and the more recent isolate from Kenya constitutes a new, second lineage. We found that the new isolate has a genetic variation that has not yet been seen for DUVV. Not only is our lack of knowledge regarding the geographical distribution of this uniquely African virus emphasised, but we have also demonstrated the potential diversity within this genotype.

  10. Oncolytic viruses as anticancer vaccines

    Directory of Open Access Journals (Sweden)

    Norman eWoller

    2014-07-01

    Full Text Available Oncolytic virotherapy has shown impressive results in preclinical studies and first promising therapeutic outcomes in clinical trials as well. Since viruses are known for a long time as excellent vaccination agents, oncolytic viruses are now designed as novel anticancer agents combining the aspect of lysis-dependent cytoreductive activity with concomitant induction of antitumoral immune responses. Antitumoral immune activation by oncolytic virus infection of tumor tissue comprises both, immediate effects of innate immunity and also adaptive responses for long lasting antitumoral activity which is regarded as the most prominent challenge in clinical oncology. To date, the complex effects of a viral tumor infection on the tumor microenvironment and the consequences for the tumor-infiltrating immune cell compartment are poorly understood. However, there is more and more evidence that a tumor infection by an oncolytic virus opens up a number of options for further immunomodulating interventions such as systemic chemotherapy, generic immunostimulating strategies, dendritic cell-based vaccines, and antigenic libraries to further support clinical efficacy of oncolytic virotherapy.

  11. Tetraspanin Assemblies in Virus Infection

    Directory of Open Access Journals (Sweden)

    Luise Florin

    2018-05-01

    Full Text Available Tetraspanins (Tspans are a family of four-span transmembrane proteins, known as plasma membrane “master organizers.” They form Tspan-enriched microdomains (TEMs or TERMs through lateral association with one another and other membrane proteins. If multiple microdomains associate with each other, larger platforms can form. For infection, viruses interact with multiple cell surface components, including receptors, activating proteases, and signaling molecules. It appears that Tspans, such as CD151, CD82, CD81, CD63, CD9, Tspan9, and Tspan7, coordinate these associations by concentrating the interacting partners into Tspan platforms. In addition to mediating viral attachment and entry, these platforms may also be involved in intracellular trafficking of internalized viruses and assist in defining virus assembly and exit sites. In conclusion, Tspans play a role in viral infection at different stages of the virus replication cycle. The present review highlights recently published data on this topic, with a focus on events at the plasma membrane. In light of these findings, we propose a model for how Tspan interactions may organize cofactors for viral infection into distinct molecular platforms.

  12. Genital herpes simplex virus infections.

    Science.gov (United States)

    Rosenthal, M S

    1979-09-01

    In recent years, a great increase in interest in genital herpes has been stimulated partly by the rising prevalence of this disease and partly by observations suggesting that genital herpes is a cause of cervical cancer. The clinical pictures produced by genital herpes simplex virus infections are similar in men and women. In contrast to recurrent attacks, initial episodes of infection are generally more extensive, last longer, and are more often associated with regional lymphadenopathy and systemic symptoms. Genital herpes in pregnancy may pose a serious threat to the newborn infant. Although the data suggesting genital herpes simplex virus infection is a cause of cervical cancer are quite extensive, the evidence is largely circumstantial. In spite of these more serious aspects of genital herpes simplex virus infection, episodes of genital herpes are almost always self-limited and benign. Frequent recurrences pose the major therapeutic and management problem. At present, there is no satisfactory treatment for recurrent genital herpes simplex virus in fection. Many of the suggested therapies, although some sound very promising, are potentially dangerous and should be used only under carefully controlled conditions.

  13. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  14. ICTV virus taxonomy profile: Pneumoviridae

    NARCIS (Netherlands)

    B.K. Rima (Bert); Collins, P. (Peter); Easton, A. (Andrew); R.A.M. Fouchier (Ron); Kurath, G. (Gael); Lamb, R.A. (Robert A.); Lee, B. (Benhur); A. Maisner (Andrea); P.A. Rota (Paul); Wang, L. (Linfa); Lefkowitz, E.J. (Elliot J.); Davison, A.J. (Andrew J.); Simmonds, P. (Peter); Sabanadzovic, S. (Sead); Smith, D.B. (Donald B.); Orton, R.J. (Richard J.); Siddell, S.G. (Stuart G.)

    2017-01-01

    textabstractThe family Pneumoviridae comprises large enveloped negative-sense RNA viruses. This taxon was formerly a subfamily within the Paramyxoviridae, but was reclassified in 2016 as a family with two genera, Orthopneumovirus and Metapneumovirus. Pneumoviruses infect a range of mammalian

  15. Chikungunya VIrUS infection

    African Journals Online (AJOL)

    A retrospective study of 107 cases of serologically proven chikungunya (CHIK) virus infection was undertaken. All respondents 'had contracted the. 'disease at least 3 years previously; 87,9% had fully .recovered, 3,7% experienced only occasional stiff- ness or mild discomfort, 2,8% had persistent resi- dual joint stiffness but ...

  16. How infectious is SARS virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. How infectious is SARS virus. Influenza: 1 patient infects ten people. SARS: 1 patient infects 2-4 people. Incubation period 10 days. Are there `silent´ cases ? Is quarantine enough ? How will it behave if and when it returns ?

  17. Viruses involved in chickpea stunt

    NARCIS (Netherlands)

    Horn, N.M.

    1994-01-01

    Chickpea stunt is the most important virus disease of chickpea ( Cicer arietinum L). This disease is characterized by leaf chlorosis or leaf reddening (depending on the chickpea cultivar), plant stunting, internode shortening, reduction in size of

  18. Diversity of large DNA viruses of invertebrates.

    Science.gov (United States)

    Williams, Trevor; Bergoin, Max; van Oers, Monique M

    2017-07-01

    In this review we provide an overview of the diversity of large DNA viruses known to be pathogenic for invertebrates. We present their taxonomical classification and describe the evolutionary relationships among various groups of invertebrate-infecting viruses. We also indicate the relationships of the invertebrate viruses to viruses infecting mammals or other vertebrates. The shared characteristics of the viruses within the various families are described, including the structure of the virus particle, genome properties, and gene expression strategies. Finally, we explain the transmission and mode of infection of the most important viruses in these families and indicate, which orders of invertebrates are susceptible to these pathogens. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. A Literature Review of Zika Virus

    Science.gov (United States)

    Bloch, Evan M.

    2016-01-01

    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus’s vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic. PMID:27070380

  20. COMPOSITION OF FOWLPOX VIRUS AND INCLUSION MATRIX.

    Science.gov (United States)

    RANDALL, C C; GAFFORD, L G; DARLINGTON, R W; HYDE, J

    1964-04-01

    Randall, Charles C. (University of Mississippi School of Medicine, Jackson), Lanelle G. Gafford, Robert W. Darlington, and James M. Hyde. Composition of fowlpox virus and inclusion matrix. J. Bacteriol. 87:939-944. 1964.-Inclusion bodies of fowlpox virus infection are especially favorable starting material for the isolation of virus and inclusion matrix. Electron micrographs of viral particles and matrix indicated a high degree of purification. Density-gradient centrifugation of virus in cesium chloride and potassium tartrate was unsatisfactory because of inactivation, and clumping or disintegration. Chemical analyses of virus and matrix revealed significant amounts of lipid, protein, and deoxyribonucleic acid, but no ribonucleic acid or carbohydrate. Approximately 47% of the weight of the virus and 83% of the matrix were extractable in chloroform-methanol. The lipid partitions of the petroleum ether extracts were similar, except that the phospholipid content of the matrix was 2.2 times that of the virus. Viral particles were sensitive to diethyl ether and chloroform.

  1. Top 10 plant viruses in molecular plant pathology.

    Science.gov (United States)

    Scholthof, Karen-Beth G; Adkins, Scott; Czosnek, Henryk; Palukaitis, Peter; Jacquot, Emmanuel; Hohn, Thomas; Hohn, Barbara; Saunders, Keith; Candresse, Thierry; Ahlquist, Paul; Hemenway, Cynthia; Foster, Gary D

    2011-12-01

    Many scientists, if not all, feel that their particular plant virus should appear in any list of the most important plant viruses. However, to our knowledge, no such list exists. The aim of this review was to survey all plant virologists with an association with Molecular Plant Pathology and ask them to nominate which plant viruses they would place in a 'Top 10' based on scientific/economic importance. The survey generated more than 250 votes from the international community, and allowed the generation of a Top 10 plant virus list for Molecular Plant Pathology. The Top 10 list includes, in rank order, (1) Tobacco mosaic virus, (2) Tomato spotted wilt virus, (3) Tomato yellow leaf curl virus, (4) Cucumber mosaic virus, (5) Potato virus Y, (6) Cauliflower mosaic virus, (7) African cassava mosaic virus, (8) Plum pox virus, (9) Brome mosaic virus and (10) Potato virus X, with honourable mentions for viruses just missing out on the Top 10, including Citrus tristeza virus, Barley yellow dwarf virus, Potato leafroll virus and Tomato bushy stunt virus. This review article presents a short review on each virus of the Top 10 list and its importance, with the intent of initiating discussion and debate amongst the plant virology community, as well as laying down a benchmark, as it will be interesting to see in future years how perceptions change and which viruses enter and leave the Top 10. © 2011 The Authors. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd.

  2. Competitive virus assay method for titration of noncytopathogenic bovine viral diarrhea viruses (END⁺ and END⁻ viruses).

    Science.gov (United States)

    Muhsen, Mahmod; Ohi, Kota; Aoki, Hiroshi; Ikeda, Hidetoshi; Fukusho, Akio

    2013-03-01

    A new, reliable and secure virus assay method, named the competitive virus assay (CVA) method, has been established for the titration of bovine viral diarrhea viruses (BVDVs) that either show the exaltation of Newcastle disease virus (END) phenomenon or heterologous interference phenomenon (but not the END phenomenon). This method is based on the principle of (1) homologous interference between BVDVs, by using BVDV RK13/E(-) or BVDV RK13/E(+) strains as competitor virus, and (2) END phenomenon and heterologous interference, by using attenuated Newcastle disease virus (NDV) TCND strain as challenge virus. In titration of BVDV END(+) and BVDV END(-) viruses, no significant difference in estimated virus titer was observed between CVA and conventional methods. CVA method demonstrated comparable levels of sensitivity and accuracy as conventional END and interference methods, which require the use of a velogenic Miyadera strain of NDV and vesicular stomatitis virus (VSV), both of which are agents of high-risk diseases. As such, the CVA method is a safer alternative, with increased bio-safety and bio-containment, through avoidance of virulent strains that are commonly employed with conventional methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Ganjam virus/Nairobi sheep disease virus induces a pro-inflammatory response in infected sheep

    OpenAIRE

    bin Tarif, Abid; Lasecka, Lidia; Holzer, Barbara; Baron, Michael D

    2012-01-01

    Abstract Partly due to climate change, and partly due to changes of human habitat occupation, the impact of tick-borne viruses is increasing. Nairobi sheep disease virus (NSDV) and Ganjam virus (GV) are two names for the same virus, which causes disease in sheep and goats and is currently known to be circulating in India and East Africa. The virus is transmitted by ixodid ticks and causes a severe hemorrhagic disease. We have developed a real-time PCR assay for the virus genome and validated ...

  4. Clinical and biological differences between recurrent herpes simplex virus and varicella-zoster virus infections

    International Nuclear Information System (INIS)

    Straus, S.E.

    1989-01-01

    The major features that distinguish recurrent herpes simplex virus infections from zoster are illustrated in this article by two case histories. The clinical and epidemiologic features that characterize recurrent herpes simplex virus and varicella-zoster virus infections are reviewed. It is noted that herpesvirus infections are more common and severe in patients with cellular immune deficiency. Each virus evokes both humoral and cellular immune response in the course of primary infection. DNA hybridization studies with RNA probes labelled with sulfur-35 indicate that herpes simplex viruses persist within neurons, and that varicella-zoster virus is found in the satellite cells that encircle the neurons

  5. What contemporary viruses tell us about evolution: a personal view.

    Science.gov (United States)

    Moelling, Karin

    2013-09-01

    Recent advances in information about viruses have revealed novel and surprising properties such as viral sequences in the genomes of various organisms, unexpected amounts of viruses and phages in the biosphere, and the existence of giant viruses mimicking bacteria. Viruses helped in building genomes and are driving evolution. Viruses and bacteria belong to the human body and our environment as a well-balanced ecosystem. Only in unbalanced situations do viruses cause infectious diseases or cancer. In this article, I speculate about the role of viruses during evolution based on knowledge of contemporary viruses. Are viruses our oldest ancestors?

  6. Pharmacological inhibition of feline immunodeficiency virus (FIV).

    Science.gov (United States)

    Mohammadi, Hakimeh; Bienzle, Dorothee

    2012-05-01

    Feline immunodeficiency virus (FIV) is a member of the retroviridae family of viruses and causes an acquired immunodeficiency syndrome (AIDS) in domestic and non-domestic cats worldwide. Genome organization of FIV and clinical characteristics of the disease caused by the virus are similar to those of human immunodeficiency virus (HIV). Both viruses infect T lymphocytes, monocytes and macrophages, and their replication cycle in infected cells is analogous. Due to marked similarity in genomic organization, virus structure, virus replication and disease pathogenesis of FIV and HIV, infection of cats with FIV is a useful tool to study and develop novel drugs and vaccines for HIV. Anti-retroviral drugs studied extensively in HIV infection have targeted different steps of the virus replication cycle: (1) inhibition of virus entry into susceptible cells at the level of attachment to host cell surface receptors and co-receptors; (2) inhibition of fusion of the virus membrane with the cell membrane; (3) blockade of reverse transcription of viral genomic RNA; (4) interruption of nuclear translocation and viral DNA integration into host genomes; (5) prevention of viral transcript processing and nuclear export; and (6) inhibition of virion assembly and maturation. Despite much success of anti-retroviral therapy slowing disease progression in people, similar therapy has not been thoroughly investigated in cats. In this article we review current pharmacological approaches and novel targets for anti-lentiviral therapy, and critically assess potentially suitable applications against FIV infection in cats.

  7. Avian influenza virus transmission to mammals.

    Science.gov (United States)

    Herfst, S; Imai, M; Kawaoka, Y; Fouchier, R A M

    2014-01-01

    Influenza A viruses cause yearly epidemics and occasional pandemics. In addition, zoonotic influenza A viruses sporadically infect humans and may cause severe respiratory disease and fatalities. Fortunately, most of these viruses do not have the ability to be efficiently spread among humans via aerosols or respiratory droplets (airborne transmission) and to subsequently cause a pandemic. However, adaptation of these zoonotic viruses to humans by mutation or reassortment with human influenza A viruses may result in airborne transmissible viruses with pandemic potential. Although our knowledge of factors that affect mammalian adaptation and transmissibility of influenza viruses is still limited, we are beginning to understand some of the biological traits that drive airborne transmission of influenza viruses among mammals. Increased understanding of the determinants and mechanisms of airborne transmission may aid in assessing the risks posed by avian influenza viruses to human health, and preparedness for such risks. This chapter summarizes recent discoveries on the genetic and phenotypic traits required for avian influenza viruses to become airborne transmissible between mammals.

  8. West Nile virus: North American experience

    Science.gov (United States)

    Hofmeister, Erik K.

    2011-01-01

    West Nile virus, a mosquito-vectored flavivirus of the Japanese encephalitis serogroup, was first detected in North America following an epizootic in the New York City area in 1999. In the intervening 11 years since the arrival of the virus in North America, it has crossed the contiguous USA, entered the Canadian provinces bordering the USA, and has been reported in the Caribbean islands, Mexico, Central America and, more recently, South America. West Nile virus has been reported in over 300 species of birds in the USA and has caused the deaths of thousands of birds, local population declines of some avian species, the clinical illness and deaths of thousands of domestic horses, and the clinical disease in over 30 000 Americans and the deaths of over 1000. Prior to the emergence of West Nile virus in North America, St. Louis encephalitis virus and Dengue virus were the only other known mosquito-transmitted flaviviruses in North America capable of causing human disease. This review will discuss the North American experience with mosquito-borne flavivirus prior to the arrival of West Nile virus, the entry and spread of West Nile virus in North America, effects on wild bird populations, genetic changes in the virus, and the current state of West Nile virus transmission.

  9. 9 CFR 113.206 - Wart Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Wart Vaccine, Killed Virus. 113.206... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.206 Wart Vaccine, Killed Virus. Wart Vaccine, Killed Virus, shall be prepared...

  10. 9 CFR 113.209 - Rabies Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Rabies Vaccine, Killed Virus. 113.209... Killed Virus Vaccines § 113.209 Rabies Vaccine, Killed Virus. Rabies Vaccine (Killed Virus) shall be prepared from virus-bearing cell cultures or nerve tissues obtained from animals that have developed rabies...

  11. Identification of virus isolates inducing mosaic of sugarcane in ...

    African Journals Online (AJOL)

    Sugarcane mosaic disease caused by sugarcane mosaic virus (SCMV), Johnsongrass mosaic virus (JGMV), maize dwarf mosaic virus (MDMV) and sorghum mosaic Virus (SrMV) is an economically important viral disease of sugarcane worldwide. Field survey was conducted to assess the presence of the viruses involve in ...

  12. Application of artificial intelligence for detecting derived viruses

    CSIR Research Space (South Africa)

    Asiru, OF

    2017-06-01

    Full Text Available they infect files and systems is still the same. Hence, such viruses cannot be argued to be new. In this paper, the authors refer to such viruses as derived viruses. Just like new viruses, derived viruses are hard to detect with current scanning...

  13. Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

    International Nuclear Information System (INIS)

    Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee; Schriewer, Jill; Evans, David H.; Buller, R. Mark; Barry, Michele

    2014-01-01

    Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus

  14. Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

    Energy Technology Data Exchange (ETDEWEB)

    Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Schriewer, Jill [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Evans, David H. [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Buller, R. Mark [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Barry, Michele, E-mail: michele.barry@ualberta.ca [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada)

    2014-05-15

    Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus.

  15. Powassan Virus: Persistence of Virus Activity During 1966

    Science.gov (United States)

    McLean, Donald M.; Cobb, Cathron; Gooderham, Susan E.; Smart, Carol A.; Wilson, A. G.; Wilson, W. E.

    1967-01-01

    Powassan virus isolations were achieved from three of 60 pools of Ixodes cookei ticks removed from 286 groundhogs (Marmota monax) which were collected some 200 miles north of Toronto between May 5 and September 5, 1966. Virus yields per pool of one to 11 ticks ranged from 102.5 to 106.0 TCD50 for primary swine kidney tissue cultures, and positive pools were collected on June 24, July 15 and August 10. Powassan neutralizing antibodies were detected by mouse inoculation tests in 143 of 362 animals including 127 of 286 groundhogs, 14 of 45 red squirrels (Tamiasciurus hudsonicus) and two of 31 other forest mammals. The monthly prevalence of antibody in the current season's groundhogs increased from 0 to 25% with the progression of summer, but in older animals the incidence remained between 38 and 62% throughout the season. These results substantiate earlier findings which pointed towards the maintenance of Powassan virus in nature by a cycle involving groundhogs and squirrels as reservoirs, with ticks as vectors, from which human infections occurred tangentially. PMID:6019677

  16. Comparative analysis of rabbit hemorrhagic disease virus (RHDV) and new RHDV2 virus antigenicity, using specific virus-like particles

    OpenAIRE

    Bárcena, Juan; Guerra, Beatriz; Angulo, Iván; González, Julia; Valcárcel, Félix; Mata, Carlos P.; Castón, José R.; Blanco, Esther; Alejo, Alí

    2015-01-01

    International audience; In 2010 a new Lagovirus related to rabbit haemorrhagic disease virus (RHDV) emerged in France and has since rapidly spread throughout domestic and wild rabbit populations of several European countries. The new virus, termed RHDV2, exhibits distinctive genetic, antigenic and pathogenic features. Notably, RHDV2 kills rabbits previously vaccinated with RHDV vaccines. Here we report for the first time the generation and characterization of RHDV2-specific virus-like particl...

  17. Type C virus activation in nontransformed mouse cells by uv-irradiated herpes simplex virus

    International Nuclear Information System (INIS)

    Hampar, B.; Hatanaka, M.; Aulakh, G.; Derge, J.G.; Lee, L.; Showalter, S.

    1977-01-01

    Infection of nontransformed mouse cells with uv-irradiated herpes simplex virus (uv-HSV) resulted in the activation of an endogenous xenotropic (x-tropic) type C virus. Synthesis of type C virus persisted for only a few days, with most of the virus remaining cell associated. The levels of type C virus activated by uv-HSV varied depending on the multiplicity of infection (m.o.i.) and the uv dose. At low uv doses, where cell killing occurred, little or no type C virus synthesis was observed. Maximum levels of type C virus synthesis were observed with the minimum uv dose which eliminated cell killing by HSV. Synthesis of type C virus, albeit at lower levels, was still observed at uv doses beyond those required to prevent cell killing

  18. Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.

    Science.gov (United States)

    Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R

    2016-02-19

    Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV.

  19. A virus of hyperthermophilic archaea with a unique architecture among DNA viruses

    NARCIS (Netherlands)

    Rensen, Elena Ilka; Mochizuki, Tomohiro; Quemin, Emmanuelle; Schouten, S.; Krupovic, Mart; Prangishvili, David

    2016-01-01

    Viruses package their genetic material in diverse ways. Most known strategies include encapsulation of nucleic acids into spherical or filamentous virions with icosahedral or helical symmetry, respectively. Filamentous viruses with dsDNA genomes are currently associated exclusively with Archaea.

  20. Type C virus activation in nontransformed mouse cells by uv-irradiated herpes simplex virus

    Energy Technology Data Exchange (ETDEWEB)

    Hampar, B. (National Institutes of Health, Bethesda, MD); Hatanaka, M.; Aulakh, G.; Derge, J.G.; Lee, L.; Showalter, S.

    1977-02-01

    Infection of nontransformed mouse cells with uv-irradiated herpes simplex virus (uv-HSV) resulted in the activation of an endogenous xenotropic (x-tropic) type C virus. Synthesis of type C virus persisted for only a few days, with most of the virus remaining cell associated. The levels of type C virus activated by uv-HSV varied depending on the multiplicity of infection (m.o.i.) and the uv dose. At low uv doses, where cell killing occurred, little or no type C virus synthesis was observed. Maximum levels of type C virus synthesis were observed with the minimum uv dose which eliminated cell killing by HSV. Synthesis of type C virus, albeit at lower levels, was still observed at uv doses beyond those required to prevent cell killing.

  1. New frontiers in oncolytic viruses: optimizing and selecting for virus strains with improved efficacy

    Directory of Open Access Journals (Sweden)

    Lundstrom K

    2018-02-01

    Full Text Available Kenneth Lundstrom PanTherapeutics, Lutry, Switzerland Abstract: Oncolytic viruses have demonstrated selective replication and killing of tumor cells. Different types of oncolytic viruses – adenoviruses, alphaviruses, herpes simplex viruses, Newcastle disease viruses, rhabdoviruses, Coxsackie viruses, and vaccinia viruses – have been applied as either naturally occurring or engineered vectors. Numerous studies in animal-tumor models have demonstrated substantial tumor regression and prolonged survival rates. Moreover, clinical trials have confirmed good safety profiles and therapeutic efficacy for oncolytic viruses. Most encouragingly, the first cancer gene-therapy drug – Gendicine, based on oncolytic adenovirus type 5 – was approved in China. Likewise, a second-generation oncolytic herpes simplex virus-based drug for the treatment of melanoma has been registered in the US and Europe as talimogene laherparepvec. Keywords: immunotherapy, viral vectors, clinical trials, drug approval

  2. Invasive pneumococcal and meningococcal disease : association with influenza virus and respiratory syncytial virus activity?

    NARCIS (Netherlands)

    Jansen, A G S C; Sanders, E A M; VAN DER Ende, A; VAN Loon, A M; Hoes, A W; Hak, E

    2008-01-01

    Few studies have examined the relationship between viral activity and bacterial invasive disease, considering both influenza virus and respiratory syncytial virus (RSV). This study aimed to assess the potential relationship between invasive pneumococcal disease (IPD), meningococcal disease (MD), and

  3. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

    Science.gov (United States)

    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

    2015-06-01

    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

  4. Comparative analysis of rabbit hemorrhagic disease virus (RHDV) and new RHDV2 virus antigenicity, using specific virus-like particles.

    Science.gov (United States)

    Bárcena, Juan; Guerra, Beatriz; Angulo, Iván; González, Julia; Valcárcel, Félix; Mata, Carlos P; Castón, José R; Blanco, Esther; Alejo, Alí

    2015-09-24

    In 2010 a new Lagovirus related to rabbit haemorrhagic disease virus (RHDV) emerged in France and has since rapidly spread throughout domestic and wild rabbit populations of several European countries. The new virus, termed RHDV2, exhibits distinctive genetic, antigenic and pathogenic features. Notably, RHDV2 kills rabbits previously vaccinated with RHDV vaccines. Here we report for the first time the generation and characterization of RHDV2-specific virus-like particles (VLPs). Our results further confirmed the differential antigenic properties exhibited by RHDV and RHDV2, highlighting the need of using RHDV2-specific diagnostic assays to monitor the spread of this new virus.

  5. Configuring Symantec AntiVirus

    CERN Document Server

    Shimonski, Robert

    2003-01-01

    This is the only book that will teach system administrators how to configure, deploy, and troubleshoot Symantec Enterprise Edition in an enterprise network. The book will reflect Symantec''s philosophy of "Centralized Antivirus Management." For the same reasons that Symantec bundled together these previously separate products, the book will provide system administrators with a holistic approach to defending their networks from malicious viruses. This book will also serve as a Study Guide for those pursuing Symantec Product Specialist Certifications.Configuring Symantec AntiVirus Enterprise Edition contains step-by-step instructions on how to Design, implement and leverage the Symantec Suite of products in the enterprise.ØFirst book published on market leading product and fast-growing certification. Despite the popularity of Symantec''s products and Symantec Product Specialist certifications, there are no other books published or announced.ØLess expensive substitute for costly on-sight training. Symantec off...

  6. ICTV Virus Taxonomy Profile: Picornaviridae.

    Science.gov (United States)

    Zell, R; Delwart, E; Gorbalenya, A E; Hovi, T; King, A M Q; Knowles, N J; Lindberg, A M; Pallansch, M A; Palmenberg, A C; Reuter, G; Simmonds, P; Skern, T; Stanway, G; Yamashita, T; Ictv Report Consortium

    2017-10-01

    The family Picornaviridae comprises small non-enveloped viruses with RNA genomes of 6.7 to 10.1 kb, and contains >30 genera and >75 species. Most of the known picornaviruses infect mammals and birds, but some have also been detected in reptiles, amphibians and fish. Many picornaviruses are important human and veterinary pathogens and may cause diseases of the central nervous system, heart, liver, skin, gastrointestinal tract or upper respiratory tract. Most picornaviruses are transmitted by the faecal-oral or respiratory routes. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Picornaviridae, which is available at www.ictv.global/report/picornaviridae.

  7. Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.

    Science.gov (United States)

    Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C

    2017-04-15

    Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and

  8. Cowpox Virus in Llama, Italy

    Science.gov (United States)

    Brozzi, Alberto; Eleni, Claudia; Polici, Nicola; D’Alterio, Gianlorenzo; Carletti, Fabrizio; Scicluna, Maria Teresa; Castilletti, Concetta; Capobianchi, Maria R.; Di Caro, Antonino; Autorino, Gian Luca; Amaddeo, Demetrio

    2011-01-01

    Cowpox virus (CPXV) was isolated from skin lesions of a llama on a farm in Italy. Transmission electron microscopy showed brick-shaped particles consistent with orthopoxviruses. CPXV-antibodies were detected in llama and human serum samples; a CPXV isolate had a hemagglutinin sequence identical to CPXV-MonKre08/1–2-3 strains isolated from banded mongooses in Germany. PMID:21801638

  9. Treatment of ebola virus disease.

    Science.gov (United States)

    Kilgore, Paul E; Grabenstein, John D; Salim, Abdulbaset M; Rybak, Michael

    2015-01-01

    In March 2014, the largest Ebola outbreak in history exploded across West Africa. As of November 14, 2014, the World Health Organization has reported a total of 21,296 Ebola virus disease (EVD) cases, including 13,427 laboratory-confirmed EVD cases reported from the three most affected countries (Guinea, Liberia, and Sierra Leone). As the outbreak of EVD has spread, clinical disease severity and national EVD case-fatality rates have remained high (21.2-60.8%). Prior to 2013, several EVD outbreaks were controlled by using routine public health interventions; however, the widespread nature of the current EVD outbreak as well as cultural practices in the affected countries have challenged even the most active case identification efforts. In addition, although treatment centers provide supportive care, no effective therapeutic agents are available for EVD-endemic countries. The ongoing EVD outbreak has stimulated investigation of several different therapeutic strategies that target specific viral structures and mechanisms of Ebola viruses. Six to eight putative pharmacotherapies or immunologically based treatments have demonstrated promising results in animal studies. In addition, agents composed of small interfering RNAs targeting specific proteins of Ebola viruses, traditional hyperimmune globulin isolated from Ebola animal models, monoclonal antibodies, and morpholino oligomers (small molecules used to block viral gene expression). A number of EVD therapeutic agents are now entering accelerated human trials in EVD-endemic countries. The goal of therapeutic agent development includes postexposure prevention and EVD cure. As knowledge of Ebola virus virology and pathogenesis grows, it is likely that new therapeutic tools will be developed. Deployment of novel Ebola therapies will require unprecedented cooperation as well as investment to ensure that therapeutic tools become available to populations at greatest risk for EVD and its complications. In this article, we

  10. Recent advances on Ebola virus

    OpenAIRE

    Yasir Waheed; Mehreen Tahir; Hasnain Waheed; Sher Zaman Safi

    2017-01-01

    The 2014–2015 Ebola epidemic in West Africa was the largest of its kind, with more than 11 000 deaths and 28 637 cases. The epidemic mobilized a coalition of countries from US to China, European Union, and African countries. The international community was not prepared to face this unprecedented epidemic. Numbers of research groups are working to find a potent vaccine against Ebola. Ebola virus has the ability to dodge the immune system either by blocking interferon production ...

  11. Viruses & kidney disease: beyond HIV

    OpenAIRE

    Waldman, Meryl; Marshall, Vickie; Whitby, Denise; Kopp, Jeffrey B.

    2008-01-01

    HIV-infected patients may acquire new viral co-infections; they may also experience the reactivation or worsening of existing viral infections, including active, smoldering, or latent infections. HIV-infected patients may be predisposed to these viral infections due to immunodeficiency or to risk factors common to HIV and other viruses. A number of these affect the kidney, either by direct infection or by deposition of immune complexes. In this review we discuss the renal manifestations and t...

  12. Saffold virus infection associated with human myocarditis

    DEFF Research Database (Denmark)

    Nielsen, Trine Skov; Nielsen, Alex Yde; Banner, Jytte

    2016-01-01

    BACKGROUND: Saffold virus was described in 2007 as one of the first human viruses within the genus cardioviruses. Cardioviruses may cause severe infections of the myocardium in animals, and several studies have associated saffold virus with human disease. As a result, saffold virus has been...... isolated from different anatomical compartments, including the myocardium, but, until now, it has not been possible to demonstrate the accompanying histopathological signs of inflammation. OBJECTIVES: The aim of the study was to examine if saffold virus is capable of causing invasive infection in the human...... myocardium. STUDY DESIGN: Using real-time PCR, we retrospectively examined formalin-fixed paraffin embedded cardiac tissue specimens from 150 deceased individuals diagnosed with myocarditis at autopsy. The results were compared with histological findings. RESULTS AND CONCLUSIONS: Saffold virus was detected...

  13. Tunable protease-activatable virus nanonodes.

    Science.gov (United States)

    Judd, Justin; Ho, Michelle L; Tiwari, Abhinav; Gomez, Eric J; Dempsey, Christopher; Van Vliet, Kim; Igoshin, Oleg A; Silberg, Jonathan J; Agbandje-McKenna, Mavis; Suh, Junghae

    2014-05-27

    We explored the unique signal integration properties of the self-assembling 60-mer protein capsid of adeno-associated virus (AAV), a clinically proven human gene therapy vector, by engineering proteolytic regulation of virus-receptor interactions such that processing of the capsid by proteases is required for infection. We find the transfer function of our engineered protease-activatable viruses (PAVs), relating the degree of proteolysis (input) to PAV activity (output), is highly nonlinear, likely due to increased polyvalency. By exploiting this dynamic polyvalency, in combination with the self-assembly properties of the virus capsid, we show that mosaic PAVs can be constructed that operate under a digital AND gate regime, where two different protease inputs are required for virus activation. These results show viruses can be engineered as signal-integrating nanoscale nodes whose functional properties are regulated by multiple proteolytic signals with easily tunable and predictable response surfaces, a promising development toward advanced control of gene delivery.

  14. Concepts in Light Microscopy of Viruses

    Science.gov (United States)

    Witte, Robert; Georgi, Fanny

    2018-01-01

    Viruses threaten humans, livestock, and plants, and are difficult to combat. Imaging of viruses by light microscopy is key to uncover the nature of known and emerging viruses in the quest for finding new ways to treat viral disease and deepening the understanding of virus–host interactions. Here, we provide an overview of recent technology for imaging cells and viruses by light microscopy, in particular fluorescence microscopy in static and live-cell modes. The review lays out guidelines for how novel fluorescent chemical probes and proteins can be used in light microscopy to illuminate cells, and how they can be used to study virus infections. We discuss advantages and opportunities of confocal and multi-photon microscopy, selective plane illumination microscopy, and super-resolution microscopy. We emphasize the prevalent concepts in image processing and data analyses, and provide an outlook into label-free digital holographic microscopy for virus research. PMID:29670029

  15. No Love Lost Between Viruses and Interferons.

    Science.gov (United States)

    Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

    2015-11-01

    The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

  16. Zika virus: the latest newcomer

    Directory of Open Access Journals (Sweden)

    Juan-Carlos eSaiz

    2016-04-01

    Full Text Available Since the beginning of this century, humanity has been facing a new emerging, or re-emerging, virus threat almost every year: West Nile, Influenza A, avian flu, dengue, Chikungunya, SARS, MERS, Ebola, and now Zika, the latest newcomer. Zika virus (ZIKV, a flavivirus transmitted by Aedes mosquitoes, was identified in 1947 in a sentinel monkey in Uganda, and later on in humans in Nigeria. The virus was mainly confined to the African continent until it was detected in south-east Asia the 1980´s, then in the Micronesia in 2007 and, more recently in the Americas in 2014, where it has displayed an explosive spread, as advised by the World Health Organization (WHO, which resulted in the infection of hundreds of thousands of people. ZIKV infection was characterized by causing a mild disease presented with fever, headache, rash, arthralgia, and conjunctivitis, with exceptional reports of an association with Guillain-Barre syndrome (GBS and microcephaly. However, since the end of 2015, an increase in the number of GBS associated cases and an astonishing number of microcephaly in foetus and new-borns in Brazil have been related to ZIKV infection, raising serious worldwide public health concerns. Clarifying such worrisome relationships is, thus, a current unavoidable goal. Here, we extensively review what is currently known about ZIKV, from molecular biology, transmission routes, ecology and epidemiology, to clinical manifestations, pathogenesis, diagnosis, prophylaxis and public health.

  17. HCV Virus and Lymphoid Neoplasms

    Directory of Open Access Journals (Sweden)

    Yutaka Tsutsumi

    2011-01-01

    Full Text Available Hepatitis C virus (HCV is one of the viruses known to cause hepatic cancer. HCV is also believed to be involved in malignant lymphoma. In this paper, we investigated characteristics of malignant lymphoma cases that were anti-HCV antibody (HCV-Ab positive. We were able to perform pathological examinations on 13 out of 14 HCV-positive cases. Of these, lymphoid tissues of 10 stained positive for HCV-Ab. There was no significant correlation between the degree of HCV staining and the rate of recurrence or resistance to treatment. However, there did appear to be a consistent decrease in the amount of HCV-RNA between pre- and posttreatment among HCV-Ab-positive cases; that is, treatment-resistant cases that exhibited resistance from the first treatment and recurrent cases more frequently had a higher HCV level at treatment termination compared to the pretreatment level. This suggests that the HCV virus either accelerates oncogenesis by direct interaction with B cells or indirectly affects lymphoma prognosis.

  18. West Nile Virus Drug Discovery

    Directory of Open Access Journals (Sweden)

    Siew Pheng Lim

    2013-12-01

    Full Text Available The outbreak of West Nile virus (WNV in 1999 in the USA, and its continued spread throughout the Americas, parts of Europe, the Middle East and Africa, underscored the need for WNV antiviral development. Here, we review the current status of WNV drug discovery. A number of approaches have been used to search for inhibitors of WNV, including viral infection-based screening, enzyme-based screening, structure-based virtual screening, structure-based rationale design, and antibody-based therapy. These efforts have yielded inhibitors of viral or cellular factors that are critical for viral replication. For small molecule inhibitors, no promising preclinical candidate has been developed; most of the inhibitors could not even be advanced to the stage of hit-to-lead optimization due to their poor drug-like properties. However, several inhibitors developed for related members of the family Flaviviridae, such as dengue virus and hepatitis C virus, exhibited cross-inhibition of WNV, suggesting the possibility to re-purpose these antivirals for WNV treatment. Most promisingly, therapeutic antibodies have shown excellent efficacy in mouse model; one of such antibodies has been advanced into clinical trial. The knowledge accumulated during the past fifteen years has provided better rationale for the ongoing WNV and other flavivirus antiviral development.

  19. Human Papilloma Virus and Autophagy

    Directory of Open Access Journals (Sweden)

    Domenico Mattoscio

    2018-06-01

    Full Text Available Human papilloma viruses (HPVs are a group of double-stranded DNA viruses known to be the primary cause of cervical cancer. In addition, evidence has now established their role in non-melanoma skin cancers, head and neck cancer (HNC, and the development of other anogenital malignancies. The prevalence of HPV-related HNC, in particular oropharyngeal cancers, is rapidly increasing, foreseeing that HPV-positive oropharyngeal cancers will outnumber uterine cervical cancers in the next 15–20 years. Therefore, despite the successful advent of vaccines originally licensed for cervical cancer prevention, HPV burden is still very high, and a better understanding of HPV biology is urgently needed. Autophagy is the physiological cellular route that accounts for removal, degradation, and recycling of damaged organelles, proteins, and lipids in lysosomal vacuoles. In addition to this scavenger function, autophagy plays a fundamental role during viral infections and cancers and is, therefore, frequently exploited by viruses to their own benefit. Recently, a link between HPV and autophagy has clearly emerged, leading to the conceivable development of novel anti-viral strategies aimed at restraining HPV infectivity. Here, recent findings on how oncogenic HPV16 usurp autophagy are described, highlighting similarities and differences with mechanisms adopted by other oncoviruses.

  20. Recent advances on Ebola virus

    Directory of Open Access Journals (Sweden)

    Yasir Waheed

    2017-02-01

    Full Text Available The 2014–2015 Ebola epidemic in West Africa was the largest of its kind, with more than 11 000 deaths and 28 637 cases. The epidemic mobilized a coalition of countries from US to China, European Union, and African countries. The international community was not prepared to face this unprecedented epidemic. Numbers of research groups are working to find a potent vaccine against Ebola. Ebola virus has the ability to dodge the immune system either by blocking interferon production or by glycoprotein-based immune diversion. Individuals who survived from the Ebola virus are facing different health issues after the infection. The rate of miscarriage is also high in Ebola survivors while there are variable reports of the presence of Ebola virus in semen of Ebola survivors. There are many asymptomatic Ebola patients under consideration. West African countries lack the basic healthcare system, for which the actual number of deaths by the Ebola outbreak are much more than the deaths caused by the direct viral infection. The hospitals were empty due to fear and death of nurses and doctors. Millions of children missed the vaccine against measles. Hundreds of thousands of people could not get food. The Ebola epidemic also affected the mental health of people living in endemic countries. The families affected by Ebola are facing discrimination in the society. There is a dire need to adopt United Nations Sustainable Development Goal 3, which stresses to prepare ourselves to face any national or global health risk.

  1. DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

    OpenAIRE

    Július Rozák; Zdenka Gálová

    2013-01-01

    The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen a...

  2. The roles of viruses in periodontal diseases

    OpenAIRE

    C C Azodo; P Erhabor

    2015-01-01

    The roles of bacteria in the etiopathogenesis of periodontal disease are well-understand, but that of the virus found in the periodontal environment are poorly understood. The aim of this literature review was to report the roles of viruses in periodontal diseases. The roles of viruses in periodontal diseases were categorized into the role in disease etiology, role in the pathogenesis of periodontal diseases, role in diseases progression and role in response to treatment. Clearer understandin...

  3. Zika Virus: An Emergent Neuropathological Agent

    Science.gov (United States)

    White, Martyn K.; Wollebo, Hassen S.; Beckham, J. David; Tyler, Kenneth L.; Khalili, Kamel

    2016-01-01

    The emergence of Zika virus in the Americas has followed a pattern that is familiar from earlier epidemics of other viruses, where a new disease is introduced into a human population and then spreads rapidly with important public health consequences. In the case of Zika virus, an accumulating body of recent evidence implicates the virus in the etiology of serious pathologies of the human nervous system, that is, the occurrence of microcephaly in neonates and Guillain–Barré syndrome in adults. Zika virus is an arbovirus (arthropod-borne virus) and a member of the family Flaviviridae, genus Flavivirus. Zika virions are enveloped and icosahedral, and contain a nonsegmented, single-stranded, positive-sense RNA genome, which encodes 3 structural and 7 nonstructural proteins that are expressed as a single polyprotein that undergoes cleavage. Zika genomic RNA replicates in the cytoplasm of infected host cells. Zika virus was first detected in 1947 in the blood of a febrile monkey in Uganda’s Zika Forest and in crushed suspensions of the Aedes mosquito, which is one of the vectors for Zika virus. The virus remained obscure, with a few human cases confined to Africa and Asia. There are two lineages of the Zika virus, African and Asian, with the Asian strain causing outbreaks in Micronesia in 2007 and French Polynesia in 2013–2014. From here, the virus spread to Brazil with the first report of autochthonous Zika transmission in the Americas in March 2015. The rapid advance of the virus in the Americas and its likely association with microcephaly and Guillain–Barré syndrome make Zika an urgent public health concern. PMID:27464346

  4. Isolation of avian influenza virus in Texas.

    Science.gov (United States)

    Glass, S E; Naqi, S A; Grumbles, L C

    1981-01-01

    An avian influenza virus with surface antigens similar to those of fowl plague virus (Hav 1 Nav 2) was isolated in 1979 from 2 commercial turkey flocks in Central Texas. Two flocks in contact with these infected flocks developed clinical signs, gross lesions, and seroconversion but yielded no virus. This was the first recorded incidence of clinical avian influenza in Texas turkeys and only the second time that an agent with these surface antigens was isolated from turkeys in U.S.

  5. Measles virus: Background and oncolytic virotherapy

    OpenAIRE

    Sankhajit Bhattacharjee; Pramod Kumar Yadava

    2018-01-01

    Measles is a highly transmissible disease caused by measles virus and remains a major cause of child mortality in developing countries. Measles virus nucleoprotein (N) encapsidates the RNA genome of the virus for providing protection from host cell endonucleases and for specific recognition of viral RNA as template for transcription and replication. This protein is over-expressed at the time of viral replication. The C-terminal of N protein is intrinsically disordered, which enables this prot...

  6. Varicella zoster virus infection causing urinary retention in a child ...

    African Journals Online (AJOL)

    2012-11-02

    Nov 2, 2012 ... Varicella zoster virus (VZV) of the human herpes virus family .... VZV, cytomegalovirus and Epstein-Barr virus. Radiculomyelitis causing transient urinary retention and sensory lumbosacral symptoms is known as Elsberg ...

  7. Bacteriophages: update on application as models for viruses in water

    African Journals Online (AJOL)

    Bacteriophages: update on application as models for viruses in water. ... the resistance of human viruses to water treatment and disinfection processes. ... highly sensitive molecular techniques viruses have been detected in drinking water ...

  8. serological detection of seed borne viruses in cowpea regenerated

    African Journals Online (AJOL)

    Administrator

    out to detect the presence of seed borne viruses in fourteen cowpea accessions ... were serologically indexed to detect any seed-borne viruses after acclimatisation to screen house conditions. The .... showed external virus-like symptoms were.

  9. survey of the symptoms and viruses associated with cowpea (vigna

    African Journals Online (AJOL)

    Osondu

    2012-10-29

    Oct 29, 2012 ... of the prevalence of virus disease symptoms and to specifically identify the viruses infecting cowpea. (Vigna unguiculata . ... 1Department of Crop Protection, Faculty of Agriculture,. University of ..... emerging viruses. This will ...

  10. Tomato ringspot virus and Tobacco ringspot virus in Highbush Blueberry in New York State

    Science.gov (United States)

    A survey of highbush blueberry (Vaccinium corymbosum L.) cultivars Patriot and Bluecrop showing virus-like symptoms and decline in vigor in New York was conducted to assess the occurrence of viruses. Leaf samples from symptomatic and asymptomatic bushes reacted positively to Tobacco ringspot virus ...

  11. Functional properties of Virus-Encoded and Virus-Regulated 7TM Receptors

    DEFF Research Database (Denmark)

    Spiess, Katja; Rosenkilde, Mette Marie

    2014-01-01

    During co-evolution with their hosts, viruses have developed several survival strategies that involve exploitation of 7TM receptors. These include virus-encoded 7TM receptors and ligands and viral regulation of endogenous receptors. Many functional properties have been ascribed to virus-exploited...

  12. 78 FR 29755 - Human Immunodeficiency Virus Patient-Focused Drug Development and Human Immunodeficiency Virus...

    Science.gov (United States)

    2013-05-21

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0473] Human Immunodeficiency Virus Patient-Focused Drug Development and Human Immunodeficiency Virus Cure... an opportunity for public comment on human immunodeficiency virus (HIV) Patient-Focused Drug...

  13. 78 FR 46969 - Human Immunodeficiency Virus Patient-Focused Drug Development and Human Immunodeficiency Virus...

    Science.gov (United States)

    2013-08-02

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0473] Human Immunodeficiency Virus Patient-Focused Drug Development and Human Immunodeficiency Virus Cure... for the notice of public meeting entitled ``Human Immunodeficiency Virus (HIV) Patient-Focused Drug...

  14. 9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Virus Diarrhea Vaccine, Killed Virus. 113.215 Section 113.215 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD...

  15. Monitoring virus entry into living cells using DiD-labeled dengue virus particles

    NARCIS (Netherlands)

    Ayala Nunez, Vanesa; Wilschut, Jan; Smit, Jolanda M.

    2011-01-01

    A variety of approaches can be applied to investigate the multiple steps and interactions that occur during virus entry into the host cell. Single-virus tracking is a powerful real-time imaging technique that offers the possibility to monitor virus-cell binding, internalization, intracellular

  16. Genome Sequence of Bivens Arm Virus, a Tibrovirus Belonging to the Species Tibrogargan virus (Mononegavirales: Rhabdoviridae).

    OpenAIRE

    Chiu, Charles; Lauck, M; Yú, SQ; Caì, Y; Hensley, LE; Chiu, CY; O'Connor, DH; Kuhn, JH

    2015-01-01

    The new rhabdoviral genus Tibrovirus currently has two members, Coastal Plains virus and Tibrogargan virus. Here, we report the coding-complete genome sequence of a putative member of this genus, Bivens Arm virus. A genomic comparison reveals Bivens Arm vi

  17. Temporal Analysis of Andes Virus and Sin Nombre Virus Infections of Syrian Hamsters

    Science.gov (United States)

    2007-05-01

    Microbiology . All Rights Reserved. Temporal Analysis of Andes Virus and Sin Nombre Virus Infections of Syrian Hamsters Victoria Wahl-Jensen,1 Jennifer...Ye, C., J. Prescott , R. Nofchissey, D. Goade, and B. Hjelle. 2004. Neutralizing antibodies and Sin Nombre virus RNA after recovery from hantavirus

  18. Tubule-forming capacity of the movement proteins of alfalfa mosaic virus and brome mosaic virus

    NARCIS (Netherlands)

    Kasteel, D. T.; van der Wel, N. N.; Jansen, K. A.; Goldbach, R. W.; van Lent, J. W.

    1997-01-01

    The structural phenotype of the movement proteins (MPs) of two representatives of the Bromoviridae, alfalfa mosaic virus (AMV) and brome mosaic virus (BMV), was studied in protoplasts. Immunofluorescence microscopy showed that the MPs of these viruses, for which there has been no evidence of a

  19. «I Am Legend»: comparison of the fictional virus infection and Rabies virus

    Directory of Open Access Journals (Sweden)

    José Francisco CAMACHO AGUILERA

    2016-04-01

    Full Text Available Using the movie I am legend (2007 by, the rabies virus infection is reviewed in this article, given its strong resemblance to the fictional disease created in this film caused by the virus Krippin. A review of history, virus characteristics, viral transmission, clinical manifestations, diagnostics, mortality, treatment and prevention, are presented and are contrasted with the film.

  20. Perinatal hepatitis B virus detection by hepatitis B virus-DNA analysis.

    OpenAIRE

    De Virgiliis, S; Frau, F; Sanna, G; Turco, M P; Figus, A L; Cornacchia, G; Cao, A

    1985-01-01

    Maternal transmission of hepatitis B virus infection in relation to the hepatitis B e antigen/antibody system and serum hepatitis B virus-DNA were evaluated. Results indicate that hepatitis B virus-DNA analysis can identify hepatitis B serum antigen positive mothers who may transmit infection to their offspring.