WorldWideScience

Sample records for lung agar bead

  1. Beads.

    Science.gov (United States)

    Weewish Tree, 1979

    1979-01-01

    Beads served both as ornaments and as a medium of exchange, and the Indians manufactured them from such natural sources as bones, stones, beans, nuts, animal teeth, and polished antlers. Even after the introduction of European glass beads, the Indians continued to make their favorite beads from the natural sources. (DS)

  2. Optimization of pectinase immobilization on grafted alginate-agar gel beads by 24 full factorial CCD and thermodynamic profiling for evaluating of operational covalent immobilization.

    Science.gov (United States)

    Abdel Wahab, Walaa A; Karam, Eman A; Hassan, Mohamed E; Kansoh, Amany L; Esawy, Mona A; Awad, Ghada E A

    2018-07-01

    Pectinase produced by a honey derived from the fungus Aspergillus awamori KX943614 was covalently immobilized onto gel beads made of alginate and agar. Polyethyleneimine, glutaraldehyde, loading time and enzyme's units were optimized by 2 4 full factorial central composite design (CCD). The immobilization process increased the optimal working pH for the free pectinase from 5 to a broader range of pH4.5-5.5 and the optimum operational temperature from 55°C to a higher temperature, of 60°C, which is favored to reduce the enzyme's microbial contamination. The thermodynamics studies showed a thermal stability enhancement against high temperature for the immobilized formula. Moreover, an increase in half-lives and D-values was achieved. The thermodynamic studies proved that immobilization of pectinase made a remarkable increase in enthalpy and free energy because of enzyme stability enhancement. The reusability test revealed that 60% of pectinase's original activity was retained after 8 successive cycles. This gel formula may be convenient for immobilization of other industrial enzymes. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  4. Synthesis and characterization of high-surface-area millimeter-sized silica beads with hierarchical multi-modal pore structure by the addition of agar

    Energy Technology Data Exchange (ETDEWEB)

    Han, Yosep; Choi, Junhyun [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of); Tong, Meiping, E-mail: tongmeiping@iee.pku.edu.cn [The Key Laboratory of Water and Sediment Sciences, Ministry of Education, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Kim, Hyunjung, E-mail: kshjkim@jbnu.ac.kr [Department of Mineral Resources and Energy Engineering, Chonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do 561–756 (Korea, Republic of)

    2014-04-01

    Millimeter-sized spherical silica foams (SSFs) with hierarchical multi-modal pore structure featuring high specific surface area and ordered mesoporous frameworks were successfully prepared using aqueous agar addition, foaming and drop-in-oil processes. The pore-related properties of the prepared spherical silica (SSs) and SSFs were systematically characterized by field emission-scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), small-angle X-ray diffraction (SAXRD), Hg intrusion porosimetry, and N{sub 2} adsorption–desorption isotherm measurements. Improvements in the BET surface area and total pore volume were observed at 504 m{sup 2} g{sup −1} and 5.45 cm{sup 3} g{sup −1}, respectively, after an agar addition and foaming process. Despite the increase in the BET surface area, the mesopore wall thickness and the pore size of the mesopores generated from the block copolymer with agar addition were unchanged based on the SAXRD, TEM, and BJH methods. The SSFs prepared in the present study were confirmed to have improved BET surface area and micropore volume through the agar loading, and to exhibit interconnected 3-dimensional network macropore structure leading to the enhancement of total porosity and BET surface area via the foaming process. - Highlights: • Millimeter-sized spherical silica foams (SSFs) are successfully prepared. • SSFs exhibit high BET surface area and ordered hierarchical pore structure. • Agar addition improves BET surface area and micropore volume of SSFs. • Foaming process generates interconnected 3-D network macropore structure of SSFs.

  5. Glass bead cultivation of fungi

    DEFF Research Database (Denmark)

    Droce, Aida; Sørensen, Jens Laurids; Giese, H.

    2013-01-01

    Production of bioactive compounds and enzymes from filamentous fungi is highly dependent on cultivation conditions. Here we present an easy way to cultivate filamentous fungi on glass beads that allow complete control of nutrient supply. Secondary metabolite production in Fusarium graminearum...... and Fusarium solani cultivated on agar plates, in shaking liquid culture or on glass beads was compared. Agar plate culture and glass bead cultivation yielded comparable results while liquid culture had lower production of secondary metabolites. RNA extraction from glass beads and liquid cultures was easier...... to specific nutrient factors. •Fungal growth on glass beads eases and improves fungal RNA extraction....

  6. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. [Detection of serum proteins in the patients of lung adenocarcinoma by the method of magnetic bead based sample fractionation and MALDI-TOF-MS].

    Science.gov (United States)

    Liu, Dan; Liu, Lun-Xu; Yuan, Quan; Li, Xiao-Liang; Huang, Na; Yang, Xiao-Dong

    2010-05-01

    To screen the serum proteins related to human lung adenocarcinoma using matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) technology. The blood samples were collected from 10 patients of lung adenocarcinoma before and one week after the surgery, while 10 healthy subjects were used as control. The differential protein expression between the two groups and the change of those proteins after surgery were studied by ClinProt magnetic bead enrichment and MALDI-TOF-MS. Six protein peaks were identified, 2 of them were highly expressed protein biomarkers with relative molecular weights of 2661, 2991, and increased after the surgery, 4 of them were lowly expressed protein biomarkers with relative molecular weights of 4091, 4210, 4644, 5336, which continuously decreased after the surgery. ClinProt magnetic bead enrichment and MALDI-TOF-MS is a quick, easy and sensitive method of proteomics. The differential expressed proteins may be the latent tumor marker of lung adenocarcinoma. The alteration of those proteins after surgery might be helpful to assess the therapeutic effect and prognosis.

  8. A lung segmental model of chronic Pseudomonas infection in sheep.

    Directory of Open Access Journals (Sweden)

    David Collie

    Full Text Available Chronic lung infection with Pseudomonas aeruginosa is a major contributor to morbidity, mortality and premature death in cystic fibrosis. A new paradigm for managing such infections is needed, as are relevant and translatable animal models to identify and test concepts. We sought to improve on limitations associated with existing models of infection in small animals through developing a lung segmental model of chronic Pseudomonas infection in sheep.Using local lung instillation of P. aeruginosa suspended in agar beads we were able to demonstrate that such infection led to the development of a suppurative, necrotising and pyogranulomatous pneumonia centred on the instilled beads. No overt evidence of organ or systemic compromise was apparent in any animal during the course of infection. Infection persisted in the lungs of individual animals for as long as 66 days after initial instillation. Quantitative microbiology applied to bronchoalveolar lavage fluid derived from infected segments proved an insensitive index of the presence of significant infection in lung tissue (>10(4 cfu/g.The agar bead model of chronic P. aeruginosa lung infection in sheep is a relevant platform to investigate both the pathobiology of such infections as well as novel approaches to their diagnosis and therapy. Particular ethical benefits relate to the model in terms of refining existing approaches by compromising a smaller proportion of the lung with infection and facilitating longitudinal assessment by bronchoscopy, and also potentially reducing animal numbers through facilitating within-animal comparisons of differential therapeutic approaches.

  9. A lung segmental model of chronic Pseudomonas infection in sheep.

    Science.gov (United States)

    Collie, David; Govan, John; Wright, Steven; Thornton, Elisabeth; Tennant, Peter; Smith, Sionagh; Doherty, Catherine; McLachlan, Gerry

    2013-01-01

    Chronic lung infection with Pseudomonas aeruginosa is a major contributor to morbidity, mortality and premature death in cystic fibrosis. A new paradigm for managing such infections is needed, as are relevant and translatable animal models to identify and test concepts. We sought to improve on limitations associated with existing models of infection in small animals through developing a lung segmental model of chronic Pseudomonas infection in sheep. Using local lung instillation of P. aeruginosa suspended in agar beads we were able to demonstrate that such infection led to the development of a suppurative, necrotising and pyogranulomatous pneumonia centred on the instilled beads. No overt evidence of organ or systemic compromise was apparent in any animal during the course of infection. Infection persisted in the lungs of individual animals for as long as 66 days after initial instillation. Quantitative microbiology applied to bronchoalveolar lavage fluid derived from infected segments proved an insensitive index of the presence of significant infection in lung tissue (>10(4) cfu/g). The agar bead model of chronic P. aeruginosa lung infection in sheep is a relevant platform to investigate both the pathobiology of such infections as well as novel approaches to their diagnosis and therapy. Particular ethical benefits relate to the model in terms of refining existing approaches by compromising a smaller proportion of the lung with infection and facilitating longitudinal assessment by bronchoscopy, and also potentially reducing animal numbers through facilitating within-animal comparisons of differential therapeutic approaches.

  10. Fungal cultivation on glass-beads

    DEFF Research Database (Denmark)

    Droce, Aida; Sørensen, Jens Laurids; Giese, Henriette

    Transcription of various bioactive compounds and enzymes are dependent on fungal cultivation method. In this study we cultivate Fusarium graminearum and Fusarium solani on glass-beads with liquid media in petri dishes as an easy and inexpensive cultivation method, that resembles in secondary...... metabolite production to agar-cultivation but with an easier and more pure RNA-extraction of total fungal mycelia....

  11. Bead-size directed distribution of Pseudomonas aeruginosa results in distinct inflammatory response in a mouse model of chronic lung infection

    DEFF Research Database (Denmark)

    Christophersen, L J; Trøstrup, H; Damlund, Dina Silke Malling

    2012-01-01

    or in the peripheral respiratory zone. To study this we produced two distinct sizes of small alginate beads (SB) and large beads (LB) containing P. aeruginosa. In total, 175 BALB/c mice were infected with either SB or LB. At day 1 the quantitative bacteriology was higher in the SB group compared to the LB group (P

  12. Magnetization of large polystyrene peptide beads for capturing and expanding cancer cells

    International Nuclear Information System (INIS)

    Marik, Jan; Lau, D.H.; Song Aimin; Wang Xiaobing; Liu Ruiwu; Lam, K.S.

    2003-01-01

    A method is described for preparation of large magnetic polystyrene beads coupled with peptide ligands for surface receptors of lung cancer cells. We have demonstrated the feasibility of using these magnetic peptide beads for capturing and enriching lung cancer cells spiked into blood. These magnetic peptide beads potentially can be used to efficiently isolate cancer cells from body fluids

  13. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  14. Effect of algal density in bead, bead size and bead concentrations ...

    African Journals Online (AJOL)

    Effect of algal density in bead, bead size and bead concentrations on wastewater nutrient removal. ... African Journal of Biotechnology ... The bioreactor containing algal beads (4 mm diameter) with 1.5 x 106 cells bead-1 (cell stocking) at concentration of 10.66 beads ml-1 wastewater (1:3 bead: wastewater, v/v) achieved ...

  15. A String of Beads

    Science.gov (United States)

    Mead, Kelly C.

    2006-01-01

    In this article, the author relates how she designed a math activity she called Beads to use in conjunction with their school's 100th day celebration. Beads has provided her kindergarten class with many opportunities to practice a variety of math skills - counting, patterning, sorting, comparing, making sets, predicting, identifying numerals,…

  16. In-bead screening

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to screening of one-bead-one-compound (OBOC) combinatorial libraries which is useful for the discovery of compounds displaying molecular interactions with a biological or a physicochemical system, such as substrates and inhibitors of enzymes and the like. The invention...... provides a method for screening a library of compounds for their interaction with a physico- chemical or biological system and a corresponding kit for performing the method of screening a one-bead-one-compound library of compounds....

  17. Effect of algal density in bead, bead size and bead concentrations ...

    African Journals Online (AJOL)

    Laboratory experiments were performed to study nitrogen and phosphorus uptake by the unicellular green microalga Chlorella vulgaris immobilized in calcium alginate beads. Different cell stockings in beads, different bead sizes and different algal bead concentrations in wastewaters were tested. Significant higher nutrients ...

  18. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  19. Modulation of epithelial sodium channel (ENaC expression in mouse lung infected with Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Radzioch Danuta

    2005-01-01

    Full Text Available Abstract Background The intratracheal instillation of Pseudomonas aeruginosa entrapped in agar beads in the mouse lung leads to chronic lung infection in susceptible mouse strains. As the infection generates a strong inflammatory response with some lung edema, we tested if it could modulate the expression of genes involved in lung liquid clearance, such as the α, β and γ subunits of the epithelial sodium channel (ENaC and the catalytic subunit of Na+-K+-ATPase. Methods Pseudomonas aeruginosa entrapped in agar beads were instilled in the lung of resistant (BalB/c and susceptible (DBA/2, C57BL/6 and A/J mouse strains. The mRNA expression of ENaC and Na+-K+-ATPase subunits was tested in the lung by Northern blot following a 3 hours to 14 days infection. Results The infection of the different mouse strains evoked regulation of α and β ENaC mRNA. Following Pseudomonas instillation, the expression of αENaC mRNA decreased to a median of 43% on days 3 and 7 after infection and was still decreased to a median of 45% 14 days after infection (p 1Na+-K+-ATPase mRNA, the catalytic subunit of the sodium pump, was recorded. The distinctive expression profiles of the three subunits were not different, between the susceptible and resistant mouse strains. Conclusions These results show that Pseudomonas infection, by modulating ENaC subunit expression, could influence edema formation and clearance in infected lungs.

  20. Sangadzhi Kononov, Buddhist Prayer Beads

    OpenAIRE

    Churyumov, Anton; Kovaeva, Bair

    2016-01-01

    Prayer beads have special dividers that divide the beads into 7, 21 and 33. Apart from using in prayers, the Kalmyks also keep beads as amulets that are believed to have strong energy. After prayers, old people often bless their children and grandchildren with their beads. Such beads are also kept in families from one generation to the next. Sangadzhi believes that prayer beads store inside them the energy of mantras that have been read with them. There is an interesting story about the pray...

  1. Half bead welding technique

    International Nuclear Information System (INIS)

    Canonico, D.A.; Holz, P.P.

    1978-05-01

    The ORNL has employed the Section XI half-bead procedure for six repair welds. Table 2 identifies the repairs and the components upon which they were accomplished. The weld repairs were performed to permit us to evaluate material properties, residual stresses, weld repair procedures, and structural behavior of repaired pressure vessels. As a consequence of our study we concluded that when the half bead procedure is correctly applied: (1) there is no metallurgical degradation of the base material, (2) residual stresses of yield point magnitude will be present, and (3) the structural integrity of the pressure vessel is not impaired at Charpy V-notch upper shelf temperatures

  2. In vivo fluorescence imaging of bacteriogenic cyanide in the lungs of live mice infected with cystic fibrosis pathogens.

    Directory of Open Access Journals (Sweden)

    Seong-Won Nam

    Full Text Available BACKGROUND: Pseudomonas aeruginosa (PA and Burkholderia cepacia complex (Bcc, commonly found in the lungs of cystic fibrosis (CF patients, often produce cyanide (CN, which inhibits cellular respiration. CN in sputa is a potential biomarker for lung infection by CF pathogens. However, its actual concentration in the infected lungs is unknown. METHODS AND FINDINGS: This work reports observation of CN in the lungs of mice infected with cyanogenic PA or Bcc strains using a CN fluorescent chemosensor (4',5'-fluorescein dicarboxaldehyde with a whole animal imaging system. When the CN chemosensor was injected into the lungs of mice intratracheally infected with either PA or B. cepacia strains embedded in agar beads, CN was detected in the millimolar range (1.8 to 4 mM in the infected lungs. CN concentration in PA-infected lungs rapidly increased within 24 hours but gradually decreased over the following days, while CN concentration in B. cepacia-infected lungs slowly increased, reaching a maximum at 5 days. CN concentrations correlated with the bacterial loads in the lungs. In vivo efficacy of antimicrobial treatments was tested in live mice by monitoring bacteriogenic CN in the lungs. CONCLUSIONS: The in vivo imaging method was also found suitable for minimally invasive testing the efficacy of antibiotic compounds as well as for aiding the understanding of bacterial cyanogenesis in CF lungs.

  3. Microfluidic magnetic bead conveyor belt

    NARCIS (Netherlands)

    van Pelt, S.; Frijns, A.J.H.; den Toonder, J.M.J.

    2017-01-01

    Magnetic beads play an important role in the miniaturization of clinical diagnostics systems. In lab-on-chip platforms, beads can be made to link to a target species and can then be used for the manipulation and detection of this species. Current bead actuation systems utilize complex on-chip coil

  4. Coated Aerogel Beads

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2014-01-01

    Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

  5. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  6. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  7. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  8. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  9. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  10. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  11. Microfabricated Passive Magnetic Bead separators

    DEFF Research Database (Denmark)

    Hansen, Mikkel Fougt; Lund-Olesen, Torsten; Smistrup, Kristian

    2006-01-01

    The use and manipulation of functionalized magnetic beads for bioanalysis in lab-on-a-chip systems is receiving growing interest. We have developed microfluidic systems with integrated magnetic structures for the capture and release of magnetic beads. The systems are fabricated in silicon by deep...

  12. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  13. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  14. Multitracer Stable Isotope Quantification of Arginase and Nitric Oxide Synthase Activity in a Mouse Model of Pseudomonas Lung Infection

    Directory of Open Access Journals (Sweden)

    Hartmut Grasemann

    2014-01-01

    Full Text Available Cystic fibrosis airways are deficient for L-arginine, a substrate for nitric oxide synthases (NOSs and arginases. The rationale for this study was to quantify NOS and arginase activity in the mouse lung. Anesthetized unventilated mice received a primed constant stable isotope intravenous infusion containing labeled L-arginine, ornithine, and citrulline. The isotopic enrichment of each of the infused isotopomers and its product amino acids were measured in plasma and organ homogenates using liquid chromatography-tandem mass spectrometry. The effect of infection was studied three days after direct tracheal instillation of Pseudomonas-coated agar beads. In the infusion model, lung infection resulted in a significant (28-fold increase in NOS activity in lung but not in trachea, kidney, liver, or plasma. Absolute rates of arginase activity in solid tissues could not be calculated in this model. In an isolated lung perfusion model used for comparison increased NOS activity in infected lungs was confirmed (28.5-fold and lung arginase activity was increased 9.7-fold. The activity of L-arginine metabolizing enzymes can be measured using stable isotope conversion in the mouse. Accumulation of L-ornithine in the whole mouse model hindered the exact quantification of arginase activity in the lung, a problem that was overcome utilizing an isolated lung perfusion model.

  15. bEADS

    DEFF Research Database (Denmark)

    Williams, Peter Leslie; Overholt, Daniel

    2017-01-01

    While there are a great variety of digital musical interfaces available to the working musician, few offer the level of immediate, nuanced and instinctive interaction that one finds in an acoustic shaker. bEADS is a prototype of a digital musical instrument that utilises the gestural vocabulary...... associated with shaken idiophones and expands on the techniques and sonic possibilities associated with them. By using a bespoke physically informed synthesis engine, in conjunction with accelerometer and pressure sensor data, an actuated handheld instrument has been built that allows for quickly switching...... between widely differing percussive sound textures. The prototype has been evaluated by three experts with different levels of involvement in professional music making....

  16. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  18. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  19. Lung

    International Nuclear Information System (INIS)

    DeNardo, G.L.; Blankenship, W.J.; Burdine, J.A. Jr.; DeNardo, S.J.

    1975-01-01

    At present no simple statement can be made relative to the role of radionuclidic lung studies in the pediatric population. It is safe to assume that they will be used with increasing frequency for research and clinical applications because of their sensitivity and ready applicability to the pediatric patient. Methods comparable to those used in adults can be used in children older than 4 years. In younger children, however, a single injection of 133 Xe in solution provides an index of both regional perfusion and ventilation which is easier to accomplish. This method is particularly valuable in infants and neonates because it is rapid, requires no patient cooperation, results in a very low radiation dose, and can be repeated in serial studies. Radionuclidic studies of ventilation and perfusion can be performed in almost all children if the pediatrician and the nuclear medicine specialist have motivation and ingenuity. S []ontaneous pulmonary vascular occlusive disease which occurs in infants and pulmonary emboli in children are easily detected using radionuclides. The pathophysiologic defects of pulmonary agenesis, bronchopulmonary sequestration, and foreign body aspiration may be demonstrated by these techniques. These techniques also appear to be useful in following patients with bronchial asthma, cystic fibrosis, congenital emphysema, and postinfection pulmonary abnormalities. (auth)

  20. Microfluidic magnetic bead conveyor belt.

    Science.gov (United States)

    van Pelt, Stijn; Frijns, Arjan; den Toonder, Jaap

    2017-11-07

    Magnetic beads play an important role in the miniaturization of clinical diagnostics systems. In lab-on-chip platforms, beads can be made to link to a target species and can then be used for the manipulation and detection of this species. Current bead actuation systems utilize complex on-chip coil systems that offer low field strengths and little versatility. We demonstrate a novel system based on an external rotating magnetic field and on-chip soft-magnetic structures to focus the field locally. These structures were designed and optimized using finite element simulations in order to create a number of local flux density maxima. These maxima, to which the magnetic beads are attracted, move over the chip surface in a continuous way together with the rotation of the external field, resulting in a mechanism similar to that of a conveyor belt. A prototype was fabricated using PDMS molding techniques mixed with iron powder for the magnetic structures. In the subsequent experiments, a quadrupole electromagnet was used to create the rotating external field. We observed that beads formed agglomerates that rolled over the chip surface, just above the magnetic structures. Field rotation frequencies between 0.1-50 Hz were tested resulting in magnetic bead speeds of over 1 mm s -1 for the highest frequency. With this, we have shown that our novel concept works, combining a simple design and simple operation with a powerful and versatile method for bead actuation. This makes it a promising method for further research and utilization in lab-on-chip systems.

  1. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  2. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  3. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  4. Disposal of bead ion exchange resin wastes

    International Nuclear Information System (INIS)

    Gay, R.L.; Granthan, L.F.

    1985-01-01

    Bead ion exchange resin wastes are disposed of by a process which involves spray-drying a bead ion exchange resin waste in order to remove substantially all of the water present in such waste, including the water on the surface of the ion exchange resin beads and the water inside the ion exchange resin beads. The resulting dried ion exchange resin beads can then be solidified in a suitable solid matrix-forming material, such as a polymer, which solidifies to contain the dried ion exchange resin beads in a solid monolith suitable for disposal by burial or other conventional means

  5. Elastase-coupled beads as a tool for characterizing localized alveolar tissue destruction associated with the onset of emphysema

    Science.gov (United States)

    Craig, J. M.; Scott, A. L.

    2013-01-01

    Intratracheal elastase challenge of laboratory animals has long been established as a model for observing the physiological and morphological changes that result from alveolar destruction, the hallmark of emphysema. However, instillation of elastase suspended in buffer results in widespread inflammation and variable emphysematous lesions, which has made the identification of specific cellular and molecular events associated with the onset of emphysema difficult to define. Here we establish a bead-based elastase delivery system that induces localized tissue destruction, a key event in the initiation of emphysema. Elastase was coupled to bisacrylamide beads, which were shown to retain enzymatic activity prior to intratracheal administration in mice. C57BL/6 mice were given a single dose of 40,000 beads, which became distributed throughout the small airways and parenchyma of the lung. Elastase-coupled beads resulted in a quantifiable loss of alveolar tissue immediately surrounding the beads, an effect that was not observed with beads that lacked protein altogether or with beads containing elastase inactivated by an irreversible inhibitor. Furthermore, beads bound with active elastase elicited local recruitment of mononuclear cells, including macrophages, and polymorphonuclear neutrophils to the site of bead deposition, a feature consistent with the cellular infiltration observed following conventional solubilized elastase challenges. This work identifies a novel bead-based enzyme delivery system that also extends the elastase model of emphysema to permit the characterization of mechanisms that drive alveolar surface area loss following elastin degradation in focal emphysematous lesions. PMID:23558388

  6. Calibration beads containing luminescent lanthanide ion complexes

    Science.gov (United States)

    The reliability of lanthanide luminescence measurements, by both flow cytometry and digital microscopy, will be enhanced by the availability of narrow-band emitting lanthanide calibration beads. These beads can also be used to characterize spectrographic instruments, including mi...

  7. Three-bead steering microswimmers

    Science.gov (United States)

    Rizvi, Mohd Suhail; Farutin, Alexander; Misbah, Chaouqi

    2018-02-01

    The self-propelled microswimmers have recently attracted considerable attention as model systems for biological cell migration as well as artificial micromachines. A simple and well-studied microswimmer model consists of three identical spherical beads joined by two springs in a linear fashion with active oscillatory forces being applied on the beads to generate self-propulsion. We have extended this linear microswimmer configuration to a triangular geometry where the three beads are connected by three identical springs in an equilateral triangular manner. The active forces acting on each spring can lead to autonomous steering motion; i.e., allowing the swimmer to move along arbitrary paths. We explore the microswimmer dynamics analytically and pinpoint its rich character depending on the nature of the active forces. The microswimmers can translate along a straight trajectory, rotate at a fixed location, as well as perform a simultaneous translation and rotation resulting in complex curved trajectories. The sinusoidal active forces on the three springs of the microswimmer contain naturally four operating parameters which are more than required for the steering motion. We identify the minimal operating parameters which are essential for the motion of the microswimmer along any given arbitrary trajectory. Therefore, along with providing insights into the mechanics of the complex motion of the natural and artificial microswimmers, the triangular three-bead microswimmer can be utilized as a model for targeted drug delivery systems and autonomous underwater vehicles where intricate trajectories are involved.

  8. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  9. Microstructural Study on Oxygen Permeated Arc Beads

    Directory of Open Access Journals (Sweden)

    Kuan-Heng Liu

    2015-01-01

    Full Text Available We simulated short circuit of loaded copper wire at ambient atmosphere and successfully identified various phases of the arc bead. A cuprous oxide flake was formed on the surface of the arc bead in the rapid solidification process, and there were two microstructural constituents, namely, Cu-κ eutectic structure and solutal dendrites. Due to the arc bead formed at atmosphere during the local equilibrium solidification process, the phase of arc bead has segregated to the cuprous oxide flake, Cu-κ eutectic, and Cu phase solutal dendrites, which are the fingerprints of the arc bead permeated by oxygen.

  10. Magnetic bead detection using nano-transformers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyung Kwon; Ahn, Doyeol [Institute of Quantum Information Processing and Systems, University of Seoul, 90 Jeonnong, Dongdaemun, Seoul 130-743 (Korea, Republic of); Hwang, Jong Seung; Hwang, Sung Woo, E-mail: dahn@uos.ac.kr [Research Center for Time-domain Nano-functional Devices and School of Electrical Engineering, Korea University, 5-1 Anam, Sungbuk, Seoul 136-701 (Korea, Republic of)

    2010-11-19

    A novel scheme to detect magnetic beads using a nano-scale transformer with a femtoweber resolution is reported. We have performed a Faraday's induction experiment with the nano-transformer at room temperature. The transformer shows the linear output voltage responses to the sinusoidal input current. When magnetic beads are placed on the transformer, the output responses are increased by an amount corresponding to the added magnetic flux from the beads when compared with the case of no beads on the transformer. In this way, we could determine whether magnetic beads are on top of the transformer in a single particle level.

  11. Magnetic bead detection using nano-transformers.

    Science.gov (United States)

    Kim, Hyung Kwon; Hwang, Jong Seung; Hwang, Sung Woo; Ahn, Doyeol

    2010-11-19

    A novel scheme to detect magnetic beads using a nano-scale transformer with a femtoweber resolution is reported. We have performed a Faraday's induction experiment with the nano-transformer at room temperature. The transformer shows the linear output voltage responses to the sinusoidal input current. When magnetic beads are placed on the transformer, the output responses are increased by an amount corresponding to the added magnetic flux from the beads when compared with the case of no beads on the transformer. In this way, we could determine whether magnetic beads are on top of the transformer in a single particle level.

  12. Direct friction measurement in draw bead testing

    DEFF Research Database (Denmark)

    Olsson, David Dam; Bay, Niels; Andreasen, Jan Lasson

    2005-01-01

    The application of draw beads in sheet metal stamping ensures controlled drawing-in of flange parts. Lubrication conditions in draw beads are severe due to sliding under simultaneous bending. Based on the original draw bead test design by Nine [1] comprehensive studies of friction in draw beads...... have been reported in literature. A major drawback in all these studies is that friction is not directly measured, but requires repeated measurements of the drawing force with and without relative sliding between the draw beads and the sheet material. This implies two tests with a fixed draw bead tool...... and a freely rotating tool respectively, an approach, which inevitably implies large uncertainties due to scatter in the experimental conditions. In order to avoid this problem a new draw bead test is proposed by the authors measuring the friction force acting on the tool radius directly by a build...

  13. Developement of Spherical Polyurethane Beads

    Institute of Scientific and Technical Information of China (English)

    K. Maeda; H. Ohmori; H. Gyotoku

    2005-01-01

    @@ 1Results and Discussion We established a new method to produce the spherical polyurethane beads which have narrower distribution of particle size. This narrower distribution was achieved by the polyurethane prepolymer which contains ketimine as a blocked chain-extending agent. Firstly, the prepolymer is dispersed into the aqueous solution containing surfactant. Secondaly, water comes into the inside of prepolymer as oil phase. Thirdly, ketimine is hydrolyzed to amine, and amine reacts with prepolymer immediately to be polyurethane.Our spherical polyurethane beads are very suitable for automotive interior parts especially for instrument panel cover sheet producing under the slush molding method, because of good process ability, excellent durability to the sunlight and mechanical properties at low temperature. See Fig. 1 ,Fig. 2 and Fig. 3 (Page 820).

  14. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  15. The negative enrichment by immunomagnetic beads for tumor cells from malignant pleural effusions

    Institute of Scientific and Technical Information of China (English)

    杨俊俊

    2012-01-01

    Objective To establish a method (negative enrichment by immunomagnetic beads) for detection of tumor cells in pleural effusions and to evaluate the sensitivity and specificity of the method for clinical application. Methods Five,10,20,50 and 100 A549(lung adenocarcinoma) cells were labeled with

  16. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  17. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  18. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  19. Structuring and calorie control of bakery products by templating batter with ultra melt-resistant food-grade hydrogel beads.

    Science.gov (United States)

    Thompson, Benjamin R; Horozov, Tommy S; Stoyanov, Simeon D; Paunov, Vesselin N

    2017-08-01

    We report the use of a temperature insensitive, food-grade hydrogel to reduce the caloric density of pancakes that were prepared at temperatures much higher than the boiling point of water. This cheap, facile method utilises a mixed agar-methylcellulose hydrogel, which was blended to produce a slurry of hydrogel microbeads. The pancake batter was mixed with a controlled volume percentage of slurry of hydrogel beads and cooked. From bomb calorimetry experiments, the composites were found to have a reduced caloric density that reflects the volume percentage of hydrogel beads mixed with the batter. Using this procedure, we were able to reduce the caloric density of pancakes by up to 23 ± 3% when the volume percentage of hydrogel beads initially used was 25%. The method is not limited to pancakes and could potentially be applied to various other food products. The structure and morphology of the freeze-dried pancakes and pancake-hydrogel composites were investigated and pores of a similar size to the hydrogel beads were found, confirming that the gel beads maintained their structure during the cooking process. There is scope for further development of this method by the encapsulation of nutritionally beneficial or flavour enhancing ingredients within the hydrogel beads.

  20. Comparison of non-magnetic and magnetic beads in bead-based assays

    NARCIS (Netherlands)

    Hansenová Maňásková, S.; van Belkum, A.; Endtz, H.P.; Bikker, F.J.; Veerman, E.C.I.; van Wamel, W.J.B.

    2016-01-01

    Multiplex bead-based flow cytometry is an attractive way for simultaneous, rapid and cost-effective analysis of multiple analytes in a single sample. Previously, we developed various bead-based assays using non-magnetic beads coated with Staphylococcus aureus and Streptococcus pneumoniae antigens

  1. Beautiful Beads: A Lesson in Making Beads with Friendly Clay. AMACO[R] Lesson.

    Science.gov (United States)

    Gamble, Harriet; Gamble, David

    This lesson resource includes a brief summary of the history of bead making and historic fascination with beads as adornment. A focus on design elements, color theory, craftsmanship, and technical skill in bead making is encouraged. The plan includes lesson goals and objectives; background preparation; a glossary of terms; a list of supplies; and…

  2. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  3. Fused Bead Analysis of Diogenite Meteorites

    Science.gov (United States)

    Mittlefehldt, D.W.; Beck, B.W.; McSween, H.Y.; Lee, C.T. A.

    2009-01-01

    Bulk rock chemistry is an essential dataset in meteoritics and planetary science [1]. A common method used to obtain the bulk chemistry of meteorites is ICP-MS. While the accuracy, precision and low detection limits of this process are advantageous [2], the sample size used for analysis (approx.70 mg) can be a problem in a field where small and finite samples are the norm. Fused bead analysis is another bulk rock analytical technique that has been used in meteoritics [3]. This technique involves forming a glass bead from 10 mg of sample and measuring its chemistry using a defocused beam on a microprobe. Though the ICP-MS has lower detection limits than the microprobe, the fused bead method destroys a much smaller sample of the meteorite. Fused bead analysis was initially designed for samples with near-eutectic compositions and low viscosities. Melts generated of this type homogenize at relatively low temperatures and produce primary melts near the sample s bulk composition [3]. The application of fused bead analysis to samples with noneutectic melt compositions has not been validated. The purpose of this study is to test if fused bead analysis can accurately determine the bulk rock chemistry of non-eutectic melt composition meteorites. To determine this, we conduct two examinations of the fused bead. First, we compare ICP-MS and fused bead results of the same samples using statistical analysis. Secondly, we inspect the beads for the presence of crystals and chemical heterogeneity. The presence of either of these would indicate incomplete melting and quenching of the bead.

  4. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  5. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  6. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  7. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  8. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  10. Microwave-Assisted Synthesis of kappa-Carrageenan Beads Containing Silver Nanoparticles with Dye Adsorption and Antibacterial Properties

    Directory of Open Access Journals (Sweden)

    Hossein Hosseinzadeh

    2016-04-01

    Full Text Available In this work, we used a simple and totally green method for synthesizing silver nanoparticles using kappa-carrageenan as reducing and stabilizing agent. The beads were prepared in aqueous medium by microwave heating, and then followed by cross-linking with K+ cations without using any additional toxic and expensive chemical agents. The preparation method of the carrageenan-based beads is easy, fast, simple, effective, and safe. The synthesized beads loaded with were characterized by ultraviolet-visible absorbance spectra, transmition electron microscopy and X-Ray diffraction techniques. The as-prepared beads were evaluated to remove cationic crystal violet dye from aqueous solutions. The thermodynamic parameters shown that the sorption process was feasible, spontaneous and endothermic. The kinetics and isotherm of crystal violet adsorption were found to well fit to pseudo-second-order kinetic and Langmuir isotherm model, respectively. Moreover, the antibacterial activity of the obtained beads was examined using the nutrient agar disc diffusion method.

  11. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  12. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  13. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  14. Cell surface clustering of Cadherin adhesion complex induced by antibody coated beads

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Cadherin receptors mediate cell-cell adhesion, signal transduction and assembly of cytoskeletons. How a single transmembrane molecule Cadherin can be involved in multiple functions through modulating its binding activities with many membrane adhesion molecules and cytoskeletal components is an unanswered question which can be elucidated by clues from bead experiments. Human lung cells expressing N-Cadherin were examined. After co-incubation with anti-N-Cadherin monoclonal antibody coated beads, cell surface clustering of N-Cadherin was induced. Immunofluorescent detection demonstrated that in addition to Cadherin, β-Catenin, α-Catenin, α-Actinin and Actin fluorescence also aggregated respectively at the membrane site of bead attachment. Myosin heavy chain (MHC), another major component of Actin cytoskeleton, did not aggregate at the membrane site of bead attachment. Adhesion unrelated protein Con A and polylysine conjugated beads did not induce the clustering of adhesion molecules. It is indicated that the Cadherin/Catenins/α-Actinin/Actin complex is formed at Cadherin mediated cell adherens junction; occupancy and cell surface clustering of Cadherin is crucial for the formation of Cadherin adhesion protein complexes.

  15. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  16. Blood Compatibility of Sulfonated Cladophora Nanocellulose Beads

    Directory of Open Access Journals (Sweden)

    Igor Rocha

    2018-03-01

    Full Text Available Sulfonated cellulose beads were prepared by oxidation of Cladophora nanocellulose to 2,3-dialdehyde cellulose followed by sulfonation using bisulfite. The physicochemical properties of the sulfonated beads, i.e., high surface area, high degree of oxidation, spherical shape, and the possibility of tailoring the porosity, make them interesting candidates for the development of immunosorbent platforms, including their application in extracorporeal blood treatments. A desired property for materials used in such applications is blood compatibility; therefore in the present work, we investigate the hemocompatibility of the sulfonated cellulose beads using an in vitro whole blood model. Complement system activation (C3a and sC5b-9 levels, coagulation activation (thrombin-antithrombin (TAT levels and hemolysis were evaluated after whole blood contact with the sulfonated beads and the results were compared with the values obtained with the unmodified Cladophora nanocellulose. Results showed that neither of the cellulosic materials presented hemolytic activity. A marked decrease in TAT levels was observed after blood contact with the sulfonated beads, compared with Cladophora nanocellulose. However, the chemical modification did not promote an improvement in Cladophora nanocellulose hemocompatibility in terms of complement system activation. Even though the sulfonated beads presented a significant reduction in pro-coagulant activity compared with the unmodified material, further modification strategies need to be investigated to control the complement activation by the cellulosic materials.

  17. Blood Compatibility of Sulfonated Cladophora Nanocellulose Beads.

    Science.gov (United States)

    Rocha, Igor; Lindh, Jonas; Hong, Jaan; Strømme, Maria; Mihranyan, Albert; Ferraz, Natalia

    2018-03-07

    Sulfonated cellulose beads were prepared by oxidation of Cladophora nanocellulose to 2,3-dialdehyde cellulose followed by sulfonation using bisulfite. The physicochemical properties of the sulfonated beads, i.e., high surface area, high degree of oxidation, spherical shape, and the possibility of tailoring the porosity, make them interesting candidates for the development of immunosorbent platforms, including their application in extracorporeal blood treatments. A desired property for materials used in such applications is blood compatibility; therefore in the present work, we investigate the hemocompatibility of the sulfonated cellulose beads using an in vitro whole blood model. Complement system activation (C3a and sC5b-9 levels), coagulation activation (thrombin-antithrombin (TAT) levels) and hemolysis were evaluated after whole blood contact with the sulfonated beads and the results were compared with the values obtained with the unmodified Cladophora nanocellulose. Results showed that neither of the cellulosic materials presented hemolytic activity. A marked decrease in TAT levels was observed after blood contact with the sulfonated beads, compared with Cladophora nanocellulose. However, the chemical modification did not promote an improvement in Cladophora nanocellulose hemocompatibility in terms of complement system activation. Even though the sulfonated beads presented a significant reduction in pro-coagulant activity compared with the unmodified material, further modification strategies need to be investigated to control the complement activation by the cellulosic materials.

  18. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  19. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  20. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  1. Relative contribution of Prevotella intermedia and Pseudomonas aeruginosa to lung pathology in airways of patients with cystic fibrosis.

    Science.gov (United States)

    Ulrich, Martina; Beer, Isabelle; Braitmaier, Peter; Dierkes, Michaela; Kummer, Florian; Krismer, Bernhard; Schumacher, Ulrike; Gräpler-Mainka, Ute; Riethmüller, Joachim; Jensen, Peter Ø; Bjarnsholt, Thomas; Høiby, Niels; Bellon, Gabriel; Döring, Gerd

    2010-11-01

    Patients with cystic fibrosis (CF) with Pseudomonas aeruginosa lung infections produce endobronchial mucus plugs allowing growth of obligate anaerobes including Prevotella spp. Whether obligate anaerobes contribute to the pathophysiology of CF lung disease is unknown. The virulence of Prevotella intermedia and Ps aeruginosa was investigated in vitro and in mice, antibodies against P intermedia in CF sera were assessed and a culture-independent detection method for P intermedia/P nigrescens in CF sputum was tested. P intermedia reached cell numbers of >10(5)->10(7) colony-forming units (CFU)/ml sputum. The majority of patients with CF (16/17; 94.1%) produced antibodies against two immunoreactive antigens of P intermedia. Culture supernatant fluids, collected from 10(9) P intermedia cells, were more cytotoxic to respiratory epithelial cells in vitro and inflammatory in mouse lungs than respective fluids from anaerobically grown Ps aeruginosa, while fluids from aerobically grown Ps aeruginosa had the highest cytotoxicity and inflammation. Both pathological effects were largely reduced when culture supernatant fluids from 10(7) cells of either species were used. P intermedia cells (∼10(6)CFU/lung) did not induce mortality in the agar beads lung infection mouse model, while Ps aeruginosa cells caused death in 30% of mice due to rapid multiplication. A P intermedia/P nigrescens-specific PNA probe was significantly more sensitive than culture-dependent diagnostic assays to detect these strict anaerobes. Ps aeruginosa and P intermedia become significantly virulent in vitro and in vivo when cell numbers exceed 10(8) CFU/lung.

  2. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  3. Yersinia pestis detection by loop-mediated isothermal amplification combined with magnetic bead capture of DNA

    Directory of Open Access Journals (Sweden)

    Na Feng

    Full Text Available ABSTRACT We developed a loop-mediated isothermal amplification (LAMP assay for the detection of Y. pestis by targeting the 3a sequence on chromosome. All 11 species of the genus Yersinia were used to evaluate the specificity of LAMP and PCR, demonstrating that the primers had a high level of specificity. The sensitivity of LAMP or PCR was 2.3 or 23 CFU for pure culture, whereas 2.3 × 104 or 2.3 × 106 CFU for simulated spleen and lung samples. For simulated liver samples, the sensitivity of LAMP was 2.3 × 106 CFU, but PCR was negative at the level of 2.3 × 107 CFU. After simulated spleen and lung samples were treated with magnetic beads, the sensitivity of LAMP or PCR was 2.3 × 103 or 2.3 × 106 CFU, whereas 2.3 × 105 or 2.3 × 107 CFU for magnetic bead-treated liver samples. These results indicated that some components in the tissues could inhibit LAMP and PCR, and liver tissue samples had a stronger inhibition to LAMP and PCR than spleen and lung tissue samples. LAMP has a higher sensitivity than PCR, and magnetic bead capture of DNAs could remarkably increase the sensitivity of LAMP. LAMP is a simple, rapid and sensitive assay suitable for application in the field or poverty areas.

  4. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  5. The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet

    Science.gov (United States)

    Dunlap, Dacey; Patrick, Patricia

    2012-01-01

    During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…

  6. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  7. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  8. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  9. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  10. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  11. Long-term cryopreservation of non-spore-forming fungi in Microbank™ beads for plant pathological investigations.

    Science.gov (United States)

    Lakshman, Dilip K; Singh, Vimla; Camacho, Manuel E

    2018-05-01

    Long-term preservation of experimental fungi without genetic, morphological, and pathogenic changes is of paramount importance in mycological and plant pathological investigations. Several cryogenic and non-cryogenic methods are available for the preservation of fungi, but the methods can be cumbersome, hazardous, expensive, and often not suitable for long-term storage of non-spore-forming (sterile) fungi. A method of preservation of spore-forming fungi in commercially available porous beads (Micrbank™) under cryogenic condition was successfully tested for three non-spore-forming basidiomycetes genera: Rhizoctonia solani (teleomorph: Thanatephorus cucumeris) (n = 19), Ceratobasidium species (n = 1), and Waitea circinata (n = 3), and a non-spore forming ascomycetes, Sclerotinia sclerotiorum (n = 1). For comparison, spore-forming ascomycetous fungi, Alternaria alternata (n = 1), Bauveria basiana (n = 2), Botrytis cinerea (n = 1), Fusarium oxysporum f.sp. gladiolii (n = 1), Trichoderma spp. (n = 3), and Thielaviopsis basicola (n = 2) were also cryopreserved in Microbank beads. Viable fungal isolates of all test species were retrieved after five years of storage at -80 °C, which was longer than the viabilities of the corresponding isolates cryopreserved in agar plugs or colonized wheat seeds. Fungi revived from the Microbank beads maintained identical morphology and cultural characteristics of the parent isolates. Randomly selected Rhizoctonia isolates revived from the Microbank beads maintained respective pathological properties of the parent isolates; also, no mutation was detected in the internal transcribed spacer (ITS) ribosomal DNA when compared with respective cultures maintained at ambient temperature. This finding demonstrated the utility of cryopreservation in Microbank beads as a convenient alternative to conventional long-term preservation of a wide group of fungal cultures for plant pathological investigations

  12. ADSORPTION AND RELEASING PROPERTIES OF BEAD CELLULOSE

    Institute of Scientific and Technical Information of China (English)

    A. Morales; E. Bordallo; V. Leon; J. Rieumont

    2004-01-01

    The adsorption of some dyes on samples of bead cellulose obtained in the Unit of Research-Production "Cuba 9"was studied. Methylene blue, alizarin red and congo red fitted the adsorption isotherm of Langmuir. Adsorption kinetics at pH = 6 was linear with the square root of time indicating the diffusion is the controlling step. At pH = 12 a non-Fickian trend was observed and adsorption was higher for the first two dyes. Experiments carried out to release the methylene blue occluded in the cellulose beads gave a kinetic behavior of zero order. The study of cytochrome C adsorption was included to test a proteinic material. Crosslinking of bead cellulose was performed with epichlorohydrin decreasing its adsorption capacity in acidic or alkaline solution.

  13. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  14. Bead Capture on Magnetic Sensors in a Microfluidic System

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Dalslet, Bjarke Thomas; Damsgaard, Christian Danvad

    2009-01-01

    The accumulation of magnetic beads by gravitational sedimentation and magnetic capture on a planar Hall-effect sensor integrated in a microfluidic channel is studied systematically as a function of the bead concentration, the fluid flow rate, and the sensor bias current. It is demonstrated...... that the sedimentation flux is proportional to the bead concentration and has a power law relation to the fluid flow rate. The mechanisms for the bead accumulation are investigated and it is found that gravitational sedimentation dominates the bead accumulation, whereas the stability of the sedimented beads against...

  15. Cooling Rates of Lunar Volcanic Glass Beads

    Science.gov (United States)

    Hui, Hejiu; Hess, Kai-Uwe; Zhang, Youxue; Peslier, Anne; Lange, Rebecca; Dingwell, Donald; Neal, Clive

    2016-01-01

    It is widely accepted that the Apollo 15 green and Apollo 17 orange glass beads are of volcanic origin. The diffusion profiles of volatiles in these glass beads are believed to be due to degassing during eruption (Saal et al., 2008). The degree of degassing depends on the initial temperature and cooling rate. Therefore, the estimations of volatiles in parental magmas of lunar pyroclastic deposits depend on melt cooling rates. Furthermore, lunar glass beads may have cooled in volcanic environments on the moon. Therefore, the cooling rates may be used to assess the atmospheric condition in an early moon, when volcanic activities were common. The cooling rates of glasses can be inferred from direct heat capacity measurements on the glasses themselves (Wilding et al., 1995, 1996a,b). This method does not require knowledge of glass cooling environments and has been applied to calculate the cooling rates of natural silicate glasses formed in different terrestrial environments. We have carried out heat capacity measurements on hand-picked lunar glass beads using a Netzsch DSC 404C Pegasus differential scanning calorimeter at University of Munich. Our preliminary results suggest that the cooling rate of Apollo 17 orange glass beads may be 12 K/min, based on the correlation between temperature of the heat capacity curve peak in the glass transition range and glass cooling rate. The results imply that the parental magmas of lunar pyroclastic deposits may have contained more water initially than the early estimations (Saal et al., 2008), which used higher cooling rates, 60-180 K/min in the modeling. Furthermore, lunar volcanic glass beads could have been cooled in a hot gaseous medium released from volcanic eruptions, not during free flight. Therefore, our results may shed light on atmospheric condition in an early moon.

  16. Beads from Inhumation Rite Burials of Gnezdovo Burial Mound

    Directory of Open Access Journals (Sweden)

    Dobrova Olga P.

    2017-12-01

    Full Text Available The beads from 33 inhumation burials at Gnezdovo burial mound are examined in the article. The beads (total 367 were crafted from stretched tube (258, stretched stick (3, winding (45, press molding (2 pcs., welding (2 pcs., and mosaic beads (9 pcs.. The burial mound contains virtually no broken beads, including the settlement's most common yellow glass beads. Besides glass beads, cornelian, crystal, amber and faience beads have been registered among the burial mound material, as well as beads crafted with metal. Apart from beads, grave inventories contained a series of pendants with a bead strung on a wire ring. The considered complexes contain five pendants of this type. Besides Gnezdovo, similar pendants have been discovered in Kiev, Timerev, Pskov and Vladimir barrows. A comparison between bead sets from Gnezdovo and Kiev burial mounds allows to conclude that the general composition and occurrence frequency of beads is identical for these burials. At the same time, beads crafted with rock crystal, cornelian and metal are more frequently discovered in Kiev inhumations.

  17. exploring traditional glass bead making techniques in jewellery

    African Journals Online (AJOL)

    User

    Glass bead making techniques and their mass production will help the individual ... communicate cultural values in a symbolic lan- guage which ..... Surface of most of the new beads were rough ... tourism potential to be developed further to.

  18. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  20. Study on the etched carnelian beads unearthed in China

    Institute of Scientific and Technical Information of China (English)

    Deyun Zhao

    2014-01-01

    Etched carnelian beads originated in the Indus Civilization;this kind of ornaments and its manufacturing techniques were spread to the whole Eurasia Continent.The etched carnelian beads unearthed in China can be classified into four types,the comparisons of which to their foreign counterparts may reveal their different sources and diffusion routes.The etched carnelian beads and their glass imitations unearthed in China had influences to the making of the glass "eye beads" in

  1. Metal-Containing Polystyrene Beads as Standards for Mass Cytometry.

    Science.gov (United States)

    Abdelrahman, Ahmed I; Ornatsky, Olga; Bandura, Dmitry; Baranov, Vladimir; Kinach, Robert; Dai, Sheng; Thickett, Stuart C; Tanner, Scott; Winnik, Mitchell A

    2010-01-01

    We examine the suitability of metal-containing polystyrene beads for the calibration of a mass cytometer instrument, a single particle analyser based on an inductively coupled plasma ion source and a time of flight mass spectrometer. These metal-containing beads are also verified for their use as internal standards for this instrument. These beads were synthesized by multiple-stage dispersion polymerization with acrylic acid as a comonomer. Acrylic acid acts as a ligand to anchor the metal ions within the interior of the beads. Mass cytometry enabled the bead-by-bead measurement of the metal-content and determination of the metal-content distribution. Beads synthesized by dispersion polymerization that involved three stages were shown to have narrower bead-to-bead variation in their lanthanide content than beads synthesized by 2-stage dispersion polymerization. The beads exhibited insignificant release of their lanthanide content to aqueous solutions of different pHs over a period of six months. When mixed with KG1a or U937 cell lines, metal-containing polymer beads were shown not to affect the mass cytometry response to the metal content of element-tagged antibodies specifically attached to these cells.

  2. Controlled torque on superparamagnetic beads for functional biosensors

    NARCIS (Netherlands)

    Janssen, X.J.A.; Schellekens, A.J.; van Ommering, K.; IJzendoorn, van L.J.; Prins, M.W.J.

    2009-01-01

    We demonstrate that a rotating magnetic field can be used to apply a controlled torque on superparamagnetic beads which leads to a tunable bead rotation frequency in fluid. Smooth rotation is obtained for field rotation frequencies many orders of magnitude higher than the bead rotation frequency. A

  3. A Controlled Drug-Delivery Experiment Using Alginate Beads

    Science.gov (United States)

    Farrell, Stephanie; Vernengo, Jennifer

    2012-01-01

    This paper describes a simple, cost-effective experiment which introduces students to drug delivery and modeling using alginate beads. Students produce calcium alginate beads loaded with drug and measure the rate of release from the beads for systems having different stir rates, geometries, extents of cross-linking, and drug molecular weight.…

  4. Assessment of the Problems of Manual Automobile Tyre Bead ...

    African Journals Online (AJOL)

    The tyre-rim bead bond must be broken to carry out repairs on a failed automobile tyre. The use of the locally fabricated manual bead breaking equipment as it is being practiced today by commercial tyre repair artisans in Nigeria is characterized by drudgery. This article reports a study of the local manual bead breaking ...

  5. New Nanoparticles Dispersing Beads Mill with Ultra Small Beads and its Application

    International Nuclear Information System (INIS)

    Inkyo, M; Tahara, T; Imajyo, Y

    2011-01-01

    Two of the major problems related to nanoparticle dispersion with a conventional beads mill are re-agglomeration and damage to the crystalline structure of the particles. The Ultra Apex Mill was developed to solve these problems by enabling the use of ultra-small beads with a diameter of less than 0.1mm. The core of this breakthrough development is centrifugation technology which allows the use of beads as small as 0.015mm. When dispersing agglomerated nanoparticles the impulse of the small beads is very low which means there is little influence on the particles. The surface energy of the nanoparticles remains low so the properties are not likely to change. As a result, stable nanoparticle dispersions can be achieved without re-cohesion. The Ultra Apex Mill is superior to conventional beads mills that are limited to much larger bead sizes. The technology of the Ultra Apex Mill has pioneered practical applications for nanoparticles in various fields: composition materials for LCD screens, ink-jet printing, ceramic condensers and cosmetics.

  6. Friction of N-bead macromolecules in solution: Effects of the bead-solvent interaction

    International Nuclear Information System (INIS)

    Uvarov, Alexander; Fritzsche, Stephan

    2006-01-01

    The role of the bead-solvent interaction has been studied for its influence on the dynamics of an N-bead macromolecule which is immersed into a solution. Using a Fokker-Planck equation for the phase-space distribution function of the macromolecule, we show that all the effects of the solution can be treated entirely in terms of the friction tensors which are assigned to each pair of interacting beads in the chain. For the high-density as well as for the critical solvent, the properties of these tensors are discussed in detail and are calculated by using several (realistic) choices of the bead-solvent potential. From the friction tensors, moreover, an expression for the center-of-mass friction coefficient of a (N-bead) chain macromolecule is derived. Numerical data for this coefficient for 'truncated' Lennard-Jones bead-solvent potential are compared with results from molecular dynamic simulations and from the phenomenological theoretical data as found in the literature

  7. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  8. Bead-bead interaction parameters in dissipative particle dynamics: Relation to bead-size, solubility parameter, and surface tension

    Science.gov (United States)

    Maiti, Amitesh; McGrother, Simon

    2004-01-01

    Dissipative particle dynamics (DPD) is a mesoscale modeling method for simulating equilibrium and dynamical properties of polymers in solution. The basic idea has been around for several decades in the form of bead-spring models. A few years ago, Groot and Warren [J. Chem. Phys. 107, 4423 (1997)] established an important link between DPD and the Flory-Huggins χ-parameter theory for polymer solutions. We revisit the Groot-Warren theory and investigate the DPD interaction parameters as a function of bead size. In particular, we show a consistent scheme of computing the interfacial tension in a segregated binary mixture. Results for three systems chosen for illustration are in excellent agreement with experimental results. This opens the door for determining DPD interactions using interfacial tension as a fitting parameter.

  9. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  10. The control of beads diameter of bead-on-string electrospun nanofibers and the corresponding release behaviors of embedded drugs

    Energy Technology Data Exchange (ETDEWEB)

    Li, Tingxiao [Key Laboratory of Textile Science and Technology (Donghua University), Ministry of Education of China, Shanghai 201620 (China); College of Textiles, Donghua University, Shanghai 201620 (China); Ding, Xin, E-mail: xding@dhu.edu.cn [Key Laboratory of Textile Science and Technology (Donghua University), Ministry of Education of China, Shanghai 201620 (China); College of Textiles, Donghua University, Shanghai 201620 (China); Tian, Lingling, E-mail: lingling_tian@nus.edu.sg [Center of Nanofibers & Nanotechnology, Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore); Hu, Jiyong; Yang, Xudong [Key Laboratory of Textile Science and Technology (Donghua University), Ministry of Education of China, Shanghai 201620 (China); College of Textiles, Donghua University, Shanghai 201620 (China); Ramakrishna, Seeram [Center of Nanofibers & Nanotechnology, Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore); Guangdong-Hongkong-Macau Institute of CNS Regeneration (GHMICR), Jinan University, Guangzhou 510632 (China)

    2017-05-01

    Bead-on-string nanofibers, with appropriate control of the beads diameter, are potential fibrous structures for efficient encapsulation of particle drugs in micron scales and could achieve controlled drug release for tissue engineering applications. In this study, the beads diameter of electrospun bead-on-string nanofibers was controlled by adjusting the concentration of spinning polymer, poly (lactic-co-glycolic acid) (PLGA), and the solvent ratio of chloroform to acetone. The images of the scanning electron microscopy (SEM) suggested that bead-on-string nanofibers could be successfully obtained only with a certain range of PLGA solution concentration. Moreover, with the decrease in the solvent ratio of chloroform to acetone, the range was left-shifted towards a smaller concentration. In addition, increase in the PLGA solution concentration within the range the beads diameter became greater and the shape of the beads changed from oval to slender when increasing the PLGA concentration within the range. The bead-on-string nanofibers with different beads diameter were further used to load micro-particle drugs of tetracycline hydrochloride, as a model drug, to examine the release behavior of nanofibers scaffold. The release profiles of drug loaded bead-on-string nanofibers demonstrated the possibility to alleviate the burst drug release by means of beads diameter control. - Highlights: • Bead diameter of bead-on-string electrospun nanofibers was controlled by varying solvent ratio and polymer concentration. • The effect of the addition of particle drugs on BD of bead-on-string electrospun nanofibers was studied. • The corresponding release behaviors of nanofibers with different BD loading micro-particle drugs were investigated. • Bead-on-string nanofibers with bigger BD could alleviate the initial burst release.

  11. The control of beads diameter of bead-on-string electrospun nanofibers and the corresponding release behaviors of embedded drugs

    International Nuclear Information System (INIS)

    Li, Tingxiao; Ding, Xin; Tian, Lingling; Hu, Jiyong; Yang, Xudong; Ramakrishna, Seeram

    2017-01-01

    Bead-on-string nanofibers, with appropriate control of the beads diameter, are potential fibrous structures for efficient encapsulation of particle drugs in micron scales and could achieve controlled drug release for tissue engineering applications. In this study, the beads diameter of electrospun bead-on-string nanofibers was controlled by adjusting the concentration of spinning polymer, poly (lactic-co-glycolic acid) (PLGA), and the solvent ratio of chloroform to acetone. The images of the scanning electron microscopy (SEM) suggested that bead-on-string nanofibers could be successfully obtained only with a certain range of PLGA solution concentration. Moreover, with the decrease in the solvent ratio of chloroform to acetone, the range was left-shifted towards a smaller concentration. In addition, increase in the PLGA solution concentration within the range the beads diameter became greater and the shape of the beads changed from oval to slender when increasing the PLGA concentration within the range. The bead-on-string nanofibers with different beads diameter were further used to load micro-particle drugs of tetracycline hydrochloride, as a model drug, to examine the release behavior of nanofibers scaffold. The release profiles of drug loaded bead-on-string nanofibers demonstrated the possibility to alleviate the burst drug release by means of beads diameter control. - Highlights: • Bead diameter of bead-on-string electrospun nanofibers was controlled by varying solvent ratio and polymer concentration. • The effect of the addition of particle drugs on BD of bead-on-string electrospun nanofibers was studied. • The corresponding release behaviors of nanofibers with different BD loading micro-particle drugs were investigated. • Bead-on-string nanofibers with bigger BD could alleviate the initial burst release.

  12. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  13. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  14. Aptamer-Modified Magnetic Beads in Biosensing

    Science.gov (United States)

    Scheper, Thomas; Walter, Johanna-Gabriela

    2018-01-01

    Magnetic beads (MBs) are versatile tools for the purification, detection, and quantitative analysis of analytes from complex matrices. The superparamagnetic property of magnetic beads qualifies them for various analytical applications. To provide specificity, MBs can be decorated with ligands like aptamers, antibodies and peptides. In this context, aptamers are emerging as particular promising ligands due to a number of advantages. Most importantly, the chemical synthesis of aptamers enables straightforward and controlled chemical modification with linker molecules and dyes. Moreover, aptamers facilitate novel sensing strategies based on their oligonucleotide nature that cannot be realized with conventional peptide-based ligands. Due to these benefits, the combination of aptamers and MBs was already used in various analytical applications which are summarized in this article. PMID:29601533

  15. Biosorption of americium by alginate beads

    International Nuclear Information System (INIS)

    Borba, Tania Regina de; Marumo, Julio Takehiro; Goes, Marcos Maciel de; Ferreira, Rafael Vicente de Padua; Sakata, Solange Kazumi

    2009-01-01

    The use of biotechnology to remove heavy metals from wastes plays great potential in treatment of radioactive wastes and therefore the aim of this study was to evaluate the biosorption of americium by alginate beads. Biosorption has been defined as the property of certain biomolecules to bind and remove selected ions or other molecules from aqueous solutions. The calcium alginate beads as biosorbent were prepared and analyzed for americium uptaking. The experiments were performed in different solution activity concentrations, pH and exposure time. The results suggest that biosorption process is more efficient at pH 4 and for 75, 150, 300 Bq/mL and 120 minutes were necessary to remove almost 100% of the americium-241 from the solution. (author)

  16. RF Bead Pull Measurements of the DQW

    CERN Document Server

    Jaume, Guillaume

    2015-01-01

    This report was written within the framework of the CERN Summer Student Program. It is focused on the Radio Frequency study of the Double Quarter Wave Crab Cavity [1] considered for the crab-crossing scheme of the LHC Luminosity upgrade [2]. HFSS simulation [3] and Bead-Pull Measurements technique were used for the characterization of the higher-order terms of the main deflecting mode.

  17. Spray drying of bead resins: feasibility tests

    International Nuclear Information System (INIS)

    Gay, R.L.; Grantham, L.F.; Jones, L.J.

    1984-01-01

    Rockwell International has developed a volume reduction system for low-level reactor wastes based on drying the wastes in a heated-air spray dryer. The drying of slurries of sodium sulfate, boric acid, and powdered ion exchange resins was demonstrated in previous tests. The drying of bead ion exchange resins can be especially difficult due to the relatively large size of bead resins (about 500 to 800 microns) and their natural affinity for water. This water becomes part of the pore structure of the resins and normally comprises 50 t 60 wt % of the resin weight. A 76-cm-diameter spray dryer was used for feasibility tests of spray drying of cation and anion bead resins. These resins were fed to the dryer in the as-received form (similar to dewatered resins) and as slurries. A dry, free-flowing product was produced in all the tests. The volume of the spray-dried product was one-half to one-third the volume of the as-received material. An economic analysis was made of the potential cost savings that can be achieved using the Rockwel spray dryer system. In-plant costs, transportation costs, and burial costs of spray-dried resins were compared to similar costs for disposal of dewatered resins. A typical utility producing 170 m 3 (6,000 ft 3 ) per year of dewatered resins can save $600,000 to $700,000 per year using this volume reduction system

  18. Glass bead sterilizer comprehensively defeats hot air oven in orthodontic clinic

    Directory of Open Access Journals (Sweden)

    Sanjeev Vasudev Jakati

    2015-01-01

    Full Text Available Background: It is necessary to ′try in′ several bands before the correct one is selected. A possible concern with re-using such bands is the lack of cross-infection control. Aim and Objectives: To determine whether such bands could be successfully decontaminated with Glass bead sterilization so that they could be re-used without a cross-infection risk. Materials: Custom made molar bands were taken and buccal tubes,lingual sheath and lingual cleat were welded under strict aseptic conditions. Methods: Samples were divided into 2 groups i.e. A and B, based on mode for sterilization. Sterilized attachments were placed in each of 2 conical flask. The bacteria spores were inoculated into both flask under strict aseptic conditions. Bacteria Bacillus subtillis and Staphylococcus albus species were allowed to multiply in individual flasks filled with BHI broth for 24 hours. Bands from 1st group were placed in a glass bead sterilizer. For the 2 nd group i.e. hot air oven group, all bands were placed together. After sterilization bands were removed and placed in freshly sterilized 500ml conical flask containing BHI broth for 24 hours in the incubator. The following day randomly 4 attachments were selected from each group and streaked on blood agar culture plates. Results: After sterilization and on further incubation in BHI broth for 24 and 48 hrs. Respectively no growth was seen. Conclusion: 1 hr. of Hot Air Oven sterilization (excluding pre sterilization heat up time and post sterilization cooling time at 190°C is as effective as 3 min of Chair side Glass Bead sterilization.

  19. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  20. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  1. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  2. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  3. Discrete dipole approximation simulation of bead enhanced diffraction grating biosensor

    International Nuclear Information System (INIS)

    Arif, Khalid Mahmood

    2016-01-01

    We present the discrete dipole approximation simulation of light scattering from bead enhanced diffraction biosensor and report the effect of bead material, number of beads forming the grating and spatial randomness on the diffraction intensities of 1st and 0th orders. The dipole models of gratings are formed by volume slicing and image processing while the spatial locations of the beads on the substrate surface are randomly computed using discrete probability distribution. The effect of beads reduction on far-field scattering of 632.8 nm incident field, from fully occupied gratings to very coarse gratings, is studied for various bead materials. Our findings give insight into many difficult or experimentally impossible aspects of this genre of biosensors and establish that bead enhanced grating may be used for rapid and precise detection of small amounts of biomolecules. The results of simulations also show excellent qualitative similarities with experimental observations. - Highlights: • DDA was used to study the relationship between the number of beads forming gratings and ratio of first and zeroth order diffraction intensities. • A very flexible modeling program was developed to design complicated objects for DDA. • Material and spatial effects of bead distribution on surfaces were studied. • It has been shown that bead enhanced grating biosensor can be useful for fast detection of small amounts of biomolecules. • Experimental results qualitatively support the simulations and thus open a way to optimize the grating biosensors.

  4. HPMA and HEMA copolymer bead interactions with eukaryotic cells

    Directory of Open Access Journals (Sweden)

    Cristina D. Vianna-Soares

    2004-09-01

    Full Text Available Two different hydrophilic acrylate beads were prepared via aqueous suspension polymerization. Beads produced of a hydroxypropyl methacrylate (HPMA and ethyleneglycol methacrylate (EDMA copolymer were obtained using a polyvinyl alcohol suspending medium. Copolymers of 2hydroxyethyl methacrylate (HEMA, methyl methacrylate (MMA and ethyleneglycol methacrylate (EDMA beads were obtained using magnesium hydroxide as the suspending agent. Following characterization by scanning electron microscopy (SEM, nitrogen sorption analysis (NSA and mercury intrusion porosimetry (MIP, the beads were cultured with monkey fibroblasts (COS7 to evaluate their ability to support cell growth, attachment and adhesion. Cell growth behavior onto small HPMA/EDMA copolymer beads and large HEMA/MMA/EDMA copolymer beads is evaluated regarding their hidrophilicity/hidrophobicity and surface roughness.

  5. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    黄承志; 李原芳; 黄新华; 范美坤

    2000-01-01

    The microarray of DNA probes with 5’ -NH2 and 5’ -Tex/3’ -NH2 modified terminus on 10 um carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) is characterized in the preseni paper. it was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentra-tion of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  6. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The microarray of DNA probes with 5′-NH2 and 5′-Tex/3′-NH2 modified terminus on 10 m m carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)- carbodiimide (EDC) is characterized in the present paper. It was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentration of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  7. Configurational Statistics of Magnetic Bead Detection with Magnetoresistive Sensors

    DEFF Research Database (Denmark)

    Henriksen, Anders Dahl; Ley, Mikkel Wennemoes Hvitfeld; Flyvbjerg, Henrik

    2015-01-01

    Magnetic biosensors detect magnetic beads that, mediated by a target, have bound to a functionalized area. This area is often larger than the area of the sensor. Both the sign and magnitude of the average magnetic field experienced by the sensor from a magnetic bead depends on the location...... of the bead relative to the sensor. Consequently, the signal from multiple beads also depends on their locations. Thus, a given coverage of the functionalized area with magnetic beads does not result in a given detector response, except on the average, over many realizations of the same coverage. We present...... a systematic theoretical analysis of how this location-dependence affects the sensor response. The analysis is done for beads magnetized by a homogeneous in-plane magnetic field. We determine the expected value and standard deviation of the sensor response for a given coverage, as well as the accuracy...

  8. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  9. Detection of ''beading faults'' in welded tubes

    International Nuclear Information System (INIS)

    Mondot, J.

    In the steel tube industry the word ''beading'' refers to a highly localised leak affecting the welded zone. During the pneumatic test its flow rate is generally very low no more than a few thousandths of a mm 3 /second. Detection of such a fault by this test is consequently slow, and those which are choked or at the limit of leakage may escape detection. For greater safety, the tube technician is now using non-destructive testing methods such as eddy-currents and ultrasonics [fr

  10. Creating nanoshell on the surface of titanium hydride bead

    Directory of Open Access Journals (Sweden)

    PAVLENKO Vyacheslav Ivanovich

    2016-12-01

    Full Text Available The article presents data on the modification of titanium hydride bead by creating titanium nanoshell on its surface by ion-plasma vacuum magnetron sputtering. To apply titanium nanoshell on the titanium hydride bead vacuum coating plant of multifunctional nanocomposite coatings QVADRA 500 located in the center of high technology was used. Analysis of the micrographs of the original surface of titanium hydride bead showed that the microstructure of the surface is flat, smooth, in addition the analysis of the microstructure of material surface showed the presence of small porosity, roughness, mainly cavities, as well as shallow longitudinal cracks. The presence of oxide film in titanium hydride prevents the free release of hydrogen and fills some micro-cracks on the surface. Differential thermal analysis of both samples was conducted to determine the thermal stability of the initial titanium hydride bead and bead with applied titanium nanoshell. Hydrogen thermal desorption spectra of the samples of the initial titanium hydride bead and bead with applied titanium nanoshell show different thermal stability of compared materials in the temperature range from 550 to 860о C. Titanium nanoshells applied in this way allows increasing the heat resistance of titanium hydride bead – the temperature of starting decomposition is 695о C and temperature when decomposition finishes is more than 1000о C. Modified in this way titanium hydride bead can be used as a filler in the radiation protective materials used in the construction or upgrading biological protection of nuclear power plants.

  11. Lung cancer

    International Nuclear Information System (INIS)

    Aisner, J.

    1985-01-01

    This book contains 13 chapters. Some of the chapter titles are: The Pathology of Lung Cancer; Radiotherapy for Non-Small-Cell Cancer of the Lung; Chemotherapy for Non-Small-Cell Lung Cancer; Immunotherapy in the Management of Lung Cancer; Preoperative Staging and Surgery for Non-Small-Cell Lung Cancer; and Prognostic Factors in Lung Cancer

  12. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  13. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  14. Pseudomonas aeruginosa aggregate formation in an alginate bead model system exhibits In Vivo-like characteristics

    DEFF Research Database (Denmark)

    Sønderholm, Majken; Kragh, Kasper Nørskov; Koren, Klaus

    2017-01-01

    similar in size to in vivo aggregates observed ex vivo in cystic fibrosis lungs and chronic wounds. Bacterial aggregates primarily grew in the bead periphery and decreased in size and abundance toward the center of the bead. Microsensor measurements showed that the O2 concentration decreased rapidly...... and flexible in vivo-like biofilm model system, wherein bacterial growth exhibits central features of in vivo biofilms. This was observed by the formation of small cell aggregates in a secondary matrix with O2-limited growth, which was alleviated by the addition of NO3− as an alternative electron acceptor...

  15. TiO2 beads and TiO2-chitosan beads for urease immobilization

    International Nuclear Information System (INIS)

    Ispirli Doğaç, Yasemin; Deveci, İlyas; Teke, Mustafa; Mercimek, Bedrettin

    2014-01-01

    The aim of the present study is to synthesize TiO 2 beads for urease immobilization. Two different strategies were used to immobilize the urease on TiO 2 beads. In the first method (A), urease enzyme was immobilized onto TiO 2 beads by adsorption and then crosslinking. In the second method (B), TiO 2 beads were coated with chitosan-urease mixture. To determine optimum conditions of immobilization, different parameters were investigated. The parameters of optimization were initial enzyme concentration (0.5; 1; 1.5; 2 mg/ml), alginate concentration (1; 2; 3%), glutaraldehyde concentration (1; 2; 3% v/v) and chitosan concentration (2; 3; 4 mg/ml). The optimum enzyme concentrations were determined as 1.5 mg/ml for A and 1.0 mg/ml for B. The other optimum conditions were found 2.0% (w/v) for alginate concentration (both A and B); 3.0 mg/ml for chitosan concentration (B) and 2.0% (v/v) for glutaraldehyde concentration (A). The optimum temperature (20-60 °C), optimum pH (3.0-10.0), kinetic parameters, thermal stability (4–70 °C), pH stability (4.0-9.0), operational stability (0-230 min) and reusability (20 times) were investigated for characterization. The optimum temperatures were 30 °C (A), 40 °C (B) and 35 °C (soluble). The temperature profiles of the immobilized ureases were spread over a large area. The optimum pH values for the soluble urease and immobilized urease prepared by using methods (A) and (B) were found to be 7.5, 7.0, 7.0, respectively. The thermal stabilities of immobilized enzyme sets were studied and they maintained 50% activity at 65 °C. However, at this temperature free urease protected only 15% activity. - Highlights: • TiO 2 and TiO 2 -chitosan beads for urease immobilization have been prepared and characterized. • The beads used in this work are good matrices for the immobilization of urease. • The immobilized urease was shown to have good properties and stabilities (pH and thermal stability, operational stability). • The 50

  16. Bead Collage: An Arts-Based Research Method

    Science.gov (United States)

    Kay, Lisa

    2013-01-01

    In this paper, "bead collage," an arts-based research method that invites participants to reflect, communicate and construct their experience through the manipulation of beads and found objects is explained. Emphasizing the significance of one's personal biography and experiences as a researcher, I discuss how my background as an…

  17. Growth and morphology of thermophilic dairy starters in alginate beads.

    Science.gov (United States)

    Lamboley, Laurence; St-Gelais, Daniel; Champagne, Claude P; Lamoureux, Maryse

    2003-06-01

    The aim of this research was to produce concentrated biomasses of thermophilic lactic starters using immobilized cell technology (ICT). Fermentations were carried out in milk using pH control with cells microentrapped in alginate beads. In the ICT fermentations, beads represented 17% of the weight. Some assays were carried out with free cells without pH control, in order to compare the ICT populations with those of classical starters. With Streptococcus thermophilus, overall populations in the fermentor were similar, but maximum bead population for (8.2 x 10(9) cfu/g beads) was 13 times higher than that obtained in a traditional starter (4.9 x 10(8) cfu/ml). For both Lactobacillus helveticus strains studied, immobilized-cell populations were about 3 x 10(9) cfu/g beads. Production of immobilized Lb. bulgaricus 210R strain was not possible, since no increases in viable counts occurred in beads. Therefore, production of concentrated cell suspension in alginate beads was more effective for S. thermophilus. Photomicrographs of cells in alginate beads demonstrated that, while the morphology of S. thermophilus remained unchanged during the ICT fermentation, immobilized cells of Lb. helveticus appeared wider. In addition, cells of Lb. bulgaricus were curved and elongated. These morphological changes would also impair the growth of immobilized lactobacilli.

  18. Towards a programmable magnetic bead microarray in a microfluidic channel

    DEFF Research Database (Denmark)

    Smistrup, Kristian; Bruus, Henrik; Hansen, Mikkel Fougt

    2007-01-01

    to use larger currents and obtain forces of longer range than from thin current lines at a given power limit. Guiding of magnetic beads in the hybrid magnetic separator and the construction of a programmable microarray of magnetic beads in the microfluidic channel by hydrodynamic focusing is presented....

  19. Towards Hypoxia-responsive Drug-eluting Embolization Beads.

    Science.gov (United States)

    Ashrafi, Koorosh; Heaysman, Clare L; Phillips, Gary J; Lloyd, Andrew W; Lewis, Andrew L

    2017-05-30

    Drug release from chemoembolization microspheres stimulated by the presence of a chemically reducing environment may provide benefits for targeting drug resistant and metastatic hypoxic tumours. A water-soluble disulfide-based bifunctional cross-linker bis(acryloyl)-(l)-cystine (BALC) was synthesised, characterised and incorporated into a modified poly(vinyl) alcohol (PVA) hydrogel beads at varying concentrations using reverse suspension polymerisation. The beads were characterised to confirm the amount of cross-linker within each formulation and its effects on the bead properties. Elemental and UV/visible spectroscopic analysis confirmed the incorporation of BALC within the beads and sizing studies showed that in the presence of a reducing agent, all bead formulations increased in mean diameter. The BALC beads could be loaded with doxorubicin hydrochloride and amounts in excess of 300mg of drug per mL of hydrated beads could be achieved but required conversion of the carboxylic acid groups of the BALC to their sodium carboxylate salt forms. Elution of doxorubicin from the beads demonstrated a controlled release via ionic exchange. Some formulations exhibited an increase in size and release of drug in the presence of a reducing agent, and therefore demonstrated the ability to respond to an in vitro reducing environment. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Concepts for increasing gentamicin release from handmade bone cement beads

    NARCIS (Netherlands)

    Rasyid, Hermawan N; van der Mei, Henny C; Frijlink, Henderik W; Soegijoko, Soegijardjo; Van Horn, Jim R; Busscher, Hendrik; Neut, Daniëlle

    2009-01-01

    BACKGROUND AND PURPOSE: Commercial gentamicin-loaded bone cement beads (Septopal) constitute an effective delivery system for local antibiotic therapy. These beads are not available in all parts of the world, and are too expensive for frequent use in others. Thus, orthopedic surgeons worldwide make

  1. Beaded Fiber Mats of PVA Containing Unsaturated Heteropoly Salt

    Institute of Scientific and Technical Information of China (English)

    Guo Cheng YANG; Yan PAN; Jian GONG; Chang Lu SHAO; Shang Bin WEN; Chen SHAO; Lun Yu QU

    2004-01-01

    Poly(vinyl alcohol) (PVA) fiber mats containing unsaturated heteropoly salt was prepared for the first time. IR, X-ray diffraction and SEM photographs characterized the beaded fiber mats.The viscoelasticity and the conductivity of the solution were the key factors that influence the formation of the beaded fiber mats.

  2. Optimization of weld bead geometry of MS plate

    Indian Academy of Sciences (India)

    The considered specimen was checked to harmonize the optimum setting between input factors, for example, welding current, open circuit voltage, and thickness of plate, with respect to obtaining prosperous weld strength as well as bead geometry quality characteristics, for example, tensile strength, bead width, ...

  3. SparseBeads data: benchmarking sparsity-regularized computed tomography

    DEFF Research Database (Denmark)

    Jørgensen, Jakob Sauer; Coban, Sophia B.; Lionheart, William R. B.

    2017-01-01

    -regularized reconstruction. A collection of 48 x-ray CT datasets called SparseBeads was designed for benchmarking SR reconstruction algorithms. Beadpacks comprising glass beads of five different sizes as well as mixtures were scanned in a micro-CT scanner to provide structured datasets with variable image sparsity levels...

  4. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  5. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  6. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  7. Entrapment of laurel lipase in chitosan hydrogel beads.

    Science.gov (United States)

    Yagar, Hulya; Balkan, Ugur

    2017-08-01

    Laurel seed lipase was entrapped within chitosan beads with ionotropic gelatin method using tripolyphosphate (TPP) as multivalent covalent counter ion. Immobilization yield was 78%. First, optimum immobilization conditions were determined, and morphology of chitosan beads was characterized by scanning electron microscopy. Optimum pH and temperature were evaluated as 6.0 and 40 °C, respectively. The immobilized beads saved about 55% of its activities at 60° while saved about 32% at 70 °C for 30 min. V max /K m values were determined as 31.75 and 2.87 using olive oil as substrate for immobilized beads and free enzyme, respectively. Immobilized beads showed the activities during 30 days at +4 °C.

  8. A NOVEL APPROACH TO SYNTHESIZE CHITOSAN BEADS CROSSLINKED BY EPICHLOROHYDRIN

    Institute of Scientific and Technical Information of China (English)

    WANG Yongjian; BAI Shu; SUN Yan

    2001-01-01

    The present investigation describes a novel method for preparing spherical chitosan particles based on crosslinking with epichlorohydrin. Certain amount of pre-crosslinking agent was added to form chitosan gels by traditional inverse phase suspension polymerization. Then the gels were crosslinked by epichlorohydrin at basic condition to obtain chitosan beads. The effects of reaction conditions, such as crosslinking time, the amount of crosslinking agent and the NaOtt concentration,on the physical properties of the chitosan beads were investigated. The beads were found to have more amino groups in the polymer chains than the beads crosslinked by glutaraldehyde. The capacity for copper ions is as high as 40mg/g. The beads have good mechanical strength and can be reused.

  9. A NOVEL APPROACH TO SYNTHESIZE CHITOSAN BEADS CROSSLINKED BY EPICHLOROHYDRIN

    Institute of Scientific and Technical Information of China (English)

    WANGYongjina; BAIShu; 等

    2001-01-01

    The present investigation describes a novel method for preparing spherical chitosan particles based on crosslinking with epichlorohydrin.Certain amount of pre-crosslinking agent was added to form chitosan gels by traditional inverse phase suspension polymerization.Then the gels were crosslinked by epichlorohydrin at basic condition to obtain chitosan beads.The effects of reaction conditions,such as crosslinking time,the amount of crosslinking agent and the NaOH concentration,on the physical properties of the chitosan beads were investigated.The beads were found to have more amino groups in the polymer chains than the beads crosslinked by glutaraldehyde.The capacity for copper ions in as high as 40mg/g,The beads have good mechanical strength and can be reused.

  10. Bead magnetorelaxometry with an on-chip magnetoresistive sensor

    DEFF Research Database (Denmark)

    Dalslet, Bjarke Thomas; Damsgaard, Christian Danvad; Donolato, Marco

    2011-01-01

    Magnetorelaxometry measurements on suspensions of magnetic beads are demonstrated using a planar Hall effect sensor chip embedded in a microfluidic system. The alternating magnetic field used for magnetizing the beads is provided by the sensor bias current and the complex magnetic susceptibility...... spectra are recorded as the 2nd harmonic of the sensor response. The complex magnetic susceptibility signal appears when a magnetic bead suspension is injected, it scales with the bead concentration, and it follows the Cole-Cole expression for Brownian relaxation. The complex magnetic susceptibility...... signal resembles that from conventional magnetorelaxometry done on the same samples apart from an offset in Brownian relaxation frequency. The time dependence of the signal can be rationalized as originating from sedimented beads....

  11. Graphene Oxide Conjugated Magnetic Beads for RNA Extraction.

    Science.gov (United States)

    Pham, Xuan-Hung; Baek, Ahruem; Kim, Tae Han; Lee, Sang Hun; Rho, Won-Yeop; Chung, Woo-Jae; Kim, Dong-Eun; Jun, Bong-Hyun

    2017-08-04

    A magnetic material that consists of silica-coated magnetic beads conjugated with graphene oxide (GO) was successfully prepared for facile ribonucleic acid (RNA) extraction. When the GO-modified magnetic beads were applied to separate the RNA from the lysed cell, the cellular RNAs were readily adsorbed to and readily desorbed from the surface of the GO-modified magnetic beads by urea. The amount of RNA extracted by the GO-modified magnetic beads was ≈170 % as much as those of the control extracted by a conventional phenol-based chaotropic solution. These results demonstrate that the facile method of RNA separation by using GO-modified magnetic beads as an adsorbent is an efficient and simple way to purify intact cellular RNAs and/or microRNA from cell lysates. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Oxytetracycline removal from water by novel microbial embedding gel beads

    Science.gov (United States)

    Wu, Nan; Pan, Peng; Zeng, Ming; Wang, Wei; Xu, Chenshan; Zhang, Zongpeng; Liu, Xinyuan; Wang, Yichao

    2018-01-01

    As a common antibiotic in aquatic environment, excessive oxytetracycline (OTC) is urgent to be removed due to its great biological toxicity. Compared with the traditional activated sludge, microbial embedding can enhance the treating efficiency. In this study, novel microbial embedding gel beads were produced with the additional agent of cyclodextrin (CD). Results show that CD could increase the mass transfer of OTC into gel beads, possibly because of its strong affinity for organic matters. In terms of OTC biodegradation, gel beads with CD were comparable to gel beads without CD, while the former’s sucrose removal efficiency was higher than the latter. The biodegradation of OTC only occurred in the presence of sucrose. The respiration test also confirmed these findings. Overall, the produced novel gel beads modified with CD could improve the removal performance of OTC.

  13. Design of systems for handling radioactive ion exchange resin beads

    International Nuclear Information System (INIS)

    Shapiro, S.A.; Story, G.L.

    1979-01-01

    The flow of slurries in pipes is a complex phenomenon. There are little slurry data available on which to base the design of systems for radioactive ion exchange resin beads and, as a result, the designs vary markedly in operating plants. With several plants on-line, the opportunity now exists to evaluate the designs of systems handling high activity spent resin beads. Results of testing at Robbins and Meyers Pump Division to quantify the behavior of resin bead slurries are presented. These tests evaluated the following slurry parameters; resin slurry velocity, pressure drop, bead degradation, and slurry concentration effects. A discussion of the general characteristics of resin bead slurries is presented along with a correlation to enable the designer to establish the proper flowrate for a given slurry composition and flow regime as a function of line size. Guidelines to follow in designing a resin handling system are presented

  14. Switchable cell trapping using superparamagnetic beads

    Energy Technology Data Exchange (ETDEWEB)

    Bryan, M. T.; Smith, K. H.; Real, M. E.; Bashir, M. A.; Fry, P. W.; Fischer, P.; Im, M.-Y.; Schrefl, T.; Allwood, D. A.; Haycock, J. W.

    2010-04-30

    Ni{sub 81}Fe{sub 19} microwires are investigated as the basis of a switchable template for positioning magnetically-labeled neural Schwann cells. Magnetic transmission X-ray microscopy and micromagnetic modeling show that magnetic domain walls can be created or removed in zigzagged structures by an applied magnetic field. Schwann cells containing superparamagnetic beads are trapped by the field emanating from the domain walls. The design allows Schwann cells to be organized on a surface to form a connected network and then released from the surface if required. As aligned Schwann cells can guide nerve regeneration, this technique is of value for developing glial-neuronal co-culture models in the future treatment of peripheral nerve injuries.

  15. Metallic gold beads in hyaluronic acid

    DEFF Research Database (Denmark)

    Pedersen, Dan Sonne; Tran, Thao Phuong; Smidt, Kamille

    2013-01-01

    . In conclusion, our findings support that bio-liberation of gold from metallic gold surfaces have anti-inflammatory properties similar to classic gold compounds, warranting further studies into the pharmacological potential of this novel gold-treatment and the possible synergistic effects of hyaluronic acid....... by exploiting macrophage-induced liberation of gold ions (dissolucytosis) from gold surfaces. Injecting gold beads in hyaluronic acid (HA) as a vehicle into the cavities of the brain can delay clinical signs of disease progression in the MS model, experimental autoimmune encephalitis (EAE). This study...... investigates the anti-inflammatory properties of metallic gold/HA on the gene expression of tumor necrosis factor (Tnf-α), Interleukin (Il)-1β, Il-6, Il-10, Colony-stimulating factor (Csf)-v2, Metallothionein (Mt)-1/2, Bcl-2 associated X protein (Bax) and B cell lymphoma (Bcl)-2 in cultured J774 macrophages...

  16. On-chip signal amplification of magnetic bead-based immunoassay by aviating magnetic bead chains.

    Science.gov (United States)

    Jalal, Uddin M; Jin, Gyeong Jun; Eom, Kyu Shik; Kim, Min Ho; Shim, Joon S

    2017-11-06

    In this work, a Lab-on-a-Chip (LOC) platform is used to electromagnetically actuate magnetic bead chains for an enhanced immunoassay. Custom-made electromagnets generate a magnetic field to form, rotate, lift and lower the magnetic bead chains (MBCs). The cost-effective, disposable LOC platform was made with a polymer substrate and an on-chip electrochemical sensor patterned via the screen-printing process. The movement of the MBCs is controlled to improve the electrochemical signal up to 230% when detecting beta-type human chorionic gonadotropin (β-hCG). Thus, the proposed on-chip MBC-based immunoassay is applicable for rapid, qualitative electrochemical point-of-care (POC) analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Inhibitive Effect of antibiotic-loaded beads to cure chronic osteomyelitis in developing country : Hand-made vs commercial beads

    NARCIS (Netherlands)

    Rasyid, Hcrmawan N.; Van Horn, Jim R.; Van der Mei, Henny C.; Soegijoko, Sooegijardjo; Busscher, Henk J.; Neut, Danielle; Ibrahim, F; Osman, NAA; Usman, J; Kadri, NA

    2007-01-01

    Local antibiotic-loaded beads have been approved for standard treatment of orthopaedic pathogens, especially chronic osteomyelitis. Septopal (R), the only commercial local antibiotic bead available on the market, is expensive and contains only gentamicin. This study aimed to compare the in vitro

  18. Energy efficient bead milling of microalgae: Effect of bead size on disintegration and release of proteins and carbohydrates.

    Science.gov (United States)

    Postma, P R; Suarez-Garcia, E; Safi, C; Yonathan, K; Olivieri, G; Barbosa, M J; Wijffels, R H; Eppink, M H M

    2017-01-01

    The disintegration of three industry relevant algae (Chlorella vulgaris, Neochloris oleoabundans and Tetraselmis suecica) was studied in a lab scale bead mill at different bead sizes (0.3-1mm). Cell disintegration, proteins and carbohydrates released into the water phase followed a first order kinetics. The process is selective towards proteins over carbohydrates during early stages of milling. In general, smaller beads led to higher kinetic rates, with a minimum specific energy consumption of ⩽0.47kWhkg DW -1 for 0.3mm beads. After analysis of the stress parameters (stress number and stress intensity), it appears that optimal disintegration and energy usage for all strains occurs in the 0.3-0.4mm range. During the course of bead milling, the native structure of the marker protein Rubisco was retained, confirming the mildness of the disruption process. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  20. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  1. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  2. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  4. DWPF GLASS BEADS AND GLASS FRIT TRANSPORT DEMONSTRATION

    Energy Technology Data Exchange (ETDEWEB)

    Adamson, D; Bradley Pickenheim, B

    2008-11-24

    DWPF is considering replacing irregularly shaped glass frit with spherical glass beads in the Slurry Mix Evaporator (SME) process to decrease the yield stress of the melter feed (a non-Newtonian Bingham Plastic). Pilot-scale testing was conducted on spherical glass beads and glass frit to determine how well the glass beads would transfer when compared to the glass frit. Process Engineering Development designed and constructed the test apparatus to aid in the understanding and impacts that spherical glass beads may have on the existing DWPF Frit Transfer System. Testing was conducted to determine if the lines would plug with the glass beads and the glass frit slurry and what is required to unplug the lines. The flow loop consisted of vertical and horizontal runs of clear PVC piping, similar in geometry to the existing system. Two different batches of glass slurry were tested: a batch of 50 wt% spherical glass beads and a batch of 50 wt% glass frit in process water. No chemicals such as formic acid was used in slurry, only water and glass formers. The glass beads used for this testing were commercially available borosilicate glass of mesh size -100+200. The glass frit was Frit 418 obtained from DWPF and is nominally -45+200 mesh. The spherical glass beads did not have a negative impact on the frit transfer system. The transferring of the spherical glass beads was much easier than the glass frit. It was difficult to create a plug with glass bead slurry in the pilot transfer system. When a small plug occurred from setting overnight with the spherical glass beads, the plug was easy to displace using only the pump. In the case of creating a man made plug in a vertical line, by filling the line with spherical glass beads and allowing the slurry to settle for days, the plug was easy to remove by using flush water. The glass frit proved to be much more difficult to transfer when compared to the spherical glass beads. The glass frit impacted the transfer system to the point

  5. DWPF GLASS BEADS AND GLASS FRIT TRANSPORT DEMONSTRATION

    International Nuclear Information System (INIS)

    Adamson, D.; Pickenheim, Bradley

    2008-01-01

    DWPF is considering replacing irregularly shaped glass frit with spherical glass beads in the Slurry Mix Evaporator (SME) process to decrease the yield stress of the melter feed (a non-Newtonian Bingham Plastic). Pilot-scale testing was conducted on spherical glass beads and glass frit to determine how well the glass beads would transfer when compared to the glass frit. Process Engineering Development designed and constructed the test apparatus to aid in the understanding and impacts that spherical glass beads may have on the existing DWPF Frit Transfer System. Testing was conducted to determine if the lines would plug with the glass beads and the glass frit slurry and what is required to unplug the lines. The flow loop consisted of vertical and horizontal runs of clear PVC piping, similar in geometry to the existing system. Two different batches of glass slurry were tested: a batch of 50 wt% spherical glass beads and a batch of 50 wt% glass frit in process water. No chemicals such as formic acid was used in slurry, only water and glass formers. The glass beads used for this testing were commercially available borosilicate glass of mesh size -100+200. The glass frit was Frit 418 obtained from DWPF and is nominally -45+200 mesh. The spherical glass beads did not have a negative impact on the frit transfer system. The transferring of the spherical glass beads was much easier than the glass frit. It was difficult to create a plug with glass bead slurry in the pilot transfer system. When a small plug occurred from setting overnight with the spherical glass beads, the plug was easy to displace using only the pump. In the case of creating a man made plug in a vertical line, by filling the line with spherical glass beads and allowing the slurry to settle for days, the plug was easy to remove by using flush water. The glass frit proved to be much more difficult to transfer when compared to the spherical glass beads. The glass frit impacted the transfer system to the point

  6. Lung Emergencies

    Science.gov (United States)

    ... The Marfan Foundation Marfan & Related Disorders What is Marfan Syndrome? What are Related Disorders? What are the Signs? ... Emergencies Lung Emergencies Surgeries Lung Emergencies People with Marfan syndrome can be at increased risk of sudden lung ...

  7. Calcium Pectinate Beads Formation: Shape and Size Analysis

    Directory of Open Access Journals (Sweden)

    Boon-Beng Lee

    2014-04-01

    Full Text Available The aim of this study was to investigate the inter-relationship between process variables and the size and shape of pectin solution droplets upon detachment from a dripping tip as well as Ca-pectinate beads formed after gelation via image analysis. The sphericity factor (SF of the droplets was generally smaller than 0.05. There was no specific trend between the SF of the droplets and the pectin concentration or the dripping tip radius. The SF the beads formed from high-concentration pectin solutions and a small dripping tip was smaller than 0.05. The results show that the Reynolds number and Ohnesorge number of the droplets fall within the operating region for forming spherical beads in the shape diagram, with the exception to the lower boundary. The lower boundary of the operating region has to be revised to Oh = 2.3. This is because the critical viscosity for Ca-pectinate bead formation is higher than that of Ca-alginate beads. On the other hand, the radius of the droplets and beads increased as the dripping tip radius increased. The bead radius can easily be predicted by Tate’s law equation.

  8. Self-organizing magnetic beads for biomedical applications

    International Nuclear Information System (INIS)

    Gusenbauer, Markus; Kovacs, Alexander; Reichel, Franz; Exl, Lukas; Bance, Simon; Özelt, Harald; Schrefl, Thomas

    2012-01-01

    In the field of biomedicine magnetic beads are used for drug delivery and to treat hyperthermia. Here we propose to use self-organized bead structures to isolate circulating tumor cells using lab-on-chip technologies. Typically blood flows past microposts functionalized with antibodies for circulating tumor cells. Creating these microposts with interacting magnetic beads makes it possible to tune the geometry in size, position and shape. We developed a simulation tool that combines micromagnetics and discrete particle dynamics, in order to design micropost arrays made of interacting beads. The simulation takes into account the viscous drag of the blood flow, magnetostatic interactions between the magnetic beads and gradient forces from external aligned magnets. We developed a particle–particle particle–mesh method for effective computation of the magnetic force and torque acting on the particles. - Highlights: ► We propose to use self-organized bead structures to isolate circulating tumor cells. ► Flexible ways are important to get a high probability of catching cancer cells. ► The beads make it possible to tune the geometry in size position and shape.

  9. Ecohydraulics of Strings and Beads in Bedrock Rivers

    Science.gov (United States)

    Wohl, E.

    2016-12-01

    Twenty years ago, Jack Stanford and others described rivers in bedrock canyons as resembling beads on a string when viewed in planform. The beads are relatively wide, low gradient river segments with floodplains, whereas the strings are the intervening steep, narrow river segments with minimal floodplain development. This pattern of longitudinal variations in channel and valley morphology along bedrock canyon rivers is very common, from small channels to major rivers such as the Colorado. Basic understanding of river ecosystems, as well as limited studies, indicates that the beads are more retentive and biologically productive. Although both strings and beads can provide habitat for diverse organisms, strings are more likely to serve as migration corridors, whereas beads provide spawning and nursery habitat, facilitate lateral (channel-floodplain) and vertical (channel-hyporheic) exchanges and associated habitat diversity, and retain dissolved and particulate organic matter. Recognition of the different characteristics and functions of strings and beads can be used to identify their spatial distribution along a river or within a river network and the hydraulically driven processes that sustain channel form, water quality, and biota within strings and beads. Diverse modeling approaches can then be used to quantify the fluxes of water and sediment needed to maintain these hydraulically driven processes. This conceptual framework is illustrated using examples from mountain streams in the Southern Rockies and canyon rivers in the southwestern United States.

  10. Nutrition for Lung Cancer

    Science.gov (United States)

    ... Become An Advocate Volunteer Ways To Give Lung Cancer www.lung.org > Lung Health and Diseases > Lung Disease Lookup > ... Cancer Learn About Lung Cancer What Is Lung Cancer Lung Cancer Basics Causes & Risk Factors Lung Cancer Staging ...

  11. Simulation of non-linear coaxial line using ferrite beads

    International Nuclear Information System (INIS)

    Furuya, S.; Matsumoto, H.; Tachi, K.; Takano, S.; Irisawa, J.

    2002-01-01

    A ferrite sharpener is a non-linear coaxial line using ferrite beads, which produces high-voltage, high-dV/dt pulses. We have been examining the characteristics of ferrite sharpeners experimentally, varying various parameters. Also we have made the simulation of the ferrite sharpener and compared the predictions with the experimental results in detail to analyze the characteristics of the sharpener. In this report, calculating the magnetization M of the ferrite bead, we divide the bead into n sections radially instead of adopting M at the average radius in the previous report. (author)

  12. Random glycopeptide bead libraries for seromic biomarker discovery

    DEFF Research Database (Denmark)

    Kracun, Stjepan Kresimir; Cló, Emiliano; Clausen, Henrik

    2010-01-01

    have developed a random glycopeptide bead library screening platform for detection of autoantibodies and other binding proteins. Libraries were build on biocompatible PEGA beads including a safety-catch C-terminal amide linker (SCAL) that allowed mild cleavage conditions (I(2)/NaBH(4) and TFA...... to other tumor glycoforms by on-bead enzymatic glycosylation reactions with recombinant glycosyltransferases. Hence, we have developed a high-throughput flexible platform for rapid discovery of O-glycopeptide biomarkers and the method has applicability in other types of assays such as lectin...

  13. A High-Throughput SU-8Microfluidic Magnetic Bead Separator

    DEFF Research Database (Denmark)

    Bu, Minqiang; Christensen, T. B.; Smistrup, Kristian

    2007-01-01

    We present a novel microfluidic magnetic bead separator based on SU-8 fabrication technique for high through-put applications. The experimental results show that magnetic beads can be captured at an efficiency of 91 % and 54 % at flow rates of 1 mL/min and 4 mL/min, respectively. Integration...... of soft magnetic elements in the chip leads to a slightly higher capturing efficiency and a more uniform distribution of captured beads over the separation chamber than the system without soft magnetic elements....

  14. A two-channel detection method for autofluorescence correction and efficient on-bead screening of one-bead one-compound combinatorial libraries using the COPAS fluorescence activated bead sorting system

    International Nuclear Information System (INIS)

    Hintersteiner, Martin; Auer, Manfred

    2013-01-01

    One-bead one-compound combinatorial library beads exhibit varying levels of autofluorescence after solid phase combinatorial synthesis. Very often this causes significant problems for automated on-bead screening using TentaGel beads and fluorescently labeled target proteins. Herein, we present a method to overcome this limitation when fluorescence activated bead sorting is used as the screening method. We have equipped the COPAS bead sorting instrument with a high-speed profiling unit and developed a spectral autofluorescence correction method. The correction method is based on a simple algebraic operation using the fluorescence data from two detection channels and is applied on-the-fly in order to reliably identify hit beads by COPAS bead sorting. Our method provides a practical tool for the fast and efficient isolation of hit beads from one-bead one-compound library screens using either fluorescently labeled target proteins or biotinylated target proteins. This method makes hit bead identification easier and more reliable. It reduces false positives and eliminates the need for time-consuming pre-sorting of library beads in order to remove autofluorescent beads. (technical note)

  15. K Basin sludge/resin bead separation test report

    International Nuclear Information System (INIS)

    Squier, D.M.

    1998-01-01

    The K Basin sludge is an accumulation of fuel element corrosion products, organic and inorganic ion exchange materials, canister gasket materials, iron and aluminum corrosion products, sand, dirt and minor amounts of other organic material. The sludge will be collected and treated for storage and eventual disposal. This process will remove the large solid materials by a 1/4 inch screen. The screened material will be subjected to nitric acid in a chemical treatment process. The organic ion exchange resin beads produce undesirable chemical reactions with the nitric acid. The resin beads must be removed from the bulk material and treated by another process. An effective bead separation method must extract 95% of the resin bead mass without entraining more than 5% of the other sludge component mass. The test plan I-INF-2729, ''Organic Ion Exchange Resin Separation Methods Evaluation,'' proposed the evaluation of air lift, hydro cyclone, agitated slurry and elutriation resin bead separation methods. This follows the testing strategy outlined in section 4.1 of BNF-2574, ''Testing Strategy to Support the Development of K Basins Sludge Treatment Process''. Engineering study BNF-3128, ''Separation of Organic Ion Exchange Resins from Sludge,'' Rev. 0, focused the evaluation tests on a method that removed the fine sludge particles by a sieve and then extracted the beads by means of a elutriation column. Ninety-nine percent of the resin beads are larger than 125 microns and 98.5 percent are 300 microns and larger. Particles smaller than 125 microns make up the largest portion of sludge in the K Basins. Eliminating a large part of the sludge's non-bead component will reduce the quantity that is lifted with the resin beads in the elutriation column. Resin bead particle size distribution measurements are given in Appendix A The Engineering Testing Laboratory conducted measurements of a elutriation column's ability to extract resin beads from a sieved, non-radioactive sludge

  16. Chronic Pseudomonas aeruginosa lung infection in normal and athymic rats

    DEFF Research Database (Denmark)

    Johansen, H K; Espersen, F; Pedersen, S S

    1993-01-01

    We have compared a chronic lung infection with Pseudomonas aeruginosa embedded in alginate beads in normal and athymic rats with an acute infection with free live P. aeruginosa bacteria. The following parameters were observed and described: mortality, macroscopic and microscopic pathologic changes...

  17. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  18. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  19. Efficient functionalization of poly(styrene) beads immobilized metal ...

    Indian Academy of Sciences (India)

    Three types of new bead-shaped heterogeneous nanoparticle (NP) catalysts were synthesized by sim- plified procedures .... and Ag+-doped titanium. Therefore, removal ..... References. 1. Storhoff J J, Elghanian R, Mucic R C, Mirkin C A and.

  20. An approach to implement virtual channels for flowing magnetic beads

    International Nuclear Information System (INIS)

    Tang, Shih-Hao; Chiang, Hung-Wei; Hsieh, Min-Chien; Chang, Yen-Di; Yeh, Po-Fan; Tsai, Jui-che; Shieh, Wung-Yang

    2014-01-01

    This work demonstrates the feasibility of a novel microfluidic system with virtual channels formed by ‘walls’ of magnetic fields, including collecting channels, transporting channels and function channels. The channels are defined by the nickel patterns. With its own ferromagnetism, nickel can be magnetized using an external magnetic field; the nickel structures then generate magnetic fields that can either guide or trap magnetic beads. A glass substrate is sandwiched between the liquid containing magnetic beads and the chip with nickel structures, preventing the liquid from directly contacting the nickel. In this work, collecting channels, transporting channels and function channels are displayed sequentially. In the collecting channel portion, channels with different shapes are compared. Next, in the transporting channel portion we demonstrate I-, S- and Y-shaped channels can steer magnetic beads smoothly. Finally, in the function channel portion, a switchable trapping channel implemented with a bistable mechanism performs the passing and blocking of a magnetic bead. (paper)

  1. Standard specification for beaded process glass pipe and fittings

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This specification covers chemically resistant, low expansion Type-I borosilicate glass, Class A, (see Specification E 438) used to manufacture beaded end flanged-glass pipe and fittings for pressure and vacuum applications.

  2. An integrated open-cavity system for magnetic bead manipulation.

    Science.gov (United States)

    Abu-Nimeh, F T; Salem, F M

    2013-02-01

    Superparamagnetic beads are increasingly used in biomedical assays to manipulate, transport, and maneuver biomaterials. We present a low-cost integrated system designed in bulk CMOS to manipulate and separate biomedical magnetic beads. The system consists of 8 × 8 coil-arrays suitable for single bead manipulation, or collaborative multi-bead manipulation, using pseudo-parallel executions. We demonstrate the flexibility of the design in terms of different coil sizes, DC current levels, and layout techniques. In one array module example, the size of a single coil is 30 μm × 30 μm and the full array occupies an area of 248 μm × 248 μm in 0.5 μm CMOS technology. The programmable DC current source supports 8 discrete levels up to 1.5 mA. The total power consumption of the entire module is 9 mW when running at full power.

  3. Influence of recycled polystyrene beads on cement paste properties

    Directory of Open Access Journals (Sweden)

    Maaroufi Maroua

    2018-01-01

    Full Text Available In order to keep up with the requirements of sustainable development, there is a growing interest towards reducing the energy consumption in the construction and rehabilitation of buildings and the promotion of recycling waste in building materials. The use of recycled polystyrene beads in cement-based materials composition constitutes a solution to improve the insulation in buildings. This allows also limiting landfill by reusing the polystyrene waste. The aim of this study is to compare some properties and performances of a cement paste containing polystyrene beads to a reference paste designed with only the same cement. An experimental campaign was conducted and the obtained results showed that adding recycled polystyrene beads to a cement paste improves its hygro-thermal properties. Further studies are however necessary to better understand the real role of the polystyrene beads in the heat and mass transfers.

  4. Selective manipulation of superparamagnetic beads by a magnetic microchip

    KAUST Repository

    Gooneratne, Chinthaka Pasan; Yassine, Omar; Giouroudi, Ioanna; Kosel, Jü rgen

    2013-01-01

    In this paper, a magnetic microchip (MMC) is presented, to first trap and then selectively manipulate individual, superparamagnetic beads (SPBs) to another trapping site. Trapping sites are realized through soft magnetic micro disks made of Ni80Fe20

  5. TiO₂ beads and TiO₂-chitosan beads for urease immobilization.

    Science.gov (United States)

    Ispirli Doğaç, Yasemin; Deveci, Ilyas; Teke, Mustafa; Mercimek, Bedrettin

    2014-09-01

    The aim of the present study is to synthesize TiO2 beads for urease immobilization. Two different strategies were used to immobilize the urease on TiO2 beads. In the first method (A), urease enzyme was immobilized onto TiO2 beads by adsorption and then crosslinking. In the second method (B), TiO2 beads were coated with chitosan-urease mixture. To determine optimum conditions of immobilization, different parameters were investigated. The parameters of optimization were initial enzyme concentration (0.5; 1; 1.5; 2mg/ml), alginate concentration (1; 2; 3%), glutaraldehyde concentration (1; 2; 3% v/v) and chitosan concentration (2; 3; 4 mg/ml). The optimum enzyme concentrations were determined as 1.5mg/ml for A and 1.0mg/ml for B. The other optimum conditions were found 2.0% (w/v) for alginate concentration (both A and B); 3.0mg/ml for chitosan concentration (B) and 2.0% (v/v) for glutaraldehyde concentration (A). The optimum temperature (20-60°C), optimum pH (3.0-10.0), kinetic parameters, thermal stability (4-70°C), pH stability (4.0-9.0), operational stability (0-230 min) and reusability (20 times) were investigated for characterization. The optimum temperatures were 30°C (A), 40°C (B) and 35°C (soluble). The temperature profiles of the immobilized ureases were spread over a large area. The optimum pH values for the soluble urease and immobilized urease prepared by using methods (A) and (B) were found to be 7.5, 7.0, 7.0, respectively. The thermal stabilities of immobilized enzyme sets were studied and they maintained 50% activity at 65°C. However, at this temperature free urease protected only 15% activity. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  7. Sensitive detection of nucleic acids by PNA hybridization directed co-localization of fluorescent beads

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Deborggraeve, Stijn; Büscher, Philippe

    2011-01-01

    )avidin-coated fluorescent beads, differing in size and color [green beads (1 µm) and red beads (5.9 µm)], thereby allowing distinct detection of each PNA probe by conventional fluorescence microscopy. These two PNA beads showed easily detectable co-localization when simultaneously hybridizing to a target nucleic acid...

  8. Ferrite bead effect on Class-D amplifier audio quality

    OpenAIRE

    Haddad , Kevin El; Mrad , Roberto; Morel , Florent; Pillonnet , Gael; Vollaire , Christian; Nagari , Angelo

    2014-01-01

    International audience; This paper studies the effect of ferrite beads on the audio quality of Class-D audio amplifiers. This latter is a switch-ing circuit which creates high frequency harmonics. Generally, a filter is used at the amplifier output for the sake of electro-magnetic compatibility (EMC). So often, in integrated solutions, this filter contains ferrite beads which are magnetic components and present nonlinear behavior. Time domain measurements and their equivalence in frequency do...

  9. Plasma membrane isolation using immobilized concanavalin A magnetic beads.

    Science.gov (United States)

    Lee, Yu-Chen; Srajer Gajdosik, Martina; Josic, Djuro; Lin, Sue-Hwa

    2012-01-01

    Isolation of highly purified plasma membranes is the key step in constructing the plasma membrane proteome. Traditional plasma membrane isolation method takes advantage of the differential density of organelles. While differential centrifugation methods are sufficient to enrich for plasma membranes, the procedure is lengthy and results in low recovery of the membrane fraction. Importantly, there is significant contamination of the plasma membranes with other organelles. The traditional agarose affinity matrix is suitable for isolating proteins but has limitation in separating organelles due to the density of agarose. Immobilization of affinity ligands to magnetic beads allows separation of affinity matrix from organelles through magnets and could be developed for the isolation of organelles. We have developed a simple method for isolating plasma membranes using lectin concanavalin A (ConA) magnetic beads. ConA is immobilized onto magnetic beads by binding biotinylated ConA to streptavidin magnetic beads. The ConA magnetic beads are used to bind glycosylated proteins present in the membranes. The bound membranes are solubilized from the magnetic beads with a detergent containing the competing sugar alpha methyl mannoside. In this study, we describe the procedure of isolating rat liver plasma membranes using sucrose density gradient centrifugation as described by Neville. We then further purify the membrane fraction by using ConA magnetic beads. After this purification step, main liver plasma membrane proteins, especially the highly glycosylated ones and proteins containing transmembrane domains could be identified by LC-ESI-MS/MS. While not described here, the magnetic bead method can also be used to isolate plasma membranes from cell lysates. This membrane purification method should expedite the cataloging of plasma membrane proteome.

  10. Preparation of Bio-beads and Their Atrazine Degradation Characteristics

    Institute of Scientific and Technical Information of China (English)

    BI Hai-tao; ZHANG Lan-ying; LIU Na; ZHU Bo-lin

    2011-01-01

    Screened atrazine-mineralizing bacterium-Pseudomonas W4 was embedded inside an improved PVAH3BO3 embedment matrix to make bio-beads to degrade atrazine. The atrazine degradation characteristics were studied. The preparation procedure of bio-beads was as follows: (1) preparing a mixture of 100, 12.5, 10, 1.5 and 1 g/L PVA, bentonite(Ca), activated carbon powder, sodium alginate and centrifuged Pseudomonas W4 bacterium, respectively; (2) the mixture was dropped into a gently stirred cross linker solution(pH=6.7) and cured at 10 ℃ for 24 h.The optimal atrazine degradation conditions by bio-beads were as follows: pH=7, the auxiliary carbon source was glucose, and the concentration of glucose was greater than 325 mg/L. The bio-beads demonstrated stronger tolerance ability than the free microorganism to the increase of PCBs, hydrogen ion and hydroxide ion. SEM images show the uniform distribution of the microorganism inside bio-beads and the porous cross-linked structure of bio-beads which provides excellent mass transfer capacity.

  11. Hydrodynamic Torques and Rotations of Superparamagnetic Bead Dimers

    Science.gov (United States)

    Pease, Christopher; Etheridge, J.; Wijesinghe, H. S.; Pierce, C. J.; Prikockis, M. V.; Sooryakumar, R.

    Chains of micro-magnetic particles are often rotated with external magnetic fields for many lab-on-a-chip technologies such as transporting beads or mixing fluids. These applications benefit from faster responses of the actuated particles. In a rotating magnetic field, the magnetization of superparamagnetic beads, created from embedded magnetic nano-particles within a polymer matrix, is largely characterized by induced dipoles mip along the direction of the field. In addition there is often a weak dipole mop that orients out-of-phase with the external rotating field. On a two-bead dimer, the simplest chain of beads, mop contributes a torque Γm in addition to the torque from mip. For dimers with beads unbound to each other, mop rotates individual beads which generate an additional hydrodynamic torque on the dimer. Whereas, mop directly torques bound dimers. Our results show that Γm significantly alters the average frequency-dependent dimer rotation rate for both bound and unbound monomers and, when mop exceeds a critical value, increases the maximum dimer rotation frequency. Models that include magnetic and hydrodynamics torques provide good agreement with the experimental findings over a range of field frequencies.

  12. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  13. Effects of agitation rate on aggregation during beads-to-beads subcultivation of microcarrier culture of human mesenchymal stem cells.

    Science.gov (United States)

    Takahashi, Iori; Sato, Keigo; Mera, Hisashi; Wakitani, Shigeyuki; Takagi, Mutsumi

    2017-06-01

    With the aim to utilize human mesenchymal stem cells (hMSCs) grown in large scale for regenerative medicine, effects of agitation rate on aggregation during beads-to-beads subcultivation of microcarrier culture of hMSCs were studied. hMSCs could attach and grew on surface-type microcarriers of Cytodex 1, whereas almost no cell elongation and growth were observed on porous type microcarriers of Cytopores. The percentages of aggregated Cytodex 1 microcarriers at an agitation rate of 60 and 90 rpm were lower than that at 30 rpm, which was the lowest agitation rate necessary for the suspension of Cytodex 1 microcarriers, and the cells grew fastest at 60 rpm. hMSC could be subcultivated on Cytodex 1 by the beads-to-beads method at both 30 and 60 rpm without trypsinization. However, agitation at 60 rpm resulted in a markedly lower percentage of aggregated microcarriers not only before but also after subcultivation. The percentages of CD90- and CD166-positive cells among cells grown on Cytodex 1 at 60 rpm (91.5 and 87.6 %) were comparable to those of cells grown in the pre-culture on dishes. In conclusion, hMSCs could be subcultivated on Cytodex 1 by beads-to-beads method maintaining the expressions of the cell surface antigens CD90 and CD166, while adjusting agitation rate could decrease the microcarrier aggregation.

  14. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  15. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  16. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  17. Use of antibiotic beads to salvage infected breast implants.

    Science.gov (United States)

    Sherif, Rami D; Ingargiola, Michael; Sanati-Mehrizy, Paymon; Torina, Philip J; Harmaty, Marco A

    2017-10-01

    When an implant becomes infected, implant salvage is often performed where the implant is removed, capsulectomy is performed, and a new implant is inserted. The patient is discharged with a PICC line and 6-8 weeks of intravenous (IV) antibiotics. This method has variable success and subjects the patient to long-term systemic antibiotics. In the 1960s, the use of antibiotic-impregnated beads for the treatment of chronic osteomyelitis was described. These beads deliver antibiotic directly to the site of the infection, thereby eliminating the complications of systemic IV antibiotics. This study aimed to present a case series illustrating the use of STIMULAN calcium sulfate beads loaded with vancomycin and tobramycin to increase the rate of salvage of the infected implant and forgo IV antibiotics. A retrospective analysis was performed of patients who were treated at Mount Sinai Hospital for implant infection with salvage and antibiotic beads. Twelve patients were identified, 10 of whom had breast cancer. Comorbidities included hypertension, smoking, and immunocompromised status. Infections were noted anywhere from 5 days to 8 years postoperatively. Salvage was successful in 9 out of the 12 infected implants using antibiotic bead therapy without home IV antibiotics. The use of antibiotic beads is promising for salvaging infected breast implants without IV antibiotics. Seventy-five percent of the implants were successfully salvaged. Of the three patients who had unsalvageable implants, one was infected with antibiotic-resistant Rhodococcus that was refractory to bead therapy and one was noncompliant with postoperative instructions. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  18. Two Contrasting Failure Modes of Enteric Coated Beads.

    Science.gov (United States)

    Shi, Galen H; Dong, Xia; Lytle, Michelle; Kemp, Craig A J; Behme, Robert J; Hinds, Jeremy; Xiao, Zhicheng

    2018-04-09

    This study aimed to elucidate the mechanisms and kinetics of coating failure for enteric coated beads exposed to high-humidity conditions at different storage temperatures. Enteric coated beads were placed on high-humidity conditions (75 to 98% relative humidity (RH)) in the temperature range of 5 to 40°C. These stability samples of beads were tested for acid dissolution and water activity and also analyzed with SEM, X-ray CT, and DMA. Exposure of enteric coated beads to high humidity led to increased gastric release of drug which eventually failed the dissolution specification. SEM showed visible cracks on the surface of beads exposed to 5°C/high humidity and fusion of enteric beads into agglomerates at 40°C/high humidity. In a non-destructive time elapse study, X-ray CT demonstrated swelling of microcrystalline cellulose cores, crack initiation, and propagation through the API layer within days under 5°C/98% RH storage conditions and ultimately fracture through the enteric coating. DMA data showed a marked reduction in T g of the enteric coating materials after exposure to humidity. At 5°C/high humidity, the hygroscopic microcrystalline cellulose core absorbed moisture leading to core swelling and consequent fracture through the brittle API and enteric layers. At 40°C (high humidity) which is above the T g of the enteric polymer, enteric coated beads coalesced into agglomerates due to melt flow of the enteric coating. We believe it is the first report on two distinct failure models of enteric coated dosage forms.

  19. A new index for characterizing micro-bead motion in a flow induced by ciliary beating: Part II, modeling.

    Directory of Open Access Journals (Sweden)

    Mathieu Bottier

    2017-07-01

    Full Text Available Mucociliary clearance is one of the major lines of defense of the human respiratory system. The mucus layer coating the airways is constantly moved along and out of the lung by the activity of motile cilia, expelling at the same time particles trapped in it. The efficiency of the cilia motion can experimentally be assessed by measuring the velocity of micro-beads traveling through the fluid surrounding the cilia. Here we present a mathematical model of the fluid flow and of the micro-beads motion. The coordinated movement of the ciliated edge is represented as a continuous envelope imposing a periodic moving velocity boundary condition on the surrounding fluid. Vanishing velocity and vanishing shear stress boundary conditions are applied to the fluid at a finite distance above the ciliated edge. The flow field is expanded in powers of the amplitude of the individual cilium movement. It is found that the continuous component of the horizontal velocity at the ciliated edge generates a 2D fluid velocity field with a parabolic profile in the vertical direction, in agreement with the experimental measurements. Conversely, we show than this model can be used to extract microscopic properties of the cilia motion by extrapolating the micro-bead velocity measurement at the ciliated edge. Finally, we derive from these measurements a scalar index providing a direct assessment of the cilia beating efficiency. This index can easily be measured in patients without any modification of the current clinical procedures.

  20. Confocal nanoscanning, bead picking (CONA): PickoScreen microscopes for automated and quantitative screening of one-bead one-compound libraries.

    Science.gov (United States)

    Hintersteiner, Martin; Buehler, Christof; Uhl, Volker; Schmied, Mario; Müller, Jürgen; Kottig, Karsten; Auer, Manfred

    2009-01-01

    Solid phase combinatorial chemistry provides fast and cost-effective access to large bead based libraries with compound numbers easily exceeding tens of thousands of compounds. Incubating one-bead one-compound library beads with fluorescently labeled target proteins and identifying and isolating the beads which contain a bound target protein, potentially represents one of the most powerful generic primary high throughput screening formats. On-bead screening (OBS) based on this detection principle can be carried out with limited automation. Often hit bead detection, i.e. recognizing beads with a fluorescently labeled protein bound to the compound on the bead, relies on eye-inspection under a wide-field microscope. Using low resolution detection techniques, the identification of hit beads and their ranking is limited by a low fluorescence signal intensity and varying levels of the library beads' autofluorescence. To exploit the full potential of an OBS process, reliable methods for both automated quantitative detection of hit beads and their subsequent isolation are needed. In a joint collaborative effort with Evotec Technologies (now Perkin-Elmer Cellular Technologies Germany GmbH), we have built two confocal bead scanner and picker platforms PS02 and a high-speed variant PS04 dedicated to automated high resolution OBS. The PS0X instruments combine fully automated confocal large area scanning of a bead monolayer at the bottom of standard MTP plates with semiautomated isolation of individual hit beads via hydraulic-driven picker capillaries. The quantification of fluorescence intensities with high spatial resolution in the equatorial plane of each bead allows for a reliable discrimination between entirely bright autofluorescent beads and real hit beads which exhibit an increased fluorescence signal at the outer few micrometers of the bead. The achieved screening speed of up to 200,000 bead assayed in less than 7 h and the picking time of approximately 1 bead

  1. Processes Leading to Beaded Channels Formation in Central Yakutia

    Science.gov (United States)

    Tarbeeva, A. M.; Lebedeva, L.; Efremov, V. S.; Krylenko, I. V.; Surkov, V. V.

    2017-12-01

    Beaded channels, consisting of deepened and widened pools and connecting narrow runs, are common fluvial forms in permafrost regions. Recent studies have shown that beaded channels are very important for connecting alluvial rivers with headwater lakes allowing fish passage and foraging habitats, as well as regulating river runoff. Beaded channels are known as typical thermokarst landforms; however, there is no evidence of their origin and formative processes. Geomorphological analyzes of beaded channels have been completed in several permafrost regions including field observations of Shestakovka River in Central Yakutia. The study aims to recognize the modern exogenic processes and formative mechanisms of beaded river channels. We show that beaded channel of Shestakovka River form in the perennially frozen sand with low ice content, leading us to hypothesize that thermokarst is not the main process of formation. Due to the significant volume of water, the pools don't freeze over entirely during winters, even under harsh climatic conditions. As a result, lenses of pressurized water remain under surface ice underlain by perennially thawed sediments. The presence of thawed sediments under the pools and frozen sediments under the runs leads to uneven thermoerosion of the riverbed during floods, providing the beaded form of the channel. In addition, freezing of pools during winter leads to pressure increasing under ice cover and formation of ice mounds, which crack several times during winter leading to disturbance of riverbanks. Many 1st to 3rd order streams have a specific transitional meandering-to-beaded form resembling the shape of unconfined meandering rivers, but consisting of pools and runs. However, such channels exhibit no evidences of present-day erosion of concave banks and sediment accumulation at the convex banks as typically being observed in normally meandering rivers. Such forms of channels indicates that their formation occurred by the greater channel

  2. Transarterial chemoembolization with drug-eluting beads in hepatocellular carcinoma

    Science.gov (United States)

    Nam, Hee Chul; Jang, Bohyun; Song, Myeong Jun

    2016-01-01

    Transarterial chemoembolization (TACE) is a widely used standard treatment for patients with hepatocellular carcinoma (HCC) who are not suitable candidates for curative treatments. The rationale for TACE is that intra-arterial chemotherapy using lipiodol and chemotherapeutic agents, followed by selective vascular embolization, results in a strong cytotoxic effect as well as ischemia (conventional TACE). Recently, drug-eluting beads (DC Beads®) have been developed for transcatheter treatment of HCC to deliver higher doses of the chemotherapeutic agent and to prolong contact time with the tumor. DC Beads® can actively sequester doxorubicin hydrochloride from solution and release it in a controlled sustained fashion. Treatment with DC Beads® substantially reduced the amount of chemotherapeutic agent that reached the systemic circulation compared with conventional, lipiodol-based regimens, significantly reducing drug-related adverse events. In this article, we describe the treatment response, survival, and safety of TACE used with drug-eluting beads for the treatment of HCC and discuss future therapeutic possibilities. PMID:27833376

  3. Surface imprinted beads for the recognition of human serum albumin.

    Science.gov (United States)

    Bonini, Francesca; Piletsky, Sergey; Turner, Anthony P F; Speghini, Adolfo; Bossi, Alessandra

    2007-04-15

    The synthesis of poly-aminophenylboronic acid (ABPA) imprinted beads for the recognition of the protein human serum albumin (HSA) is reported. In order to create homogeneous recognition sites, covalent immobilisation of the template HSA was exploited. The resulting imprinted beads were selective for HSA. The indirect imprinting factor (IF) calculated from supernatant was 1.6 and the direct IF, evaluated from the protein recovered from the beads, was 1.9. The binding capacity was 1.4 mg/g, which is comparable to commercially available affinity materials. The specificity of the HSA recognition was evaluated with competitive experiments, indicating a molar ratio 4.5/1 of competitor was necessary to displace half of the bound HSA. The recognition and binding of the imprinted beads was also tested with a complex sample, human serum and targeted removal of HSA without a loss of the other protein components was demonstrated. The easy preparation protocol of derivatised beads and a good protein recognition properties make the approach an attractive solution to analytical and bio-analytical problems in the field of biotechnology.

  4. Removal of Uranium from Aqueous Solution by Alginate Beads

    Directory of Open Access Journals (Sweden)

    Jing Yu

    2017-04-01

    Full Text Available The adsorption of uranium (VI by calcium alginate beads was examined by batch experiments. The effects of environmental conditions on U (VI adsorption were studied, including contact time, pH, initial concentration of U (VI, and temperature. The alginate beads were characterized by using scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, and Fourier transform infrared spectroscopy. Fourier transform infrared spectra indicated that hydroxyl and alkoxy groups are present at the surface of the beads. The experimental results showed that the adsorption of U (VI by alginate beads was strongly dependent on pH, the adsorption increased at pH 3∼7, then decreased at pH 7∼9. The adsorption reached equilibrium within 2 minutes. The adsorption kinetics of U (VI onto alginate beads can be described by a pseudo first-order kinetic model. The adsorption isotherm can be described by the Redlich-Peterson model, and the maximum adsorption capacity was 237.15 mg/g. The sorption process is spontaneous and has an exothermic reaction.

  5. Removal of uranium from aqueous solution by aliginate beads

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Jing; Wang, Jian Long [Collaborative Innovation Center for Advanced Nuclear Energy Technology, INET, Tsinghua University, Beijing (China); Jiang, Yizhou [Northwest Institute of Nuclear Technology, Xian (China)

    2017-04-15

    The adsorption of uranium (VI) by calcium alginate beads was examined by batch experiments. The effects of environmental conditions on U (VI) adsorption were studied, including contact time, pH, initial concentration of U (VI), and temperature. The alginate beads were characterized by using scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, and Fourier transform infrared spectroscopy. Fourier transform infrared spectra indicated that hydroxyl and alkoxy groups are present at the surface of the beads. The experimental results showed that the adsorption of U (VI) by alginate beads was strongly dependent on pH, the adsorption increased at pH 3∼7, then decreased at pH 7∼9. The adsorption reached equilibrium within 2 minutes. The adsorption kinetics of U (VI) onto alginate beads can be described by a pseudo first-order kinetic model. The adsorption isotherm can be described by the Redlich-Peterson model, and the maximum adsorption capacity was 237.15 mg/g. The sorption process is spontaneous and has an exothermic reaction.

  6. Controlled antiseptic release by alginate polymer films and beads.

    Science.gov (United States)

    Liakos, Ioannis; Rizzello, Loris; Bayer, Ilker S; Pompa, Pier Paolo; Cingolani, Roberto; Athanassiou, Athanassia

    2013-01-30

    Biodegradable polymeric materials based on blending aqueous dispersions of natural polymer sodium alginate (NaAlg) and povidone iodine (PVPI) complex, which allow controlled antiseptic release, are presented. The developed materials are either free standing NaAlg films or Ca(2+)-cross-linked alginate beads, which properly combined with PVPI demonstrate antibacterial and antifungal activity, suitable for therapeutic applications, such as wound dressing. Glycerol was used as the plasticizing agent. Film morphology was studied by optical and atomic force microscopy. It was found that PVPI complex forms well dispersed circular micro-domains within the NaAlg matrix. The beads were fabricated by drop-wise immersion of NaAlg/PVPI/glycerol solutions into aqueous calcium chloride solutions to form calcium alginate beads encapsulating PVPI solution (CaAlg/PVPI). Controlled release of PVPI was possible when the composite films and beads were brought into direct contact with water or with moist media. Bactericidal and fungicidal properties of the materials were tested against Escherichia coli bacteria and Candida albicans fungi. The results indicated very efficient antibacterial and antifungal activity within 48 h. Controlled release of PVPI into open wounds is highly desired in clinical applications to avoid toxic doses of iodine absorption by the wound. A wide variety of applications are envisioned such as external and internal wound dressings with controlled antiseptic release, hygienic and protective packaging films for medical devices, and polymer beads as water disinfectants. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Fluorescent detection of C-reactive protein using polyamide beads

    Science.gov (United States)

    Jagadeesh, Shreesha; Chen, Lu; Aitchison, Stewart

    2016-03-01

    Bacterial infection causes Sepsis which is one of the leading cause of mortality in hospitals. This infection can be quantified from blood plasma using C - reactive protein (CRP). A quick diagnosis at the patient's location through Point-of- Care (POC) testing could give doctors the confidence to prescribe antibiotics. In this paper, the development and testing of a bead-based procedure for CRP quantification is described. The size of the beads enable them to be trapped in wells without the need for magnetic methods of immobilization. Large (1.5 mm diameter) Polyamide nylon beads were used as the substrate for capturing CRP from pure analyte samples. The beads captured CRP either directly through adsorption or indirectly by having specific capture antibodies on their surface. Both methods used fluorescent imaging techniques to quantify the protein. The amount of CRP needed to give a sufficient fluorescent signal through direct capture method was found suitable for identifying bacterial causes of infection. Similarly, viral infections could be quantified by the more sensitive indirect capture method. This bead-based assay can be potentially integrated as a disposable cartridge in a POC device due to its passive nature and the small quantities needed.

  8. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  9. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  10. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  11. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  12. Lung scintigraphy

    International Nuclear Information System (INIS)

    Dalenz, Roberto.

    1994-01-01

    A review of lung scintigraphy, perfusion scintigraphy with SPECT, lung ventilation SPECT, blood pool SPECT. The procedure of lung perfusion studies, radiopharmaceutical, administration and clinical applications, imaging processing .Results encountered and evaluation criteria after Biello and Pioped. Recommendations and general considerations have been studied about relation of this radiopharmaceutical with other pathologies

  13. A Pneumatic Actuated Microfluidic Beads-Trapping Device

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guocheng; Cai, Ziliang; Wang, Jun; Wang, Wanjun; Lin, Yuehe

    2011-08-20

    The development of a polydimethylsiloxane (PDMS) microfluidic microbeads trapping device is reported in this paper. Besides fluid channels, the proposed device includes a pneumatic control chamber and a beads-trapping chamber with a filter array structure. The pneumatic flow control chamber and the beads-trapping chamber are vertically stacked and separated by a thin membrane. By adjusting the pressure in the pneumatic control chamber, the membrane can either be pushed against the filter array to set the device in trapping mode or be released to set the device in releasing mode. In this paper, a computational fluid dynamics simulation was conducted to optimize the geometry design of the filter array structure; the device fabrication was also carried out. The prototype device was tested and the preliminary experimental results showed that it can be used as a beads-trapping unit for various biochemistry and analytical chemistry applications, especially for flow injection analysis systems.

  14. Bead-based screening in chemical biology and drug discovery

    DEFF Research Database (Denmark)

    Komnatnyy, Vitaly V.; Nielsen, Thomas Eiland; Qvortrup, Katrine

    2018-01-01

    libraries for early drug discovery. Among the various library forms, the one-bead-one-compound (OBOC) library, where each bead carries many copies of a single compound, holds the greatest potential for the rapid identification of novel hits against emerging drug targets. However, this potential has not yet...... been fully realized due to a number of technical obstacles. In this feature article, we review the progress that has been made towards bead-based library screening and applications to the discovery of bioactive compounds. We identify the key challenges of this approach and highlight key steps needed......High-throughput screening is an important component of the drug discovery process. The screening of libraries containing hundreds of thousands of compounds requires assays amanable to miniaturisation and automization. Combinatorial chemistry holds a unique promise to deliver structural diverse...

  15. The dispersion of fine chitosan particles by beads-milling

    Science.gov (United States)

    Rochima, Emma; Utami, Safira; Hamdani, Herman; Azhary, Sundoro Yoga; Praseptiangga, Danar; Joni, I. Made; Panatarani, Camellia

    2018-02-01

    This research aimed to produce fine chitosan particles from a crab shell waste by beads-milling method by two different concentration of PEG as dispersing agent (150 and 300 wt. %). The characterization was performed to obtain the size and size distribution, the characteristics of functional groups and the degree of deacetylation. The results showed that the chitosan fine particles was obtained with a milling time 120 minutes with the best concentration of PEG 400 150 wt. %. The average particle size of the as-prepared suspension is 584 nm after addition of acetic acid solution (1%, v/v). Beads milling process did not change the glucosamine and N-acetylglucosamine content on chitosan structure which is indicated by degree of deacetylation higher than 70%. It was concluded that beads milling process can be applied to prepare chitosan fineparticles by proper adjustment in the milling time, pH and dosage of dispersing agent.

  16. Development of multifunctional chitosan beads for fluoride removal

    Energy Technology Data Exchange (ETDEWEB)

    Viswanathan, Natrayasamy [Department of Chemistry, Gandhigram Rural University, Gandhigram 624 302, Tamilnadu (India); Sairam Sundaram, C. [Department of Science and Humanities, Karaikal Polytechnic College, Karaikal 609 609, Puducherry (India); Meenakshi, S., E-mail: drs_meena@rediffmail.com [Department of Chemistry, Gandhigram Rural University, Gandhigram 624 302, Tamilnadu (India)

    2009-08-15

    Chitosan beads (CB) which have negligible defluoridation capacity (DC) have been chemically modified by introducing multifunctional groups, viz., NH{sub 3}{sup +} and COOH groups by means of protonation and carboxylation in order to utilize both amine and hydroxyl groups for fluoride removal. The protonated cum carboxylated chitosan beads (PCCB) showed a maximum DC of 1800 mg F{sup -}/kg whereas raw chitosan beads displayed only 52 mg F{sup -}/kg. Sorption process was found to be independent of pH and slightly influenced in the presence of other common anions. The fluoride sorption on modified forms was reasonably explained by Freundlich and Langmuir isotherms. The sorbents were characterised by FTIR and SEM with EDAX analysis. The sorption process follows pseudo-second-order and intraparticle diffusion kinetic models. The suitability of PCCB has been tested with field sample collected from a nearby fluoride endemic area.

  17. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  18. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  1. The Surface Imprinted Polystyrene Beads Prepared via Emulsion Templates

    Institute of Scientific and Technical Information of China (English)

    Guo Xiang CHENG; Guang Ling PEI; Ling Gang ZENG; Li Yong ZHANG; Chao LIU

    2004-01-01

    In this paper, the surface imprinted cross-linked polystyrene beads were prepared via suspension polymerization with styrene (St), divinylbezene (DVB), polyvinyl alcohol (PVA1788), the mixture of Span 85 and xylene or the mixture of Span 85 and paraffin as monomer, cross-linking agent, dispersion stabilizer and templates, respectively. The results indicate that there are dense cavities on the surface of beads, and the diameter and density of cavity are related with the composition and amount of emulsion template. The forming mechanism of cavity from thermodynamics and dynamics was proposed.

  2. Corrosion of ancient glass beads found in Southern Thailand

    International Nuclear Information System (INIS)

    Won-in, K; Thongkam, Y; Intarasiri, S; Kamwanna, T; Dararutana, P

    2012-01-01

    Glass has been used as ornaments and decorations in Thailand for several hundred years. The archaeological resources suggested that the ancient glass beads excavated in southern Thailand were made more than 1300 years ago. Initial findings revealed that there were number of difference in shade between the glass beads of difference colors. Energy dispersive X-ray spectrometer (EDS) system attached with scanning electron microscope (SEM) and particle-induced X-ray emission spectroscopy (PIXE) were firstly used to study the surface corrosion of the samples. SEM micrographs showed more corroded and flaked microstructure. These were contributed to the interaction of both the ground water and its dissolved chemical compounds.

  3. Magnet polepiece design for uniform magnetic force on superparamagnetic beads

    OpenAIRE

    Fallesen, Todd; Hill, David B.; Steen, Matthew; Macosko, Jed C.; Bonin, Keith; Holzwarth, George

    2010-01-01

    Here we report construction of a simple electromagnet with novel polepieces which apply a spatially uniform force to superparamagnetic beads in an optical microscope. The wedge-shaped gap was designed to keep ∂Bx∕∂y constant and B large enough to saturate the bead. We achieved fields of 300–600 mT and constant gradients of 67 T∕m over a sample space of 0.5×4 mm2 in the focal plane of the microscope and 0.05 mm along the microscope optic axis. Within this space the maximum force on a 2.8 μm di...

  4. Lung density

    DEFF Research Database (Denmark)

    Garnett, E S; Webber, C E; Coates, G

    1977-01-01

    The density of a defined volume of the human lung can be measured in vivo by a new noninvasive technique. A beam of gamma-rays is directed at the lung and, by measuring the scattered gamma-rays, lung density is calculated. The density in the lower lobe of the right lung in normal man during quiet...... breathing in the sitting position ranged from 0.25 to 0.37 g.cm-3. Subnormal values were found in patients with emphsema. In patients with pulmonary congestion and edema, lung density values ranged from 0.33 to 0.93 g.cm-3. The lung density measurement correlated well with the findings in chest radiographs...... but the lung density values were more sensitive indices. This was particularly evident in serial observations of individual patients....

  5. What Is Lung Cancer?

    Science.gov (United States)

    ... Shareable Graphics Infographics “African-American Men and Lung Cancer” “Lung Cancer Is the Biggest Cancer Killer in Both ... starts in the lungs, it is called lung cancer. Lung cancer begins in the lungs and may spread ...

  6. Abscess in the Lungs

    Science.gov (United States)

    ... Home Lung and Airway Disorders Abscess in the Lungs Abscess in the Lungs Causes Symptoms Diagnosis Treatment Resources ... here for the Professional Version Abscess in the Lungs Abscess in the Lungs A lung abscess is a ...

  7. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  8. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  9. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  10. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  11. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  12. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  13. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  14. Residual gentamicin-release from antibiotic-loaded polymethylmethacrylate beads after 5 years of implantation

    NARCIS (Netherlands)

    Neut, D; van de Belt, H; van Horn, [No Value; van der Mei, HC; Busscher, HJ

    In infected joint arthroplasty, high local levels of antibiotics are achieved through temporary implantation of non-biodegradable gentamicin-loaded polymethylmethacrylate beads. Despite their antibiotic release, these beads act as a biomaterial surface to which bacteria preferentially adhere, grow

  15. Exploring Traditional Glass Bead Making Techniques in Jewellery ...

    African Journals Online (AJOL)

    Exploring traditional glass bead making techniques in jewellery in some prominent areas in Ghana is a means to exposing the area for metal and ceramic artists and other related fields of discipline such as aesthetics and criticism to complement their form of ... Keywords: livelihood, vitreous, glass bottles, furnace, threading ...

  16. Glass bead transformation method for gram-positive bacteria

    OpenAIRE

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2009-01-01

    A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.

  17. Collection Development: From Beads to Bangles (Jewelry Making)

    Science.gov (United States)

    Hanrahan, Katie

    2010-01-01

    Jewelry making began exploding as a hobby about ten years ago, largely because the flush economy gave individuals more leisure time and disposable income. Jewelry classes, bead stores, and special events have multiplied like craft shows at Christmas time. While the recent economic downturn has slowed the growth of the hobby, it is still as popular…

  18. Evaluation of double drop beads pavement edge lines.

    Science.gov (United States)

    2009-08-01

    This report presents an evaluation of Double Drop Bead (DDB) edge lines used on ALDOT-maintained highways. It compares DDB to three other pavement marking types in terms of service lives, life-cycle costs, and both dry-night retroreflectivity and wet...

  19. Superparamagnetic beads in rotating magnetic fields: microfluidic experiments

    NARCIS (Netherlands)

    Den Toonder, J.M.J.; Bokdam, M.

    2008-01-01

    The effect of the Mason number, ratio of viscous and magnetic force, on suspended superparamagnetic micro sized beads was investigated experimentally. Microfluidic experiments were performed in a set-up that generates a rotating homogeneous magnetic field. In the presence of a magnetic field, the

  20. Removal of organic dyes by magnetic alginate beads.

    Science.gov (United States)

    Rocher, Vincent; Siaugue, Jean-Michel; Cabuil, Valérie; Bee, Agnès

    2008-02-01

    This study deals with the development of a clean and safe process for water pollution remediation. We have synthesized a magnetic adsorbent in order to develop a solid-phase extraction process assisted by a magnetic field. To follow an 'ecoconception' approach, magnetic beads containing magnetic nanoparticles and activated carbon are prepared with a biopolymer extracted from algae, sodium alginate. The use of renewable bioresources of low cost and those disposable in large amount allows the development of a product with a low impact on the environment. The adsorption properties of activated carbon and magnetic properties of iron oxide nanoparticles are combined to produce an interesting magnetic composite. Synthesis and characterization of the magnetic beads have been reported. Their adsorption capacity was investigated by measuring the removal of two dyes (methylene blue and methyl orange) of different charges from aqueous solutions. The efficiency of the beads has been compared with that of non-encapsulated activated carbon. The effects of initial dye concentration, pH and calcium content of the beads have been studied. Adsorption kinetics experiments have been carried out and the data have been well fitted by a pseudo-second-order equation.

  1. StoryBeads: Preserving indigenous knowledge through tangible interaction design

    CSIR Research Space (South Africa)

    Reitsma, L

    2013-09-01

    Full Text Available in technology adoption. The study resulted in a recording device that fits the target group’s oral tradition and is based on a concept in which oral stories are recorded and associated with tangible beads that can be incorporated into traditional beadwork...

  2. Continuous removal and recovery of lead by alginate beads, free ...

    African Journals Online (AJOL)

    This study examines the possibility of using Chlorella vulgaris cells in repeated lead adsorption/desorption cycles. Alginate beads and immobilized with algal cells were more effective and suitable than free cells. Consistently high lead removal (>90%) and recovery (about 100%) were achieved. Lead adsorption was mainly ...

  3. 485 assessment of the problems of manual automobile tyre bead

    African Journals Online (AJOL)

    eobe

    rim bead bond must be broken to carry out repairs on a failed automobile tyre. ... engine will not be transformed into the motion of the vehicle. It provides the only point of contact between ..... Popular Mechanic 162 (6): 62. http://books.google.

  4. Low-cost commercial glass beads as dosimeters in radiotherapy

    International Nuclear Information System (INIS)

    Jafari, S.M.; Bradley, D.A.; Gouldstone, C.A.; Sharpe, P.H.G.; Alalawi, A.; Jordan, T.J.; Clark, C.H.; Nisbet, A.; Spyrou, N.M.

    2014-01-01

    Recent developments in advanced radiotherapy techniques using small field photon beams, require small detectors to determine the delivered dose in steep dose gradient fields. Commercially available glass jewellery beads exhibit thermoluminescent properties and have the potential to be used as dosimeters in radiotherapy due to their small size ( 60 Co gamma rays over doses ranging from 1 to 2500 cGy. A thermoluminescence (TL) system and an electron paramagnetic resonance (EPR) system were employed for read out. Both the TL and EPR studies demonstrated a radiation-induced signal, the sensitivity of which varied with bead colour. White coloured beads proved to be the most sensitive for both systems. The smallest and therefore least sensitive bead sizes allowed measurement of doses of 1 cGy using the TL system while that for the EPR system was approximately 1000 cGy. The fading rate was found to be 10% 30 days after irradiation with both readout systems. The dose response is linear with measured dose over the dose range 1 to 2500 cGy, with an R 2 correlation coefficient of greater than 0.999. The batch-to-batch reproducibility of a set of dosimeters after a single irradiation was found to be 3% (1 SD). The reproducibility of individual dosimeters was found to be 1.7%. No measurable angular dependence was found (results agreed within 1%). Dose rate response was found to agree within 1% for dose rates of 100 to 600 cGy/min. These results demonstrate the potential use of glass beads as TL dosimeters over the dose range commonly applied in radiotherapy. - Highlights: • We examined the dosimetric properties of a low cost commercially produced glass seed beads. • Glass beads are available in small size of 1–3 mm, suitable for dosimetry of small radiation fields. • The results demonstrate a mean reproducibility of 0.23% (2 SD), batch homogeneity of within 5%. • Dose response was linear over wide dose range tested for 1 cGy to kGy. • Improved fading effect of 10

  5. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  6. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  7. Ionically crosslinked alginate–carboxymethyl cellulose beads for the delivery of protein therapeutics

    International Nuclear Information System (INIS)

    Kim, Min Sup; Park, Sang Jun; Gu, Bon Kang; Kim, Chun-Ho

    2012-01-01

    Highlights: ► We prepared Fe 3+ crosslinked alginate–carboxymethyl cellulose (AC) beads. ► Different surface and inner morphology of AC beads were observed on volume of CMC. ► AC beads showed minimum swelling degree in acidic condition. ► Protein release from AC beads was to control in gastrointestinal condition. - Abstract: We developed Fe 3+ -crosslinked alginate–carboxymethyl cellulose (AC) beads in various volume ratios by dropping an AC solution into a ferric chloride solution to form protein therapeutic carrier beads. Scanning electron microscopy revealed that the roughness and pore size of the crosslinked beads increased with the volume ratio of the carboxymethyl cellulose. Fourier transform-infrared analysis revealed the formation of a three-dimensional bonding structure between the anionic polymeric chains of AC and the Fe 3+ ions. The degree of swelling and the release profile of albumin from the beads were investigated under simulated gastrointestinal conditions (pH 1.2, 4.5, and 7.4). The Fe 3+ -crosslinked AC beads displayed different degrees of swelling and albumin release for the various AC volume ratios and under various pH conditions. An in vitro release test was used to monitor the controlled release of albumin from the AC beads under simulated gastrointestinal conditions over 24 h. The Fe 3+ -crosslinked AC beads protected and controlled the release of protein, demonstrating that such beads present a promising protein therapeutic carrier for the oral delivery.

  8. Flow Cytometry-Based Bead-Binding Assay for Measuring Receptor Ligand Specificity

    NARCIS (Netherlands)

    Sprokholt, Joris K.; Hertoghs, Nina; Geijtenbeek, Teunis B. H.

    2016-01-01

    In this chapter we describe a fluorescent bead-binding assay, which is an efficient and feasible method to measure interaction between ligands and receptors on cells. In principle, any ligand can be coated on fluorescent beads either directly or via antibodies. Binding between ligand-coated beads

  9. Comparison between simulation and experimentally observed interactions between two magnetic beads in a fluidic system

    Energy Technology Data Exchange (ETDEWEB)

    Oduwole, Olayinka, E-mail: olayinka.oduwole@eng.ox.ac.uk; Grob, David Tim, E-mail: tim.grob@eng.ox.ac.uk; Sheard, Steve, E-mail: steve.sheard@eng.ox.ac.uk

    2016-06-01

    Continuous flow separation of magnetic particles within a microfluidic device could lead to improved performance of magnetic bead-based assays but the undesirable formation of bead clusters reduces its efficiency; this efficiency refers to the ability to separate bound magnetic beads from a mixture of particles. Such agglomerates are formed due to magnetic binding forces while hydrodynamic interactions strongly influence the particles' movement. This paper presents a model for interactions between a pair of equal sized super-paramagnetic beads suspended in water within a uniform magnetic field. To the best of our knowledge, we present for the first time a comparison between simulated trajectories and the beads' movement captured on video; the beads were suspended in a stationary fluid placed within a uniform magnetic field. In conclusion, the model is a good approximation for beads interacting with their nearest neighbours and is able to predict the trajectory pattern of these particles in a magnetic bead-based assay. Predicting the magnetically induced interaction of nearby beads will help in determining the density of beads in an assay and in avoiding agglomeration over a fixed time duration. - Highlights: • We modelled the interactions between a pair of super-paramagnetic beads suspended in water within a uniform magnetic field. • We tracked the movement of the bead pair and captured it on video. • We compared the numerical results with the video data and achieved a good agreement. • We predicted the agglomeration time as a function of the separation distance.

  10. Influence of Immobilized Biomolecules on Magnetic Bead Plug Formation and Retention in Capillary Electrophoresis

    Science.gov (United States)

    Henken, Rachel L.; Chantiwas, Rattikan; Gilman, S. Douglass

    2012-01-01

    Significant changes in the formation and retention of magnetic bead plugs in a capillary during electrophoresis were studied, and it was demonstrated that these effects were due to the type of biological molecule immobilized on the surface of these beads. Three biological molecules, an antibody, an oligonucleotide and alkaline phosphatase, were attached to otherwise identical streptavidin-coated magnetic beads through biotin-avidin binding in order to isolate differences in bead immobilization in a magnetic field resulting from the type of biological molecule immobilized on the bead surface. Alkaline phosphatase also was attached to the magnetic beads using epoxy groups on the bead surfaces (instead of avidin-biotin binding) to study the impact of immobilization chemistry. The formation and retention of magnetic bead plugs were studied quantitatively using light scattering detection of magnetic particles eluting from the bead plugs and qualitatively using microscopy. Both the type of biomolecule immobilized on the magnetic bead surface and the chemistry used to link the biomolecule to the magnetic bead impacted the formation and retention of the bead plugs. PMID:22437880

  11. DTDGA impregnated XAD-16 beads for separation and recovery of palladium from acidic wastes

    International Nuclear Information System (INIS)

    Singh, Krishan Kant; Kanagare, Anant B.; Bairwa, K.K.; Manmohan Kumar; Bajaj, Parma N.; Ruhela, Ritesh; Singh, Ajoy K.; Hubli, Rajendra C.

    2014-01-01

    In the present study DTDGA extractant impregnated XAD16 polymeric beads (DTDGA- XAD16) were synthesized by wet chemical method and the beads were characterized by various techniques viz. FT-IR, Optical microscopy, SEM and TGA. The DTDGA-XAD 16 beads were evaluated for separation and recovery of palladium from high level waste solutions (HLW)

  12. Influence of size of emboli on extravascular lung water

    International Nuclear Information System (INIS)

    Dawson, C.A.; Rickaby, D.A.; Linehan, J.H.

    1989-01-01

    We examined the influence of the size of emboli on the vascular volume (QL) and extravascular volume (Qev) accessible to 3 HOH during a single pass through an isolated dog lung lobe using the double indicator-dilution method with 125I-human serum albumin as the vascular indicator. As successively more beads of a given diameter (58, 548, or 3,175 microns) were introduced into a lung lobe, a linear relationship between QL and Qev was obtained as they both decreased. The slope of the graph of QL vs. Qev with progressive embolism was directly proportional to the bead diameter. This suggested an approach for estimating the total vascular volume in vessels smaller than the diameter of the beads before embolization, referred to as Qm. If it is assumed that most of the transvascular diffusional exchange of 3 HOH occurs in vessels smaller than the smallest beads (mainly capillaries) and that vessel obstruction does not change the ratio of Qev to the perfused capillary volume, the slope of the plot of QL vs. Qev is an estimate of the fraction, Qm/QL, of the total vascular volume in vessels smaller than the bead diameter. In the dog lung lobes studied, Qm/QL was approximately 0.64 for 58-microns vessels, 0.75 for 548-microns vessels, and 0.82 for 3,175-microns vessels. The results suggest that, with occlusion of vessels greater than or equal to 58 microns, 3 HOH does not diffuse significantly into unperfused regions

  13. Process and device for fabrication of ice beads and application to abrasive blasting with ice beads for surface treatments

    International Nuclear Information System (INIS)

    Barnier, M.; Manificat, A.; Perroud, P.

    1989-01-01

    A device is described for cleaning and decontamination by abrasive blasting with ice beads. It comprises a water injector, with many holes, at the top of a column feeded with cold gas where solidification of water droplets begins, solidification is completed in a cooling liquids, ice is extracted by a screw and pushed to the projection nozzle with cold gas [fr

  14. Lung Cancer

    International Nuclear Information System (INIS)

    Maghfoor, Irfan; Perry, M.C.

    2005-01-01

    Lung cancer is the leading cause of cancer-related mortality. Since tobacco smoking is the cause in vast majority of cases, the incidence of lung cancer is expected to rise in those countries with high or rising incidence of tobacco smoking. Even though population at a risk of developing lung cancer are easily identified, mass screening for lung cancer is not supported by currently available evidence. In case of non-small cell lung cancer, a cure may be possible with surgical resection followed by post-operative chemotherapy in those diagnosed at an early stage. A small minority of patients who present with locally advanced disease may also benefit from preoperative chemotherapy and/or radiation therapy to down stage the tumor to render it potentially operable. In a vast majority of patients, however, lung cancer presents at an advanced stage and a cure is not possible with currently available therapeutic strategies. Similarly small cell lung cancer confined to one hemi-thorax may be curable with a combination of chemotherapy and thoracic irradiation followed by prophylactic cranial irradiation, if complete remission is achieved at the primary site. Small cell lung cancer that is spread beyond the confines of one hemi-thorax is however, considered incurable. In this era of molecular targeted therapies, new agents are constantly undergoing pre-clinical and clinical testing with the aim of targeting the molecular pathways thought to involved in etiology and pathogenesis of lung cancer. (author)

  15. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  16. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  17. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  19. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  20. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  1. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  2. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  3. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  4. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  5. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  6. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  7. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  8. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  9. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  10. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  11. Strategies for enumeration of circulating microvesicles on a conventional flow cytometer: Counting beads and scatter parameters.

    Science.gov (United States)

    Alkhatatbeh, Mohammad J; Enjeti, Anoop K; Baqar, Sara; Ekinci, Elif I; Liu, Dorothy; Thorne, Rick F; Lincz, Lisa F

    2018-01-01

    Enumeration of circulating microvesicles (MVs) by conventional flow cytometry is accomplished by the addition of a known amount of counting beads and calculated from the formula: MV/μl = (MV count/bead count) × final bead concentration. We sought to optimize each variable in the equation by determining the best parameters for detecting 'MV count' and examining the effects of different bead preparations and concentrations on the final calculation. Three commercially available bead preparations (TruCount, Flow-Count and CountBright) were tested, and MV detection on a BD FACSCanto was optimized for gating by either forward scatter (FSC) or side scatter (SSC); the results were compared by calculating different subsets of MV on a series of 74 typical patient plasma samples. The relationship between the number of beads added to each test and the number of beads counted by flow cytometry remained linear over a wide range of bead concentrations ( R 2 ≥ 0.997). However, TruCount beads produced the most consistent (concentration variation = 3.8%) calculated numbers of plasma CD41 + /Annexin V + MV, which were significantly higher from that calculated using either Flow-Count or CountBright ( p beads by FSC and 0.16 μm beads by SSC, but there were significantly more background events using SSC compared with FSC (3113 vs. 470; p = 0.008). In general, sample analysis by SSC resulted in significantly higher numbers of MV ( p beads provided linear results at concentrations ranging from 6 beads/μl to 100 beads/μl, but TruCount was the most consistent. Using SSC to gate MV events produced high background which negatively affected counting bead enumeration and overall MV calculations. Strategies to reduce SSC background should be employed in order to reliably use this technique.

  12. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  13. Induced movement of the magnetic beads and DNA-based dumbbell in a micro fluidic channel

    Science.gov (United States)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2007-12-01

    We have explored controlled movement of magnetic beads and a dumbbell structure composed of DNA, a magnetic and a non-magnetic bead in a micro fluidic channel. Movement of the beads and dumbbells is simulated assuming that a net force is described as a superposition between the magnetic and hydrodynamic drag forces. Trajectories of beads and dumbbells are observed with optical light microscopy. The experimentally measured data show a good agreement with the simulations. This dynamical approach offers the prospect to stretch the DNA within the dumbbell and investigate its conformational changes. Further on, we demonstrate that short sonication can reduce multiple attachments of DNA to the beads.

  14. Stability of alginate-titanium dioxide based photocatalyst beads for water treatment application under UV irradiation

    OpenAIRE

    WENG HOONG LAM

    2017-01-01

    Immobilizing TiO2 photocatalyst in alginate beads has been considered to be a green approach for the separation and recycling of the photocatalyst in UV water treatment. However, the feasibility of using alginate beads in industry is largely dependent on their photo-stability during operation. This study aimed to provide a better understanding on the degradation of alginate/TiO2 beads under UV irradiation and to improve beads stability. The beads stability can be improved by increasing the al...

  15. Compositional characterization of sintered (U,Th)O2 pellets by EDXRF using fused bead specimens

    International Nuclear Information System (INIS)

    Sanjay Kumar, S.; Dhara, Sangita; Misra, N.L.; Aggarwal, S.K.

    2015-01-01

    Fused bead specimens were used for analyzing sintered (U,Th)O 2 pellets by Energy Dispersive X-Ray Fluorescence (EDXRF) spectrometry. The bead specimens of calibration mixtures U 3 O 8 and ThO 2 were made by fusing them in Lithium Tetraborate/Metaborate fusion mixtures using a fusion bead machine. The EDXRF spectra of these beads were used for making calibration plot for U% determination in (U+Th) amounts. Using these calibration plots and EDXRF spectra of bead of sintered (U,Th)O 2 pellets, U% in these pellets was successfully determined. (author)

  16. Lung Cancer

    Science.gov (United States)

    Lung cancer is one of the most common cancers in the world. It is a leading cause of cancer death in men and women in the United States. Cigarette smoking causes most lung cancers. The more cigarettes you smoke per day and ...

  17. Lung Cancer Screening

    Science.gov (United States)

    ... factors increase or decrease the risk of lung cancer. Lung cancer is a disease in which malignant (cancer) ... following PDQ summaries for more information about lung cancer: Lung Cancer Prevention Non-Small Cell Lung Cancer Treatment ...

  18. A planar conducting microstructure to guide and confine magnetic beads to a sensing zone

    KAUST Repository

    Gooneratne, Chinthaka Pasan

    2011-08-01

    A novel planar conducting microstructure is proposed to transport and confine magnetic micro/nano beads to a sensing zone. Manipulation and concentration of magnetic beads are achieved by employing square-shaped conducting micro-loops, with a few hundred nano-meters in thickness, arranged in a unique fashion. These microstructures are designed to produce high magnetic field gradients which are directly proportional to the force applied to manipulate the magnetic beads. Furthermore, the size of the microstructures allows greater maneuverability and control of magnetic beads than what could be achieved by permanent magnets. The aim of the microstructures is to guide magnetic beads from a large area and confine them to a smaller area where for example quantification would take place. Experiments were performed with different concentrations of 2 μm diameter magnetic beads. Experimental results showed that magnetic beads could be successfully guided and confined to the sensing zone. © 2011 Elsevier B.V. All rights reserved.

  19. Improvement of removal characteristics for uranium by immobilization of diphosil powder into alginate bead

    International Nuclear Information System (INIS)

    Kim, K. J.; Kang, I. S.; Lee, Y. H.; Son, J. S.; Hong, K. P.

    2003-01-01

    Chemical wastes containing small amounts of uranium can not be disposed of them as industrial wastes. Especially for the removal of uranium, In this study, the method of immobilizing Diphosil powder within alginate beads is adopted to make a bead from powdered resin. Sodium alginate bead itself showed a capability to uptake uranium to above 60%, but the value was decreased to below 30% after equilibrium. The rate of uranium adsorption increased with increasing content of Diphosil in sodium alginate bead. Diphosil resin itself showed very fast uptake of uranium from early stages, and then the rates were leveled off. Diphosil bead showed a improved capability to uptake uranium considering Diphosil content in the bead, and a considerable potential for further applications of a continuous process by using a bead form of Diphosil

  20. Separation of yttrium using carbon nanotube doped polymeric beads impregnated with D2EHPA

    International Nuclear Information System (INIS)

    Dasgupta, Kinshuk; Yadav, Kartikey K.; Singh, D.K.; Anitha, M.; Singh, H.

    2013-01-01

    Di-2-ethylhexyl phosphoric acid impregnated polyethersulfone based composite beads in combination with additives such as polyvinyl alcohol (PVA) and multiwalled carbon nanotube (MWCNT) has been prepared by non-solvent phase inversion method. The synthesized beads were characterized by scanning electron microscopy, thermogravimetry and infra-red spectroscopy. Effect of additives on bead morphology, solvent impregnation capacity, extractability and stability has been examined to compare their suitability for yttrium recovery from acidic medium. Microstructural investigation as well as experimental findings confirmed the role of additives in modifying the pore structures in beads, responsible for varied degree of yttrium extraction. Further the role of metal ion concentration in aqueous phase on its recovery by polymeric beads was also evaluated. Among the tested beads PES/D2EHPA/MWCNT/PVA beads were found to be superior for Y(Ill) extraction. (author)

  1. Bead Capture and Release on a Magnetic Sensor in a Microfluidic System

    DEFF Research Database (Denmark)

    Dalslet, Bjarke Thomas; Damsgaard, Christian Danvad; Freitas, S.C.

    Planar Hall effect magnetic sensors for detection of biological agents using surface treated magnetic beads are integrated with a fluid injection system. The response of the sensors is used to evaluate bead capture rates for different bead concentrations c and fluid flow rates Q, and to monitor...... subsequent removal of the beads. It is found that the capture rate scales directly with c and that it depends linearly on Q. At low Q the capture rate is only partially due to gravitational sedimentation of beads. At higher Q an additional term proportional to Q becomes important, which is attributed...... to capture of beads by the magnetic fields near the sensor. It is shown that beads can be washed off the sensor surface....

  2. On the occurrence of ‘bead lightning’ phenomena in long laboratory sparks

    Energy Technology Data Exchange (ETDEWEB)

    Vayanganie, S.P.A., E-mail: amilavayanganie@gmail.com [Atmospheric Physics and Lightning Research Group, University of Colombo, Colombo 03 (Sri Lanka); Cooray, V.; Rahman, Mahbubur; Hettiarachchi, Pasan; Diaz, Oscar [Lightning Research Group, The Ångström Laboratory Division of Electricity, Department of Engineering Sciences, Uppsala University, Box 534, SE-751 21 Uppsala (Sweden); Fernando, M. [Atmospheric Physics and Lightning Research Group, University of Colombo, Colombo 03 (Sri Lanka)

    2016-02-22

    The formation of bead lightning, where the lightning channel appears to break up into luminous fragments, is still an object of speculation. Here we report similar observations in laboratory discharges. Analysis of time resolved photographs shows that the discharge channel exhibits a ‘bead pattern’ in the decaying stage of the discharge and the occurrence of loops in the channel sections where the bead pattern is observed. This result presents the first evidence that the rapid cooling of non-uniform channel sections could lead to the formation of beads. It is suggested that periodically occurring non-uniform channel sections could explain the bead pattern of lightning discharges. - Highlights: • For the first time, the occurrence of bead patterns in the channel of laboratory sparks was reported. • Depending on the geometry some regions of the channel decays faster than the other sections. • A possible mechanism for the occurrence of beads in decaying states of lightning flashes is proposed.

  3. On the chemical variability of Middelburg glass beads and rods

    International Nuclear Information System (INIS)

    Karklins, K.; Kottman, J.; Hancock, R.G.V.; Sempowski, M.L.; Nohe, A.W.; Moreau, J.-F.; Aufreiter, S.; Kenyon, I.

    2001-01-01

    Forty-three glass samples from a late 16th-early 17th century, glass beadmaking house in Middelburg, the Netherlands, were selected for maximum colouring variability, including plain and multi-coloured varieties. The glass chemistries were quite diverse, within each colour grouping. For each single colour of glass, anticipated colouring elements (copper for turquoise blue, cobalt for dark blue, manganese for rose, and tin for white) were used, with the exception of two beads that were opacified wih antimony rather than with tin. Multi-coloured glass glasses (chevron beads) produced chemistries that match the mixing of the different coloured glasses. In some cases, low relative amounts of some inter-mixed glasses were not detectable against the composition of the major glass component. (author). 16 refs., 3 tabs

  4. Frictionless Demonstration Using Fine Plastic Beads For Teaching Mechanics

    International Nuclear Information System (INIS)

    Ishii, K.; Kagawa, K.; Khumaeni, A.; Kurniawan, K. H.

    2010-01-01

    New equipment for demonstrating laws of mechanics have successfully been constructed utilizing fine sphere plastic beads (0.3 mm in diameter). Fine plastic beads function as ball bearings to reduce the friction between the object and the plate surface. By this method, a quantitative measurement of energy conservation law has successfully been carried out with a small error of less 3%. The strong advantage of this frictionless method is that we can always use the same objects like Petri dishes for demonstrating many kinds of mechanics laws, such as the first, second, and the third laws of motion, momentum conservation law, and energy conservation law. This demonstration method surely has a beneficial effect for students, who can then understand mechanics laws systematically with a unified concept and no confusion.

  5. Methodological Study of Cell Separation with Domestic Immunomagnetic Beads

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    To establish the method of cell separation with domestic immuomagnetic beads, three methods were investigated. Direct method, SPA method and Biotin-Avidin method were applied to separate cell strain Hut-78 and CD4 positive cells. Separation rate of strain Hut-78 was more than 90 % in direct method. Detachment rate with papain was over 95 %. Cell activity was well retained. SPA method and Biotin-Avidin methods were also effective, but the direct method was superior to the other two techniques. Before separated by the direct method, CD4 positive cells constituted 46.4 %±6.4 % of mononuclear cells (MNC), but in eliminated suspension there was only 6.2 %±2.3 % CD4 positive cells left. In the separated part, 80.6 %±7.2 % of the cells combined with the beads. It is concluded that the direct method in separating cells had high sensitivity and specificity.

  6. Bead perturbation measurement for the KEK linac cavity

    International Nuclear Information System (INIS)

    Okumura, Shoji; Swenson, D.A.

    1975-03-01

    The axial electric field in the KEK linac cavity is measured by a bead perturbation method. The beat signal of around 1 kHz is generated with the rf signals from the cavity in self-excitation and from a signal generator whose output frequency is fixed. The period of the beat signal is measured by a counter in order to detect the small change in the resonant frequency of the cavity due to a bead perturbation. The counting data are transferred to a mini-computer after each period of the beat signal. The average fields of each gap are calculated in the computer and they are displayed on a storage oscilloscope. It takes about 50 seconds to complete the whole process of the measurement. The measuring system and the results obtained are described in this paper. (auth.)

  7. Plasticity of an Amorphous Assembly of Elastic Gel Beads

    Science.gov (United States)

    Grosshans, D.; Knaebel, A.; Lequeux, F.

    1995-01-01

    We have studied the rheological properties of an assembly of swollen gel beads in a lack of solvent. The system is an amorphous assembly of packed soft spheres in a given volume. We have studied the plastic behavior of the system, and interpreted it in terms of bead rearrangements within the assembly. Nous avons étudié les propriétés rhéologiques d'un assemblage de billes de gel gonflées en défaut de solvant. Le système est donc une assemblée amorphe de sphères molles écrasées à volume total constant. Nous avons étudié divers aspects du comportement plastique et nous l'avons interprété en termes de réorganisations de billes dans l'assemblage.

  8. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  9. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  10. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  12. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  13. Molecularly Imprinted Polymer Beads-Synthesis, Evaluation and Applications

    OpenAIRE

    Zhou, Tongchang

    2016-01-01

    Molecularly imprinted polymers (MIPs) are artificial receptors designed for the selective recognition of template molecules. These polymers have been applied in analytical separations, as chemical sensors and in drug delivery system due to their low cost and high stability. In recent years MIP beads, especially those with good selectivity in aqueous solution, have become attractive as they can be potentially used as selective adsorbents for the solid phase extraction (SPE) and chromatographic...

  14. Selective manipulation of superparamagnetic beads by a magnetic microchip

    KAUST Repository

    Gooneratne, Chinthaka Pasan

    2013-07-01

    In this paper, a magnetic microchip (MMC) is presented, to first trap and then selectively manipulate individual, superparamagnetic beads (SPBs) to another trapping site. Trapping sites are realized through soft magnetic micro disks made of Ni80Fe20, and SPB motion is controlled by current-carrying, tapered, conducting lines made of Au. The MMC was realized using standard microfabrication techniques and provides a cheap and versatile platform for microfluidic systems for cell manipulation. © 2013 IEEE.

  15. Hot wire TIG temper bead welding for nuclear repairs

    International Nuclear Information System (INIS)

    Lambert, J.A.; Gilston, P.F.

    1989-08-01

    A preliminary assessment has been carried out to determine the suitability of the hot wire tungsten inert gas (TIG) welding process for the repair of thick section, ferritic steel nuclear pressure vessels. The objective has been to identify a hot wire TIG temper bead procedure, suitable for repairs without post weld heat treatment. This procedure involves depositing two weld layers with carefully selected welding parameters such that overlapping thermal cycles produce a refined and tempered heat affected zone, HAZ, microstructure. (author)

  16. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  17. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  18. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  19. Structure and superparamagnetic behaviour of magnetite nanoparticles in cellulose beads

    Energy Technology Data Exchange (ETDEWEB)

    Correa, Jose R., E-mail: correa@fq.uh.cu [Department of General Chemistry, Faculty of Chemistry, University of Havana, Zapata and G, Havana City 10400 (Cuba); Bordallo, Eduardo [Sugar Cane-Cellulose Research Center, Cuba-9, Quivican (Cuba); Canetti, Dora [Department of Inorganic Chemistry, Faculty of Chemistry, University of Havana, Zapata and G, Havana City 10400 (Cuba); Leon, Vivian [Sugar Cane-Cellulose Research Center, Cuba-9, Quivican (Cuba); Otero-Diaz, Luis C. [Department of Inorganic Chemistry-1, Complutense University of Madrid, Madrid 28040 (Spain); Electron Microscopy Center, Complutense University of Madrid, Madrid 28040 (Spain); Negro, Carlos [Chemical Engineering Department, Complutense University of Madrid, Madrid 28040 (Spain); Gomez, Adrian [Electron Microscopy Center, Complutense University of Madrid, Madrid 28040 (Spain); Saez-Puche, Regino [Department of Inorganic Chemistry-1, Complutense University of Madrid, Madrid 28040 (Spain)

    2010-08-15

    Superparamagnetic magnetite nanoparticles were obtained starting from a mixture of iron(II) and iron(III) solutions in a preset total iron concentration from 0.04 to 0.8 mol l{sup -1} with ammonia at 25 and 70 {sup o}C. The regeneration of cellulose from viscose produces micrometrical spherical cellulose beads in which synthetic magnetite were embedded. The characterization of cellulose-magnetite beads by X-ray diffraction, Scanning and Transmission Electron Microscopy and magnetic measurement is reported. X-ray diffraction patterns indicate that the higher is the total iron concentration and temperature the higher is the crystal size of the magnetite obtained. Transmission Electron Microscopy studies of cellulose-magnetite beads revealed the distribution of magnetite nanoparticles inside pores of hundred nanometers. Magnetite as well as the cellulose-magnetite composites exhibit superparamagnetic characteristics. Field cooling and zero field cooling magnetic susceptibility measurements confirm the superparamagnetic behaviour and the blocking temperature for the magnetite with a mean size of 12.5 nm, which is 200 K.

  20. HOM identification by bead pulling in the Brookhaven ERL cavity

    CERN Document Server

    Hahn, H; Jain, Puneet; Johnson, Elliott C; Xu, Wencan

    2014-01-01

    Exploratory measurements of the Brookhaven Energy Recovery Linac (ERL) cavity at superconducting temperature produced a long list of high order modes (HOMs). The niobium 5-cell cavity is terminated at each end with HOM ferrite dampers that successfully reduce the Q-factors to levels required to avoid beam break up (BBU) instabilities. However, a number of un-damped resonances with Q≥106 were found at 4 K and their mode identification forms the focus of this paper. The approach taken here consists of bead pulling on a copper (Cu) replica of the ERL cavity with dampers involving various network analyzer measurements. Several different S21 transmission measurements are used, including those taken from the fundamental input coupler to the pick-up probe across the cavity, others between beam-position monitor probes in the beam tubes, and also between probes placed into the cells. The bead pull technique suitable for HOM identification with a metallic needle or dielectric bead is detailed. This paper presents the...

  1. Chitosan and chemically modified chitosan beads for acid dyes sorption

    Institute of Scientific and Technical Information of China (English)

    AZLAN Kamari; WAN SAIME Wan Ngah; LAI KEN Liew

    2009-01-01

    The capabilities of chitosan and chitosan-EGDE (ethylene glycol diglycidyl ether) beads for removing Acid Red 37 (AR 37) and Acid Blue 25 (AB 25) from aqueous solution were examined. Chitosan beads were cross-linked with EGDE to enhance its chemical resistance and mechanical strength. Experiments were performed as a function of pH, agitation period and concentration of AR 37 and AB 25. It was shown that the adsorption capacities of chitosan were comparatively higher than chitosan-EGDE for both acid dyes. This is mainly because cross-linking using EGDE reduces the major adsorption sites -NH3+ on chitosan. Langmuir isotherm model showed best conformity compared to Freundlich and BET. The kinetic experimental data agreed very well to the pseudo second-order kinetic model. The desorption study revealed that after three cycles of adsorption and desorption by NaOH and HCl, both adsorbents retained their promising adsorption abilities. FT-IR analysis proved that the adsorption of acid dyes onto chitosan-based adsorbents was a physical adsorption. Results also showed that chitosan and chitosan-EGDE beads were favourable adsorbers and could be employed as low-cost alternatives for the removal of acid dyes in wastewater treatment.

  2. Lung abscess

    International Nuclear Information System (INIS)

    Ha, H.K.; Kang, M.W.; Park, J.M.; Yang, W.J.; Shinn, K.S.; Bahk, Y.W.

    1993-01-01

    Lung abscess was successfully treated with percutaneous drainage in 5 of 6 patients. Complete abscess resolution occurred in 4 patients, partial resolution in one, and no response in one. The duration of drainage ranged from 7 to 18 days (mean 15.5 days) in successful cases. The failure of drainage in one neurologicall impaired patient was attributed to persistent aspiration. In 2 patients, concurrent pleural empyema was also cured. CT provided the anatomic details necessary for choosing the puncture site and avoiding puncture of the lung parenchyma. Percutaneous catheter drainage is a safe and effective method for treating lung abscess. (orig.)

  3. Universal approach for selective trace metal determinations via sequential injection-bead injection-lab-on-valve using renewable hydrophobic bead surfaces as reagent carriers

    DEFF Research Database (Denmark)

    Long, Xiangbao; Miró, Manuel; Hansen, Elo Harald

    2005-01-01

    involves the use of poly(styrene-divinylbenzene) beads containing pendant octadecyl moieties (C18-PS/DVB), which are preimpregnated with a selective organic metal chelating agent prior to the automatic manipulation of the beads in the microbore conduits of the LOV unit. By adapting this approach...

  4. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  5. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  6. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  7. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  8. Preparation of Glutaraldehyde Cross-Linked Chitosan Beads Under Microwave Irradiation and Properties of Urease Immobilized onto the Beads

    Institute of Scientific and Technical Information of China (English)

    LIANG Zupei; FENG Yaqing; MENG Shuxian; ZHANG Weihong

    2005-01-01

    The glutaraldehyde cross-linked chitosan beads were prepared under microwave irradiation and urease was immobilized onto the beads. The activity and the yield of enzyme activity of the immobilized urease were 10.83 U/g carrier and 47.7%, respectively. The optimum conditions of immobilization were 1% of glutaraldehyde volume fraction, 10 mg/g of urease/beads weight ratio, 24 h of the processing time and pH 6.5 of the reaction medium for immobilization. The properties of the immobilized urease were investigated and compared with those of the free enzyme. The optimum pH values were 6.5 and 7.0 for the immobilized and free urease, respectively. The optimum temperature was 60 ℃ for the free urease, while it shifted to 65 ℃ for the immobilized enzyme. The Michaelis constant K m was 9.1 mmol/L for the immobilized and 12.5 mmol/L for the free urease. The immobilized urease retained 40% of its initial enzyme activity even after 10 repeated uses. The immobilized urease stored at 4 ℃ retained 46% of its initial activity even after 35 d.

  9. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  10. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  11. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  12. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  13. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  14. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  15. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  16. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  17. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  18. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  19. Lung cancer

    Science.gov (United States)

    ... causing chemicals such as uranium, beryllium, vinyl chloride, nickel chromates, coal products, mustard gas, chloromethyl ethers, gasoline, and diesel exhaust Exposure to radon gas Family history of lung cancer ...

  20. Lung surgery

    Science.gov (United States)

    ... are thoracotomy and video-assisted thoracoscopic surgery (VATS). Robotic surgery may also be used. Lung surgery using ... Center-Shreveport, Shreveport, LA. Review provided by VeriMed Healthcare Network. Also reviewed by David Zieve, MD, MHA, ...

  1. Preparation and characterization of chitosan/cashew gum beads loaded with Lippia sidoides essential oil

    Energy Technology Data Exchange (ETDEWEB)

    Paula, Haroldo C.B., E-mail: hpaula@ufc.br [Department of Analytical and Physical Chemistry, Federal University of Ceara, UFC, Fortaleza-CE (Brazil); Sombra, Fernanda Matoso; Cavalcante, Rafaela de Freitas; Abreu, Flavia O.M.S. [Department of Analytical and Physical Chemistry, Federal University of Ceara, UFC, Fortaleza-CE (Brazil); Paula, Regina C.M. de [Department of Organic and Inorganic Chemistry, Federal University of Ceara, UFC, Fortaleza-CE (Brazil)

    2011-03-12

    Beads based on chitosan (CH) and cashew gum (CG), were prepared and loaded with an essential oil with larvicide activity (Lippia sidoides - Ls). CH and CH-CG beads were characterized by scanning electron microscopy (SEM), infrared and UV-VIS spectroscopy, thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), as well as, regarding their larvicide loading, swelling, in vitro and in vivo release kinetics. The oil encapsulation was evidenced by FTIR analysis and LS loading ranges from 2.4% to 4.4%. CH beads duly showed swelling degree (Q) values from 4.0 to 6.7, reaching equilibrium after 30 min, whereas crosslinked CH-CG beads showed lower swelling values, from 0.4 to 3.8, exhibiting a longer equilibrium time. Liquid transport parameters have revealed diffusion coefficient for CH-CG beads, as low as 2 x 10{sup -15} m{sup 2}/s. TGA and DSC revealed that CH:CG crosslinked beads are more thermally stable than CH beads. In vitro release follows a non-Fickian diffusion profile for both bead types, however, and a prolonged release being achieved only after beads crosslinking. In vivo release showed that both CH and CH-CG presented a prolonged larvicide effect. These aforesaid results, indicate that CH-CG beads loaded with LS are efficient for A. aegypti larval control.

  2. Preparation and characterization of chitosan/cashew gum beads loaded with Lippia sidoides essential oil

    International Nuclear Information System (INIS)

    Paula, Haroldo C.B.; Sombra, Fernanda Matoso; Cavalcante, Rafaela de Freitas; Abreu, Flavia O.M.S.; Paula, Regina C.M. de

    2011-01-01

    Beads based on chitosan (CH) and cashew gum (CG), were prepared and loaded with an essential oil with larvicide activity (Lippia sidoides - Ls). CH and CH-CG beads were characterized by scanning electron microscopy (SEM), infrared and UV-VIS spectroscopy, thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), as well as, regarding their larvicide loading, swelling, in vitro and in vivo release kinetics. The oil encapsulation was evidenced by FTIR analysis and LS loading ranges from 2.4% to 4.4%. CH beads duly showed swelling degree (Q) values from 4.0 to 6.7, reaching equilibrium after 30 min, whereas crosslinked CH-CG beads showed lower swelling values, from 0.4 to 3.8, exhibiting a longer equilibrium time. Liquid transport parameters have revealed diffusion coefficient for CH-CG beads, as low as 2 x 10 -15 m 2 /s. TGA and DSC revealed that CH:CG crosslinked beads are more thermally stable than CH beads. In vitro release follows a non-Fickian diffusion profile for both bead types, however, and a prolonged release being achieved only after beads crosslinking. In vivo release showed that both CH and CH-CG presented a prolonged larvicide effect. These aforesaid results, indicate that CH-CG beads loaded with LS are efficient for A. aegypti larval control.

  3. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  4. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  5. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  6. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  7. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  8. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  9. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  10. Elution of Clindamycin and Enrofloxacin From Calcium Sulfate Hemihydrate Beads In Vitro.

    Science.gov (United States)

    Phillips, Heidi; Boothe, Dawn M; Bennett, R Avery

    2015-11-01

    To compare the in vitro elution characteristics of clindamycin and enrofloxacin from calcium sulfate hemihydrate beads containing a single antibiotic, both antibiotics, and each antibiotic incubated in the same eluent well. Experimental in vitro study. Calcium sulfate hemihydrate beads were formed by mixing with clindamycin and/or enrofloxacin to create 4 study groups: (1) 160 mg clindamycin/10 beads; (2) 160 mg enrofloxacin/10 beads; (3) 160 mg clindamycin + 160 mg enrofloxacin/10 beads; and (4) 160 mg clindamycin/5 beads and 160 mg enrofloxacin/5 beads. Chains of beads were formed in triplicate and placed in 5 mL phosphate buffered saline (PBS; pH 7.4 and room temperature) with constant agitation. Antibiotic-conditioned PBS was sampled at 14 time points from 1 hour to 30 days. Clindamycin and enrofloxacin concentrations in PBS were determined using high-performance liquid chromatography. Eluent concentrations from clindamycin-impregnated beads failed to remain sufficiently above minimum inhibitory concentration (MIC) for common infecting bacteria over the study period. Enrofloxacin eluent concentrations remained sufficiently above MIC for common wound pathogens of dogs and cats and demonstrated an atypical biphasic release pattern. No significant differences in elution occurred as a result of copolymerization of the antibiotics into a single bead or from individual beads co-eluting in the same eluent well. Clindamycin-impregnated beads cannot be recommended for treatment of infection at the studied doses; however, use of enrofloxacin-impregnated beads may be justified when susceptible bacteria are cultured. © Copyright 2015 by The American College of Veterinary Surgeons.

  11. Comparison of four supports for adsorption of reactive dyes by immobilized Aspergillus fumigatus beads

    Institute of Scientific and Technical Information of China (English)

    WANG Bao-e; HU Yong-you

    2007-01-01

    Four materials, sodium carboxymethylcellulose (Na-CMC), sodium alginate (SA), polyvinyl alcohol (PVA), and chitosan (CTS), were prepared as supports for entrapping fungus Aspergillus fumigatus. The adsorption of synthetic dyes, reactive brilliant blue KN-R, and reactive brilliant red K-2BP, by these immobilized gel beads and plain gel beads was evaluated. The adsorption efficiencies of reactive brilliant red K-2BP and reactive brilliant blue KN-R by CTS immobilized beads were 89.1% and 93.5% in 12 h, respectively. The adsorption efficiency by Na-CMC immobilized beads was slightly lower than that of mycelial pellets. But the dye culture mediums were almost completely decolorized in 48 h using the above-mentioned two immobilized beads (exceeding 95%). The adsorption efficiency by SA immobilized beads exceeded 92% in 48 h. PVA-SA immobilized beads showed the lowest adsorption efficiency, which was 79.8% for reactive brilliant red K-2BP and 92.5% for reactive brilliant blue KN-R in 48 h. Comparing the adsorption efficiency by plain gel beads, Na-CMC plain gel beads ranked next to CTS ones. SA and PVA-SA plain gel beads hardly had the ability of adsorbing dyes. Subsequently, the growth of mycelia in Na-CMC and SA immobilized beads were evaluated. The biomass increased continuously in 72 h. The adsorption capacity of reactive brilliant red K-2BP and reactive brilliant blue KN-R by Na-CMC immobilized beads was 78.0 and 86.7 mg/g, respectively. The SEM micrographs show that the surface structure of Na-CMC immobilized bead is loose and finely porous, which facilitates diffusion of the dyes.

  12. Safeguards Analytical Laboratory evaluation program. Part 1. Resin bead mass spectrometry. Part 2. Results of a resin bead field experiment-Tastex-J

    International Nuclear Information System (INIS)

    Walker, R.L.; Smith, D.H.; Carter, J.A.; Musick, W.R.; Donohue, D.L.; Deron, S.; Asakura, Y.; Kagami, K.; Irinouchi, S.; Masui, J.

    1981-01-01

    The first part of this report covers background of resin bead spectrometry and the new batch resin bead method. In the original technique, about ten anion resin beads in the nitrate form were exposed to the diluted sample solution. The solution was adjusted to be a 8 M HNO 3 and to have about 1 μg U per bead. Up to 48 hours of static contact between beads and solution was required for adsorption of 1 to 3 ng Pu and U per bead to be achieved. Under these conditions, contamination was a problem at reprocessing facilities. The new batch techniques reduces the risk of contamination by handling one hundred times more U in the final diluted sample which is exposed to a proportionately larger number of beads. Moreover, it only requires ten minutes adsorption time to provide about 1000 purified samples for mass spectrometry. The amounts of Pu and U adsorbed versus time were determined and results are tabulated. The second part of this report briefly summarizes results of resin bead field tests completed at the Power Reactor and Nuclear Fuel Development Corporation (PNC) reprocessing plant in Tokai-mura, Japan. Both methods, the original small-sample resin bead and the batch technique, were investigated on spent fuel solutions. Beads were prepared at PNC and distributed to IAEA and ORNL along with dried residues for conventional mass spectrometric analysis at IAEA. Parallel measurements were made at PNC using their normal measuring routines. The U and Pu measurements of all resin and those of PNC are in excellent agreement for the batch method. Discrepancies were noted in the U measurements by the original method

  13. Unexpandable lung.

    Science.gov (United States)

    Pereyra, Marco F; Ferreiro, Lucía; Valdés, Luis

    2013-02-01

    Unexpandable lung is a mechanical complication by which the lung does not expand to the chest wall, impeding a normal apposition between the two pleural layers. The main mechanism involved is the restriction of the visceral pleura due to the formation of a fibrous layer along this pleural membrane. This happens because of the presence of an active pleural disease (lung entrapment), which can be resolved if proper therapeutic measures are taken, or a remote disease (trapped lung), in which an irreversible fibrous pleural layer has been formed. The clinical suspicion arises with the presence of post-thoracocentesis hydropneumothorax or a pleural effusion that cannot be drained due to the appearance of thoracic pain. The diagnosis is based on the analysis of the pleural liquid, the determination of pleural pressures as we drain the effusion and on air-contrast chest CT. As both represent the continuity of one same process, the results will depend on the time at which these procedures are done. If, when given a lung that is becoming entrapped, the necessary therapeutic measures are not taken, the final result will be a trapped lung. In this instance, most patients are asymptomatic or have mild exertional dyspnea and therefore they do not require treatment. Nevertheless, in cases of incapacitating dyspnea, it may be necessary to use pleural decortication in order to resolve the symptoms. Copyright © 2012 SEPAR. Published by Elsevier Espana. All rights reserved.

  14. Angiotensin converting enzyme immobilized on magnetic beads as a tool for ligand fishing.

    Science.gov (United States)

    de Almeida, Fernando G; Vanzolini, Kenia L; Cass, Quezia B

    2017-01-05

    Angiotensin converting enzyme (ACE) presents an important role in blood pressure regulation, since that converts angiotensin I to the vasoconstrictor angiotensin II. Some commercially available ACE inhibitors are captopril, lisinopril and enalapril; due to their side effects, naturally occurring inhibitors have been prospected. In order to endorse this research field we have developed a new tool for ACE ligand screening. To this end, ACE was extracted from bovine lung, purified and chemically immobilized in modified ferrite magnetic beads (ACE-MBs). The ACE-MBs have shown a Michaelian kinetic behavior towards hippuryl-histidyl-leucine. Moreover, as proof of concept, the ACE-MBs was inhibited by lisinopril with a half maximal inhibitory concentration (IC 50 ) of 10nM. At the fishing assay, ACE-MBs were able not only to fish out the reference inhibitor, but also one peptide from a pool of tryptic digested BSA. In conclusion, ACE-MBs emerge as new straightforward tool for ACE kinetics determination, inhibition and binder screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. FUZZY REGRESSION MODEL TO PREDICT THE BEAD GEOMETRY IN THE ROBOTIC WELDING PROCESS

    Institute of Scientific and Technical Information of China (English)

    B.S. Sung; I.S. Kim; Y. Xue; H.H. Kim; Y.H. Cha

    2007-01-01

    Recently, there has been a rapid development in computer technology, which has in turn led todevelop the fully robotic welding system using artificial intelligence (AI) technology. However, therobotic welding system has not been achieved due to difficulties of the mathematical model andsensor technologies. The possibilities of the fuzzy regression method to predict the bead geometry,such as bead width, bead height, bead penetration and bead area in the robotic GMA (gas metalarc) welding process is presented. The approach, a well-known method to deal with the problemswith a high degree of fuzziness, is used to build the relationship between four process variablesand the four quality characteristics, respectively. Using these models, the proper prediction of theprocess variables for obtaining the optimal bead geometry can be determined.

  16. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  17. Modeling of welded bead profile for rapid prototyping by robotic MAG welding

    Institute of Scientific and Technical Information of China (English)

    CAO Yong; ZHU Sheng; WANG Tao; WANG Wanglong

    2009-01-01

    As a deposition technology, robotic metal active gas(MAG) welding has shown new promise for rapid prototyping (RP) of metallic parts. During the process of metal forming using robotic MAG welding, sectional profile of single-pass welded bead is critical to formed accuracy and quality of metal pans. In this paper, the experiments of single-pass welded bead for rapid prototyping using robotic MAG welding were carried out. The effect of some edge detectors on the cross-sectional edge of welded bead was discussed and curve fitting was applied using leat square fitting. Consequently, the mathematical model of welded bead profile was developed. The experimental results show that good shape could be obtained under suitable welding parameters. Canny operawr is suitable to edge detection of welded bead profile, and the mathematical model of welded bead profile developed is approximately parabola.

  18. Magnetic measurements of suspended functionalised ferromagnetic beads under DC applied fields

    International Nuclear Information System (INIS)

    De Los Santos V, Luis; Llandro, Justin; Lee, Dongwook; Mitrelias, Thanos; Palfreyman, Justin J.; Hayward, Thomas J.; Cooper, Jos; Bland, J.A.C.; Barnes, Crispin H.W.; Arroyo C, Juan L.; Lees, Martin

    2009-01-01

    In this work, a simple technique to obtain the hysteresis loops of magnetic beads (Spherotech Inc.) in liquid suspension is presented. The magnetic measurements were taken in a DC Magnetic Property Measurement System (MPMS-SQUID sensor). Samples were based on ferromagnetic beads (surface-functionalized NH 2 , mean diameter 4.32 μm) prepared in three conditions: dry, suspended in sucrose solution and in suspension after functionalization with fluorophore. Special small containers (1.3 cm long) made of non magnetic plastic were designed to hold the beads in liquid. The results indicate that the bead's remnant magnetization is half of the value at maximum applied field in all cases. However, due to the additional degrees of rotational freedom, beads suspended in a liquid do not present coercivity. The use of ferromagnetic beads and magnetic elements of different architectures for applications in bioassays is also discussed.

  19. Impact of Spherical Frit Beads on Simulated DWPF Slurries

    International Nuclear Information System (INIS)

    SMITH, MICHAEL

    2005-01-01

    It has been shown that the rheological properties of simulated Defense Waste Processing Facility (DWPF) melter feed with the glass former frit as mostly (90 weight percent) solid spherical particles (referred to as beads) were improved as the feed was less viscous as compared to DWPF melter feed that contained the normal irregular shaped frit particles. Because the physical design of the DWPF Slurry Mix Evaporator (SME), Melter Feed Tank (MFT), and melter feed loop are fixed, the impact of changing the rheology might be very beneficial. Most importantly, higher weight percent total solids feed might be processed by reducing the rheological properties (specifically yield stress) of the feed. Additionally, if there are processing problems, such as air entrainment or pumping, these problems might be alleviated by reducing the rheological properties, while maintaining targeted throughputs. Rheology modifiers are chemical, physical, or a combination of the two and can either thin or thicken the rheology of the targeted slurry. The beads are classified as a physical rheological modifier in this case. Even though the improved rheological properties of the feed in the above mentioned DWPF tanks could be quite beneficial, it is the possibility of increased melt rate that is the main driver for the use of beaded glass formers. By improving the rheological properties of the feed, the weight percent solids of the feed could be increased. This higher weight percent solids (less water) feed could be processed faster by the melter as less energy would be required to evaporate the water, and more would be available for the actual melting of the waste and the frit. In addition, the use of beads to thin the feed could possibly allow for the use of a lower targeted acid stoichiometry in the feed preparation process (if in fact acid stoichiometry is being driven by feed rheology as opposed to feed chemistry). Previous work by the Savannah River National Laboratory (SRNL) with the lab

  20. SparseBeads data: benchmarking sparsity-regularized computed tomography

    Science.gov (United States)

    Jørgensen, Jakob S.; Coban, Sophia B.; Lionheart, William R. B.; McDonald, Samuel A.; Withers, Philip J.

    2017-12-01

    Sparsity regularization (SR) such as total variation (TV) minimization allows accurate image reconstruction in x-ray computed tomography (CT) from fewer projections than analytical methods. Exactly how few projections suffice and how this number may depend on the image remain poorly understood. Compressive sensing connects the critical number of projections to the image sparsity, but does not cover CT, however empirical results suggest a similar connection. The present work establishes for real CT data a connection between gradient sparsity and the sufficient number of projections for accurate TV-regularized reconstruction. A collection of 48 x-ray CT datasets called SparseBeads was designed for benchmarking SR reconstruction algorithms. Beadpacks comprising glass beads of five different sizes as well as mixtures were scanned in a micro-CT scanner to provide structured datasets with variable image sparsity levels, number of projections and noise levels to allow the systematic assessment of parameters affecting performance of SR reconstruction algorithms6. Using the SparseBeads data, TV-regularized reconstruction quality was assessed as a function of numbers of projections and gradient sparsity. The critical number of projections for satisfactory TV-regularized reconstruction increased almost linearly with the gradient sparsity. This establishes a quantitative guideline from which one may predict how few projections to acquire based on expected sample sparsity level as an aid in planning of dose- or time-critical experiments. The results are expected to hold for samples of similar characteristics, i.e. consisting of few, distinct phases with relatively simple structure. Such cases are plentiful in porous media, composite materials, foams, as well as non-destructive testing and metrology. For samples of other characteristics the proposed methodology may be used to investigate similar relations.

  1. Butyl acetate synthesis using immobilized lipase in calcium alginate beads

    International Nuclear Information System (INIS)

    Mohd Zulkhairi Abdul Rahim; Lee, Pat M.; Lee, Kong H.

    2008-01-01

    The esterification reaction of acetic acid and n-butanol using immobilized lipase encapsulated in calcium alginate beads (Lipase - CAB) and in chitosan coated calcium alginate beads (Lipase-CCAB) in n-hexane under mild reaction conditions were studied. Effects of temperature and substrate concentration (acetic acid and n-butanol) using Lipase - CAB, Lipase - CCAB and free lipase on the esterification reaction and their thermal stability towards esterification reaction were investigated. Results of temperature studies showed that the butyl acetate conversion increased with increase of temperature and reached the highest yield of about 70% around 50 degree Celsius for both immobilized systems but the yield of product catalyzed by free enzyme decreased as temperature was increased. Thermal stabilities studies showed that the Lipase-CCAB and Lipase-CAB were stable throughout the temperature range of 30-60 degree Celsius. However, free lipase became less stable at temperatures higher than 50 degree Celsius. The substrates, n-butanol and acetic acid exerted different effects on the esterification reaction and the reaction was favoured by higher acetic acid concentration than butanol. Kinetics parameters, Km and Vmax values for both substrates and the specific activities of the three enzyme system were also determined. The beads morphology was examined using SEM. Batch-wise operational stability studies for both immobilized systems demonstrated that the immobilized lipase performed better in the batch wise reactor system than the continuous bioreactor system and that the immobilized lipase remained active for at least 5 cycles of batch wise esterification reactions. (author)

  2. Microscope-controlled glass bead blasting: a new technique

    Directory of Open Access Journals (Sweden)

    Peter Kotschy

    2011-01-01

    Full Text Available Peter Kotschy1, Sascha Virnik2, Doris Christ3, Alexander Gaggl21Private Practice, Vienna, Austria; 2Department of Oral and Maxillofacial Surgery, Central Hospital, Klagenfurt, Austria; 3Klagenfurt, AustriaObjective: The aim of periodontal therapy is the healing of periodontal inflammation; the protection of the attachment and the alveolar bone; and the regeneration of the periodontal structures. In the therapy of periodontitis, supra- and subgingival scaling and root planing plays a main role. The procedure described combines perfect root cleaning without scaling and root planing and minimal invasive periodontal surgery without a scalpel.Material and methods: Glass beads of 90 µm were used with the kinetic preparation unit PrepStart® under a pressure of 0.5–5 bar. This technique was practised only under visual control using the OPMI® PRO Magis microscope. Seven examinations were carried out at baseline after 3, 6, 12, 18, 24, and 36 months.Results: Time shows a statistically significant influence on all of the considered target variables (P < 0.0001 for all. As the according estimate is negative, probing depth decreases over time. The major decrease seems to be during the first 6 months. Considering probing depth, plaque on the main effect root shows significant influence (again, P < 0.0001 for all. Observations with high probing depth at the beginning were faster than those with low probing depth. The same characteristic appears by attachment level. Patients with more loss of attachment show more gain.Conclusions: Using microscope-controlled glass bead blasting results in a perfectly clean root surface using visual control (magnification 20×. Microscope-controlled glass bead blasting is therefore a good alternative to periodontal surgery.Keywords: periodontal therapy, microscope, periodontitis

  3. Salt and divalent cations affect the flexible nature of the natural beaded chromatin structure

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Griffith, J

    1977-01-01

    Cl or 0.6M NaCL, and is compact in 0.01 M NaCl solutions if histone H 1 is present. Even high concentrations of urea did not alter the fundamental beaded structure, consisting of 110A beads of 200 base pair content, each joined by thin DNA bridges of 50 base pairs. The physical bead observed by EM...

  4. Fabrication of micromagnetic beads with molecular recognition/electron-transfer peptides for the sensing of ovalbumin

    Energy Technology Data Exchange (ETDEWEB)

    Sugawara, Kazuharu, E-mail: kzsuga@maebashi-it.ac.jp [Maebashi Institute of Technology, Gunma, 371-0816 (Japan); Kuramitz, Hideki [Department of Environmental Biology and Chemistry, Graduate School of Science and Engineering for Research, University of Toyama, Toyama, 930-8555 (Japan); Shinohara, Hiroki [Maebashi Institute of Technology, Gunma, 371-0816 (Japan)

    2017-03-15

    Electrochemical sensing of ovalbumin (OVA) was performed using magnetic beads with OVA recognition (RNRCKGTDVQAW)/electron-transfer (YYYYC) peptides. The focus of this study was to construct a highly sensitive and regenerative tool for OVA detection based on the interaction between a protein and peptide-1(RNRCKGTDVQAWYYYYC). The peptide-1 was introduced to the bead through four types of cross-linking reagents. Magnetic beads of different sizes with N-(6-maleimidocaproyloxy)sulfosuccinimide (Sulfo-EMCS) were also prepared. An oxidation peak due to tyrosine residues at 0.65 V depended on the distance of the electron-transfer peptide from the bead surface and on the surface area of the magnetic beads that contacted the electrode surface. The response of the electro-transfer peptide moiety was decreased because the protein was accumulated via the recognition peptide on the beads. When using Sulfo-EMCS and beads that were 6.0–6.9 μm in diameter, the calibration curve of OVA was linear and ranged from 8.0 × 10{sup −13} to 2.0 × 10{sup −11} M. To regenerate the magnetic beads, the measurements were achieved after removal of the OVA using a denaturing reagent. When OVA was added to fetal bovine serum containing a complex matrix, OVA was recovered at a rate of 98–100%. Consequently, these magnetic beads could be a powerful tool for the sensing of OVA in real samples. - Highlights: • Ovalbumin recognition/electron-transfer peptides were immobilized on magnetic beads. • The accumulation of the protein through the peptides on the beads caused the change of electrode response. • The magnetic beads could be reused for sensing of ovalbumin.

  5. [Development of new magnetic bead separation and purification instrument].

    Science.gov (United States)

    Xu, Yingyuan; Chen, Yi

    2014-05-01

    The article describes the development of new magnetic bead separation and purification instrument. The main application of the instrument is to capture tubercle bacillus from sputum. It is a pretreatment instrument and provides a new platform to help doctors to diagnose bacillary phthisis. Not only could it be used for tubercle bacillus capturing, but also for gene, protein and cell separating and purification. Because the controller of the instrument is 16-bit single chip microcomputer, the cost could be greatly reduced and it will be widely used in China.

  6. Lung function

    International Nuclear Information System (INIS)

    Sorichter, S.

    2009-01-01

    The term lung function is often restricted to the assessment of volume time curves measured at the mouth. Spirometry includes the assessment of lung volumes which can be mobilised with the corresponding flow-volume curves. In addition, lung volumes that can not be mobilised, such as the residual volume, or only partially as FRC and TLC can be measured by body plethysmography combined with the determination of the airway resistance. Body plethysmography allows the correct positioning of forced breathing manoeuvres on the volume-axis, e.g. before and after pharmacotherapy. Adding the CO single breath transfer factor (T LCO ), which includes the measurement of the ventilated lung volume using He, enables a clear diagnosis of different obstructive, restrictive or mixed ventilatory defects with and without trapped air. Tests of reversibility and provocation, as well as the assessment of inspiratory mouth pressures (PI max , P 0.1 ) help to classify the underlying disorder and to clarify treatment strategies. For further information and to complete the diagnostic of disturbances of the ventilation, diffusion and/or perfusion (capillar-)arterial bloodgases at rest and under physical strain sometimes amended by ergospirometry are recommended. Ideally, lung function measurements are amended by radiological and nuclear medicine techniques. (orig.) [de

  7. PRELIMINARY STUDY ON RETRO-REFLECTIVE COATED PAPER BASED ON MICRO-GLASS BEADS

    Institute of Scientific and Technical Information of China (English)

    YulongWang; ChuanshanZhao; TaoZhang

    2004-01-01

    High-reflectivity micro-glass bead, as a kind ofretro-reflective material, is widely used in reflectivefabric or film and other reflective coatings. But it israrely used in coated paper. The retro-reflectivetheory of micro-bead is described. Also the effect ofsize of micro-bead, dosage of binder and differentcolor layers on reflective properties of coated paperare discussed in this article. The results show that itsretro-reflective efficiency is good, equally toreflective fabric or film when the micro-glass bead isused in coated paper.

  8. Effect of formulation of alginate beads on their mechanical behavior and stiffness

    Institute of Scientific and Technical Information of China (English)

    Eng-Seng Chan; Tek-Kaun Lim; Wan-Ping Voo; Ravindra Pogaku; Beng Ti Tey; Zhibing Zhang

    2011-01-01

    The aim of this work was to determine the effect of formulation of alginate beads on their mechanical behavior and stiffness when compressed at high speed. The alginate beads were formulated using different types and concentrations of alginate and gelling cations and were produced using an extrusiondripping method. Single wet beads were compressed at a speed of 40 mm/min, and their elastic limits were investigated, and the corresponding force versus displacement data were obtained. The Young's moduli of the beads were determined from the force versus displacement data using the Hertz's contact mechanics theory. The alginate beads were found to exhibit plastic behavior when they were compressed beyond 50% with the exception of copper-alginate beads for which yield occured at lower deformation.Alginate beads made of higher guluronic acid contents and gelling cations of higher chemical affinity were found to have greater stiffness. Increasing the concentration of alginate and gelling ions also generated a similar effect. At such a compression speed, the values of Young's modulus of the beads were found to be in the range between 250 and 900 kPa depending on the bead formulation.

  9. PRELIMINARY STUDY ON RETRO-REFLECTIVE COATED PAPER BASED ON MICRO-GLASS BEADS

    Institute of Scientific and Technical Information of China (English)

    Yulong Wang; Chuanshan Zhao; Tao Zhang

    2004-01-01

    High-reflectivity micro-glass bead, as a kind of retro-reflective material, is widely used in reflective fabric or film and other reflective coatings. But it is rarely used in coated paper. The retro-reflective theory of micro-bead is described. Also the effect of size of micro-bead, dosage of binder and different color layers on reflective properties of coated paper are discussed in this article. The results show that its retro-reflective efficiency is good, equally to reflective fabric or film when the micro-glass bead is used in coated paper.

  10. Enhancing the antimony sorption properties of nano titania-chitosan beads using epichlorohydrin as the crosslinker.

    Science.gov (United States)

    Nishad, Padala Abdul; Bhaskarapillai, Anupkumar; Velmurugan, Sankaralingam

    2017-07-15

    Antimony is classified as a pollutant of priority importance by USEPA. We have earlier reported the synthesis of nano-titania impregnated epichlorohydrin crosslinked chitosan (TA-Cts-Epi) beads, in a format suitable for large scale applications with high sorption capacity for antimony. To understand the sorption mechanism, and to fine tune the bead composition, the effect of crosslinking density on the swelling and sorption properties of the beads was investigated in detail. Epichlorohydrin effected significant changes in physical and sorption properties of the beads. The antimony sorption capacity of the TA-Cts-Epi beads prepared by crosslinking 0.3g non-crosslinked titania-chitosan beads (TA-Cts-NCL) with 6.4mmol epichlorohydrin was 493μmol/g, while those crosslinked with 0.64mmol showed a capacity of 133μmol/g. Whereas, TA-Cts-NCL beads showed a capacity of 75μmol/g. The increase in uptake capacity with increase in crosslinking demonstrated the active involvement of the epichlorohydrin moieties in antimony binding leading to enhanced sorption. Apart from altering the stability, swelling behaviour and sorption kinetics of the beads, crosslinking significantly increased the uptake of the anionic species via electrostatic interactions. Epichlorohydrin crosslinked chitosan beads prepared without TiO 2 also showed similar behaviour. The results demonstrated the involvement of chitosan, TiO 2 and epichlorohydrin in sorption. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. On-chip measurements of Brownian relaxation vs. concentration of 40nm magnetic beads

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Hansen, Mikkel Fougt

    2012-01-01

    We present on-chip Brownian relaxation measurements on a logarithmic dilution series of 40 nm beads dispersed in water with bead concentrations between 16 mu g/ml and 4000 mu g/ml. The measurements are performed using a planar Hall effect bridge sensor at frequencies up to 1 MHz. No external fields...... are needed as the beads are magnetized by the field generated by the applied sensor bias current. We show that the Brownian relaxation frequency can be extracted from fitting the Cole-Cole model to measurements for bead concentrations of 64 mu g/ml or higher and that the measured dynamic magnetic response...... is proportional to the bead concentration. For bead concentrations higher than or equal to 500 mu g/ml, we extract a hydrodynamic diameter of 47(1) nm for the beads, which is close to the nominal bead size of 40 nm. Furthermore, we study the signal vs. bead concentration at a fixed frequency close to the Brownian...

  12. Fluctuations of cytoskeleton-bound microbeads-the effect of bead-receptor binding dynamics

    International Nuclear Information System (INIS)

    Metzner, C; Raupach, C; Mierke, C T; Fabry, B

    2010-01-01

    The cytoskeleton (CSK) of living cells is a crosslinked fiber network, subject to ongoing biochemical remodeling processes that can be visualized by tracking the spontaneous motion of CSK-bound microbeads. The bead motion is characterized by anomalous diffusion with a power-law time evolution of the mean square displacement (MSD), and can be described as a stochastic transport process with apparent diffusivity D and power-law exponent β: MSD ∼ D (t/t 0 ) β . Here we studied whether D and β change with the time that has passed after the initial bead-cell contact, and whether they are sensitive to bead coating (fibronectin, integrin antibodies, poly-L-lysine, albumin) and bead size (0.5-4.5 μm). The measurements are interpreted in the framework of a simple model that describes the bead as an overdamped particle coupled to the fluctuating CSK network by an elastic spring. The viscous damping coefficient characterizes the degree of bead internalization into the cell, and the spring constant characterizes the strength of the binding of the bead to the CSK. The model predicts distinctive signatures of the MSD that change with time as the bead couples more tightly to the CSK and becomes internalized. Experimental data show that the transition from the unbound to the tightly bound state occurs in an all-or-nothing manner. The time point of this transition shows considerable variability between individual cells (2-30 min) and depends on the bead size and bead coating. On average, this transition occurs later for smaller beads and beads coated with ligands that trigger the formation of adhesion complexes (fibronectin, integrin antibodies). Once the bead is linked to the CSK, however, the ligand type and bead size have little effect on the MSD. On longer timescales of several hours after bead addition, smaller beads are internalized into the cell more readily, leading to characteristic changes in the MSD that are consistent with increased viscous damping by the

  13. Ormosil Beads for Insulation of Ground Cryogenic Storage Tanks, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Organically modified silica (Ormosil) aerogel beads developed at Aspen Aerogels, Inc. offer several advantages for retrofitting perlite insulation in NASA's ground...

  14. Open lung biopsy

    Science.gov (United States)

    Biopsy - open lung ... An open lung biopsy is done in the hospital using general anesthesia . This means you will be asleep and ... The open lung biopsy is done to evaluate lung problems seen on x-ray or CT scan .

  15. Lung Cancer: Glossary

    Science.gov (United States)

    ... professional support team today. Learn More . Find more lung cancer resources. Learn More Donate Today! What is Lung ... to Give How Your Support Helps Events Lung Cancer Awareness © Lung Cancer Alliance. The information presented in this website ...

  16. Lung Cancer Prevention

    Science.gov (United States)

    ... Colorectal Cancer Kidney (Renal Cell) Cancer Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer ... following PDQ summaries for more information about lung cancer: Lung Cancer Screening Non-Small Cell Lung Cancer Treatment ...

  17. Lung cancer - small cell

    Science.gov (United States)

    Cancer - lung - small cell; Small cell lung cancer; SCLC ... About 15% of all lung cancer cases are SCLC. Small cell lung cancer is slightly more common in men than women. Almost all cases of SCLC are ...

  18. [Lung scintigraphy].

    Science.gov (United States)

    Schümichen, Carl; Schmidt, Matthias; Krause, Thomas

    2018-06-01

    The S1 guideline for lung scintigraphy has been updated and extended in order to emphasize the advantages oft the method in detecting acute pulmonary embolism (PE) in the periphery oft the lung (subsegmental PE), in underlying subacute and chronic pulmonary disorders, as well as in detecting chronic LE (CTEPH). Method of choice is ventilation / perfusion (V/P) SPECT or V/P SPECT/CT with even higher specificity. Because of its high sensitivity, a threshold (V/P mismatch in at least one segment or two subsegments) is introduced to avoid overtreatment. In case of a change in the therapeutic approach (observation only instead of anticoaculation) the threshold can be omitted. New data concerning the clinical and therapeutical impact of subsegmental PE are included, the chapters open questions have been extented. Other indications for V/P SPECT (secondary diagnoses, abnormalities in pulmonary perfusion, prediction of postoperative lung function) are presented with new data. Schattauer GmbH.

  19. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  20. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  1. Lung radiopharmaceuticals

    International Nuclear Information System (INIS)

    Gonzalez, B.M.

    1994-01-01

    Indication or main clinical use of Lung radiopharmaceuticals is presented and clasification of radiopharmaceuticals as ventilation and perfusion studies. Perfusion radiopharmaceuticals, main controls for administration quality acceptance. Clearence after blood administration and main clinical applications. Ventilation radiopharmaceuticals, gases and aerosols, characteristics of a ideal radioaerosol, techniques of good inhalation procedure, clinical applications. Comparison of several radiopharmaceuticals reflering to retention time as 50% administered dose, percent administered dose at 6 hours post inhalation, blood activity at 30 and 60 minutes post inhalation, initial lung absorbed dose, cumulated activity.Kinetic description of two radiopharmaceuticals, 99mTcDTPA and 99mTc-PYP

  2. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  3. The bead on a rotating hoop revisited: an unexpected resonance

    Science.gov (United States)

    Raviola, Lisandro A.; Véliz, Maximiliano E.; Salomone, Horacio D.; Olivieri, Néstor A.; Rodríguez, Eduardo E.

    2017-01-01

    The bead on a rotating hoop is a typical problem in mechanics, frequently posed to junior science and engineering students in basic physics courses. Although this system has a rich dynamics, it is usually not analysed beyond the point particle approximation in undergraduate textbooks, nor empirically investigated. Advanced textbooks show the existence of bifurcations owing to the system's nonlinear nature, and some papers demonstrate, from a theoretical standpoint, its points of contact with phase transition phenomena. However, scarce experimental research has been conducted to better understand its behaviour. We show in this paper that a minor modification to the problem leads to appealing consequences that can be studied both theoretically and empirically with the basic conceptual tools and experimental skills available to junior students. In particular, we go beyond the point particle approximation by treating the bead as a rigid spherical body, and explore the effect of a slightly non-vertical hoop's rotation axis that gives rise to a resonant behaviour not considered in previous works. This study can be accomplished by means of digital video and open source software. The experience can motivate an engaging laboratory project by integrating standard curriculum topics, data analysis and experimental exploration.

  4. Sex-specific differences in hyperoxic lung injury in mice: Implications for acute and chronic lung disease in humans

    Energy Technology Data Exchange (ETDEWEB)

    Lingappan, Krithika, E-mail: lingappa@bcm.edu [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States); Jiang, Weiwu; Wang, Lihua; Couroucli, Xanthi I. [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States); Barrios, Roberto [Department of Pathology and Genomic Medicine, The Methodist Hospital Physician Organization, 6565 Fannin Street, Suite M227, Houston, TX 77030 (United States); Moorthy, Bhagavatula [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States)

    2013-10-15

    Sex-specific differences in pulmonary morbidity in humans are well documented. Hyperoxia contributes to lung injury in experimental animals and humans. The mechanisms responsible for sex differences in the susceptibility towards hyperoxic lung injury remain largely unknown. In this investigation, we tested the hypothesis that mice will display sex-specific differences in hyperoxic lung injury. Eight week-old male and female mice (C57BL/6J) were exposed to 72 h of hyperoxia (FiO{sub 2} > 0.95). After exposure to hyperoxia, lung injury, levels of 8-iso-prostaglandin F{sub 2} alpha (8-iso-PGF 2α) (LC–MS/MS), apoptosis (TUNEL) and inflammatory markers (suspension bead array) were determined. Cytochrome P450 (CYP)1A expression in the lung was assessed using immunohistochemistry and western blotting. After exposure to hyperoxia, males showed greater lung injury, neutrophil infiltration and apoptosis, compared to air-breathing controls than females. Pulmonary 8-iso-PGF 2α levels were higher in males than females after hyperoxia exposure. Sexually dimorphic increases in levels of IL-6 (F > M) and VEGF (M > F) in the lungs were also observed. CYP1A1 expression in the lung was higher in female mice compared to males under hyperoxic conditions. Overall, our results support the hypothesis that male mice are more susceptible than females to hyperoxic lung injury and that differences in inflammatory and oxidative stress markers contribute to these sex-specific dimorphic effects. In conclusion, this paper describes the establishment of an animal model that shows sex differences in hyperoxic lung injury in a temporal manner and thus has important implications for lung diseases mediated by hyperoxia in humans. - Highlights: • Male mice were more susceptible to hyperoxic lung injury than females. • Sex differences in inflammatory markers were observed. • CYP1A expression was higher in females after hyperoxia exposure.

  5. Sex-specific differences in hyperoxic lung injury in mice: Implications for acute and chronic lung disease in humans

    International Nuclear Information System (INIS)

    Lingappan, Krithika; Jiang, Weiwu; Wang, Lihua; Couroucli, Xanthi I.; Barrios, Roberto; Moorthy, Bhagavatula

    2013-01-01

    Sex-specific differences in pulmonary morbidity in humans are well documented. Hyperoxia contributes to lung injury in experimental animals and humans. The mechanisms responsible for sex differences in the susceptibility towards hyperoxic lung injury remain largely unknown. In this investigation, we tested the hypothesis that mice will display sex-specific differences in hyperoxic lung injury. Eight week-old male and female mice (C57BL/6J) were exposed to 72 h of hyperoxia (FiO 2 > 0.95). After exposure to hyperoxia, lung injury, levels of 8-iso-prostaglandin F 2 alpha (8-iso-PGF 2α) (LC–MS/MS), apoptosis (TUNEL) and inflammatory markers (suspension bead array) were determined. Cytochrome P450 (CYP)1A expression in the lung was assessed using immunohistochemistry and western blotting. After exposure to hyperoxia, males showed greater lung injury, neutrophil infiltration and apoptosis, compared to air-breathing controls than females. Pulmonary 8-iso-PGF 2α levels were higher in males than females after hyperoxia exposure. Sexually dimorphic increases in levels of IL-6 (F > M) and VEGF (M > F) in the lungs were also observed. CYP1A1 expression in the lung was higher in female mice compared to males under hyperoxic conditions. Overall, our results support the hypothesis that male mice are more susceptible than females to hyperoxic lung injury and that differences in inflammatory and oxidative stress markers contribute to these sex-specific dimorphic effects. In conclusion, this paper describes the establishment of an animal model that shows sex differences in hyperoxic lung injury in a temporal manner and thus has important implications for lung diseases mediated by hyperoxia in humans. - Highlights: • Male mice were more susceptible to hyperoxic lung injury than females. • Sex differences in inflammatory markers were observed. • CYP1A expression was higher in females after hyperoxia exposure

  6. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  7. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  8. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  9. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  10. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  11. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  12. Porous chitosan beads of superior mechanical properties for the covalent immobilization of enzymes.

    Science.gov (United States)

    Wahba, Marwa I

    2017-12-01

    Porous chitosan beads of superior mechanical properties were produced via a two stepped treatment process. First, the chitosan ionotropic gelation solution was supplemented with Na 2 CO 3 , which acted as a porogen. Afterwards, the beads were chemically cross-linked with glutaraldehyde. This treatment also caused the produced porous chitosan beads to acquire higher observed activities of immobilized β-d-galactosidase (β-gal). The observed activities of the β-gal immobilized onto the 0.2M and the 0.35M Na 2 CO 3 treated beads were 1.63 and 1.91 fold respectively, higher than the activity offered by the control beads. Nevertheless, both the control beads and the 0.2M Na 2 CO 3 beads caused the optimum pH range of β-gal to shift from 4.6-5.1 to ∼2.7-5. The enzyme's optimum temperature shifted from 55 to 60°C after its immobilization onto the control chitosan beads whereas the β-gal immobilized onto the 0.2M Na 2 CO 3 chitosan beads exhibited a temperature optimum of 55-60°C. The reusability study revealed the superiority of the 0.2M Na 2 CO 3 treated beads which retained 59.1% of their initial activity during the 13th enzymatic cycle. On the other hand, the control chitosan beads were fragmented and lost their activity after only four enzymatic cycles. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Chinese and Venetian glass beads excavated from Fais Island in Micronesia

    International Nuclear Information System (INIS)

    Intoh, Michiko

    1997-01-01

    Full text: Over 830 glass beads were excavated from a late prehistoric cemetery site on Fais Island in the Caroline Islands, Micronesia In one of the 13 excavated burials a young woman had more that 310 glass beads around her wrist. Bone collagen from this burial was dated by AMS to 387 + 64 BP. The associated glass beads were classified into three groups based on colour and size. A sample from each group was examined for evidence of manufacturing technique. The chemical composition was determined using an X-ray microanalyser. The first group consisted of more than 300 pale green, transparent glass beads which are less than 2 mm in diameter. The chemical composition is high in PbO (75.22%) while low in MgO. Such a high lead content is characteristic of Chinese glass. The manufacturing technique could not be determined because the surfaces were too eroded. The second group contains several yellow, translucent glass beads. The chemical composition is also high in PbO (54.8%) and low in MgO. The beads were made by winding. The combination of winding and high lead strongly indicates that the beads were made in China. The third group had only one white, translucent glass bead. It has particular white stripes which suggest that it is a 'gooseberry' bead which was made in Venice between the sixteenth and eighteenth centuries. In conclusion, both Chinese and Venetian glass beads co-existed on Fais Island around the time of European contact. They are likely to have been brought in from an area which had access to both beads. Island South-East Asia is tentatively considered to be the source area

  14. Two kinds of ketoprofen enteric gel beads (CA and CS-SA using biopolymer alginate

    Directory of Open Access Journals (Sweden)

    Bingchao Cheng

    2018-03-01

    Full Text Available To obtain expected rapid-release and sustained-release of ketoprofen gel beads, this paper adopted biopolymer alginate to prepare alginate beads and chitosan-alginate gel beads. Formulation factors were investigated and optimized by the single factor test. The release of ketoprofen from calcium alginate gel beads in pH 1.0 hydrochloric acid solution was less than 10% during 2 h, then in pH6.8 was about 95% during 45 min, which met the requirements of rapid-release preparations. However, the drug release of chitosan-alginate gel beads in pH1.0 was less than 5% during 2 h, then in pH6.8 was about 50% during 6 h and reached more than 95% during 12 h, which had a good sustained-release behavior. In addition, the release kinetics of keteprofen from the calcium alginate gel beads fitted well with the Korsmeyer–Peppas model and followed a case-II transport mechanism. However, the release of keteprofen from the chitosan-alginate gel beads exhibited a non-Fickian mechanism and based on the mixed mechanisms of diffusion and polymer relaxation from chitosan-alginate beads. In a word, alginate gel beads of ketoprofen were instant analgesic, while chitosan-alginate gel beads could control the release of ketoprofen during gastro-intestinal tract and prolong the drug's action time. Keywords: Gel beads, Enteric rapid-release, Enteric sustained-release, Ketoprofen

  15. Lung Transplant

    Science.gov (United States)

    ... Severity of the recipient's lung disease Recipient's overall health Likelihood that the transplant will be successful Immediately before ... will begin within days of your surgery. Your health care team will likely work with you to design an exercise program that's right for you. Your doctor may ...

  16. Lung cancer

    DEFF Research Database (Denmark)

    Hansen, H H; Rørth, M

    1999-01-01

    The results of the many clinical trials published in 1997 had only modest impact on the treatment results using either cytostatic agents alone or combined with radiotherapy in lung cancer. In SCLC, combination chemotherapy including platin-compounds (cisplatin, carboplatin) and the podophyllotoxins...

  17. Viscosity of dilute suspensions of rigid bead arrays at low shear: accounting for the variation in hydrodynamic stress over the bead surfaces.

    Science.gov (United States)

    Allison, Stuart A; Pei, Hongxia

    2009-06-11

    In this work, we examine the viscosity of a dilute suspension of irregularly shaped particles at low shear. A particle is modeled as a rigid array of nonoverlapping beads of variable size and geometry. Starting from a boundary element formalism, approximate account is taken of the variation in hydrodynamic stress over the surface of the individual beads. For a touching dimer of two identical beads, the predicted viscosity is lower than the exact value by 5.2%. The methodology is then applied to several other model systems including tetramers of variable conformation and linear strings of touching beads. An analysis is also carried out of the viscosity and translational diffusion of several dilute amino acids and diglycine in water. It is concluded that continuum hydrodynamic modeling with stick boundary conditions is unable to account for the experimental viscosity and diffusion data simultaneously. A model intermediate between "stick" and "slip" could possibly reconcile theory and experiment.

  18. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  1. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  2. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  3. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  4. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  7. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  8. The value of the abnormalities of bronchovascular bundles in the diagnosis of diffused lung diseases

    International Nuclear Information System (INIS)

    Li Tieyi; Ji Jingling

    1997-01-01

    To evaluate the abnormalities of bronchovascular bundles in the differential diagnosis of the diffuse lung disease, seventy-two patients with diffuse lung diseases were evaluated, 15 of 72 patients were pathologically proven and the others clinically proven. Of these 72 patients, there were 33 patients with diffuse pulmonary interstitial disease, 5 patients with pulmonary parenchymal disease, 14 patients with bronchial disease, and 20 patients with disseminated disease. All patients had conventional CT scan of the chest, some also had HRCT scan. All CT images were jointly reviewed by two radiologists. The features of the abnormalities of bronchovascular bundles included: (1) Thinning of bronchovascular bundles, predominantly seen in diffuse interstitial disease of lung and chronic bronchitis; (2) thickening of bronchovascular bundles, predominantly seen in interstitial diseases and disseminated lung diseases such as sarcoidosis and lymphangitis carcinomatosis with beaded appearance of bronchovascular bundles; (3) Increased visibility of bronchovascular bundles, predominantly seen in bronchiolitis and disseminated lung diseases. CT features of the abnormalities of bronchovascular bundles are present in 80% of diffuse lung diseases. The features are not specific, but the beaded bronchovascular bundles are always seen in sarcoidosis and lymphangitis carcinomatosis. In making a distinction between idiopathic pulmonary fibrosis and chronic bronchitis complicated with interstitial fibrosis, the position of diaphragm is of value in differential diagnosis, normal or elevated diaphragm is usually seen in the former, while low and flattened diaphragm in the latter. Change of the appearance of bronchovascular bundles from normality to abnormality reflects the process of development of the lung disease

  9. Use of magnetic beads for Gram staining of bacteria in aqueous suspension.

    Science.gov (United States)

    Yazdankhah, S P; Sørum, H; Larsen, H J; Gogstad, G

    2001-12-01

    A Gram staining technique was developed using monodisperse magnetic beads in concentrating bacteria in suspension for downstream application. The technique does not require heat fixation of organisms, electrical power, or a microscope. Gram-negative and Gram-positive bacteria were identified macroscopically based on the colour of the suspension. The bacteria concentrated on magnetic beads may also be identified microscopically.

  10. Chemical–physical characterisation of Early Iron Age glass beads from Central Europe

    Energy Technology Data Exchange (ETDEWEB)

    Agua, F.; Conde, J.F.; Kobylińska, U.; Kobyliński, Z.; García-Heras, M.; Villegas, M.A.

    2017-07-01

    Archaeological excavation of the Institute of Archaeology and Ethnology (Polish Academy of Sciences, PAN) at several Iron Age sites located in West Poland and South Germany has allowed the recovery of an important set of coloured glass beads mostly decorated (6th–4th centuries BC). The present paper summarises the results obtained through the chemical and microstructural characterisation of such beads. The research was carried out by binocular microscope observations, X-ray diffraction, scanning electron microscopy, energy dispersive X-ray spectrometry and visible spectrophotometry. The main objective was to attain information on the production technology and conservation state of these beads. The results indicated that all them were produced with soda lime silicate glass, even though two groups can be separated: (i) beads containing high MgO percentages made from plant ashes as an alkaline source, and (ii) beads containing low MgO percentages made from natron as an alkaline source. As regards decorations, opaque white was obtained from tin oxide, turquoise blue from Cu2+-ions, and opaque yellow from lead antimonate. Additionally, results showed microstructural and microcrystalline differences between some glass beads studied here and other glass beads from Mediterranean areas, dated in the same chronological period. This fact pointed out the valuable role given to these beads by Iron Age communities from Central Europe. (Author)

  11. OBT analysis method using polyethylene beads for limited quantities of animal tissue

    International Nuclear Information System (INIS)

    Kim, S.B.; Stuart, M.

    2015-01-01

    This study presents a polyethylene beads method for OBT determination in animal tissues and animal products for cases where the amount of water recovered by combustion is limited by sample size or quantity. In the method, the amount of water recovered after combustion is enhanced by adding tritium-free polyethylene beads to the sample prior to combustion in an oxygen bomb. The method reduces process time by allowing the combustion water to be easily collected with a pipette. Sufficient water recovery was achieved using the polyethylene beads method when 2 g of dry animal tissue or animal product were combusted with 2 g of polyethylene beads. Correction factors, which account for the dilution due to the combustion water of the beads, are provided for beef, chicken, pork, fish and clams, as well as egg, milk and cheese. The method was tested by comparing its OBT results with those of the conventional method using animal samples collected on the Chalk River Laboratories (CRL) site. The results determined that the polyethylene beads method added no more than 25% uncertainty when appropriate correction factors are used. - Highlights: • Polyethylene beads method for OBT determination in animal tissues and animal products were determined. • The method reduces process time. • The polyethylene beads method added no more than 25% uncertainty when appropriate correction factors are used

  12. Magnetic nanoparticle-loaded alginate beads for local micro-actuation of in vitro tissue constructs.

    Science.gov (United States)

    Alshehri, Awatef M; Wilson, Otto C; Dahal, Bishnu; Philip, John; Luo, Xiaolong; Raub, Christopher B

    2017-11-01

    Magnetic nanoparticles (MNPs) self-align and transduce magnetic force, two properties which lead to promising applications in cell and tissue engineering. However, the toxicity of MNPs to cells which uptake them is a major impediment to applications in engineered tissue constructs. To address this problem, MNPs were embedded in millimeter-scale alginate beads, coated with glutaraldehyde cross-linked chitosan, and loaded in acellular and MDA-MB-231 cancer cell-seeded collagen hydrogels, providing local micro-actuation under an external magnetic field. Brightfield microscopy was used to assess nanoparticle diffusion from the bead. Phase contrast microscopy and digital image correlation were used to track collagen matrix displacement and estimate intratissue strain under magnetic actuation. Coating the magnetic alginate beads with glutaraldehyde-chitosan prevents bulk diffusion of nanoparticles into the surrounding microenvironment. Further, the beads exert force on the surrounding collagen gel and cells, resulting in intratissue strains of 0-10% tunable with bead dimensions, collagen density, and distance from the bead. Cells seeded adjacent to the embedded beads are subjected to strain gradients without loss of cell viability over two days culture. This study describes a simple way to fabricate crosslinked magnetic alginate beads to load in a collagen tissue construct without direct exposure of the construct to nanoparticles. The findings are significant to in vitro studies of mechanobiology in enabling precise control over dynamic mechanical loading of tissue constructs. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Sustained multiple organ ischaemia after transarterial chemoembolization with drug-eluting beads for hepatocellular carcinoma.

    Science.gov (United States)

    Kim, Young Woon; Kwon, Jung Hyun; Nam, Soon Woo; Jang, Jeong Won; Jung, Hyun Suk; Shin, Yu Ri; Park, Eun Su; Shim, Dong Jae

    2018-02-01

    Transarterial chemoembolization (TACE) with drug-eluting beads (DC beads) may enhance drug delivery to tumours and reduce systemic toxicity. TACE with DC beads leads to significantly fewer serious side-effects compared with conventional TACE. A 66-year-old man with hepatocellular carcinoma (HCC) complained of continuous abdominal pain 1 month after TACE with DC beads. At the time of TACE, angiography revealed severe stenosis of both hepatic arteries. The diagnostic work up on admission suggested severe bile duct injury with regional bile duct dilatation, segmental liver and spleen infarction, necrotizing pancreatitis, as well as gastric and duodenal ulcers. The pathology specimens of the duodenum contained DC beads that had passed through small vessels in the connective tissue. The patient's condition appeared to improve after 2 weeks of antibiotic treatment and supportive care, but new multifocal liver and spleen infarction subsequently developed. After 2 months, he was well enough to be discharged. His HCC partially responded to the TACE with DC beads but eventually progressed and he died after 11 months. The present case report highlights unexpected ongoing multiple organ ischaemia in a 66-year-old man treated for HCC using TACE with DC beads. The use of TACE with DC beads should be carefully considered in patients with vascular strictures or aberrant blood supply.

  14. EXPERIMENTAL TESTING OF DRAW-BEAD RESTRAINING FORCE IN SHEET METAL FORMING

    Institute of Scientific and Technical Information of China (English)

    J.H. Yang; J. Chen; D.N. He; X. Y. Ruan

    2003-01-01

    Due to complexities of draw-bead restraining force calculated according to theory anddepending on sheet metal forming properties experiment testing system, a simplifiedmethod to calculate draw-bead restraining force is put forward by experimental methodin cup-shaped drawing process. The experimental results were compared with numer-ical results and proved agreement. It shows the method is effective.

  15. Evaluation of the Seismic Characterision of Select Engineered Nanoparticles in Saturated Glass Beads

    Science.gov (United States)

    A laboratory testing apparatus was developed for the study of seismic body wave propagation through nanoparticles dispersed in pore fluid that is essentially saturating glass beads. First, the responses of water-saturated glass bead specimens were studied to establish baseline si...

  16. Preparation of chitosan/amino multiwalled carbon nanotubes nanocomposite beads for bilirubin adsorption in hemoperfusion.

    Science.gov (United States)

    Zong, Wenhui; Chen, Jian; Han, Wenyan; Chen, Jie; Wang, Yue; Wang, Weichao; Cheng, Guanghui; Ou, Lailiang; Yu, Yaoting

    2018-01-01

    Chitosan-carbon nanotube composite beads combines the advantages of chitosan in forming a stable biocompatible framework and carbon nanotube that provide nanometer effects (high strength and high specific surface area etc.). In this study, chitosan/amino multiwalled carbon nanotubes (CS/AMWCNT) composite beads was prepared by phase-inversion method, in which CS and AMWCNT was crosslinked by ethylene glycol diglycidyl ether (EGDE). The CS/AMWCNT nanocomposite beads produced has been characterized by BET, SEM, TGA, and Raman spectroscopy which exhibited enhanced thermal stability due to the incorporation of AMWCNT. Mechanical test results showed that mechanical strength of the CS/AMWCNT composite beads was significantly enhanced when comparing to unmodified chitosan beads, the breakage percentage decreased from 34.1% to 0.67%. The adsorption capacity for bilirubin was measured in PBS and BSA solutions, and the CS/AMWCNT composite beads with 5 wt% AMWCNT showed much higher adsorption capacity (12.7 mg/g in PBS and 7.6 mg/g in BSA) to bilirubin than chitosan beads (8.5 mg/g in PBS and 4.2 mg/g in BSA). Our nanocomposite beads with excellent hemocompatibility has a high potential application in blood purification as an efficient adsorbent for bilirubin. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 96-103, 2018. © 2016 Wiley Periodicals, Inc.

  17. Tunable bead-on-string microstructures fabricated by mechano-electrospinning

    International Nuclear Information System (INIS)

    Bu Ningbin; Huang Yongan; Deng Huixu; Yin Zhouping

    2012-01-01

    In this paper, bead-on-string microstructures are fabricated by the mechano-electrospinning (MES) process in a continuously tunable manner. The thin jet is pulled onto the substrate by the stable electric field force and tunable mechanical drawing force, and then the bead-on-string structures are generated by means of the force exerted on the jet, which changes from capillary force and resisting viscosity force to friction force at the contact point in the horizontal direction. In a stable bead-on-string formation process, one cycle can be divided into three stages from the point of view of the jet behaviour: being anchored, being stretched, and skipping. The bead size and the bead gap are continuously tunable through the MES process. The fabrication mechanisms of the bead-on-string microstructure are uncovered through theoretical analysis and experimental characterization. When a critical velocity is achieved, the jet directly falls on the substrate without accumulation since the mechanical drawing force in the horizontal direction overtakes the capillary force, which leads the bead-on-string microstructures to a continuous fibre line. It is a flexible and highly controllable method to fabricate bead-on-string microstructures.

  18. Concanavalin A immobilized magnetic poly(glycidyl methacrylate) beads for prostate specific antigen binding.

    Science.gov (United States)

    Idil, Neslihan; Perçin, Işık; Karakoç, Veyis; Yavuz, Handan; Aksöz, Nilüfer; Denizli, Adil

    2015-10-01

    The aim of this study was to prepare Concanavalin A (Con A) immobilized magnetic poly(glycidyl methacrylate) (mPGMA) beads for prostate specific antigen (PSA) binding and to study binding capacities of the beads using lectin-glycoprotein interactions. Firstly, iron oxide nanoparticles were synthesized by co-precipitation method and then, beads were synthesized by dispersion polymerization in the presence of iron oxide nanoparticles. Con A molecules were both covalently immobilized onto the beads directly and through the spacer arm (1,6-diaminohexane-HDMA). The total PSA and free PSA binding onto the mPGMA-HDMA-Con A beads were higher than that of the mPGMA-Con A beads. Maximum PSA binding capacity was observed as 91.2 ng/g. Approximately 45% of the bound PSA was eluted by using 0.1 M mannose as elution agent. The mPGMA-HDMA-Con A beads could be reused without a remarkable decrease in the binding capacities after 5 binding-desorption cycles. Serum fractions were analyzed using SDS-PAGE. The mPGMA-HDMA-Con A beads could be useful for the detection of PSA and suggested as a model system for other glycoprotein biomarkers. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. In vivo cleansing efficacy of biodegradable exfoliating beads assessed by skin bioengineering techniques.

    Science.gov (United States)

    Kitsongsermthon, J; Duangweang, K; Kreepoke, J; Tansirikongkol, A

    2017-11-01

    The plastic microbeads, used in many cleansers, will be banned in cosmetic and personal care products within 2017 since they are non-degradable and can disturb the living organisms in water reservoirs. Various choices of biodegradable beads are commercially available, but their efficacy has not been proven yet. This study aimed to compare the cleansing efficacy in dirt and sebum removal aspects of three types of exfoliating beads. The gel scrubs with polyethylene (PE) beads, mannan beads or wax beads, were formulated and evaluated for their stability. The in vivo evaluation was done in 38 healthy volunteers and the skin irritation, efficacy for dirt and sebum removal were measured by Mexameter ® , Colorimeter ® , and Sebumeter ® , respectively. The selected gel scrubs did not cause an irritation in any volunteers. The differences in dirt residues between before and after scrubbing were not statistically significant among three gel scrubs and the similar result was also reported in the sebum removal study. All gel scrubs demonstrated the comparable cleansing efficacy in term of dirt and sebum removal. Thus, mannan beads and wax beads may be replaced non-biodegradable PE beads to achieve the similar cleansing effect. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Capture of DNA in microfluidic channel using magnetic beads: increasing capture efficiency with integrated microfluidic mixer

    DEFF Research Database (Denmark)

    Lund-Olesen, Torsten; Dufva, Hans Martin; Hansen, Mikkel Fougt

    2007-01-01

    We have studied the hybridization of target DNA in solution with probe DNA on magnetic beads immobilized on the channel sidewalls in a magnetic bead separator. The hybridization is carried out under a liquid flow and is diffusion limited. Two systems are compared: one with a straight microfluidic...... place on the surface in a microfluidic system....

  1. On-chip measurement of the Brownian relaxation frequency of magnetic beads using magnetic tunneling junctions

    DEFF Research Database (Denmark)

    Donolato, M.; Sogne, E.; Dalslet, Bjarke Thomas

    2011-01-01

    We demonstrate the detection of the Brownian relaxation frequency of 250 nm diameter magnetic beads using a lab-on-chip platform based on current lines for exciting the beads with alternating magnetic fields and highly sensitive magnetic tunnel junction (MTJ) sensors with a superparamagnetic free...

  2. Polymerized serum albumin beads for use as slow-release adjuvants

    International Nuclear Information System (INIS)

    Martin, M.E.D.

    1987-02-01

    Experimental vaccines have been made by covalently bonding virus particles into polymerized rabbit serum albumin beads. Using Nodamura virus as a model antigen, these model vaccines induced specific humoral antibody production, comparable with that achieved using Freund's adjuvants. Virus specific antibodies were also induced when Nodamura virus was covalently attached to the bead surface using different crosslinkers. However, when poliovirus type 2 (Sabin strain) was polymerized into beads, the levels of neutralizing antibodies were insignificant compared with control aqueous vaccines. The synthetic immunostimulator, muramyl dipeptide, was included with bead vaccines in an attempt to potentiate the immune response. Immunostimulation is achieved by a slow release of antigen coinciding with the gradual breakdown of bead structure. Methods used include radio-iodination and radioimmunoassay. 65 figs., 6 tabs., 173 refs

  3. Preparation and Characterization of Highly Spherical Silica-titania Aerogel Beads with High Surface Area

    Directory of Open Access Journals (Sweden)

    YU Yu-xi

    2017-02-01

    Full Text Available The silica-titania aerogel beads were synthesized through sol-gel reaction followed by supercritical drying, in which TEOS and TBT as co-precursors, EtOH as solvents, HAC and NH3·H2O as catalysts. The as-prepared aerogel beads were characterized by SEM,TEM,XRD,FT-IR,TG-DTA and nitrogen adsorption-desorption. The results indicate that the diameter distribution of beads are between 1-8mm, the average diameter of beads is 3.5mm. The aerogel beads have nanoporous network structure with high specific surface area of 914.5m2/g, and the TiO2 particles are distributed in the aerogel uniformly, which keep the anatase crystal under high temperature.

  4. Investigation on rare earth magnets recycling by organophosphoric extractant encapsulated polymeric beads for separation of dysprosium

    International Nuclear Information System (INIS)

    Yadav, Kartikey K.; Singh, D.K.; Kain, V.

    2017-01-01

    Rare earth elements (REEs) are a basic requirement of the electronics and new industries including green technology. In the present work an organophosphoric extractant encapsulating polyethersulfone (PES) beads has been developed and employed for dysprosium (Dy) separation from aqueous stream. Polyethersulfonic beads encapsulating PC88A were prepared by phase inversion method. During the synthesis of the beads, preparatory parameters were also optimized to obtain best suited beads which were subsequently characterized for their encapsulation capacity and micro structural investigation. The results obtained in the present investigation suggested that PES/PVAJPC88A composite beads could be used for separation of rare earths from aqueous medium obtained from the solubilisation of magnetic scrap materials

  5. Predicting of bead undercut defects in high-speed gas metal arc welding (GMAW)

    Institute of Scientific and Technical Information of China (English)

    Wen-jing XU; Chuan-song WU; De-gang ZOU

    2008-01-01

    In the gas metal arc welding (GMAW) process, when the welding speed reaches a certain threshold, there will be an onset of weld bead undercut defects which limit the further increase of the welding speed. Establishing a mathematical model for high-speed GMAW to predict the tendency of bead undercuts is of great significance to pre-vent such defects. Under the action of various forces, the transferred metal from filler wire to the weld pool, and the geometry and dimension of the pool itself decide if the bead undercut occurs or not. The previous model simpli-fied the pool shape too much. In this paper, based on the actual weld pool geometry and dimension calculated from a numerical model, a hydrostatic model for liquid metal surface is used to study the onset of bead undercut defects in the high-speed welding process and the effects of dif-ferent welding parameters on the bead undercut tendency.

  6. Speciation-dependent studies on removal of arsenic by iron-doped calcium alginate beads

    International Nuclear Information System (INIS)

    Banerjee, Anupam; Nayak, Dalia; Lahiri, Susanta

    2007-01-01

    This work aims to study the differential attitude of Fe-doped calcium alginate (Fe-CA) beads towards As(III) and As(V) compounds so that speciation-dependent environmentally sustainable methodologies can be developed for removal of arsenic from contaminated water. Throughout the experiment, 76 As has been used as precursor of stable arsenic. The affinity of As(V) towards the Fe-CA beads is greater than that of As(III). Removal efficiency of Fe-CA beads for As(V) increases with increasing number of beads and longer shaking times. At pH 3, 30 Fe-CA beads remove As(V) completely from a solution containing 20 mg kg -1 As(V). The technique has been successfully applied to the ground water collected from an arsenic-contaminated area

  7. Hierarchically templated beads with tailored pore structure for phosphopeptide capture and phosphoproteomics

    DEFF Research Database (Denmark)

    Wierzbicka, Celina; Torsetnes, Silje B.; Jensen, Ole N.

    2017-01-01

    Two templating approaches to produce imprinted phosphotyrosine capture beads with a controllable pore structure are reported and compared with respect to their ability to enrich phosphopeptides from a tryptic peptide mixture. The beads were prepared by the polymerization of urea-based host monomers...... and crosslinkers inside the pores of macroporous silica beads with both free and immobilized template. In the final step the silica was removed by fluoride etching resulting in mesoporous polymer replicas with narrow pore size distributions, pore diameters ≈ 10 nm and surface area > 260 m2 g-1. The beads displayed...... pronounced phosphotyrosine affinity and selectivity in binding tests using model peptides in acetonitrile rich solutions with a performance surpassing solution polymerized bulk imprinted materials. Tests of the beads for the enrichment of phosphopeptides from tryptic digests of twelve proteins revealed both...

  8. Formulation of Synthesized Zinc Oxide Nanopowder into Hybrid Beads for Dye Separation

    Directory of Open Access Journals (Sweden)

    H. Shokry Hassan

    2014-01-01

    Full Text Available The sol-gel prepared zinc oxide nanopowder was immobilized onto alginate-polyvinyl alcohol polymer blend to fabricate novel biocomposite beads. Various physicochemical characterization techniques have been utilized to identify the crystalline, morphological, and chemical structures of both the fabricated zinc oxide hybrid beads and their corresponding zinc oxide nanopowder. The thermal stability investigations demonstrate that ZnO nanopowder stability dramatically decreased with its immobilization into the polymeric alginate and PVA matrix. The formulated beads had very strong mechanical strength and they are difficult to be broken up to 1500 rpm. Moreover, these hybrid beads are chemically stable at the acidic media (pH < 7 especially within the pH range of 2–7. Finally, the applicability of the formulated ZnO hybrid beads for C.I. basic blue 41 (BB41 decolorization from aqueous solution was examined.

  9. On-chip measurements of Brownian relaxation of magnetic beads with diameters from 10 nm to 250 nm

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Hansen, Mikkel Fougt

    2013-01-01

    We demonstrate the use of planar Hall effect magnetoresistive sensors for AC susceptibility measurements of magnetic beads with frequencies ranging from DC to 1 MHz. This wide frequency range allows for measuring Brownian relaxation of magnetic beads with diameters ranging from 10 nm to 250 nm....... Brownian relaxation is measured for six different magnetic bead types and their hydrodynamic diameters are determined. The hydrodynamic diameters are found to be within 40% of the nominal bead diameters. We discuss the applicability of the different bead types for volume-based biosensing with respect...... to sedimentation, magnetic trapping, and signal per bead. Among the investigated beads, we conclude that the beads with a nominal diameter of 80 nm are best suited for future on-chip volume-based biosensing experiments using planar Hall effect sensors....

  10. Parallel RNA extraction using magnetic beads and a droplet array.

    Science.gov (United States)

    Shi, Xu; Chen, Chun-Hong; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

    2015-02-21

    Nucleic acid extraction is a necessary step for most genomic/transcriptomic analyses, but it often requires complicated mechanisms to be integrated into a lab-on-a-chip device. Here, we present a simple, effective configuration for rapidly obtaining purified RNA from low concentration cell medium. This Total RNA Extraction Droplet Array (TREDA) utilizes an array of surface-adhering droplets to facilitate the transportation of magnetic purification beads seamlessly through individual buffer solutions without solid structures. The fabrication of TREDA chips is rapid and does not require a microfabrication facility or expertise. The process takes less than 5 minutes. When purifying mRNA from bulk marine diatom samples, its repeatability and extraction efficiency are comparable to conventional tube-based operations. We demonstrate that TREDA can extract the total mRNA of about 10 marine diatom cells, indicating that the sensitivity of TREDA approaches single-digit cell numbers.

  11. A dynamic bead-based microarray for parallel DNA detection

    International Nuclear Information System (INIS)

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

    2011-01-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  12. Echicetin coated polystyrene beads: a novel tool to investigate GPIb-specific platelet activation and aggregation.

    Directory of Open Access Journals (Sweden)

    Alexey Navdaev

    Full Text Available von Willebrand factor/ristocetin (vWF/R induces GPIb-dependent platelet agglutination and activation of αIIbβ3 integrin, which also binds vWF. These conditions make it difficult to investigate GPIb-specific signaling pathways in washed platelets. Here, we investigated the specific mechanisms of GPIb signaling using echicetin-coated polystyrene beads, which specifically activate GPIb. We compared platelet activation induced by echicetin beads to vWF/R. Human platelets were stimulated with polystyrene beads coated with increasing amounts of echicetin and platelet activation by echicetin beads was then investigated to reveal GPIb specific signaling. Echicetin beads induced αIIbβ3-dependent aggregation of washed platelets, while under the same conditions vWF/R treatment led only to αIIbβ3-independent platelet agglutination. The average distance between the echicetin molecules on the polystyrene beads must be less than 7 nm for full platelet activation, while the total amount of echicetin used for activation is not critical. Echicetin beads induced strong phosphorylation of several proteins including p38, ERK and PKB. Synergistic signaling via P2Y12 and thromboxane receptor through secreted ADP and TxA2, respectively, were important for echicetin bead triggered platelet activation. Activation of PKG by the NO/sGC/cGMP pathway inhibited echicetin bead-induced platelet aggregation. Echicetin-coated beads are powerful and reliable tools to study signaling in human platelets activated solely via GPIb and GPIb-triggered pathways.

  13. Effect of Heat Input on Geometry of Austenitic Stainless Steel Weld Bead on Low Carbon Steel

    Science.gov (United States)

    Saha, Manas Kumar; Hazra, Ritesh; Mondal, Ajit; Das, Santanu

    2018-05-01

    Among different weld cladding processes, gas metal arc welding (GMAW) cladding becomes a cost effective, user friendly, versatile method for protecting the surface of relatively lower grade structural steels from corrosion and/or erosion wear by depositing high grade stainless steels onto them. The quality of cladding largely depends upon the bead geometry of the weldment deposited. Weld bead geometry parameters, like bead width, reinforcement height, depth of penetration, and ratios like reinforcement form factor (RFF) and penetration shape factor (PSF) determine the quality of the weld bead geometry. Various process parameters of gas metal arc welding like heat input, current, voltage, arc travel speed, mode of metal transfer, etc. influence formation of bead geometry. In the current experimental investigation, austenite stainless steel (316) weld beads are formed on low alloy structural steel (E350) by GMAW using 100% CO2 as the shielding gas. Different combinations of current, voltage and arc travel speed are chosen so that heat input increases from 0.35 to 0.75 kJ/mm. Nine number of weld beads are deposited and replicated twice. The observations show that weld bead width increases linearly with increase in heat input, whereas reinforcement height and depth of penetration do not increase with increase in heat input. Regression analysis is done to establish the relationship between heat input and different geometrical parameters of weld bead. The regression models developed agrees well with the experimental data. Within the domain of the present experiment, it is observed that at higher heat input, the weld bead gets wider having little change in penetration and reinforcement; therefore, higher heat input may be recommended for austenitic stainless steel cladding on low alloy steel.

  14. Echicetin Coated Polystyrene Beads: A Novel Tool to Investigate GPIb-Specific Platelet Activation and Aggregation

    Science.gov (United States)

    Petunin, Alexey; Clemetson, Kenneth J.; Gambaryan, Stepan; Walter, Ulrich

    2014-01-01

    von Willebrand factor/ristocetin (vWF/R) induces GPIb-dependent platelet agglutination and activation of αIIbβ3 integrin, which also binds vWF. These conditions make it difficult to investigate GPIb-specific signaling pathways in washed platelets. Here, we investigated the specific mechanisms of GPIb signaling using echicetin-coated polystyrene beads, which specifically activate GPIb. We compared platelet activation induced by echicetin beads to vWF/R. Human platelets were stimulated with polystyrene beads coated with increasing amounts of echicetin and platelet activation by echicetin beads was then investigated to reveal GPIb specific signaling. Echicetin beads induced αIIbβ3-dependent aggregation of washed platelets, while under the same conditions vWF/R treatment led only to αIIbβ3-independent platelet agglutination. The average distance between the echicetin molecules on the polystyrene beads must be less than 7 nm for full platelet activation, while the total amount of echicetin used for activation is not critical. Echicetin beads induced strong phosphorylation of several proteins including p38, ERK and PKB. Synergistic signaling via P2Y12 and thromboxane receptor through secreted ADP and TxA2, respectively, were important for echicetin bead triggered platelet activation. Activation of PKG by the NO/sGC/cGMP pathway inhibited echicetin bead-induced platelet aggregation. Echicetin-coated beads are powerful and reliable tools to study signaling in human platelets activated solely via GPIb and GPIb-triggered pathways. PMID:24705415

  15. Floating-bioadhesive gastroretentive Caesalpinia pulcherrima-based beads of amoxicillin trihydrate for Helicobacter pylori eradication.

    Science.gov (United States)

    Thombre, Nilima A; Gide, Paraag S

    2016-01-01

    An oral dosage form containing floating bioadhesive gastroretentive microspheres forms a stomach-specific drug delivery system for the treatment of Helicobacter pylori. To prepare and evaluate controlled release floating bioadhesive gastroretentive chitosan-coated amoxicillin trihydrate-loaded Caesalpinia pulcherrima galactomannan (CPG)-alginate beads (CCA-CPG-A), for H. pylori eradication. CCA-CPG-A beads were prepared by ionotropic gelation, using 2(3) factorial design with quantity of drug, combination of CPG with sodium alginate and concentration of calcium chloride as variables. Beads facilitated mucoadhesion to gastric mucosa with floating nature caused by chitosan coating for wide distribution throughout GIT. Developed beads were evaluated for characteristics like beads size-morphology, entrapment efficiency, DSC, XRD, FTIR, swelling ratio, in vitro mucoadhesion, in vitro drug release, in vitro floating and in vitro H. pylori growth inhibition studies. CCA-CPG-A beads were studied in Wistar rats for in vivo gastric mucoadhesion, in vivo H. pylori growth inhibition studies using PCR amplification of isolated DNA, rapid urease test. Developed beads possess drug release of 79-92%, entrapment efficiency of 65-89%, mucoadhesion of 61-89%. In vivo mucoadhesion study showed more than 85% mucoadhesion of beads even after 7th hour. In vitro-in vivo growth inhibition study showed complete eradication of H. pylori. CPG-alginate and chitosan in beads interacts with gastric mucosubstrate surface for prolonged gastric residence with floating bioadhesion mechanism for H. pylori eradication in rats. Floating bioadhesive CCA-CPG-A beads offer a promising drug delivery system for H. pylori eradication at lower dose, reduced adverse effect and enhance bioavailability.

  16. Antimony sorption properties of chitosan - nano TiO2 composite beads

    International Nuclear Information System (INIS)

    Nishad, Padala Abdul; Bhaskarapillai, Anupkumar; Velmurugan, Sankaralingam

    2015-01-01

    Routine decontamination campaigns of nuclear reactors are generally effective in removing various radionuclides such as cobalt, caesium, etc., and bring down the radiation field. However, during some of the decontamination campaigns, the radiation field at some surfaces was seen to have actually gone up. This was found to be due to lack of removal of antimony isotopes by the regular ion exchange resins used, which subsequently deposited over out of core surfaces leading to increased radiation field on those surfaces. Thus there exists a need for efficient antimony removal system. We have synthesised nano titania impregnated - epichlorohydrin crosslinked chitosan beads, which were found to have high sorption capacity for antimony. The beads, which were synthesised in formats suitable for large scale (column mode) applications, were shown to be effective sorbent of antimony in both +3 and +5 oxidation states. The sorbent exhibited complete removal of antimony from its aqueous solutions of concentration ranging from 150 ppb to 120 ppm. In order to understand the sorption mechanism and to fine tune the bead composition, the effect of crosslinker concentration used during the synthesis on the swelling and sorption properties of the beads was investigated in detail. The variation effected significant changes in physical parameters such as bead diameter, swelling ratio, equilibrium water content and true wet density. Sorption capacity, unlike with regular resins, was found to increase with increase in crosslinker amount. The antimony sorption capacity of the crosslinked beads prepared by crosslinking 0.3 g uncrosslinked beads with 6.4 mmol epichlorohydrin (crosslinker) was 493 μmol/g. Non-crosslinked beads showed a capacity of 75 μmol/g, while the crosslinked beads made with the least amount of crosslinker (0.64 mmol per 0.3 g beads) showed a capacity of 133 μmol/g. These results indicate the possible involvement of the crosslinker in the sorption. (author)

  17. The lungs

    International Nuclear Information System (INIS)

    Macey, D.J.; Marshall, R.

    1982-01-01

    Currently emission tomography of the lungs is only practical for perfusion images with sup(99m)Tc microaggregates and ventilation images with sup(81m)Kr. The following topics are touched on: the rotating gamma camera single photon ECT system, spatial resolution and linearity, resolution in phantom studies, area and volume studies, quantitation studies, with particular reference to the authors' experience of perfusion and ventilation in investigations of pulmonary embolism. (U.K.)

  18. [Evaluation of TB-beads assay utilizing the technique of magnetic beads--an innovative assay method for detection of acid fast bacilli].

    Science.gov (United States)

    Ohkuma, Masanori; Ikeda, Katsuyoshi; Obayashi, Konen; Ando, Yukio; Koriyama, Toyoyasu; Kimu, Minhi; Hirose, Nobuyuki; Nagasawa, Zenzo; Miyamoto, Hiroshi

    2012-01-01

    The centrifuge method with the use of Semi-Alkalin Proteinase (SAP) and NALC-NaOH, recommended by the "2007 edition of the assay guideline for detection of Mycobacterium tuberculosis," has significantly contributed to improving the sensitivities and specificities of both smear and culture tests for detection of acid fast bacilli (AFB). However, this method poses some challenges in terms of its cumbersome and time-consuming assay protocol. "TB-beads (Kyokuto Pharmaceutical Industrial Co., Ltd.)" is a newly-developed method for detection of AFB utilizing magnetic beads. We evaluated the quality of this method in comparison with the centrifuge method, focusing on the results of smear and culture tests. This evaluation study was conducted using both 5 positive and 5 negative sputum samples. The sensitivity of TB-beads for fluorescent smear tests, conducted using "Acri-stain," was almost the same as that of the centrifuge method. One advantage of TB-beads, however, was that it was very convenient to practice microscopic observation due to the clear background of the smeared glass slides. The comparison of the contamination rates between the two methods showed that TB-beads suggested significantly lower contamination rates. The centrifuge method resulted in 50% and 60% of contamination rates for HK Semisolid Isolation Medium and BacT/ALERT MP, respectively. On the other hand, the contamination rates of TB-beads for both of the culture methods were only 10%. With regard to the 5 positive sputum samples, the comparison of the detection rates between the centrifuge and TB-Beads method was made utilizing Myco Acid, Ogawa K, and BacT/ALERT MP. The TB-Beads method suggested higher detection rates for Myco Acid and Ogawa K, while there were no significant differences between the two methods for BacT/ALERT MP (16-23 days). TB-beads is an easy method that allows to simplify the process of smear tests, and contributes to significantly reducing the contamination rate of culture

  19. Neutron activation analysis of AD 1660-1930 European copper-coloured blue glass trade beads from Ontario, Canada

    International Nuclear Information System (INIS)

    Kenyon, I.; Hancock, R.G.V.; Aufreiter, S.

    1995-01-01

    Blue glass trade beads from well-dated late seventeenth- to early twentieth-century sites and collections have been analysed non-destructively by instrumental neutron activation analysis. The beads display enough variations in their elemental contents to allow us to characterize the different chemistries. The implication of these results is that similar chemical analyses of blue beads from undated archaeological sites may be used to help date the sites, since each bead chemistry has a specific earliest period. (author)

  20. Preparation of Macroporous Poly (vinyl alcohol-co-triallyl isocyanurate) Beads Bearing Aminocarboxylic Acid as Functional Groups by Suspension Polymerization

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Macroporous poly (vinyl acetate-co-triallyl isocyanurate) beads were prepared with suspension polymerization method. The copolymer beads were then transformed into poly (vinyl alcohol-co-triallyl isocyanurate) by ester exchange reaction. Aminocarboxylic acids were immobilized on the copolymer beads by the esterification of hydroxyl groups with diethyl-lenetriaminepentaacetic bisanhydride. The weak acid exchange capacities, specific surface areas and mean pore diameters of the resultant resin beads were measured.

  1. Hyperlucent lung

    International Nuclear Information System (INIS)

    Jimenez-Gutierrez, Florana; Soto-Quiros, Manuel E.

    2007-01-01

    Unilateral hyperlucent lung is also known as Swyer-James Syndrome, Macleod Syndrome or lobular or unilateral emphysema. It is an uncommon disease characterized by lung or unilateral lobe hiperlucency associated to an air trapping upon expiration. As regards to etiology, this syndrome is considered to be an acquired disease that appears secondary to respiratory infections during the early years of life, probably bronchiolitis and/ or viral pneumonia. The clinical presentation varies among patients. Some of them are asymptomatic, others present a history of recurrent episodes of pulmonary infections from early years of life or present effort dyspnea. The diagnosis is usually made accidentally by a chest radiograph in a child with history of respiratory infections or in an adult during a routine chest x- ray in an asymptomatic person. It is important to differentiate this syndrome from other causes of unilateral pulmonary hiperlucency on conventional chest x-rays. Few cases of Swyer-James Syndrome in children have been reported, it is presented the clinical case of a patient who had a parainfluenza 3 bronchopneumonia when he was a month and eighteen days of age. The differential diagnosis of this syndrome should be done with other thoracic entities that diminish the radiological pulmonary unilateral density. A case of a child who is the bearer of hyperlucent lung is described. (author) [es

  2. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  3. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  4. Development and evaluation of alginate-chitosan gastric floating beads loading with oxymatrine solid dispersion.

    Science.gov (United States)

    Liu, Yanhua; Chen, Lihong; Zhou, Chengming; Yang, Jianhong; Hou, Yanhui; Wang, Wenping

    2016-01-01

    Oxymatrine (OM) can be metabolized to matrine in gastrointestinal ileocecal valve after oral administration, which affects pharmacological activity and reduce bioavailability of OM. A type of multiple-unit alginate-chitosan (Alg-Cs) floating beads was prepared by the ionotropic gelation method for gastroretention delivery of OM. A solid dispersion technique was applied and incorporated into beads to enhance the OM encapsulation efficiency (EE) and sustain the drug release. The surface morphology and internal hollow structure of beads were evaluated using optical microscopy and scanning electron microscopy (SEM). The developed Alg-Cs beads were spherical in shape with hollow internal structure and had particle size of 3.49 ± 0.09 mm and 1.33 ± 0.09 mm for wet and dried beads. Over 84% of the optimized OM solid dispersion-loaded Alg-Cs beads were able to continuously float over the simulated gastric fluid for 12 h in vitro. The OM solid dispersion-loaded Alg-Cs beads showed drug EE of 67.07%, which was much higher than that of beads loading with pure OM. Compared with the immediate release of OM capsules and pure OM-loaded beads, the release of OM from solid dispersion-loaded Alg-Cs beads was in a sustained-release manner for 12 h. Prolonged gastric retention time of over 8.5 h was achieved for OM solid dispersion-loaded Alg-Cs floating beads in healthy rabbit in in vivo floating ability evaluated by X-ray imaging. The developed Alg-Cs beads loading with OM solid dispersion displayed excellent performance features characterized by excellent gastric floating ability, high drug EE and sustained-release pattern. The study illustrated the potential use of Alg-Cs floating beads combined with the solid dispersion technique for prolonging gastric retention and sustaining release of OM, which could provide a promising drug delivery system for gastric-specific delivery of OM for bioavailability enhancement.

  5. 77 FR 12311 - Guidance for Industry on Size of Beads in Drug Products Labeled for Sprinkle; Availability

    Science.gov (United States)

    2012-02-29

    ...] Guidance for Industry on Size of Beads in Drug Products Labeled for Sprinkle; Availability AGENCY: Food and... the availability of a guidance for industry entitled ``Size of Beads in Drug Products Labeled for... Evaluation and Research's (CDER's) current thinking on appropriate size ranges for beads in drug products...

  6. 76 FR 3144 - Draft Guidance for Industry on Size of Beads in Drug Products Labeled for Sprinkle; Availability

    Science.gov (United States)

    2011-01-19

    ...] Draft Guidance for Industry on Size of Beads in Drug Products Labeled for Sprinkle; Availability AGENCY... announcing the availability of a draft guidance for industry entitled ``Size of Beads in Drug Products... Evaluation and Research's (CDER's) current thinking on appropriate size ranges for beads in drug products...

  7. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  8. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  9. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  10. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  12. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  13. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  14. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  15. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  16. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  17. Analysis of surface properties of fixed and live cells using derivatized agarose beads.

    Science.gov (United States)

    Navarro, Vanessa M; Walker, Sherri L; Badali, Oliver; Abundis, Maria I; Ngo, Lylla L; Weerasinghe, Gayani; Barajas, Marcela; Zem, Gregory; Oppenheimer, Steven B

    2002-01-01

    A novel assay has been developed for the histochemical characterization of surface properties of cells based on their adhesion to agarose beads derivatized with more than 100 types of molecules, including sugars, lectins and other proteins, and amino acids. The assay simply involves mixing small quantities of washed cells and beads in droplets on glass microscope slides and determining to which beads various cell types adhere. Distilled water was found to be the best medium for this assay because added ions or molecules in other media inhibit adhesion in some cases. Many cells, however, cannot tolerate distilled water. Here we show that cells fixed with either of two fixatives (1% formaldehyde or Prefer fixative) displayed similar bead-binding properties as did live cells. Specificity of cell-bead binding was tested by including specific free molecules in the test suspensions in hapten-type inhibition experiments. If a hapten compound inhibited live-cell adhesion to a specific bead, it also inhibited fixed-cell adhesion to a specific bead. The results of these experiments suggest that fixed cells display authentic surface properties, opening the door for the use of this assay with many cell types that cannot tolerate distilled water.

  18. Formation of beads-on-a-string structures during the pinch-off of viscoelastic filaments

    Science.gov (United States)

    Bhat, Pradeep; Appathurai, Santosh; Harris, Michael; Pasquali, Matteo; McKinley, Gareth; Basaran, Osman

    2009-11-01

    Breakup of liquid filaments is omnipresent in nature and technology. When a filament formed by placing a drop of syrup between a thumb and a forefinger is stretched by pulling apart the two fingers, it resembles a thinning cylinder. If the same experiment is repeated with saliva, the filament's morphology close to pinch-off resembles that of beads of several sizes interconnected by slender threads. Although there is general agreement that formation of such beads-on-a-string (BOAS) morphology only occurs for viscoelastic fluids, the mechanism behind this phenomenon remains unclear and controversial. The physics of formation of BOAS structures is probed here by simulation which reveals that viscoelasticity alone does not give rise to a small, satellite bead between two much larger main drops (beads) but that inertia is required for its formation. Viscoelasticity, however, enhances the growth of the satellite bead and delays pinch-off, which leads to a relatively long-lived, stable beaded filament. The new simulations also show the formation of second-generation sub-satellite beads in certain cases, as observed experimentally but not, heretofore, predicted theoretically.

  19. Formation of beads-on-a-string structures during break-up of viscoelastic filaments

    Science.gov (United States)

    Bhat, Pradeep P.; Appathurai, Santosh; Harris, Michael T.; Pasquali, Matteo; McKinley, Gareth H.; Basaran, Osman A.

    2010-08-01

    Break-up of viscoelastic filaments is pervasive in both nature and technology. If a filament is formed by placing a drop of saliva between a thumb and forefinger and is stretched, the filament's morphology close to break-up corresponds to beads of several sizes interconnected by slender threads. Although there is general agreement that formation of such beads-on-a-string (BOAS) structures occurs only for viscoelastic fluids, the underlying physics remains unclear and controversial. The physics leading to the formation of BOAS structures is probed by numerical simulation. Computations reveal that viscoelasticity alone does not give rise to a small, satellite bead between two much larger main beads but that inertia is required for its formation. Viscoelasticity, however, enhances the growth of the bead and delays pinch-off, which leads to a relatively long-lived beaded structure. We also show for the first time theoretically that yet smaller, sub-satellite beads can also form as seen in experiments.

  20. Development of alginate gel beads with a potential use in the treatment against acute lead poisoning.

    Science.gov (United States)

    Tahtat, Djamel; Bouaicha, Malika Nawel; Benamer, Samah; Nacer-Khodja, Assia; Mahlous, Mohamed

    2017-12-01

    The objective was to develop alginate beads that could adsorb lead ions in gastric pH, in view to preconize their use in gastric lavage following lead poisoning. The swelling measurements of both, dry and hydrated beads, were carried out in simulated gastric fluid (SGF). The sorption kinetics was examined at lead concentrations ranging from 50 to 200mg/l. Calcium released during the sorption process was investigated. The swelling rate of the dry beads increased considerably with time increase and reached the equilibrium at 736% after 240min; concerning the hydrated beads, the equilibrium swelling reached 139% after 180min. The adsorption of Pb (II) in SGF by dry beads increased with the increase of time and initial lead concentration. The adsorption kinetics of Pb ions by hydrated alginate beads indicated a rapid binding of Pb ions to the sorbent during the first 15min for all the concentrations, followed by a slow increase until the equilibrium was reached after 90min. The adsorption capacity of Pb ions increased with the increase of the storage time in water at 4°C and with the weight. The amount of Ca 2+ released by the beads increased with the increase of Pb ions a rate. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Chemical and toxicological assessment of arsenic sorption onto Fe-sericite composite powder and beads.

    Science.gov (United States)

    Kim, Jiwon; Lee, Cheongho; Lee, Seung Mok; Lalhmunsiama; Jung, Jinho

    2018-01-01

    Batch sorption and leaching of arsenic (1-30mgL -1 ) on Fe-sericite composite powder and beads were investigated in this study. Fe-sericite composite powder was made from natural sericite modified with iron, and alginate was used to transform the powder into beads. The maximum sorption capacities of the Fe-sericite composite powder (15.04 and 13.21mgg -1 for As(III) and As(V), respectively) were higher than those of the corresponding beads (9.02 and 7.11mgg -1 for As(III) and As(V), respectively) owing to the higher specific surface area of the powder. In addition, the leaching amounts of As(III) from Fe-sericite composite beads (≤ 15.03%) were higher than those of the corresponding powder (≤ 5.71%). However, acute toxicity of As(III)-sorbed Fe-sericite composite beads toward Daphnia magna was not significantly different from that of the corresponding powder (p > 0.05). Considering higher uptake of the powder particles by the daphnids, Fe-sericite composite beads seem to be a more appropriate and safer sorbent for arsenic removal in practical application. Based on Fe content, Fe-sericite composite beads had similar or higher maximum sorption capacities (71.19 and 56.11mgg -1 Fe for As(III) and As(V), respectively) than those of previously reported sorbents. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Preparation of Silk Sericin/Lignin Blend Beads for the Removal of Hexavalent Chromium Ions

    Science.gov (United States)

    Kwak, Hyo Won; Shin, Munju; Yun, Haesung; Lee, Ki Hoon

    2016-01-01

    In the present study, novel adsorbents having high adsorption capability and reusability were prepared using agricultural by-products: silk sericin and lignin. Silk sericin and lignin blend beads were successfully prepared using simple coagulation methods for the removal of hexavalent chromium (Cr(VI)) from aqueous solution. A 1 M lithium chloride (LiCl)/dimethyl sulfoxide (DMSO) solvent system successfully dissolved both sericin and lignin and had sufficient viscosity for bead preparation. Compared to the conventional sericin bead adsorbent, sericin/lignin blend beads showed higher Cr(VI) adsorption capacity. The amount of lignin added to the adsorbent greatly affected the adsorption capacity of the beads, and a 50:50 sericin/lignin blend ratio was optimal. Adsorption behavior followed the Freundlich isotherm, which means the adsorption of Cr(VI) occurred on the heterogeneous surface. Cr(VI) adsorption capability increased with temperature because of thermodynamic-kinetic effects. In addition, over 90% of Cr(VI) ions were recovered from the Cr(VI) adsorbed sericin/lignin beads in a 1 M NaOH solution. The adsorption-desorption recycling process was stable for more than seven cycles, and the recycling efficiency was 82%. It is expected that the sericin/lignin beads could be successfully applied in wastewater remediation especially for hazardous Cr(VI) ions in industrial wastewater. PMID:27598142

  3. Kinase-loaded magnetic beads for sequential in vitro phosphorylation of peptides and proteins.

    Science.gov (United States)

    Hromadkova, Lenka; Kupcik, Rudolf; Vajrychova, Marie; Prikryl, Petr; Charvatova, Andrea; Jankovicova, Barbora; Ripova, Daniela; Bilkova, Zuzana; Slovakova, Marcela

    2018-01-15

    Post-translational modifications, including phosphorylation, greatly impact the physiological function of proteins, especially those that are natively unfolded and implicated in many neurodegenerative diseases. However, structural and functional studies of such proteins require fully defined phosphorylation, including those that are not physiological. Thus, the kinases ERK2 and GSK-3β were immobilized to various superparamagnetic beads with carboxylic, aldehyde, Ni 2+ , or Co 3+ functional groups, with a view to efficiently phosphorylate peptides and proteins in vitro. Full phosphorylation of specific synthetic peptides confirmed that beads were successfully loaded with kinases. Remarkably, enzymes covalently immobilized on carboxylated SeraMag beads remained active upon reuse, with residual activity after 10 uses 99.5 ± 0.34% for GSK-3β and 36.2 ± 2.01% for ERK2. The beads were also used to sequentially phosphorylate recombinant tau, which in vivo is a biomarker of Alzheimer's disease. Thus, a system consisting of two fully active kinases immobilized to magnetic beads is demonstrated for the first time. In comparison to soluble enzymes, the beads are easier to handle, reusable, and thus low-cost. Importantly, these beads are also convenient to remove from reactions to minimize contamination of phosphorylated products or to exchange with other kinases.

  4. Wax-incorporated emulsion gel beads of calcium pectinate for intragastric floating drug delivery.

    Science.gov (United States)

    Sriamornsak, Pornsak; Asavapichayont, Panida; Nunthanid, Jurairat; Luangtana-Anan, Manee; Limmatvapirat, Sontaya; Piriyaprasarth, Suchada

    2008-01-01

    The purpose of this study was to prepare wax-incorporated pectin-based emulsion gel beads using a modified emulsion-gelation method. The waxes in pectin-olive oil mixtures containing a model drug, metronidazole, were hot-melted, homogenized and then extruded into calcium chloride solution. The beads formed were separated, washed with distilled water and dried for 12 h. The influence of various types and amounts of wax on floating and drug release behavior of emulsion gel beads of calcium pectinate was investigated. The drug-loaded gel beads were found to float on simulated gastric fluid if the sufficient amount of oil was used. Incorporation of wax into the emulsion gel beads affected the drug release. Water-soluble wax (i.e. polyethylene glycol) increased the drug release while other water-insoluble waxes (i.e. glyceryl monostearate, stearyl alcohol, carnauba wax, spermaceti wax and white wax) significantly retarded the drug release. Different waxes had a slight effect on the drug release. However, the increased amount of incorporated wax in the formulations significantly sustained the drug release while the beads remained floating. The results suggest that wax-incorporated emulsion gel beads could be used as a carrier for intragastric floating drug delivery.

  5. REVIEW: CHITOSAN BASED HYDROGEL POLYMERIC BEADS – AS DRUG DELIVERY SYSTEM

    Directory of Open Access Journals (Sweden)

    Manjusha Rani

    2010-11-01

    Full Text Available Chitosan obtained by alkaline deacetylation of chitin is a non-toxic, biocompatible, and biodegradable natural polymer. Chitosan-based hydrogel polymeric beads have been extensively studied as micro- or nano-particulate carriers in the pharmaceutical and medical fields, where they have shown promise for drug delivery as a result of their controlled and sustained release properties, as well as biocompatibility with tissue and cells. To introduce desired properties and enlarge the scope of the potential applications of chitosan, graft copolymerization with natural or synthetic polymers on it has been carried out, and also, various chitosan derivatives have been utilized to form beads. The desired kinetics, duration, and rate of drug release up to therapeutical level from polymeric beads are limited by specific conditions such as beads material and their composition, bead preparation method, amount of drug loading, drug solubility, and drug polymer interaction. The present review summarizes most of the available reports about compositional and structural effects of chitosan-based hydrogel polymeric beads on swelling, drug loading, and releasing properties. From the studies reviewed it is concluded that chitosan-based hydrogel polymeric beads are promising drug delivery systems.

  6. Superparamagnetic poly(methyl methacrylate) beads for nattokinase purification from fermentation broth.

    Science.gov (United States)

    Yang, Chengli; Xing, Jianmin; Guan, Yueping; Liu, Huizhou

    2006-09-01

    An effective method for purification of nattokinase from fermentation broth using magnetic poly(methyl methacrylate) (PMMA) beads immobilized with p-aminobenzamidine was proposed in this study. Firstly, magnetic PMMA beads with a narrow size distribution were prepared by spraying suspension polymerization. Then, they were highly functionalized via transesterification reaction with polyethylene glycol. The surface hydroxyl-modified magnetic beads obtained were further modified with chloroethylamine to transfer the surface amino-modified magnetic functional beads. The morphology and surface functionality of the magnetic beads were examined by scanning electron microscopy and Fourier transform infrared. An affinity ligand, p-aminobenzamidine was covalently immobilized to the amino-modified magnetic beads by the glutaraldehyde method for nattokinase purification directly from the fermentation broth. The purification factor and the recovery of the enzyme activity were found to be 8.7 and 85%, respectively. The purification of nattokinase from fermentation broth by magnetic beads only took 40 min, which shows a very fast purification of nattokinase compared to traditional purification methods.

  7. Preparation of Silk Sericin/Lignin Blend Beads for the Removal of Hexavalent Chromium Ions

    Directory of Open Access Journals (Sweden)

    Hyo Won Kwak

    2016-09-01

    Full Text Available In the present study, novel adsorbents having high adsorption capability and reusability were prepared using agricultural by-products: silk sericin and lignin. Silk sericin and lignin blend beads were successfully prepared using simple coagulation methods for the removal of hexavalent chromium (Cr(VI from aqueous solution. A 1 M lithium chloride (LiCl/dimethyl sulfoxide (DMSO solvent system successfully dissolved both sericin and lignin and had sufficient viscosity for bead preparation. Compared to the conventional sericin bead adsorbent, sericin/lignin blend beads showed higher Cr(VI adsorption capacity. The amount of lignin added to the adsorbent greatly affected the adsorption capacity of the beads, and a 50:50 sericin/lignin blend ratio was optimal. Adsorption behavior followed the Freundlich isotherm, which means the adsorption of Cr(VI occurred on the heterogeneous surface. Cr(VI adsorption capability increased with temperature because of thermodynamic-kinetic effects. In addition, over 90% of Cr(VI ions were recovered from the Cr(VI adsorbed sericin/lignin beads in a 1 M NaOH solution. The adsorption-desorption recycling process was stable for more than seven cycles, and the recycling efficiency was 82%. It is expected that the sericin/lignin beads could be successfully applied in wastewater remediation especially for hazardous Cr(VI ions in industrial wastewater.

  8. Sodium bicarbonate-gelled chitosan beads as mechanically stable carriers for the covalent immobilization of enzymes.

    Science.gov (United States)

    Wahba, Marwa I

    2018-03-01

    The poor mechanical stability of chitosan has long impeded its industrial utilization as an immobilization carrier. In this study, the mechanical properties of chitosan beads were greatly improved through utilizing the slow rate of the sodium bicarbonate-induced chitosan gelation and combining it with the chemical cross-linking action of glutaraldehyde (GA). The GA-treated sodium bicarbonate-gelled chitosan beads exhibited much better mechanical properties and up to 2.45-fold higher observed activity of the immobilized enzyme (β-D-galactosidase (β-gal)) when compared to the GA-treated sodium tripolyphosphate (TPP)-gelled chitosan beads. The differences between the sodium bicarbonate-gelled and the TPP-gelled chitosan beads were proven visually and also via scanning electron microscopy, elemental analysis, and differential scanning calorimetry. Moreover, the optimum pH, the optimum temperature, the apparent K m , and the apparent V max of the β-gals immobilized onto the two aforementioned types of chitosan beads were determined and compared. A reusability study was also performed. This study proved the superiority of the sodium bicarbonate-gelled chitosan beads as they retained 72.22 ± 4.57% of their initial observed activity during the 13 th reusability cycle whereas the TPP-gelled beads lost their activity during the first four reusability cycles, owing to their fragmentation. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 34:347-361, 2018. © 2017 American Institute of Chemical Engineers.

  9. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  10. Decolourisation of dyes under electro-Fenton process using Fe alginate gel beads

    Energy Technology Data Exchange (ETDEWEB)

    Rosales, E.; Iglesias, O.; Pazos, M. [Department of Chemical Engineering, University of Vigo, Isaac Newton Building, Campus As Lagoas, Marcosende 36310, Vigo (Spain); Sanroman, M.A., E-mail: sanroman@uvigo.es [Department of Chemical Engineering, University of Vigo, Isaac Newton Building, Campus As Lagoas, Marcosende 36310, Vigo (Spain)

    2012-04-30

    Highlights: Black-Right-Pointing-Pointer Catalytic activity of Fe alginate gel beads for the remediation of wastewater was tested. Black-Right-Pointing-Pointer New electro-Fenton process for the remediation of polluted wastewater. Black-Right-Pointing-Pointer Continuous dye treatment without operational problem with high removal. - Abstract: This study focuses on the application of electro-Fenton technique by use of catalytic activity of Fe alginate gel beads for the remediation of wastewater contaminated with synthetic dyes. The Fe alginate gel beads were evaluated for decolourisation of two typical dyes, Lissamine Green B and Azure B under electro-Fenton process. After characterization of Fe alginate gel beads, the pH effect on the process with Fe alginate beads and a comparative study of the electro-Fenton process with free Fe and Fe alginate bead was done. The results showed that the use of Fe alginate beads increases the efficiency of the process; moreover the developed particles show a physical integrity in a wide range of pH (2-8). Around 98-100% of dye decolourisation was obtained for both dyes by electro-Fenton process in successive batches. Therefore, the process was performed with Fe alginate beads in a bubble continuous reactor. High color removal (87-98%) was attained for both dyes operating at a residence time of 30 min, without operational problems and maintaining particle shapes throughout the oxidation process. Consequently, the stable performance of Fe alginate beads opens promising perspectives for fast and economical treatment of wastewater polluted by dyes or similar organic contaminants.

  11. Development of a novel colorimetric sensor based on alginate beads for monitoring rainbow trout spoilage.

    Science.gov (United States)

    Majdinasab, Marjan; Hosseini, Seyed Mohammad Hashem; Sepidname, Marziyeh; Negahdarifar, Manizheh; Li, Peiwu

    2018-05-01

    Alginate is a non-toxic, renewable, and linear copolymer obtained from the brown algae Laminaria digitata that can be easily shaped into beads. Its good gel forming properties have made it useful for entrapping food and pharmaceutical ingredients. In this study, alginate beads were used in a novel application as a colorimetric sensor in food intelligent packaging. Colorimetric sensor was developed through entrapping red cabbage extract as a pH indicator in alginate beads. The pH indicator beads were used in rainbow trout packaging for monitoring fillets spoilage. Color change of beads during fish storage was measured using the CIELab method. The alginate bead colorimetric sensor is validated by measuring total volatile basic nitrogen (TVB-N) levels and microbial populations in fish samples. Moreover, peroxide value (PV) and thiobarbituric acid reactive substances (TBARS) were evaluated during storage. Results indicated that increasing the bacterial population during storage and production of proteolytic enzymes resulted in protein degradation, accumulation of volatile amine compounds, increase in the pH and finally color change of alginate beads. The values of TVB-N, pH, PV and TBARS increased with time of storage. The results of TVB-N and microbial growth were in accordance with color change of beads and CIELab data. Therefore, the proposed system enjoys a high sensitivity to pH variations and is capable of monitoring the spoilage of fish or other protein-rich products through its wide range of color changes. The alginate beads containing the red cabbage extract can, thus, be used as a low-cost colorimetric sensor for intelligent packaging applications.

  12. Decolourisation of dyes under electro-Fenton process using Fe alginate gel beads

    International Nuclear Information System (INIS)

    Rosales, E.; Iglesias, O.; Pazos, M.; Sanromán, M.A.

    2012-01-01

    Highlights: ► Catalytic activity of Fe alginate gel beads for the remediation of wastewater was tested. ► New electro-Fenton process for the remediation of polluted wastewater. ► Continuous dye treatment without operational problem with high removal. - Abstract: This study focuses on the application of electro-Fenton technique by use of catalytic activity of Fe alginate gel beads for the remediation of wastewater contaminated with synthetic dyes. The Fe alginate gel beads were evaluated for decolourisation of two typical dyes, Lissamine Green B and Azure B under electro-Fenton process. After characterization of Fe alginate gel beads, the pH effect on the process with Fe alginate beads and a comparative study of the electro-Fenton process with free Fe and Fe alginate bead was done. The results showed that the use of Fe alginate beads increases the efficiency of the process; moreover the developed particles show a physical integrity in a wide range of pH (2–8). Around 98–100% of dye decolourisation was obtained for both dyes by electro-Fenton process in successive batches. Therefore, the process was performed with Fe alginate beads in a bubble continuous reactor. High color removal (87–98%) was attained for both dyes operating at a residence time of 30 min, without operational problems and maintaining particle shapes throughout the oxidation process. Consequently, the stable performance of Fe alginate beads opens promising perspectives for fast and economical treatment of wastewater polluted by dyes or similar organic contaminants.

  13. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  14. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  15. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  16. Metastatic tumors of lungs

    International Nuclear Information System (INIS)

    Rozenshtraukh, L.C.; Rybakova, N.I.; Vinner, M.G.

    1987-01-01

    Roentgenologic semiotics of lung metastases and their complications, as well as peculiarities of lung metastases of separate localization tumours are presented. Definition table for primary tumour by roentgenologic aspect of lung metastases is given

  17. How Lungs Work

    Science.gov (United States)

    ... Diseases > How Lungs Work How Lungs Work The Respiratory System Your lungs are part of the respiratory system, ... your sense of smell. The Parts of the Respiratory System and How They Work Airways SINUSES are hollow ...

  18. Protecting Your Lungs

    Science.gov (United States)

    ... lung capacity. Specific breathing exercises can also help improve your lung function if you have certain lung diseases, like COPD. Exercise and breathing techniques are also great for improving your mood and helping you relax. Public Health and Your ...

  19. Note: A quartz cell with Pt single crystal bead electrode for electrochemical scanning tunneling microscope measurements.

    Science.gov (United States)

    Xia, Zhigang; Wang, Jihao; Hou, Yubin; Lu, Qingyou

    2014-09-01

    In this paper, we provide and demonstrate a design of a unique cell with Pt single crystal bead electrode for electrochemical scanning tunneling microscope (ECSTM) measurements. The active metal Pt electrode can be protected from air contamination during the preparation process. The transparency of the cell allows the tip and bead to be aligned by direct observation. Based on this, a new and effective alignment method is introduced. The high-quality bead preparations through this new cell have been confirmed by the ECSTM images of Pt (111).

  20. Magnetic composite beads for sorption of cesium ions from aqueous streams

    International Nuclear Information System (INIS)

    Shinde, Rakesh N.; Pandey, A.K.; Acharya, R.; Rajurkar, N.S.

    2014-01-01

    Magnetic separation of metal ions is one of the promising methods due to simple, fast, efficient and cost effective technology. Highly selective magnetic sorbents can be designed by immobilizing functional groups in magnetic carrier which binds to the target specific ions. In the present work chitosan-(3-aminopropyl) triethoxysilane (APTS)- copperferrocyanide (CFC) composite beads have been synthesized for sorption of 137 Cs ions from aqueous streams. Physical characterization of the best resulted polymer beads was carried out by SEM-EDX and VSM technique. Sorption of Cs ions in the various magnetic polymer beads were studied in different aqueous condition by 137 Cs (662 KeV) radiotracer assay

  1. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Henriksen, Anders Dahl

    2014-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches....... The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover...

  2. Sequential mass spectrometric analysis of uranium and plutonium employing resin bead technique

    International Nuclear Information System (INIS)

    Ramakumar, K.L.; Aggarwal, S.K.; Chitambar, S.A.; Jain, H.C.

    1985-01-01

    Sequential mass spectrometric analysis of uranium and plutonium employing anion exchange resin bead technique is reported using a high sensitive single stage magnetic analyser instrument, the routinely employed rhenium double filament assembly and 0.5M HNO 3 as a wetting agent for loading the resin beads. A precision of bettter than 0.3per cent (2sigma) is obtained on the isotopic ratio measurements. However, extreme care has to be exercised to carry the resin bead experiments under ultra clean conditions so as to avoid pick up of contamination. (author)

  3. Effect of welding current and speed on occurrence of humping bead in high-speed GMAW

    Institute of Scientific and Technical Information of China (English)

    Chen Ji; Wu Chuansong

    2009-01-01

    The developed mathematical model of humping formation mechanism in high-speed gas metal arc welding (GMAW) is used to analyze the effects of welding current and welding speed on the occurrence of humping bead. It considers both the momentum and heat content of backward flowing molten jet inside weld pool. Three-dimensional geometry of weld pool, the spacing between two adjacent humps and hump height along humping weld bead are calculated under different levels of welding current and welding speed. It shows that wire feeding rate, power intensity and the moment of backward flowing molten jet are the major factors on humping bead formation.

  4. Silica-supported Macroporous Chitosan Bead for Affinity Purification of Trypsin Inhibitor

    Institute of Scientific and Technical Information of China (English)

    Feng Na XI; Jian Min WU; Ming Ming LUAN

    2005-01-01

    Macroporous cross-linking chitosan layer coated on silica gel (CTS-SiO2) was prepared by phase inversion and polyethylene glycol (PEG) molecular imprinting methods. Formation of macroporous surface was investigated by scanning electron microscopy (SEM) and BET analysis.The prepared bead was activated by reacting with 1,2-ethylene diglycidyl ether for introducing epoxy groups, and trypsin could be efficiently immobilized on the bead as a biospecific ligand.The bead bearing trypsin was employed to purify trypsin inhibitor (TIs) from egg white as affinity adsorbent.

  5. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  6. Lung PET scan

    Science.gov (United States)

    ... Chest PET scan; Lung positron emission tomography; PET - chest; PET - lung; PET - tumor imaging; ... Grainger & Allison's Diagnostic Radiology: A Textbook of Medical Imaging . 6th ed. Philadelphia, ...

  7. Extravascular Lung Water and Acute Lung Injury

    Directory of Open Access Journals (Sweden)

    Ritesh Maharaj

    2012-01-01

    Full Text Available Acute lung injury carries a high burden of morbidity and mortality and is characterised by nonhydrostatic pulmonary oedema. The aim of this paper is to highlight the role of accurate quantification of extravascular lung water in diagnosis, management, and prognosis in “acute lung injury” and “acute respiratory distress syndrome”. Several studies have verified the accuracy of both the single and the double transpulmonary thermal indicator techniques. Both experimental and clinical studies were searched in PUBMED using the term “extravascular lung water” and “acute lung injury”. Extravascular lung water measurement offers information not otherwise available by other methods such as chest radiography, arterial blood gas, and chest auscultation at the bedside. Recent data have highlighted the role of extravascular lung water in response to treatment to guide fluid therapy and ventilator strategies. The quantification of extravascular lung water may predict mortality and multiorgan dysfunction. The limitations of the dilution method are also discussed.

  8. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  9. Metallurgical investigation of wire breakage of tyre bead grade

    Directory of Open Access Journals (Sweden)

    Piyas Palit

    2015-10-01

    Full Text Available Tyre bead grade wire is used for tyre making application. The wire is used as reinforcement inside the polymer of tyre. The wire is available in different size/section such as 1.6–0.80 mm thin Cu coated wire. During tyre making operation at tyre manufacturer company, wire failed frequently. In this present study, different broken/defective wire samples were collected from wire mill for detailed investigation of the defect. The natures of the defects were localized and similar in nature. The fracture surface was of finger nail type. Crow feet like defects including button like surface abnormalities were also observed on the broken wire samples. The defect was studied at different directions under microscope. Different advanced metallographic techniques have been used for detail investigation. The analysis revealed that, white layer of surface martensite was formed and it caused the final breakage of wire. In this present study we have also discussed about the possible reason for the formation of such kind of surface martensite (hard-phase.

  10. Exploring chemical reaction mechanisms through harmonic Fourier beads path optimization.

    Science.gov (United States)

    Khavrutskii, Ilja V; Smith, Jason B; Wallqvist, Anders

    2013-10-28

    Here, we apply the harmonic Fourier beads (HFB) path optimization method to study chemical reactions involving covalent bond breaking and forming on quantum mechanical (QM) and hybrid QM∕molecular mechanical (QM∕MM) potential energy surfaces. To improve efficiency of the path optimization on such computationally demanding potentials, we combined HFB with conjugate gradient (CG) optimization. The combined CG-HFB method was used to study two biologically relevant reactions, namely, L- to D-alanine amino acid inversion and alcohol acylation by amides. The optimized paths revealed several unexpected reaction steps in the gas phase. For example, on the B3LYP∕6-31G(d,p) potential, we found that alanine inversion proceeded via previously unknown intermediates, 2-iminopropane-1,1-diol and 3-amino-3-methyloxiran-2-ol. The CG-HFB method accurately located transition states, aiding in the interpretation of complex reaction mechanisms. Thus, on the B3LYP∕6-31G(d,p) potential, the gas phase activation barriers for the inversion and acylation reactions were 50.5 and 39.9 kcal∕mol, respectively. These barriers determine the spontaneous loss of amino acid chirality and cleavage of peptide bonds in proteins. We conclude that the combined CG-HFB method further advances QM and QM∕MM studies of reaction mechanisms.

  11. Enzyme-linked electrochemical DNA ligation assay using magnetic beads.

    Science.gov (United States)

    Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav

    2014-07-01

    DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.

  12. A novel magnet focusing plate for matrix-assisted laser desorption/ionization analysis of magnetic bead-bound analytes.

    Science.gov (United States)

    Gode, David; Volmer, Dietrich A

    2013-05-15

    Magnetic beads are often used for serum profiling of peptide and protein biomarkers. In these assays, the bead-bound analytes are eluted from the beads prior to mass spectrometric analysis. This study describes a novel matrix-assisted laser desorption/ionization (MALDI) technique for direct application and focusing of magnetic beads to MALDI plates by means of dedicated micro-magnets as sample spots. Custom-made MALDI plates with magnetic focusing spots were made using small nickel-coated neodymium micro-magnets integrated into a stainless steel plate in a 16 × 24 (384) pattern. For demonstrating the proof-of-concept, commercial C-18 magnetic beads were used for the extraction of a test compound (reserpine) from aqueous solution. Experiments were conducted to study focusing abilities, the required laser energies, the influence of a matrix compound, dispensing techniques, solvent choice and the amount of magnetic beads. Dispensing the magnetic beads onto the micro-magnet sample spots resulted in immediate and strong binding to the magnetic surface. Light microscope images illustrated the homogeneous distribution of beads across the surfaces of the magnets, when the entire sample volume containing the beads was pipetted onto the surface. Subsequent MALDI analysis of the bead-bound analyte demonstrated excellent and reproducible ionization yields. The surface-assisted laser desorption/ionization (SALDI) properties of the strongly light-absorbing γ-Fe2O3-based beads resulted in similar ionization efficiencies to those obtained from experiments with an additional MALDI matrix compound. This feasibility study successfully demonstrated the magnetic focusing abilities for magnetic bead-bound analytes on a novel MALDI plate containing small micro-magnets as sample spots. One of the key advantages of this integrated approach is that no elution steps from magnetic beads were required during analyses compared with conventional bead experiments. Copyright © 2013 John Wiley

  13. An Attempt to Shorten Loading Time of Epirubicin into DC Beads® Using Vibration and a Sieve

    International Nuclear Information System (INIS)

    Sonoda, Akinaga; Nitta, Norihisa; Yamamoto, Takefumi; Tomozawa, Yuki; Ohta, Shinichi; Watanabe, Shobu; Murata, Kiyoshi

    2017-01-01

    PurposeWe investigated the possibility of shortening the time required for loading epirubicin into calibrated polyvinyl alcohol-based hydrogel beads (DC Beads ® ) to be used for transarterial chemoembolization.MethodAfter separating the beads suspended in phosphate-buffered saline (PBS) solution by the use of a sieve (clearance 75 µm), epirubicin hydrochloride (EH) was loaded for 20, 30, or 60 s under vibration into DC beads. The EH loading rate into conventionally prepared (control) beads, i.e., beads loaded for 30 min without vibration, and vibration-loaded beads were calculated from the residual EH concentration in the bead-depleted EH solution. The amount of EH eluted from conventionally and vibration-loaded samples into a PBS solution (pH 7.0) was measured at 15 and 30 min and 1, 2, 6, 12, and 24 h. We also recorded the inhibitory effect of the PBS solution on the loading time. Using frozen sections, the EH load in the beads was evaluated visually under a fluorescence microscope.ResultsSpectrophotometry (495 nm) showed that the loading rate was 98.98 ± 0.34, 99.02 ± 0.32, and 99.50 ± 0.11 % with 20-, 30-, and 60-s vibration, respectively. The eluted rate was statistically similar between vibration- and statically loaded (control) beads. The PBS solution hampered EH loading into the beads. Visually, the distribution of EH in conventionally and vibration-loaded DC beads was similar.DiscussionThe use of vibration and the removal of PBS solution when epirubicin hydrochloride was loaded into DC beads dramatically shortened the loading time of epirubicin hydrochloride into DC beads.

  14. An Attempt to Shorten Loading Time of Epirubicin into DC Beads{sup ®} Using Vibration and a Sieve

    Energy Technology Data Exchange (ETDEWEB)

    Sonoda, Akinaga, E-mail: akinagasonoda@yahoo.co.jp; Nitta, Norihisa [Shiga University of Medical Science, Department of Radiology (Japan); Yamamoto, Takefumi [Shiga University of Medical Science, Central Research Laboratory (Japan); Tomozawa, Yuki; Ohta, Shinichi; Watanabe, Shobu; Murata, Kiyoshi [Shiga University of Medical Science, Department of Radiology (Japan)

    2017-04-15

    PurposeWe investigated the possibility of shortening the time required for loading epirubicin into calibrated polyvinyl alcohol-based hydrogel beads (DC Beads{sup ®}) to be used for transarterial chemoembolization.MethodAfter separating the beads suspended in phosphate-buffered saline (PBS) solution by the use of a sieve (clearance 75 µm), epirubicin hydrochloride (EH) was loaded for 20, 30, or 60 s under vibration into DC beads. The EH loading rate into conventionally prepared (control) beads, i.e., beads loaded for 30 min without vibration, and vibration-loaded beads were calculated from the residual EH concentration in the bead-depleted EH solution. The amount of EH eluted from conventionally and vibration-loaded samples into a PBS solution (pH 7.0) was measured at 15 and 30 min and 1, 2, 6, 12, and 24 h. We also recorded the inhibitory effect of the PBS solution on the loading time. Using frozen sections, the EH load in the beads was evaluated visually under a fluorescence microscope.ResultsSpectrophotometry (495 nm) showed that the loading rate was 98.98 ± 0.34, 99.02 ± 0.32, and 99.50 ± 0.11 % with 20-, 30-, and 60-s vibration, respectively. The eluted rate was statistically similar between vibration- and statically loaded (control) beads. The PBS solution hampered EH loading into the beads. Visually, the distribution of EH in conventionally and vibration-loaded DC beads was similar.DiscussionThe use of vibration and the removal of PBS solution when epirubicin hydrochloride was loaded into DC beads dramatically shortened the loading time of epirubicin hydrochloride into DC beads.

  15. A control system for uniform bead in fillet arc welding on tack welds

    International Nuclear Information System (INIS)

    Kim, Jae Woong; Lee, Jun Young

    2008-01-01

    Positioning a workpiece accurately and preventing weld distortion, tack welding is often adopted before main welding in the construction of welded structures. However, this tack weld deteriorates the final weld bead profile, so that the grinding process is usually performed for a uniform weld bead profile. In this study, a control system for uniform weld bead is proposed for the fillet arc welding on tack welds. The system consists of GMA welding machine, torch manipulator, laser vision sensor for measuring the tack weld size and the database for optimal welding conditions. Experiments have been performed for constructing the database and for evaluating the control capability of the system. It has been shown that the system has the capability to smooth the bead at the high level of quality

  16. One-step isolation of plasma membrane proteins using magnetic beads with immobilized concanavalin A

    DEFF Research Database (Denmark)

    Lee, Yu-Chen; Block, Gregory; Chen, Huiwen

    2008-01-01

    We have developed a simple method for isolating and purifying plasma membrane proteins from various cell types. This one-step affinity-chromatography method uses the property of the lectin concanavalin A (ConA) and the technique of magnetic bead separation to obtain highly purified plasma membrane...... proteins from crude membrane preparations or cell lines. ConA is immobilized onto magnetic beads by binding biotinylated ConA to streptavidin magnetic beads. When these ConA magnetic beads were used to enrich plasma membranes from a crude membrane preparation, this procedure resulted in 3.7-fold enrichment...... of plasma membrane marker 5'-nucleotidase activity with 70% recovery of the activity in the crude membrane fraction of rat liver. In agreement with the results of 5'-nucleotidase activity, immunoblotting with antibodies specific for a rat liver plasma membrane protein, CEACAM1, indicated that CEACAM1...

  17. CUTANEOUS SQUAMOUS CELL CARCINOMA IN A PANTHER CHAMELEON (FURCIFER PARDALIS) AND TREATMENT WITH CARBOPLATIN IMPLANTABLE BEADS.

    Science.gov (United States)

    Johnson, James G; Naples, Lisa M; Chu, Caroline; Kinsel, Michael J; Flower, Jennifer E; Van Bonn, William G

    2016-09-01

    A 3-yr-old male panther chameleon (Furcifer pardalis) presented with bilateral raised crusted skin lesions along the lateral body wall that were found to be carcinoma in situ and squamous cell carcinoma. Similar lesions later developed on the caudal body wall and tail. A subcutaneous implantable carboplatin bead was placed in the first squamous cell carcinoma lesion identified. Additional new lesions sampled were also found to be squamous cell carcinomas, and viral polymerase chain reaction was negative for papillomaviruses and herpesviruses. Significant skin loss would have resulted from excision of all the lesions, so treatment with only carboplatin beads was used. No adverse effects were observed. Lesions not excised that were treated with beads decreased in size. This is the first description of cutaneous squamous cell carcinoma and treatment with carboplatin implantable beads in a panther chameleon.

  18. Two-phase mixed media dielectric with macro dielectric beads for enhancing resistivity and breakdown strength

    Science.gov (United States)

    Falabella, Steven; Meyer, Glenn A; Tang, Vincent; Guethlein, Gary

    2014-06-10

    A two-phase mixed media insulator having a dielectric fluid filling the interstices between macro-sized dielectric beads packed into a confined volume, so that the packed dielectric beads inhibit electro-hydrodynamically driven current flows of the dielectric liquid and thereby increase the resistivity and breakdown strength of the two-phase insulator over the dielectric liquid alone. In addition, an electrical apparatus incorporates the two-phase mixed media insulator to insulate between electrical components of different electrical potentials. And a method of electrically insulating between electrical components of different electrical potentials fills a confined volume between the electrical components with the two-phase dielectric composite, so that the macro dielectric beads are packed in the confined volume and interstices formed between the macro dielectric beads are filled with the dielectric liquid.

  19. Investigation the influence of dietary fiber on the rheological properties of alginate beads

    Directory of Open Access Journals (Sweden)

    Z. Manev

    2015-03-01

    Full Text Available Abstract. During the current investigation experiments for the preparation of alginate beads with aqueous solutions of sodium alginate, calcium lactate or calcium dichloride and dietary fiber in different concentrations: inulin with varying degrees of polymerization, wheat bran and amidated apple pectin were carried out. The sodium alginate solutions were at constant concentration 3%, while calcium salts in 7% were applied for bead formation. It was proven that the rupture force of alginate beads was always higher than the pure model system regardless of the chemical structure of dietary fibers used. In the result of the carried research the dependence at a certain concentration was established at which the rupture force and deformation of the beads increased gradually.

  20. Magnetic bead micromixer: Influence of magnetic element geometry and field amplitude

    DEFF Research Database (Denmark)

    Lund-Olesen, Torsten; Buus, Bjarke B.; Howalt, Jakob

    2008-01-01

    A scheme for the silicon microfabrication of lab-on-a-chip systems with mixing based on dynamic plugs of magnetic beads is presented. The systems consist of a microfluidic channel integrated with a number of soft magnetic elements by the sides of the channel. The elements are magnetized by a homo......A scheme for the silicon microfabrication of lab-on-a-chip systems with mixing based on dynamic plugs of magnetic beads is presented. The systems consist of a microfluidic channel integrated with a number of soft magnetic elements by the sides of the channel. The elements are magnetized...... by a homogeneous external ac magnetic field. The systems are scalable with respect to the number of magnetic bead plugs and number of parallel channels, and thus they have high potential for use in biological separation using functionalized magnetic beads. The mixing efficiency is characterized for two different...

  1. Planar Hall effect sensor bridge geometries optimized for magnetic bead detection

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Henriksen, Anders Dahl

    2014-01-01

    Novel designs of planar Hall effect bridge sensors optimized for magnetic bead detection are presented and characterized. By constructing the sensor geometries appropriately, the sensors can be tailored to be sensitive to an external magnetic field, the magnetic field due to beads being magnetized...... by the sensor self-field or a combination thereof. The sensors can be made nominally insensitive to small external magnetic fields, while being maximally sensitive to magnetic beads, magnetized by the sensor self-field. Thus, the sensor designs can be tailored towards specific applications with minimal...... of the dynamic magnetic response of suspensions of magnetic beads with a nominal diameter of 80 nm are performed. Furthermore, a method to amplify the signal by appropriate combinations of multiple sensor segments is demonstrated....

  2. Evaluation of double drop beads pavement edge lines : SPR project description.

    Science.gov (United States)

    2009-01-01

    In UTCA projects 01465 and 04405, the retroreflectivities and the life cycle costs were measured and compared for standard Alabama Department of Transportation (ALDOT) thermoplastic edge : stripes that contained only one size of retroreflective beads...

  3. STUDY ON THE SYNTHESIS AND STRUCTURE OF MACRORETICULAR BEAD PAN/PVC IPN RESINS

    Institute of Scientific and Technical Information of China (English)

    LI Yanfeng; ZHUO Renxi

    1993-01-01

    Macroreticular bead PAN/PVC IPN reans with cyano and chloro groups were synthesized by interpenetrating polymerization of acrylonitrile, or acrylonitrile and divinylbenzene into a macroporous polyvinyl chloride bead. The composition and structure of the bead IPN resins have been investigated by means of FT-IR, NMR, SEM, mercury porosimetry and elemental analysis. During the process of interpenetrating polymerization, the chain propagation obeys Bernoullian statistical law, and no grafting polymerization has been observed. The content of cyano group in the resulting IPN resins can be adjusted by the amount of acrylonitrile added. The morphology of the IPN resins basically resembles that of the polyvinyl chloride bead,whereas the pore structures vary to a certain degree

  4. Rapid bead-based immunoassay for measurement of mannose-binding lectin

    DEFF Research Database (Denmark)

    Bay, J T; Garred, P

    2009-01-01

    have been developed more automated platforms for MBL analysis is urgently needed. To pursue this, we set out to develop a flexible bead-based MBL immunoassay. Serum was obtained from 98 healthy individuals and 50 patients investigated for possible immunodeficiencies. We used the Luminex xMAP bead array...... coefficient were found be 7.88% and 5.70%, respectively. A close correlation between the new assay and a reference MBL measurement ELISA was found (rho 0.9381, P bead-based assay was less sensitive to interfering anti-murine antibodies in the blood samples than when the antibodies employed were...... used in the reference polystyrene-based ELISA. The new assay could be performed in 3 h with less than 25 microl serum required of each sample. These results show that MBL can be measured readily using a bead-based platform, which may form an efficient basis for a multiplex approach to measure different...

  5. Tumour metastasis-associated gene profiling using one-dimensional microfluidic beads array

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Great efforts have been made on the early diagnosis and molecular mechanism research of tumour metastasis in recent years. In this paper, based on the one-dimensional microfluidic beads array, a novel platform for tumour metastasis-associated genes profiling has been developed by depositing nucleic acids functional beads in the microchannel. This platform is sensitive (limit of detection: 0.02 nmol/L) and can perform mRNAs analysis without PCR. Two human colon cancer cell lines (primary and metastatic) from the same patient were used as a model, and transcriptional expression profiling of multiple tumour metastasis-associated genes in these two cell lines was successfully achieved. Furthermore, the results obtained on the beads array were validated by RT-PCR. This novel beads array has advantages of high sensitivity, little sample consumption, short assay time, low cost and high throughput capability. It holds the potential in early diagnosis and mechanism research of tumour metastasis.

  6. Polyaniline coated magnetic carboxymethylcellulose beads for selective removal of uranium ions from aqueous solution

    International Nuclear Information System (INIS)

    Yakup Arica, M.; Gulay Bayramoglu; Gazi University, Ankara

    2016-01-01

    Magnetic carboxymethylcellulose (CMC) beads were prepared via ionic cross-linking. Then CMC beads were coated with polyaniline (PANI). The results of FTIR, SEM, DTA and N 2 adsorption-desorption demonstrated that aniline was successfully grafted onto the surface of mCMC beads. The potential use of the prepared adsorbent was used for removal of U(VI) ions. The determined maximum adsorption capacities of the mCMC and mCMC-g-PANI beads for U(VI) ions were 129.4 and 386.5 mg/g dry weight at pH 4.5, respectively. The thermodynamic parameters (ΔH°, ΔS° and ΔG°) were evaluated. The adsorbent systems were regenerated using 0.1 M HCl. (author)

  7. Effect of Welding Parameters on Dilution and Weld Bead Geometry in Cladding

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The effect of pulsed gas metal arc welding (GMAW) variables on the dilution and weld bead geometry in cladding X65 pipeline steel with 316L stainless steel was studied. Using a full factorial method, a series of experiments were carried out to know the effect of wire feed rate, welding speed, distance between gas nozzle and plate, and the vertical angle of welding on dilution and weld bead geometry. The findings indicate that the dilution of weld metal and its dimension i.e. width, height and depth increase with the feed rate, but the contact angle of the bead decreases first and then increases. Meantime, welding speed has an opposite effect except for dilution. There is an interaction effect between welding parameters at the contact angle. The results also show forehand welding or decreasing electrode extension decrease the angle of contact. Finally,a mathematical model is contrived to highlight the relationship between welding variables with dilution and weld bead geometry.

  8. Asynchronous Magnetic Bead Rotation (AMBR Microviscometer for Label-Free DNA Analysis

    Directory of Open Access Journals (Sweden)

    Yunzi Li

    2014-03-01

    Full Text Available We have developed a label-free viscosity-based DNA detection system, using paramagnetic beads as an asynchronous magnetic bead rotation (AMBR microviscometer. We have demonstrated experimentally that the bead rotation period is linearly proportional to the viscosity of a DNA solution surrounding the paramagnetic bead, as expected theoretically. Simple optical measurement of asynchronous microbead motion determines solution viscosity precisely in microscale volumes, thus allowing an estimate of DNA concentration or average fragment length. The response of the AMBR microviscometer yields reproducible measurement of DNA solutions, enzymatic digestion reactions, and PCR systems at template concentrations across a 5000-fold range. The results demonstrate the feasibility of viscosity-based DNA detection using AMBR in microscale aqueous volumes.

  9. Immobilization of catalase on chitosan and amino acid- modified chitosan beads.

    Science.gov (United States)

    Başak, Esra; Aydemir, Tülin

    2013-08-01

    Bovine liver catalase was covalently immobilized onto amino acid-modified chitosan beads. The beads were characterized with SEM, FTIR, TGA and the effects of immobilization on optimum pH and temperature, thermostability, reusability were evaluated. Immobilized catalase showed the maximal enzyme activity at pH 7.0 at 30°C. The kinetic parameters, Km and Vmax, for immobilized catalase on alanine-chitosan beads and lysine-chitosan beads were estimated to be 25.67 mM, 27 mM and 201.39 μmol H2O2/min, 197.50 μmol H2O2/min, respectively. The activity of the immobilized catalase on Ala-CB and Lys-CB retained 40% of its high initial activity after 100 times of reuse.

  10. A micro-pillar array to trap magnetic beads in microfluidic systems

    KAUST Repository

    Gooneratne, Chinthaka Pasan; Kosel, Jü rgen

    2012-01-01

    A micro-pillar array (MPA) is proposed in this paper to trap and separate magnetic beads (MBs) in microfluidic systems. MBs are used in many biomedical applications due to being compatible in dimension to biomolecules, the large surface area

  11. Study of The Effect of Draw-bead Geometry on Stretch Flange Formability

    Science.gov (United States)

    Orlov, O. S.; Winkler, S. L.; Worswick, M. J.; Lloyd, D. J.; Finn, M. J.

    2004-06-01

    A fully instrumented stretch flange press equipped with a back-up punch and draw-beads near the specimen cutout area is simulated. The utilization of different draw-bead geometries is examined numerically to determine the restraining forces, strains and amount of damage generated in stretch flanges during forming. Simulations of the forming process are conducted for 1mm AA5182 sheets with circular cutouts. The damage evolution with the deformed specimens is investigated using the explicit dynamic finite element code, LS-DYNA, with a modified Gurson-based material model. It was found that double draw-beads can provide the same amount of restraining force as single draw-beads, but at reduced levels of damage.

  12. Preparation of carbon nanotubes/epoxy resin composites by using hollow glass beads as the carrier

    International Nuclear Information System (INIS)

    Wu, X.F.; Zhao, Y.K.; Zhang, D.; Chen, T.B.; Ma, L.Y.

    2012-01-01

    Hollow glass beads had been utilized as the carrier to assist dispersion of carbon nanotubes in epoxy resin. Hollow glass beads were firstly aminated with gamma-aminopropyl-triethoxysilane, sencondly reacted with carboxyl-functionalized carbon nanotubes via an amidation reaction and susequently mixed with epoxy resin and hardener. The experimental results showed that carbon nanotubes could be loaded on the surfaces of hollow glass beads and approximately a monolayer of carbon nanotubes was formed when the weight ratio of hollow glass beads to carbon nanotubes was 100:5. Moreover, the dispersity of carbon nanotubes in the matrix was improved as compared to the control samples prepared by using a conventional mixing method. (author)

  13. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  14. Synthesis and characterization of chitosan impregnated calcium alginate beads for removal of uranium from aquatic stream

    International Nuclear Information System (INIS)

    Singhal, R.K.; Basu, H.; Manisha, V.; Reddy, A.V.R.; Sawant, Manjiri; Kamane, Suman

    2015-01-01

    The present study was conducted to study the feasibility of chitosan impregnated calcium alginate beads (Cal-Alg-Chi) to sorb the excess uranium from the aquatic stream. Chitosan is a linear polysaccharide composed of randomly distributed β-(1-4)-linked D glucosamine (deacetylated unit) and N-acetyl-D-glucosamine (acetylated unit). The optimal composition of calcium alginate chitosan beads is 4 % (wt/vol) alginate gel having 5% loading of chitosan. The nature and morphology of pure and uranium sorbed calcium alginate chitosan beads were characterized by scanning electron microscopy (SEM) with energy-dispersive X-ray spectroscopy (EDS), and attenuated total reflectance Fourier transform infrared spectroscopy (ATRFTIR). The results of batch sorption experiments suggest that Cal-Alg-Chi beads are very effective for removal of uranium in the pH range of 2.0-5.0 and sorption is more than 80 % in the concentration range of 1-100 mgL -1

  15. Micro-Raman and micro-XRF analysis of glass beads from the Chungde site, Taiwan

    Science.gov (United States)

    Liou, Y. S.; Wang, S. C.; Liu, Y. C.

    2014-12-01

    A large number of ancient glass beads dating back from Late Neolithic Age to early Historical Period (ca. 2300-400 BP) of Taiwan have been uncovered from archaeological sites. These glass beads with variant colors, shapes, and stylistics have long been considered to possess socio-cultural significance. Due to the color and chemical composition of glass bead might be determined by raw materials, fluxing agents, colorants, opacifiers and stabilizers. In addition, ancient glass beads are rare and precious, non-destructive analysis has been employed to decipher about the provenances, manufacturing techniques, and exchange/trade routes. In this work, micro-Raman spectroscopy and micro X-ray fluorescent spectrometer (μ-XRF) were used to examine ten ancient glass beads excavated from the Chungde site, Hualien, Taiwan, dating back to 1500-800 BP, to unravel the mineralogical and chemical compositions. Micro Raman experimental results show that glass and anorthite glass are the main constituents accompanying with trace level of quartz, albite, siderite, ankerite, and amazonite. The Raman Index of Polymerization (Ip) indicate that the sintering temperature of the glass beads is in the range of 1000~1400°C. Furthermore, the chemical compositions are corresponding to the maximum stretching vibration peak wave number (νmax Si-O Stretching) and the maximum bending vibration peak wave number (δmax Si-O Bending), which are essentially consistent with that of the India-Pacific beads. The μ-XRF results indicate the presence of oxides including SiO2, Al2O3, Fe2O3, Na2O, K2O, CaO, MgO, SnO2, TiO2, CuO, etc., and could be classified to high aluminum of soda-lime glass system. According to ternary phase diagram analysis of CaO-K2O-Na2O and K2O-Al2O3-CaO, the ancient glass beads analyzed could be attributed to the India-Pacific beads, and is in accordance with that of Raman spectra. The combination of these facts leads to the conclusion that glass beads obtained from the Chungde

  16. Intersections of lung progenitor cells, lung disease and lung cancer.

    Science.gov (United States)

    Kim, Carla F

    2017-06-30

    The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials. Copyright ©ERS 2017.

  17. Intersections of lung progenitor cells, lung disease and lung cancer

    Directory of Open Access Journals (Sweden)

    Carla F. Kim

    2017-06-01

    Full Text Available The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials.

  18. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  19. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  20. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...