MCTS (Exams 70-640, 70-642 and 70-643)

CERN Document Server

Panek, William

2011-01-01

The must-have study guide for all three Windows Server 2008 R2 MCTS examsNetwork administrators boost their value to their employers with certification, and Microsoft?s three Windows Server 2008 exams offer certification specialties in configuring Active Directory, Network Infrastructure, and Applications Infrastructure. With complete coverage to prepare you for all three exams, this comprehensive study guide has three times the value. Real-world scenarios and hands-on exercises supplement the information to facilitate learning.The three Windows Server 2008 R2 exams (70-640, 70-642, and 70-643

A comparison of root surface instrumentation using manual, ultrasonic and rotary instruments: An in vitro study using scanning electron microscopy

Directory of Open Access Journals (Sweden)

Preeti Marda

2012-01-01

Results and Conclusion: The RCI and LTSI showed nonsignificant differences between the three groups. RLTSI showed a significant difference between Slimline™ and hand curette as well as Slimline™ and Desmo-Clean™. Slimline™ showed the least mean scores for RCI, LTSI, and RLTSI. Thus, even though the difference was not statistically significant, Slimline™ insert was shown to be better than the other methods as assessed by the indices scores and the instrumentation time.

77 FR 22483 - Guidance Under Sections 642 and 643 (Income Ordering Rules)

Science.gov (United States)

2012-04-16

... 26 CFR part 1, confirming that a provision in a trust, a will, or a provision of local law that... (Code) section 642(c) with regard to the Federal tax consequences of an ordering provision in a trust, a will, or a provision of local law that attempts to determine the tax character of the amounts paid to a...

24 CFR 982.642 - Homeownership option: Pilot program for homeownership assistance for disabled families.

Science.gov (United States)

2010-04-01

... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Special Housing Types Homeownership Option § 982.642 Homeownership... declared major disaster or emergency. (d) Amount and distribution of homeownership assistance payments. (1... payment on behalf of the family in accordance with § 982.635 and this section. (2) A family that is a low...

40 CFR 415.642 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

Science.gov (United States)

2010-07-01

... SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.642 Effluent limitations....32 any existing point source subject to this subpart and producing cadmium pigments must achieve the... of the best practicable control technology currently available (BPT). Subpart BL—Cadmium Pigments...

Enzymatic U(VI) reduction by Desulfosporosinus species

International Nuclear Information System (INIS)

Suzuki, Y.; Kelly, S.D.; Kemner, K.M.; Banfield, J.F.

2004-01-01

Here we tested U(VI) reduction by a Desulfosporosinus species (sp.) isolate and type strain (DSM 765) in cell suspensions (pH 7) containing 1 mM U(VI) and lactate, under an atmosphere containing N 2 -CO 2 -H 2 (90: 5: 5). Although neither Desulfosporosinus species (spp.) reduced U(VI) in cell suspensions with 0.25% Na-bicarbonate or 0.85% NaCl, U(VI) was reduced in these solutions by a control strain, desulfovibrio desulfuricans (ATCC 642). However, both Desulfosporosinus strains reduced U(VI) in cell suspensions depleted in bicarbonate and NaCl. No U(VI) reduction was observed without lactate and H 2 electron donors or with heat-killed cells, indicating enzymatic U(VI) reduction. Uranium(VI) reduction by both strains was inhibited when 1 mM CuCl 2 was added to the cell suspensions. Because the Desulfosporosinus DSM 765 does not contain cytochrome c 3 used by Desulfovibrio spp. to reduce U(VI), Desulfosporosinus species reduce uranium via a different enzymatic pathway. (orig.)

26 CFR 1.642(c)-1 - Unlimited deduction for amounts paid for a charitable purpose.

Science.gov (United States)

2010-04-01

... the election was made, (iii) The office of the district director, or the service center, where the....642(c)-1 Unlimited deduction for amounts paid for a charitable purpose. (a) In general. (1) Any part... election, to a related estate, as defined under § 1.645-1(b), for the amount so paid. (2) In determining...

The Effect of Autoclave Sterilization on Resistance to Cyclic Fatigue of Hero Endodontic File #642 (6%) at Two Artificial Curvature.

Science.gov (United States)

Khabiri, Masoud; Ebrahimi, Maziar; Saei, Mohammad Reza

2017-12-01

File fracture can interfere with cleaning and shaping of the canal and compromise periradicular healing. Autoclave sterilization may prone the files to fracture. The purpose of the present study was to determine the effect of autoclave sterilization on the cyclic fatigue resistance of Hero642 rotary instrument in two curvatures of 45 and 60 degrees. For this experimental in-vitro study, 90 Nickel-Titanium HERO 642 rotary files #30 with 0.06 taper were selected. They were divided into two groups (curvature of 45 and 60 degree) of 45 files. Each group was then subdivided into 3 subgroups; group I: no sterilization, group II: 5 cycles of sterilization and group III: 10 cycles of sterilization. Files were used in artificial canals until fracture. The cyclic fatigue was measured as the number of cycles before fracture. The data was statically analyzed by Student's t-test and two-way analysis of variance. There was a significant difference in cyclic fatigue of two curvature of 45 and 60 degrees ( p = 0.001). However, sterilization process has no significant effect on cyclic fatigue of HERO files ( p = 0.557). Sterilization had no effect on the cyclic fatigue of HERO 642 files when used in curvature of 45 or 60 degrees.

Hematological changes among Beninese motor-bike taxi drivers ...

African Journals Online (AJOL)

user

2INSERM U954, Nutrition Genetic and Exposure to Environmental Risks, Nancy University, Medical Faculty of Nancy,. France. .... corpuscular hemoglobin concentration (MCHC) and mean ..... by the Ministry of Higher Education and Scientific.

26 CFR 1.642(c)-3 - Adjustments and other special rules for determining unlimited charitable contributions deduction.

Science.gov (United States)

2010-04-01

... the gross income of the estate for 1972, and N University receives $100,000 from the estate in such... INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES... unlimited charitable contributions deduction. (a) Income in respect of a decedent. For purposes of §§ 1.642...

BIIDXI, the At4g32460 DUF642 gene, is involved in pectin methyl esterase regulation during Arabidopsis thaliana seed germination and plant development.

Science.gov (United States)

Zúñiga-Sánchez, Esther; Soriano, Diana; Martínez-Barajas, Eleazar; Orozco-Segovia, Alma; Gamboa-deBuen, Alicia

2014-12-02

DUF642 proteins constitute a highly conserved family of proteins that are associated with the cell wall and are specific to spermatophytes. Transcriptome studies have suggested that members of this family are involved in seed development and germination processes. Previous in vitro studies have revealed that At4g32460- and At5g11420-encoded proteins interact with the catalytic domain of pectin methyl esterase 3 (AtPME3, which is encoded by At3g14310). PMEs play an important role in plant development, including seed germination. The aim of this study was to evaluate the function of the DUF642 gene At4g32460 during seed germination and plant development and to determine its relation to PME activity regulation. Our results indicated that the DUF642 proteins encoded by At4g32460 and At5g11420 could be positive regulators of PME activity during several developmental processes. Transgenic lines overexpressing these proteins showed increased PME activity during seed germination, and improved seed germination performance. In plants expressing At4g32460 antisense RNA, PME activity was decreased in the leaves, and the siliques were very short and contained no seeds. This phenotype was also present in the SALK_142260 and SALK_054867 lines for At4g32460. Our results suggested that the DUF642 family contributes to the complexity of the methylesterification process by participating in the fine regulation of pectin status during plant development.

Mediating Pathways in the Socio-Economic Gradient of Child Development: Evidence from Children 6-42 Months in Bogota

Science.gov (United States)

Rubio-Codina, Marta; Attanasio, Orazio; Grantham-McGregor, Sally

2016-01-01

Research has previously shown a gap of near 0.5 of a standard deviation (SD) in cognition and language development between the top and bottom household wealth quartile in children aged 6-42 months in a large representative sample of low- and middle-income families in Bogota, using the Bayley Scales of Infant and Toddler Development. The gaps in…

The design of red-blue 3D video fusion system based on DM642

Science.gov (United States)

Fu, Rongguo; Luo, Hao; Lv, Jin; Feng, Shu; Wei, Yifang; Zhang, Hao

2016-10-01

Aiming at the uncertainty of traditional 3D video capturing including camera focal lengths, distance and angle parameters between two cameras, a red-blue 3D video fusion system based on DM642 hardware processing platform is designed with the parallel optical axis. In view of the brightness reduction of traditional 3D video, the brightness enhancement algorithm based on human visual characteristics is proposed and the luminance component processing method based on YCbCr color space is also proposed. The BIOS real-time operating system is used to improve the real-time performance. The video processing circuit with the core of DM642 enhances the brightness of the images, then converts the video signals of YCbCr to RGB and extracts the R component from one camera, so does the other video and G, B component are extracted synchronously, outputs 3D fusion images finally. The real-time adjustments such as translation and scaling of the two color components are realized through the serial communication between the VC software and BIOS. The system with the method of adding red-blue components reduces the lost of the chrominance components and makes the picture color saturation reduce to more than 95% of the original. Enhancement algorithm after optimization to reduce the amount of data fusion in the processing of video is used to reduce the fusion time and watching effect is improved. Experimental results show that the system can capture images in near distance, output red-blue 3D video and presents the nice experiences to the audience wearing red-blue glasses.

26 CFR 1.642(c)-6 - Valuation of a remainder interest in property transferred to a pooled income fund.

Science.gov (United States)

2010-04-01

... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Valuation of a remainder interest in property... § 1.642(c)-6 Valuation of a remainder interest in property transferred to a pooled income fund. (a) In... transferred property on the valuation date. The fact that the income beneficiary may not receive the last...

Physical water scarcity metrics for monitoring progress towards SDG target 6.4: An evaluation of indicator 6.4.2 "Level of water stress".

Science.gov (United States)

Vanham, D; Hoekstra, A Y; Wada, Y; Bouraoui, F; de Roo, A; Mekonnen, M M; van de Bund, W J; Batelaan, O; Pavelic, P; Bastiaanssen, W G M; Kummu, M; Rockström, J; Liu, J; Bisselink, B; Ronco, P; Pistocchi, A; Bidoglio, G

2018-02-01

Target 6.4 of the recently adopted Sustainable Development Goals (SDGs) deals with the reduction of water scarcity. To monitor progress towards this target, two indicators are used: Indicator 6.4.1 measuring water use efficiency and 6.4.2 measuring the level of water stress (WS). This paper aims to identify whether the currently proposed indicator 6.4.2 considers the different elements that need to be accounted for in a WS indicator. WS indicators compare water use with water availability. We identify seven essential elements: 1) both gross and net water abstraction (or withdrawal) provide important information to understand WS; 2) WS indicators need to incorporate environmental flow requirements (EFR); 3) temporal and 4) spatial disaggregation is required in a WS assessment; 5) both renewable surface water and groundwater resources, including their interaction, need to be accounted for as renewable water availability; 6) alternative available water resources need to be accounted for as well, like fossil groundwater and desalinated water; 7) WS indicators need to account for water storage in reservoirs, water recycling and managed aquifer recharge. Indicator 6.4.2 considers many of these elements, but there is need for improvement. It is recommended that WS is measured based on net abstraction as well, in addition to currently only measuring WS based on gross abstraction. It does incorporate EFR. Temporal and spatial disaggregation is indeed defined as a goal in more advanced monitoring levels, in which it is also called for a differentiation between surface and groundwater resources. However, regarding element 6 and 7 there are some shortcomings for which we provide recommendations. In addition, indicator 6.4.2 is only one indicator, which monitors blue WS, but does not give information on green or green-blue water scarcity or on water quality. Within the SDG indicator framework, some of these topics are covered with other indicators. Copyright © 2017 The Authors

Sana AISSI, Metastasis CK-19 marker

African Journals Online (AJOL)

Marouen

2014-01-15

Jan 15, 2014 ... 2INSERM U837, Centre de Recherche JP Aubert, Equipe n°5, Lille, France. 3Service de ... mortatlity and therapeutic failure (Chen et al., 2013). Surgical or ... by Lin et al. (2000). To increase the sensitivity of this assay, the.

A comparison of root surface instrumentation using manual, ultrasonic and rotary instruments: an in vitro study using scanning electron microscopy.

Science.gov (United States)

Marda, Preeti; Prakash, Shobha; Devaraj, C G; Vastardis, S

2012-01-01

The commonly accepted idea concerning root planing is that excessive removal of cementum is not necessary for removal of endotoxins. The ideal instrument should enable the removal of all extraneous substances from the root surfaces, without causing any iatrogenic effects. To compare the remaining calculus, loss of tooth substance, and roughness of root surface after root planing with Gracey curette, ultrasonic instrument (Slimline insert FSI-SLI-10S), and DesmoClean rotary bur. The efficiency of calculus removal, the amount of lost tooth substance, and root surface roughness resulting from the use of hand curette, ultrasonic instrument, and rotary bur on 36 extracted mandibular incisors were examined by SEM. We used three indices to measure the changes: Remaining calculus index (RCI), Loss of tooth substance index (LTSI), and Roughness loss of tooth substance index (RLTSI). Twelve samples were treated with each instrument. The time required for instrumentation was also noted. Kruskal-Wallis ANOVA was used for multiple group comparisons and the Mann-Whitney test for group-wise comparisons. Analysis was carried out with SPSS software (version 13). The RCI and LTSI showed nonsignificant differences between the three groups. RLTSI showed a significant difference between Slimline and hand curette as well as Slimline and Desmo-Clean. Slimline showed the least mean scores for RCI, LTSI, and RLTSI. Thus, even though the difference was not statistically significant, Slimline insert was shown to be better than the other methods as assessed by the indices scores and the instrumentation time.

26 CFR 1.642(c)-6T - Valuation of a remainder interest in property transferred to a pooled income fund (temporary).

Science.gov (United States)

2010-04-01

... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Valuation of a remainder interest in property..., Trusts, and Beneficiaries § 1.642(c)-6T Valuation of a remainder interest in property transferred to a...) through (c). (d) Valuation. The present value of the remainder interest in property transferred to a...

Intellectual disability, oncogenes and tumour suppressor genes

Indian Academy of Sciences (India)

M. Bidart1 2 3 C. Coutton4 5 3. Plateforme Protéomique et Transcriptomique Clinique, Pole Recherche, CHU Grenoble, 38043 Grenoble, France; Equipe, Nanomédecine et Cerveau, Inserm U836, Grenoble Institut Neurosciences, 38000 Grenoble, France; Université Joseph Fourier, 38000 Grenoble, France; Département ...

From academic research to the creation of Chelatec company

International Nuclear Information System (INIS)

Loussouarn, A.

2002-01-01

Full text: CHELATEC (www.chelatec.fr) was founded in 2000 as a spin-off INSERM at institute U-463, Nantes Hospital, France. The present team has benefited from the abilities and know-how acquired in radioimmunotargeting within the vectorisation group of INSERM. The company provides complete engineering services based on complexation and vectorisation, as adapted to the client's needs in the fields of customised radiolabelling, radioimmunotargeting, decorporation and trapping of metals. CHELATEC conducts R and D activity under contract in key fields of chemical applications to medicine and environment. Our mission is to enable pharmaceutical industries and biotechnolgies companies to successfully exploit our skills and to help them in their product of process development. CHELATEC produces and supplies radiolabelled compounds

Physical water scarcity metrics for monitoring progress towards SDG target 6.4 : An evaluation of indicator 6.4.2 “Level of water stress”

NARCIS (Netherlands)

Vanham, D.; Hoekstra, A. Y.; Wada, Y.; Bouraoui, F.; de Roo, A.; Mekonnen, M. M.; van de Bund, W. J.; Batelaan, O.; Pavelic, P.; Bastiaanssen, Wim G M; Kummu, M.; Rockström, J.; Liu, J.; Bisselink, B.; Ronco, P.; Pistocchi, A.; Bidoglio, G.

2018-01-01

Target 6.4 of the recently adopted Sustainable Development Goals (SDGs) deals with the reduction of water scarcity. To monitor progress towards this target, two indicators are used: Indicator 6.4.1 measuring water use efficiency and 6.4.2 measuring the level of water stress (WS). This paper aims to

Ründo Mülts: "Vanemad on suunanud mind rahvuskultuuri austamise vaimus" / Raivo Raigna ; kommenteerinud Hanno Tamm, Priit Adler

Index Scriptorium Estoniae

Raigna, Raivo

2011-01-01

Päinurme koduloomuuseumist, mille rajaja ja omanik on Ründo Mülts. Sel suvel valminud Ründo Mültsi filmist "Võhmuta mõis ja asundus aegade tuules". Tallinna Ülikooli ajalootudengina asus ta uurimisöö raames uurima antud piirkonna minevikku ning otsustas jäädvustada nähtu-kuuldu ka filmilindile

Experimental determination of cesium saturated vapor pressure in the 483/642 deg K temperature

Energy Technology Data Exchange (ETDEWEB)

Gushchin, G I; Subbotin, V A; Khachaturov, Eh Kh [Gosudarstvennyj Komitet po Ispol' zovaniyu Atomnoj Ehnergii SSSR, Obninsk. Fiziko-Ehnergeticheskij Inst.

1975-07-01

Test results of saturated cesium vapour pressure in the temperature range of 483.13-642 deg K and pressure range of 15.77-1.389 N/m/sup 2/ by direct static method are presented. The testing system comprises a differential bellows-type pressure sensor, a thermostatic unit and a gas system with V-shaped oil manometer used for argon-assisted sensor calibration. The static sensor characteristic approaches linearity in the pressure range of 10-600 N/m/sup 2/. The greatest non-linearity is observed at low pressures (10-40 N/m/sup 2/) and does not exceed 3-4%. Sensor sensitivity is 0.39 mV/N/m/sup 2/ in this pressure range. The characteristic hysteresis is 0.5% and below. With pressures greater than 600 N/m/sup 2/, the sensor sensitivity gradually decreases by 12% while the characteristic hysteresis increases to 2-3%. A brief description of the experimental procedure is offered. The present results are compared with other authors' data.

ESNIB (European Science Notes Information Bulletin): Reports on Current European/Middle Eastern Science

Science.gov (United States)

1989-11-01

engineering schools through research, a human growth hormone , the absence of which causes dwarfism . The product is obtained by inserting the gene Italy of the...increase (in addition to the funds earmarked for such research out of their SERONO Institute Produces Human Growth Hormone . own budgets by INSERM, CNRS...Connie R. Orendorf ACOUSTICS Psychoacoustics Research at the Applied Psychology Unit, Medical Research Council, Cambridge, U.K

Causes of death in a cohort of EDF-GDF employees: comparison between occupational medicine and official statistics data

International Nuclear Information System (INIS)

Marchand, J.L.; Imbernon, E.; Goldberg, M.

2003-01-01

Background: In an epidemiological study, medical causes of death may be obtained from different sources. In a study on French gas and electricity company (EDF-GDF) workers, they were obtained front the national INSERM database. Additionally, the causes collected by the EDF-GDF occupational physicians, were available for a subset of 1,330 deaths, which occurred between 1989 and 1994. The data from the two sources were compared with each other, in order to assess whether they were globally equivalent, and the potential impact of their differences on the results of epidemiological analyses. Methods: Concordance rates between causes of death in the INSERM and EDF-GDF physicians databases were calculated according to the International Classification of Diseases (ICD) ninth revision codes and for various causes groups. Causes of death records were also examined in order to clarify the observed divergences. SMRs were computed in order to evaluate the consequences of using each. database in epidemiological analyses. Finally, some SMRs were computed with the two sources and compared with each other. Results: INSERM and EDF-GDF physicians causes belonged to the same causes group in 81 % of cases, but the exact cause was different for- more than half of them. The concordance rate was high for the deaths by AIDS and by cancer, and low for deaths by respiratory system and digestive system diseases. More causes of death were coded as 'unknown' in EDF-GDF physicians data than in INSERM data. The SMRs varied widely depending on whether the INSERM or EDF-GDF physicians causes of death databases were used. Conclusions: Causes of death recorded in the INSERM and EDF-GDF physicians databases are very different. Therefore, using the national mortality rates computed by INSERM with the EDF-GDF physicians causes of death to calculate SMRs is not valid, and it is observed that they may be very different from those computed with INSERM data. In a general way, it should be better to use the

Crewstation Assessment of Reach as Applied to the OH-58A Helicopter

Science.gov (United States)

1984-12-13

CLUSTER ENO ENO OFICE FIELD 0gMA BR? OMR BRI T CONSOLE LTS NST LTSI OFF OFF NO BRT MVO ANTI COLLISION FOS LTS Lii LTS OFF *OFF CFF OFF OFr AUTO Hyp...gINTER)-- 2 ANALISIS OPION(1-ALL OPERATORq,2-OPZRATORS ON LOS ONLY)--L 1 RFACH ALCORITHNl(lPASS THROUGH CONTROL,2-TERNINAIE &T CONTROL)-- 2 ***OPERATOR NO

Personal best times in an Olympic distance triathlon and in a marathon predict Ironman race time in recreational male triathletes

OpenAIRE

R?st, Christoph Alexander; Knechtle, Beat; Knechtle, Patrizia; Rosemann, Thomas; Lepers, Romuald

2011-01-01

Christoph Alexander Rüst1, Beat Knechtle1,2, Patrizia Knechtle2, Thomas Rosemann1, Romuald Lepers31Institute of General Practice and Health Services Research, University of Zurich, Zurich, Switzerland; 2Gesundheitszentrum St Gallen, St Gallen, Switzerland; 3INSERM U887, University of Burgundy, Faculty of Sport Sciences, Dijon, FranceBackground: The purpose of this study was to define predictor variables for recreational male Ironman triathletes, using age and basic measurements of an...

Predictor variables for a half marathon race time in recreational male runners

OpenAIRE

Rüst, C A; Knechtle, B; Knechtle, P; Barandun, U; Lepers, R; Rosemann, T

2011-01-01

Christoph Alexander Rüst1, Beat Knechtle1,2, Patrizia Knechtle2, Ursula Barandun1, Romuald Lepers3, Thomas Rosemann11Institute of General Practice and Health Services Research, University of Zurich, Zurich, Switzerland; 2Gesundheitszentrum St Gallen, St Gallen, Switzerland; 3INSERM U887, University of Burgundy, Faculty of Sport Sciences, Dijon, FranceAbstract: The aim of this study was to investigate predictor variables of anthropometry, training, and previous experience in order to ...

76 FR 80327 - Notice of Request for a Revision and Extension of a Currently Approved Information Collection...

Science.gov (United States)

2011-12-23

... such records that fully and correctly disclose all transactions in their business (21 U.S.C. 642... of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, gender, religion, age, disability, political beliefs, sexual orientation...

Comparison of U-Pu-Mo, U-Pu-Nb, U-Pu-Ti and U-Pu-Zr alloys; Comparaison des alliages U-Pu-Mo, U-Pu-Nb, U-Pu-Ti, U-Pu-Zr

Energy Technology Data Exchange (ETDEWEB)

Boucher, R; Barthelemy, P [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1964-07-01

The data concerning the U-Pu, U-Pu-Mo and U-Pu-Nb are recalled. The results obtained with U-Pu-Ti and U-Pu-Zr alloys containing 15-20 per cent Pu and 10 wt. per cent ternary element are reported. The transformation temperatures, the expansion coefficients, the nature of phases, the thermal cycling behaviour have been determined. A list of the principal properties of these different alloys is presented and the possibilities of their use as fast reactor's fuel element are considered. The U-Pu-Ti alloys seem to be quite promising: easiness of fabrication, large thermal stability, excellent behaviour in air, small quantity of zeta phase, temperature of solidus superior to 1100 deg. C. (authors) [French] On rappelle brievement les connaissances acquises sur les alliages U-Pu, U-Pu-Mo et U-Pu-Nb. On presente les resultats obtenus avec les alliages U-Pu-Ti et U-Pu-Zr pour des teneurs de 15 a 20 pour cent de plutonium et 10 pour cent en poids d'element ternaire. On a determine les temperatures de transformation, les coefficients de dilatation, la nature des phases, la conductibilite thermique a 20 deg. C, la tenue au cyclage thermique et diverses autres proprietes. Un tableau resume les principales proprietes des divers alliages. On considere les possibilites d'emploi de ces alliages comme combustibles de reacteur rapide. Les alliages U-Pu-Ti paraissent particulierement interessants: facilite d'elaboration, stabilite thermique etendue, tenue dans l'air excellente, faible quantite de la phase U-Pu zeta, temperature de fusion commencante superieure a 1100 deg. C. (auteurs)

Seroprevalence of Epstein-Barr virus infection in U.S. children ages 6-19, 2003-2010.

Directory of Open Access Journals (Sweden)

Jennifer Beam Dowd

Full Text Available BACKGROUND: Epstein-Barr virus (EBV is a common herpesvirus linked to infectious mononucleosis and multiple cancers. There are no national estimates of EBV seroprevalence in the United States. Our objective was to estimate the overall prevalence and sociodemographic predictors of EBV among U.S. children and adolescents aged 6-19. METHODS: We calculated prevalence estimates and prevalence ratios for EBV seroprevalence using data from the 2003-2010 U.S. National Health and Nutrition Examination Survey (NHANES for children aged 6-19 (n = 8417. Poisson regression was used to calculate multivariable-adjusted prevalence ratios across subgroup categories (sex, race/ethnicity, parental education, household income, household size, foreign-born, BMI, and household smoking. FINDINGS: Overall EBV seroprevalence was 66.5% (95% CI 64.3%-68.7%.. Seroprevalence increased with age, ranging from 54.1% (95% CI 50.2%-57.9% for 6-8 year olds to 82.9% (95% CI 80.0%-85.9% for 18-19 year olds. Females had slightly higher seroprevalence (68.9%, 95% CI 66.3%-71.6% compared to males (64.2%, 95% CI 61.7%-66.8%. Seroprevalence was substantially higher for Mexican-Americans (85.4%, 95% CI 83.1%-87.8% and Non-Hispanic Blacks (83.1%, 95% CI 81.1%-85.1% than Non-Hispanic Whites (56.9%, 95% CI 54.1%-59.8%. Large differences were also seen by family income, with children in the lowest income quartile having 81.0% (95% CI 77.6%-84.5% seroprevalence compared to 53.9% (95% CI 50.5%-57.3% in the highest income quartile, with similar results for parental education level. These results were not explained by household size, BMI, or parental smoking. Among those who were seropositive, EBV antibody titers were significantly higher for females, Non-Hispanic Blacks and Mexican-Americans, with no association found for socioeconomic factors. CONCLUSIONS: In the first nationally representative U.S. estimates, we found substantial socioeconomic and race/ethnic differences in the

IDH1 and IDH2 mutations as novel therapeutic targets: current perspectives

Directory of Open Access Journals (Sweden)

Mondesir J

2016-09-01

Full Text Available Johanna Mondesir1,2 Christophe Willekens3–5 Mehdi Touat6,7 Stéphane de Botton3–5 1Service d’Immunopathologie Clinique, Hôpital Saint Louis, 2CNRS UMR8104, INSERM U1016, Institut Cochin, Université Paris Descartes, Paris, 3Gustave Roussy, Université Paris-Saclay, Service d’Hématologie Clinique, 4INSERM U1170, Gustave Roussy, Université Paris-Saclay, Villejuif, 5Faculté de médecine Paris-Sud, Kremlin-Bicêtre, 6AP-HP, Hôpitaux Universitaires La Pitié Salpêtrière – Charles Foix, Service de Neurologie 2-Mazarin, Paris, 7Gustave Roussy, Université Paris‑Saclay, Département d’Innovation Thérapeutique et d’Essais Précoces, Villejuif, France Abstract: Isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2 are key metabolic enzymes that convert isocitrate to α-ketoglutarate. IDH1/2 mutations define distinct subsets of cancers, including low-grade gliomas and secondary glioblastomas, chondrosarcomas, intrahepatic cholangiocarcinomas, and hematologic malignancies. Somatic point mutations in IDH1/2 confer a gain-of-function in cancer cells, resulting in the accumulation and secretion in vast excess of an oncometabolite, the D-2-hydroxyglutarate (D-2HG. Overproduction of D-2HG interferes with cellular metabolism and epigenetic regulation, contributing to oncogenesis. Indeed, high levels of D-2HG inhibit α-ketoglutarate-dependent dioxygenases, including histone and DNA demethylases, leading to histone and DNA hypermethylation and finally a block in cell differentiation. Furthermore, D-2HG is a biomarker suitable for the detection of IDH1/2 mutations at diagnosis and predictive of the clinical response. Finally, mutant-IDH1/2 enzymes inhibitors have entered clinical trials for patients with IDH1/2 mutations and represent a novel drug class for targeted therapy. Keywords: tumor metabolism, epigenetic, oncogene, IDH1, IDH2, glioma, acute myeloid leukemia, 2-HG, targeted therapies

Isotope shift of 234U, 236U, 238U in U I

International Nuclear Information System (INIS)

Gagne, J.M.; Nguyen Van, S.; Saint-Dizier, J.P.; Pianarosa, P.

1976-01-01

New and very accurate data of isotope shifts and relative isotope shifts in 234 U, 236 U, 238 U are presented. The invariance of the relative isotope shift, for the transitions we have investigated, supports the hypothesis that the so called specific mass effect is negligible in uranium

Relationship between blood eosinophils, clinical characteristics, and mortality in patients with COPD

Directory of Open Access Journals (Sweden)

Zysman M

2017-06-01

Full Text Available Maeva Zysman,1 Gaëtan Deslee,2 Denis Caillaud,3 Pascal Chanez,4 Roger Escamilla,5 Isabelle Court-Fortune,6 Pascale Nesme-Meyer,7 Thierry Perez,8 Jean-Louis Paillasseur,9 Christophe Pinet,10 Gilles Jebrak,11 Nicolas Roche,12,* Pierre-Régis Burgel12,* On behalf of the Initiatives BPCO (broncho-pneumopathie chronique obstructive Scientific Committee and Investigators 1Pulmonary Dpt, Nancy, Inserm U955, team 04, Créteil, France; 2Pulmonary Dpt, Maison Blanche University Hospital, INSERM U903, Reims, France; 3Pulmonary Dpt, Gabriel Montpied University Hospital, Auvergne University, Clermont-Ferrand, France; 4Pulmonary Dpt, APHM, INSERM U1077, CNRS UMR 7733 Aix Marseille Université, Marseille, France; 5Pulmonary Dpt, Larrey University Hospital, Toulouse, France; 6Pulmonary Dpt, University Hospital, Saint-Etienne, France; 7Pulmonary Dpt, La Croix Rousse University Hospital, Lyon, France; 8Clinique des Maladies Respiratoires, Albert Calmette University Hospital, Lille, France; 9EFFI-STAT, Paris, France; 10Service de pneumologie, polyclinique Les Fleurs, Ollioules, France; 11Pulmonary Dpt, Bichat Hospital, AP-HP, Paris, France; 12Respiratory and Intensive Care Medicine Dpt, Cochin Hospital, AP-HP and Paris Descartes University (EA2511, Sorbonne Paris Cité, Paris, France *These authors contributed equally to this work Abstract: In patients with COPD, there is controversy regarding the association of blood eosinophil (Eos levels with 1 exacerbation frequency and 2 the effect of inhaled corticosteroids for prevention of exacerbations. To determine whether Eos define subgroups of patients exhibiting attributes of COPD clinical phenotypes, we compared clinical features and mortality rates in COPD patients from the Initiatives BPCO French cohort categorized using different thresholds of blood Eos levels. The following data were collected at inclusion: medical and smoking history, occupational exposures, dyspnea, cough and sputum production, exacerbations

Comparison of U-Pu-Mo, U-Pu-Nb, U-Pu-Ti and U-Pu-Zr alloys

International Nuclear Information System (INIS)

Boucher, R.; Barthelemy, P.

1964-01-01

The data concerning the U-Pu, U-Pu-Mo and U-Pu-Nb are recalled. The results obtained with U-Pu-Ti and U-Pu-Zr alloys containing 15-20 per cent Pu and 10 wt. per cent ternary element are reported. The transformation temperatures, the expansion coefficients, the nature of phases, the thermal cycling behaviour have been determined. A list of the principal properties of these different alloys is presented and the possibilities of their use as fast reactor's fuel element are considered. The U-Pu-Ti alloys seem to be quite promising: easiness of fabrication, large thermal stability, excellent behaviour in air, small quantity of zeta phase, temperature of solidus superior to 1100 deg. C. (authors) [fr

Equilibrium electrode U(4)-U and redox U(4)-U(3) potentials in molten alkali metal chlorides medium

Energy Technology Data Exchange (ETDEWEB)

Smirnov, M V; Kudyakov, V Ya; Komarov, V E; Salyulev, A B [AN SSSR, Sverdlovsk. Inst. Ehlektrokhimii

1979-02-01

Conditional standard electrode potentials of uranium are determined for diluted solutions of its tetrachloride in alkali metal chloride melts (LiCl, NaCl, NaCl-KCl, KCl, RbCl and CsCl) when using U(4) ion activity coefficient values experimentally found by the tensimetric method. These potentials shift to the electronegative side at the temperature decrease and alkali cation radius increase rsub(Msup(+)) according to the empiric ratio E*U(4)-U= -3.06+6.87x10/sup -4/ T-(1.67-10/sup -4/T-0.44) 1/rsub(Msup(+)) +-0.01. The temperature dependences of formal conditional redox potentials of the U(4)-U(3) system for above melted chlorides are estimated. The E*U(4)-U(3) value also becomes more electronegative in the series LiCl, NaCl, NaCl-KCl, KCl, RbCl and CsCl. This alternation is satisfactorily described by the empiric expression E*U(4)-U(3)= -1.74+1.74x10/sup -4/T-(0.71x10/sup -4/T-0.20) 1rsub(Msup(+)) +-0.05. The calculated values Eu*(4)-U(3) are compared with those directly measured for the NaCl-KCl equimolar mixture and 3LiCl-2KCl eutectic mixture. A satisfactory confirmity has been observed.

Equilibrium electrode U(4)-U and redox U(4)-U(3) potentials in molten alkali metal chlorides medium

International Nuclear Information System (INIS)

Smirnov, M.V.; Kudyakov, V.Ya.; Komarov, V.E.; Salyulev, A.B.

1979-01-01

Conditional standard electrode potentials of uranium are determined for diluted solutions of its tetrachloride in alkali metal chloride melts (LiCl, NaCl, NaCl-KCl, KCl, RbCl and CsCl) when using U(4) ion activity coefficient values experimentally found by the tensimetric method. These potentials shift to the electronegative side at the temperature decrease and alkali cation radius increase rsub(Msup(+)) according to the empiric ratio E*U(4)-U= -3.06+6.87x10 -4 T-(1.67-10 -4 T-0.44) 1/rsub(Msup(+)) +-0.01. The temperature dependences of formal conditional redox potentials of the U(4)-U(3) system for above melted chlorides are estimated. The E*U(4)-U(3) value also becomes more electronegative in the series LiCl, NaCl, NaCl-KCl, KCl, RbCl and CsCl. This alternation is satisfactorily described by the empiric expression E*U(4)-U(3)= -1.74+1.74x10 -4 T-(0.71x10 -4 T-0.20) 1rsub(Msup(+)) +-0.05. The calculated values Eu*(4)-U(3) are compared with those directly measured for the NaCl-KCl equimolar mixture and 3LiCl-2KCl eutectic mixture. A satisfactory confirmity has been observed

U.S. Korean Youth's Ideas and Experience of U.S. Education, U.S. Society, and U.S. History

Science.gov (United States)

An, Sohyun

2009-01-01

Drawing on and conversing with the large body of research and literature on young people's historical understanding, Asian American education, transnational migration, and Korean American studies, this dissertation research explored contemporary U.S. Korean youth's ideas and experiences of U.S. education, U.S. society and U.S. history.…

Dicty_cDB: Contig-U16581-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 915_913( CP000915 |pid:none) Francisella tularensis subsp. me... 174 1e-41 AP008232_642( AP008232 |pid:none) Sodalis glossini...( FM992690 |pid:none) Candida dubliniensis CD36 chromo... 227 9e-58 (Q9Y7F0) RecName: Full=Peroxiredoxin TSA...9( CP000148 |pid:none) Geobacter metallireducens GS-15... 199 3e-49 AY842247_1( AY842247 |pid:none) Leishmania amazonensi...2e-48 AE001363_758( AE001363 |pid:none) Chlamydophila pneumoniae CWL029,... 196 2e-48 CP001071_1298( CP001071 |pid:none) Akkermansi...none) Helicobacter pylori isolate HP52 a... 169 3e-40 CU468135_2542( CU468135 |pid:none) Erwinia tasmaniensi

Determination of the isotopic ratio 234 U/238 U and 235 U/238 U in uranium commercial reagents by alpha spectroscopy

International Nuclear Information System (INIS)

Iturbe G, J.L.

1990-02-01

In this work the determination of the isotope ratio 234 U/ 238 U and 235 U/ 238 U obtained by means of the alpha spectroscopy technique in uranium reagents of commercial marks is presented. The analyzed uranium reagents were: UO 2 (*) nuclear purity, UO 3 (*) poly-science, metallic uranium, uranyl nitrate and uranyl acetate Merck, uranyl acetate and uranyl nitrate Baker, uranyl nitrate (*) of the Refinement and Conversion Department of the ININ, uranyl acetate (*) Medi-Lab Sigma of Mexico and uranyl nitrate Em Science. The obtained results show that the reagents that are suitable with asterisk (*) are in radioactive balance among the one 234 U/ 238 U, since the obtained value went near to the unit. In the case of the isotope ratio 235 U/ 238 U the near value was also obtained the one that marks the literature that is to say 0.04347, what indicates that these reagents contain the isotope of 235 U in the percentage found in the nature of 0.71%. The other reagents are in radioactive imbalance among the 234 U/ 238 U, the found values fluctuated between 0.4187 and 0.1677, and for the quotient of activities 235 U/ 238 U its were of 0.0226, and the lowest of 0.01084. Also in these reagents it was at the 236 U as impurity. The isotope of 236 U is an isotope produced artificially, for what is supposed that the reagents that are in radioactive imbalance were synthesized starting from irradiated fuel. (Author)

Anti-U-like as an alloantibody in S-s-U- and S-s-U+(var) black people.

Science.gov (United States)

Peyrard, Thierry; Lam, Yin; Saison, Carole; Arnaud, Lionel; Babinet, Jérôme; Rouger, Philippe; Bierling, Philippe; Janvier, Daniel

2012-03-01

S, s, and U antigens belong to the MNS system. They are carried by glycophorin B (GPB), encoded by GYPB. Black people with the low-prevalence S-s- phenotype, either U- or U+(var), can make a clinically significant anti-U. Anti-U-like, a cold immunoglobulin G autoantibody quite commonly observed in S-s+U+ black persons, was previously described to be nonreactive with ficin-, α-chymotrypsin-, and pronase-treated red blood cells (RBCs); nonreactive or weakly reactive with papain-treated RBCs; and reactive with trypsin-treated RBCs. Here we describe, in S-s- people from different molecular backgrounds, an alloantibody to a high-prevalence GPB antigen, which presents the same pattern of reactivity with proteases as autoanti-U-like. Four S-s- patients with an alloantibody to a high-prevalence GPB antigen were investigated by serologic and molecular methods. An alloantibody was observed in two S-s-U-/Del GYPB, one S-s-U+(var)/GYPB(P2), and one S-s-U+(var)/GYPB(NY) patients. As this alloantibody showed the same pattern of reactivity with proteases as autoanti-U-like, we decided to name it "anti-U-like." Anti-U-like made by the two S-s-U- patients was reactive with the S-s-U+(var) RBCs of the two other patients. S-s-U-/Del GYPB, S-s-U+(var)/GYPB(P2), and S-s-U+(var)/GYPB(NY) patients can make an alloanti-U-like. Anti-U-like made by S-s-U- people appears reactive with GYPB(P2) and GYPB(NY) RBCs, which both express a weak and partial U-like reactivity. We recommend transfusing S-s-U- RBCs in S-s-U- patients showing alloanti-U-like. Our study contributes to a better understanding of alloimmunization to GPB in black people and confirms importance of genotyping in S-s- patients, especially those with sickle cell disease to be frequently transfused. © 2011 American Association of Blood Banks.

Behavior of uranium along Jucar River (Eastern Spain). Determination of 234U/238U and 235U/238U ratios

International Nuclear Information System (INIS)

Rodriguez-Alvarez, M.J.; Sanchez, F.

1995-01-01

The uranium concentration and the 234 U/ 238 U, 235 U/ 238 U activity ratios were studied in water samples from Jucar River, using low-level α-spectrometry. The effects of pH, temperature and salinity were considered and more detailed sampling was done in the neighbourhood of Cofrentes Nuclear Plant (Valencia, Spain). Changes were observed in the uranium concentration with the salinity and the 234 U/ 238 U activity ratio was found to vary with pH. Leaching and dilution, which depend on pH and salinity, are the probable mechanisms for these changes in the concentration of uranium and the activity ratios. (author) 25 refs.; 4 figs.; 1 tab

238U, 234U and 232Th in seawater

International Nuclear Information System (INIS)

Chen, J.H.; Edwards, R.L.; Wasserburg, G.J.

1986-01-01

We have developed techniques to determine 238 U, 234 U and 232 Th concentrations in seawater by isotope dilution mass spectrometry. Using these techniques, we have measured 238 U, 234 U and 232 Th in vertical profiles of unfiltered, acidified seawater from the Atlantic and 238 U and 234 U in vertical profiles from the Pacific. Determinations of 234 U/ 238 U at depths ranging from 0 to 4900 m in the Atlantic (7 0 44'N, 40 0 43'W) and the Pacific (14 0 41'N, 160 0 01'W) Oceans are the same within experimental error (±5per mille, 2σ). The average of these 234 U/ 238 U measurements is 144±2per mille (2σ) higher than the equilibrium ratio of 5.472 x 10 -5 . U concentrations, normalized to 35per mille salinity, range from 3.162 to 3.281 ng/g, a range of 3.8%. The average concentration of the Pacific samples (31 0 4'N, 159 0 1'W) is ∝1% higher than that of the Atlantic (7 0 44'N, 40 0 43'W and 31 0 49'N, 64 0 6'W). 232 Th concentrations from an Atlantic profile range from 0.092 to 0.145 pg/g. The observed constancy of the 234 U/ 238 U ratio is consistent with the predicted range of 234 U/ 238 U using a simple two-box model and the residence time of deep water in the ocean determined from 14 C. The variation in salinity-normalized U concentrations suggests that U may be much more reactive in the marine environment than previously thought. (orig./WB)

Transformation temperatures γU → δUZr2 Y γU →αU in U-Zr-Nb alloys

International Nuclear Information System (INIS)

Komar Varela, Carolina L.; Arico, Sergio F.; Gribaudo, Luis M.; Comision Nacional de Energia Atomica, General San Martin

2009-01-01

The international RERTR program has as primary objective the development of new fuels for research and test reactors to satisfy the requirement of low enrichment in 235 U (lower than 20 %). It is known that the cubic-phase (γU) has an excellent behaviour under irradiation. In this context, in the Materials Department (GIDAT-GAEN-CNEA) U-Zr-Nb alloys are considered candidates for the development of a high-density monolithic-type nuclear fuel. It is necessary to evaluate the thermodynamic parameters that allow to obtain a range of concentrations of the U-Zr-Nb system in which this phase can be retained in the metastable condition with the required 235 U density. In this work, eight U alloys with concentrations ranging from 13.9 to 43.7 wt.% Zr and from 0 to 6.4 wt.% Nb, were fabricated. Dynamical measurements of electrical resistivity, with a cooling rate of 4 o C/min, were performed and the results were analyzed. Considering this cooling rate, a Nb concentration of at least 17.8 wt. % would inhibit the transformation γU→ δUZr 2 and a concentration of al least 23.3 wt % would inhibit the γU → αU transformation. (author)

Determination of the isotopic ratio {sup 234} U/{sup 238} U and {sup 235} U/{sup 238} U in uranium commercial reagents by alpha spectroscopy; Determinacion de la relacion isotopica {sup 234} U/{sup 238} U y {sup 235} U/{sup 238} U en reactivos comerciales de uranio por espectrometria alfa

Energy Technology Data Exchange (ETDEWEB)

Iturbe G, J L

1990-02-15

In this work the determination of the isotope ratio {sup 234} U/{sup 238} U and {sup 235} U/{sup 238} U obtained by means of the alpha spectroscopy technique in uranium reagents of commercial marks is presented. The analyzed uranium reagents were: UO{sub 2} (*) nuclear purity, UO{sub 3} (*) poly-science, metallic uranium, uranyl nitrate and uranyl acetate Merck, uranyl acetate and uranyl nitrate Baker, uranyl nitrate (*) of the Refinement and Conversion Department of the ININ, uranyl acetate (*) Medi-Lab Sigma of Mexico and uranyl nitrate Em Science. The obtained results show that the reagents that are suitable with asterisk (*) are in radioactive balance among the one {sup 234} U/{sup 238} U, since the obtained value went near to the unit. In the case of the isotope ratio {sup 235} U/{sup 238} U the near value was also obtained the one that marks the literature that is to say 0.04347, what indicates that these reagents contain the isotope of {sup 235} U in the percentage found in the nature of 0.71%. The other reagents are in radioactive imbalance among the {sup 234} U/{sup 238} U, the found values fluctuated between 0.4187 and 0.1677, and for the quotient of activities {sup 235} U/{sup 238} U its were of 0.0226, and the lowest of 0.01084. Also in these reagents it was at the {sup 236} U as impurity. The isotope of {sup 236} U is an isotope produced artificially, for what is supposed that the reagents that are in radioactive imbalance were synthesized starting from irradiated fuel. (Author)

Hydrogen absorption properties of U6Mn and U6Ni

International Nuclear Information System (INIS)

Ito, H.; Yamawaki, M.; Yamamoto, T.

1998-01-01

The hydrogen absorption properties of U, U 6 Mn and U 6 Ni were investigated at hydrogen pressures below 10 5 Pa. The pressure-composition (P-C) isotherms of U, U 6 Mn and U 6 Ni were obtained and the amounts of absorbed hydrogen for U, U 6 Mn and U 6 Ni were determined to be 3, 16.6 and 16.0 for x in MH x , where M is U, U 6 Mn and U 6 Ni, respectively. The desorption plateau pressures at 573 K decreased in the order: U 6 Mn-H>U 6 Ni-H>U-H. In addition, the results for the amounts of absorbed hydrogen suggests the formation of ternary hydrides U 6 MnH 18 and U 6 NiH 14 . (orig.)

The Excited Spin State of 1I/2017 U1 ‘Oumuamua

Science.gov (United States)

Belton, Michael J. S.; Hainaut, Olivier R.; Meech, Karen J.; Mueller, Beatrice E. A.; Kleyna, Jan T.; Weaver, Harold A.; Buie, Marc W.; Drahus, Michał; Guzik, Piotr; Wainscoat, Richard J.; Waniak, Wacław; Handzlik, Barbara; Kurowski, Sebastian; Xu, Siyi; Sheppard, Scott S.; Micheli, Marco; Ebeling, Harald; Keane, Jacqueline V.

2018-04-01

We show that ‘Oumuamua’s excited spin could be in a high-energy long axis mode (LAM) state, which implies that its shape could be far from the highly elongated shape found in previous studies. CLEAN and ANOVA algorithms are used to analyze ‘Oumuamua’s lightcurve using 818 observations over 29.3 days. Two fundamental periodicities are found at frequencies (2.77 ± 0.11) and (6.42 ± 0.18) cycles/day, corresponding to (8.67 ± 0.34) hr and (3.74 ± 0.11) hr, respectively. The phased data show that the lightcurve does not repeat in a simple manner, but approximately shows a double minimum at 2.77 cycles/day and a single minimum at 6.42 cycles/day. ‘Oumuamua could be spinning in either the LAM or short axis mode (SAM). For both, the long axis precesses around the total angular momentum vector with an average period of (8.67 ± 0.34) hr. For the three LAMs we have found, the possible rotation periods around the long axis are 6.58, 13.15, or 54.48 hr, with 54.48 hr being the most likely. ‘Oumuamua may also be nutating with respective periods of half of these values. We have also found two possible SAM states where ‘Oumuamua oscillates around the long axis with possible periods at 13.15 and 54.48 hr. In this case any nutation occurs with the same periods. Determination of the spin state, the amplitude of the nutation, the direction of the total angular momentum vector (TAMV), and the average total spin period may be possible with a direct model fit to the lightcurve. We find that ‘Oumuamua is “cigar-shaped,” if close to its lowest rotational energy, and an extremely oblate spheroid if close to its highest energy state.

Heterogeneity in the 238U/235U Ratios of Angrites.

Science.gov (United States)

Tissot, F.; Dauphas, N.; Grove, T. L.

2016-12-01

Angrites are differentiated meteorites of basaltic composition, of either volcanic or plutonic origin, that display minimal post-crystallization alteration, metamorphism, shock or impact brecciation. Because quenched angrites cooled very rapidly, all radiochronometric systems closed simultaneously in these samples. Quenched angrites are thus often used as anchors for cross-calibrating short-lived dating methods (e.g., 26Al-26Mg) and the absolute dating techniques (e.g, Pb-Pb). Due to the constancy of the 238U/235U ratio in natural samples, Pb-Pb ages have long been calculated using a "consensus" 238U/235U ratio, but the discovery of resolvable variations in the 238U/235U ratio of natural samples, means that the U isotopic composition of the material to date also has to be determined in order to obtain high-precision Pb-Pb ages. We set out (a) to measure at high-precision the 238U/235U ratio of a large array of angrites to correct their Pb-Pb ages, and (b) to identify whether all angrites have a similar U isotopic composition, and, if not, what were the processes responsible for this variability. Recently, Brennecka & Wadhwa (2012) suggested that the angrite-parent body had a homogeneous 238U/235U ratio. They reached this conclusion partly because they propagated the uncertainties of the U isotopic composition of the various U double spikes that they used onto the final 238U/235U ratio the sample. Because this error is systematic (i.e., it affects all samples similarly), differences in the δ238U values of samples corrected by the same double spike are better known than one would be led to believe if uncertainties on the spike composition are propagated. At the conference, we will present the results of the high-precision U isotope analyses for six angrite samples: NWA 4590, NWA 4801, NWA 6291, Angra dos Reis, D'Orbigny, and Sahara 99555. We will show that there is some heterogeneity in the δ238U values of the angrites and will discuss the possible processes by

[Shaping ability of two nickel-titanium rotary systems in simulated S-shaped canals].

Science.gov (United States)

Luo, Hong-xia; Huang, Ding-ming; Zhang, Fu-hua; Tan, Hong; Zhou, Xue-dong

2008-01-01

To evaluate the shaping ability of two nickel-titanium rotary systems (ProTaper and Hero642) in simulated S-shaped canals. Thirty simulated S-shaped canals were randomly divided into three groups and prepared by ProTaper, Hero642, ProTaper combined with Hero642 respectively. All the canals were scanned before and after instrumentation, and the amount of material removed in the inner and outer wall and the canal width after instrumentation were measured with a computer image analysis program. There was significant difference in the amount of material removed at the inner side of apical curvature and outer side of apex between ProTaper combined with Hero642 and ProTaper files (P Hero642, and the taper of canals were better than those prepared by Hero642. ProTaper combined with Hero 642 had better shaping ability to maintain the original shape and could create good taper canals in the simulated S-shaped canal model.

Preparation of 235mU targets for 235U(n,n')235mU cross section measurements

International Nuclear Information System (INIS)

Bond, E.M.; Vieira, D.J.; Rundberg, R.S.; Glover, S.; Hynek, D.; Jansen, Y.; Becker, J.; Macri, R.

2008-01-01

This paper describes the preparation of samples for an experiment to measure the cross-section for 235 U(n,n') 235m U in a fast fission spectrum of neutrons provided by a fast pulsed reactor/critical assembly. Samples of 235m U have been prepared for the calibration of the internal conversion electron detector that is used for the 235m U measurement. Two methods are described for the preparation of 235 mU. The first method used a U-Pu chemical separation based on anion-exchange chromatography and the second method used an alpha recoil collection method. Thin, uniform samples of 235m U+ 235 U were prepared for the experiment using electrodeposition. (author)

Intenzitet stresa kod učitelja u osnovnim školama

OpenAIRE

Tomašević, Suzana; Horvat, Gordana; Leutar, Zdravka; Horvat, Gordana

2016-01-01

Cilj ovog rada bio je istražiti intenzitet stresa kod učitelja razredne i predmetne nastave u seoskim i gradskim osnovnim školama. Ovim istraživanjem želi se utvrditi postoji li statistički značajna razlika u intenzitetu stresa između učitelja razredne nastave i učitelja predmetne nastave s obzirom na mjesto rada, selo ili grad. U istraživanju je korišten psihologijski instrument za mjerenje percepcije stresa (PerceivedStressScale) (Cohen, S., Kamarck, T, Mermelstein, R. 1983). Istraživanj...

Environmental control of U concentration and 234U/238U in speleothems at subannual resolution

Science.gov (United States)

Hu, C.; Henderson, G. M.

2003-12-01

Trace element and isotope variability in speleothems encodes a range of information about the past environment, although its interpretation is often problematic. U concentration and isotopes have frequently been analysed in speleothems in order to provide chronology, but their use as environmental proxies in their own right has not been comprehensively investigated. In this study, we have investigated the environmental controls of U in a stalagmite from the Central Yangtze Valley in China. This stalagmite grew rapidly throughout the Holocone and contains visible annual layers about 300microns thick. Analysis of a portion of the stalagmite corresponding to the 1970s by electron probe, LA-ICP-MS, and by physical subsampling indicate clear annual cycles in Sr/Ca, Mg/Ca, and Ba/Ca. The reasonably open cave structure and the correlation of Sr/Ca with Mg/Ca suggest that temperature exerts considerable control over these trace element variations. U/Ca also varies seasonally by up to 42 % and shows a clear anti-correlation with Mg/Ca (correlation coefficient -0.64). Based on the inverse relationship between U/Ca and temperature exhibited in other carbonates (e.g. corals) the speleothem U/Ca is suggested to be controlled primarily by temperature and may provide a paleo cave thermometer with less rainfall influence than Mg/Ca. Ongoing monitoring of the cave temperature and humidity will assess the robustness of this conclusion and the sensitivity of speleothem U/Ca to temperature. (234U/238U) in this stalagmite range from 1.733 to 1.872 during the Holocene. The U concentration is high enough (typically 0.48 ppm) and growth rate fast enough, that (234U/238U) can also be measured at a subannual resolution. The expected alpha-recoil control of excess 234U supply suggests that these measurements may provide a measure of the transit time of recharge waters to the stalagmite during the seasonal cycle. Such a proxy would enable deconvolution of temperature and recharge-rate control

7 CFR 51.2541 - U.S. Fancy, U.S. Extra No. 1, U.S. No. 1 And U.S. Select Grades.

Science.gov (United States)

2010-01-01

... PRODUCTS 1,2 (INSPECTION, CERTIFICATION, AND STANDARDS) United States Standards for Grades of Pistachio.... Fancy,” “U.S. Extra No. 1,” “U.S. No. 1,” and “U.S. Select” consists of pistachio nuts in the shell...

Update on hypoxia-inducible factors and hydroxylases in oxygen regulatory pathways: from physiology to therapeutics

Directory of Open Access Journals (Sweden)

Ratcliffe P

2017-03-01

Full Text Available Peter Ratcliffe,1,2 Peppi Koivunen,3 Johanna Myllyharju,3 Jiannis Ragoussis,4 Judith VMG Bovée,5 Ines Batinic-Haberle,6 Claire Vinatier,7 Valérie Trichet,8 Florence Robriquet,9 Lisa Oliver,9 Betty Gardie9,10 1Target Discovery Institute, University of Oxford, 2The Francis Crick Institute, London, UK; 3Oulu Center for Cell-Matrix Research, Biocenter Oulu and Faculty of Biochemistry and Molecular Medicine, University of Oulu, Oulu, Finland; 4McGill University and Genome Quebec Innovation Centre, McGill University, Montreal, Canada; 5Department of Pathology, Leiden University Medical Center, Leiden, the Netherlands; 6Department of Radiation Oncology, Duke University School of Medicine, Durham, NC, USA; 7INSERM UMR 1229, Regenerative Medicine and Skeleton-RMeS, Team STEP, University of Nantes, UFR Odontology, 8UMR 1238 INSERM, Université de Nantes, Faculté de Médecine, 9CRCINA, INSERM, Université de Nantes, Nantes, 10Ecole Pratique des Hautes Etudes, PSL Research University, Paris, France Abstract: The “Hypoxia Nantes 2016” organized its second conference dedicated to the field of hypoxia research. This conference focused on “the role of hypoxia under physiological conditions as well as in cancer” and took place in Nantes, France, in October 6–7, 2016. The main objective of this conference was to bring together a large group of scientists from different spheres of hypoxia. Recent advances were presented and discussed around different topics: genomics, physiology, musculoskeletal, stem cells, microenvironment and cancer, and oxidative stress. This review summarizes the major highlights of the meeting. Keywords: hypoxia, genomics, lipid metabolism, musculoskeletal, cancer, oxidative stress 

U.S., U.S.S.R. Marine Expedition

Science.gov (United States)

Wainger, Lisa A.

An historic expedition involving U.S. and U.S.S.R. scientists may open a new era of cooperation in marine research. A University of California, San Diego/Scripps Institution of Oceanography ship carrying a team that includes two Soviet scientists is on an expedition that will take the R/V Thomas Washington into the Exclusive Economic Zone (EEZ) of the U.S.S.R. For the first time in a decade a U.S. research vessel has been given permission to operate in the Soviet Union's EEZ, according to Department of State representative Tom Cocke, who worked with Scripps on this project. The ship will also operate in the U.S. EEZ and international waters.

Informacioni sistemi u upravljanju rizicima u životnoj sredini

Directory of Open Access Journals (Sweden)

Dejan Inđić

2013-02-01

Full Text Available Normal 0 MicrosoftInternetExplorer4 Sažetak: Zemljotresi, poplave, nuklearni i hemijski akcidenti, zagađivanje vazduha, zemljišta i voda, ukazuju na sve veće prisustvo nesreća nastalih intenzivnim razvojem i često nekontrolisanom primenom tehnološkog razvoja. Pred društvo se postavlja problem kako se što bolje pripremiti, kako obezbediti veću usklađenost i funkcionisanje aktivnosti i mera za sprečavanje nastanka akcidentnih situacija i kako uneti promene u društveni i tehnološki razvoj koje će ići u korist prirode, ali i za dobrobit budućih generacija. U radu je prikazano korišćenje različitih informacionih sistema (IS u upravljanju rizicima u životnoj sredini i predlog za izradu jedinstvenog IS u Republici Srbiji.

Kinetics of U(VI) reduction control kinetics of U(IV) reoxidation

International Nuclear Information System (INIS)

Senko, J.M.; Minyard, M.L.; Dempsey, B.A.; Roden, E.E.; Yeh, G.-T.; Burgos, W.D.

2006-01-01

For the in situ reductive immobilization of U to be an acceptable strategy for the removal of that element from groundwater, the long-term stability of U(IV) must be determined. Rates of biotransformation of Fe species influence the mineralogy of the resulting products (Fredrickson et al., 2003; Senko et al., 2005), and we hypothesize that the rate of U(VI) reduction influences the mineralogy of resultant U(IV) precipitates. We hypothesize that slower rates of U(VI) reduction will yield U(IV) phases that are more resistant to reoxidation, and will therefore be more stable upon cessation of electron donor addition. U(IV) phases formed by relatively slow reduction may be more crystalline or larger in comparison to their relatively rapidly-formed counterparts (Figure 1), thus limiting the reactivity of slowly-formed U(IV) phases toward various oxidants. The physical location of U(IV) precipitates relative to bacterial cells may also limit the reactivity of biogenic U(IV) phases. In this situation, we expect that precipitation of U(IV) within the bacterial cell may protect U(IV) from reoxidation by limiting physical contact between U(IV) and oxidants (Figure 1). We assessed the effect of U(VI) reduction rate on the subsequent reoxidation of biogenic U(IV) and are currently conducting column scale studies to determine whether U(VI) reduction rate can be manipulated by varying the electron donor concentration used to stimulate U(VI) reduction

Perspektive promidžbe u XXI. stoljeću

OpenAIRE

Haramija, Predrag; Njavro, Đuro; Propat Darrer, Jagoda

2012-01-01

Otkriće i primjena novih postupaka u promidžbi ovisna je o dvjema vrstama silnica; s jedne strane, o novim tehničkim ili tehnološkim otkrićima glede sredstava komunikacije, a s druge strane o novim situacijama odnosno okolnostima u gospodarskome i društvenom okružju. U radu se prikazuje dosadašnji razvoj i istražuju moguće dominantne tendencije promidžbe u XXI. stoljeću. Početak XXI. stoljeća obilježava zasićenost potrošača mnoštvom promidžbenih poruka i sve veće nepovjerenje u njih, s...

Konstruktivistički pristup obrazovnom postignuću učenika

OpenAIRE

Gutvajn, Nikoleta

2009-01-01

U savremenoj pedagoškoj literaturi, razlike u obrazovnom postignuću učenika se, veomaretko, proučavaju iz perspektive učenika što je, verovatno, jedan od bitnih razloga zakontinuiranu egzistenciju kategorije „neuspešan učenik”. Cilj našeg istraživanja bio je dase problem školskog neuspeha razmotri iz perspektive učenika koji su pozicionirani kaoneuspešni. Umesto mnogobrojnih pretpostavki istraživača o tome zašto su neki učenicineusp...

Online Manufacturing Training. ToolingU Review (U)

Energy Technology Data Exchange (ETDEWEB)

Montano, Joshua Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2016-03-23

The following report is a review of ToolingU, an online manufacturing training website. ToolingU provided the author with a trail account where a number of courses were taken and the overall program was evaluated. A review of the classes revealed that most of the offerings directly align with work at the Laboratory. Ease of use, effectiveness of the system and price all make ToolingU an attractive option for manufacturing training needs.

Neural correlates of delusional infestation responding to aripiprazole monotherapy: a case report

Directory of Open Access Journals (Sweden)

Ponson L

2015-02-01

Full Text Available Laura Ponson,1,2 Frédéric Andersson,1 Wissam El-Hage1,2 1Université François-Rabelais de Tours, Inserm, Imagerie et Cerveau UMR U930, Tours, France, 2CHRU de Tours, Clinique Psychiatrique Universitaire, Tours, France Background: The pathophysiology and appropriate pharmacological interventions for delusional infestation remain unknown.Case presentation: Here, we report a case of primary delusional infestation successfully treated with aripiprazole. We performed functional magnetic resonance imaging (fMRI to investigate brain structures and functional modifications. Before antipsychotic treatment, pre- versus post-treatment fMRI images revealed a marked increase in brain activation in the supplementary motor area (SMA.Conclusion: Our results highlight the efficacy and safety of aripiprazole in the treatment of delusional infestation and the possible role of SMA dysfunction in delusional infestation. Indeed, our results suggest that psychiatric improvement of delusional infestation is associated with normalization of brain activity, particularly in the SMA. Keywords: supplementary motor area, antipsychotics, fMRI

Contribution to the study of U-Ti and U-Pu-Ti carbides; Contribution a l'etude des carbures U-C-Ti et (U, Pu) - C-Ti

Energy Technology Data Exchange (ETDEWEB)

Milet, C A [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1968-07-01

After having discussed the reasons to use (U,Pu) carbides as fast reactor fuel, we examine the influence of the addition of titanium to these carbides. A preliminary study has been done on the system of U-C-Ti and some properties have been measured such as: density, thermal expansion, electrical resistivity, atmospheric corrosion and compatibility with stainless steel. The systems U-Pu-C-Ti (Pu/U + Pu equal to 15 per cent) and U-C-Ti have been found to be very similar. There exists a two phases region (U,Pu)C + TiC, an eutectic between (U,Pu)C and TiC for approximately 15 at %. The solubilities of U + Pu in TiC and of Ti in (U,Pu)C is less than 1 % at. The addition of titanium does not markedly change thermal expansion coefficients of (U,Pu)C. However the resistance to atmospheric corrosion and compatibility with stainless steel is improved. Thermal conductivity, calculated from electrical resistivity, has increased. On the other side, the density of fissile material is lowered. The combination of (U,Pu)C + TiC seems to be the most promising alloy for application as nuclear fuel. (author) [French] Apres avoir rappele les problemes poses par un combustible pour les reacteurs a neutrons rapides et l'interet des carbures U-Pu-C comme combustible, on examine l'influence de l'addition de titane dans ces carbures. Une etude preliminaire sur le systeme U-C-Ti a ete effectuee et quelques proprietes sont indiquees: densite, coefficients de dilatation, resistivite electrique, tenue a la corrosion atmospherique, compatibilite avec l'acier inoxydable. Le systeme U-Pu-C-Ti (Pu/U + Pu egal a 15 pour cent) presente de grandes analogies avec le systeme U-C-Ti. Il existe un domaine biphase (U,Pu)C + TiC, un eutectique entre (U,Pu)C et TiC pour environ 15 at % Ti; les solubilites de U + Pu clans TiC et de Ti dans (U,Pu)C sont inferieures a 1 at %. Par rapport a la phase (U,Pu)C, l'addition de titane est sans effets importants sur les coefficients de dilatation. Par contre la tenue a

1088-IJBCS-Article-Genevieve Nguessan

African Journals Online (AJOL)

DR GATSING

2 Université Paris-Sud 11, Faculté de Pharmacie, Châtenay-Malabry, France. 3 INSERM UMR-S 769, Châtenay-Malabry, France. 4Laboratoire de pharmacologie, pharmacie clinique, thérapeutique et physiologie, UFR Sciences. Pharmaceutiques et Biologiques, Université Cocody-Abidjan, République de Côte d'Ivoire.

Neutron inelastic-scattering cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu

International Nuclear Information System (INIS)

Smith, A.B.; Guenther, P.T.

1982-01-01

Differential-neutron-emission cross sections of 232 Th, 233 U, 235 U, 238 U, 239 Pu and 240 Pu are measured between approx. = 1.0 and 3.5 MeV with the angle and magnitude detail needed to provide angle-integrated emission cross sections to approx. 232 Th, 233 U, 235 U and 238 U inelastic-scattering values, poor agreement is observed for 240 Pu, and a serious discrepancy exists in the case of 239 Pu

Analysis of 235U enrichment by chemical exchange in U(IV) - U(VI) system on anionite

International Nuclear Information System (INIS)

Raica, Paula; Axente, Damian

2007-01-01

Full text: A theoretical study about the 235 U enrichment by chemical exchange method in U(IV)-U(VI) system on anion-exchange resins is presented. The 235 U isotope concentration profiles along the band were numerically calculated using an accurate mathematical model and simulations were carried out for the situation of product and waste withdrawal and feed supply. By means of numerical simulation, an estimation of the migration time, necessary for a desired enrichment degree, was obtained. The required migration distance, the production of uranium 3 at.% 235 U per year and the plant configuration are calculated for different operating conditions. An analysis of the process scale for various experimental conditions is also presented. (authors)

Anomalous isotope effects in the U(IV)-U(VI) exchange system

International Nuclear Information System (INIS)

Fujii, Yasuhiko; Nomura, Masao; Okamoto, Makoto; Onitsuka, Hatsuki; Nakanishi, Takashi.

1992-01-01

In previous papers, the enrichment of 236 U in the U(IV) - U(VI) chemical exchange system was found to be significantly smaller than the value estimated by the normal mass dependence enrichment of 235 U. Further experiments have been carried out in the present work to confirm the strange phenomenon of the isotopic anomaly in uranium enrichment. The results have indicated that the separation coefficient of 236 U is the same value as one previously reported. To confirm the anomaly of uranium isotope separation, α-ray spectrometry was implemented to check the enrichment behavior of 234 U. Although no theoretical explanation is given for the isotopic anomaly, this is favorable phenomenon for the re-enrichment of recycled uranium which contains isotopes 232 U and 236 U. (author)

Vector coherent state representations of SO5 contains SU2 + SU2 contains U1 + U1 and SO5 contains U1 + U1

International Nuclear Information System (INIS)

Pan Feng

1991-01-01

VCS representations of SO 5 contains SU 2 + SU 2 contains U 1 + U 1 and SO 5 contains U 1 + U 1 are discussed. Reduced matrix elements for SO 5 contains SU 2 + SU 2 are derived. The multiplicity of a weight for SO 5 is determined by using the K-matrix technique

Thermodynamic modeling of the Al-U and Co-U systems

International Nuclear Information System (INIS)

Wang, J.; Liu, X.J.; Wang, C.P.

2008-01-01

The thermodynamic assessments of the Al-U and Co-U systems have been carried out by using the CALPHAD (Calculation of Phase Diagrams) method on the basis of the experimental data including thermodynamic properties and phase equilibria. Gibbs free energies of the solution phases were described by the subregular solution models with the Redlich-Kister equation, and those of the intermetallic compounds described by the sublattice models. A consistent set of thermodynamic parameters has been derived for describing the Gibbs free energies of each solution phase and intermetallic compounds in the Al-U and Co-U binary systems. The calculated phase diagrams and thermodynamic properties in the Al-U and Co-U systems are in good agreement with experimental data

Odnos između ortodontskih i izgovornih poremećaja u adolescenata

OpenAIRE

Hunski, M.; Ivičević-Desnica, J.; Škarić, I.; Horga, D.

2003-01-01

Različita su istraživanja pokazala da je broj izgovornih poremećaja veći u populaciji s ortodontskim anomalijama nego u osoba bez njih. Odnos između anatomskih struktura u orofacijalnoj regiji i izgovornih kompenzacijskih mehanizama u osoba s ortodontskim anomalijama zanimljiv je i s teoretskoga i s praktičnoga stajališta. U ovom je istraživanju na uzorku od 282 srednjoškolca (203 - 72% djevojaka i 79 - 28% dječaka) u dobi od 15 do 18 godina istražen odnos između ortodontskih i izgovornih por...

In-pile test results of U-silicide or U-nitride coated U-7Mo particle dispersion fuel in Al

Science.gov (United States)

Kim, Yeon Soo; Park, J. M.; Lee, K. H.; Yoo, B. O.; Ryu, H. J.; Ye, B.

2014-11-01

U-silicide or U-nitride coated U-Mo particle dispersion fuel in Al (U-Mo/Al) was in-pile tested to examine the effectiveness of the coating as a diffusion barrier between the U-7Mo fuel kernels and Al matrix. This paper reports the PIE data and analyses focusing on the effectiveness of the coating in terms of interaction layer (IL) growth and general fuel performance. The U-silicide coating showed considerable success, but it also provided evidence for additional improvement for coating process. The U-nitride coated specimen showed largely inefficient results in reducing IL growth. From the test, important observations were also made that can be utilized to improve U-Mo/Al fuel performance. The heating process for coating turned out to be beneficial to suppress fuel swelling. The use of larger fuel particles confirmed favorable effects on fuel performance.

In-pile test results of U-silicide or U-nitride coated U-7Mo particle dispersion fuel in Al

Energy Technology Data Exchange (ETDEWEB)

Kim, Yeon Soo, E-mail: yskim@anl.gov [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439 (United States); Park, J.M.; Lee, K.H.; Yoo, B.O. [Korea Atomic Energy Research Institute, 989-111 Daedeokdaero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Ryu, H.J. [Dept. of Nuclear and Quantum Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Ye, B. [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439 (United States)

2014-11-15

U-silicide or U-nitride coated U-Mo particle dispersion fuel in Al (U-Mo/Al) was in-pile tested to examine the effectiveness of the coating as a diffusion barrier between the U-7Mo fuel kernels and Al matrix. This paper reports the PIE data and analyses focusing on the effectiveness of the coating in terms of interaction layer (IL) growth and general fuel performance. The U-silicide coating showed considerable success, but it also provided evidence for additional improvement for coating process. The U-nitride coated specimen showed largely inefficient results in reducing IL growth. From the test, important observations were also made that can be utilized to improve U-Mo/Al fuel performance. The heating process for coating turned out to be beneficial to suppress fuel swelling. The use of larger fuel particles confirmed favorable effects on fuel performance.

[Reply to « Why is it difficult to implement biomedical policy? The ase of the Cancéropôles, the French cancer organizations », by Audrey Vézian, Med Sci (Paris) 2014 Aug-Sep; 30 (8-9) : 803-7].

Science.gov (United States)

Chabannon, Christian; Bougnoux, Philippe; Favre, Gilles; Formstecher, Pierre; Laurent-Puig, Pierre; Oudet, Pierre; Trillet-Lenoir, Véronique

2014-10-01

The authors, all in charge of the administration of one of the 7 French Cancéropôles, reply to the article authored by Audrey Vézian, and -provide an alternative and more supportive view of the initiatives -sponsored by these regional cancer research networks. © 2014 médecine/sciences – Inserm.

Assay of Uranium Isotopic Ratios 234U/238U, 235U/238U in Bottom Sediment Samples Using Destructive and Non Destructive Techniques (Nasser Lake)

International Nuclear Information System (INIS)

Agha, A.R.; El-Mongy, S.A.; Kandel, A.E.

2011-01-01

Nasser Lake is the greatest man-made lake in the World. It is considered as the main source of water where the Nile water is impounded behind the Aswan high dam.. Uranium has three naturally occurring isotopes 234 U, 235 U and 238 U with isotopic abundance 0.00548, 0.7200 and 99.2745 atom percent. Dissolved uranium in the lake is primary due to weathering process. Monitoring of the isotopic ratios of uranium is used as a good indicator to trace and evaluate the origin and activities associated with any variation of uranium in the lake environment. The main objective of the present study is to clarify any potential variation of natural uranium 234 U/ 238 U, 235 U/ 238 U ratios in sediment samples of Nasser Lake by using destructive alpha and non destructive gamma- techniques. The results show that the uranium isotopic activity ratios are very close to the natural values. This study can also be used for radiological protection and safety evaluation purposes.

A mixed-valent uranium phosphonate framework containing U{sup IV}, U{sup V}, and U{sup VI}

Energy Technology Data Exchange (ETDEWEB)

Chen, Lanhua; Zheng, Tao; Wang, Yaxing; Diwu, Juan; Chai, Zhifang; Wang, Shuao [School for Radiological and interdisciplinary Sciences (RAD-X), Soochow University, Suzhou (China); Collaborative Innovation Center of Radiation Medicine, Jiangsu Higher Education Institutions, Suzhou (China); Bao, Songsong; Zheng, Limin [State Key Laboratory of Coordination Chemistry, School of Chemistry and Chemical Engineering, Collaborative Innovation Center of Advanced Microstructures, Nanjing University (China); Zhang, Linjuan; Wang, Jianqiang [Shanghai Institute of Applied Physics and, Key Laboratory of Nuclear Radiation and Nuclear Energy Technology, Chinese Academy of Sciences, Shanghai (China); Liu, Hsin-Kuan [Department of Chemistry, National Central University, Jhongli (China); Albrecht-Schmitt, Thomas E. [Department of Chemistry and Biochemistry, Florida State University, Tallahassee, FL (United States)

2016-08-16

It is shown that U{sup V}O{sub 2}{sup +} ions can reside at U{sup VI}O{sub 2}{sup 2+} lattice sites during mild reduction and crystallization process under solvothermal conditions, yielding a complicated and rare mixed-valent uranium phosphonate compound that simultaneously contains U{sup IV}, U{sup V}, and U{sup VI}. The presence of uranium with three oxidation states was confirmed by various characterization techniques, including X-ray crystallography, X-ray photoelectron, electron paramagnetic resonance, FTIR, UV/Vis-NIR absorption, and synchrotron radiation X-ray absorption spectroscopy, and magnetism measurements. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Measurement of 233U/234U ratios in contaminated groundwater using alpha spectrometry

International Nuclear Information System (INIS)

Harrison, Jennifer J.; Payne, Timothy E.; Wilsher, Kerry L.; Thiruvoth, Sangeeth; Child, David P.; Johansen, Mathew P.; Hotchkis, Michael A.C.

2016-01-01

The uranium isotope 233 U is not usually observed in alpha spectra from environmental samples due to its low natural and fallout abundance. It may be present in samples from sites in the vicinity of nuclear operations such as reactors or fuel reprocessing facilities, radioactive waste disposal sites or sites affected by clandestine nuclear operations. On an alpha spectrum, the two most abundant alpha emissions of 233 U (4.784 MeV, 13.2%; and 4.824 MeV, 84.3%) will overlap with the 234 U doublet peak (4.722 MeV, 28.4%; and 4.775 MeV, 71.4%), if present, resulting in a combined 233+234 U multiplet. A technique for quantifying both 233 U and 234 U from alpha spectra was investigated. A series of groundwater samples were measured both by accelerator mass spectrometry (AMS) to determine 233 U/ 234 U atom and activity ratios and by alpha spectrometry in order to establish a reliable 233 U estimation technique using alpha spectra. The Genie™ 2000 Alpha Analysis and Interactive Peak Fitting (IPF) software packages were used and it was found that IPF with identification of three peaks ( 234 U minor, combined 234 U major and 233 U minor, and 233 U major) followed by interference correction on the combined peak and a weighted average activity calculation gave satisfactory agreement with the AMS data across the 233 U/ 234 U activity ratio range (0.1–20) and 233 U activity range (2–300 mBq) investigated. Correlation between the AMS 233 U and alpha spectrometry 233 U was r 2  = 0.996 (n = 10). - Highlights: • Describes a technique for deconvoluting the combined 233 U and 234 U multiplet in alpha spectra. • Enables 233 U and 234 U activities and 233 U/ 234 U ratios to be quantified without requiring additional analysis and measurement. • Applicable to an environmental matrix (groundwater) using standard alpha spectrometry counting equipment, operation and set-up.

Seawater 234U/238U recorded by modern and fossil corals

Science.gov (United States)

Chutcharavan, Peter M.; Dutton, Andrea; Ellwood, Michael J.

2018-03-01

U-series dating of corals is a crucial tool for generating absolute chronologies of Late Quaternary sea-level change and calibrating the radiocarbon timescale. Unfortunately, coralline aragonite is susceptible to post-depositional alteration of its primary geochemistry. One screening technique used to identify unaltered corals relies on the back-calculation of initial 234U/238U activity (δ234Ui) at the time of coral growth and implicitly assumes that seawater δ234U has remained constant during the Late Quaternary. Here, we test this assumption using the most comprehensive compilation to date of coral U-series measurements. Unlike previous compilations, this study normalizes U-series measurements to the same decay constants and corrects for offsets in interlaboratory calibrations, thus reducing systematic biases between reported δ234U values. Using this approach, we reassess (a) the value of modern seawater δ234U, and (b) the evolution of seawater δ234U over the last deglaciation. Modern coral δ234U values (145.0 ± 1.5‰) agree with previous measurements of seawater and modern corals only once the data have been normalized. Additionally, fossil corals in the surface ocean display δ234Ui values that are ∼5-7‰ lower during the last glacial maximum regardless of site, taxon, or diagenetic setting. We conclude that physical weathering of U-bearing minerals exposed during ice sheet retreat drives the increase in δ234U observed in the oceans, a mechanism that is consistent with the interpretation of the seawater Pb-isotope signal over the same timescale.

Photochemistry of U(BH4)4 and U(BD4)4

International Nuclear Information System (INIS)

Paine, R.T.; Schonberg, P.R.; Light, R.W.; Danen, W.C.; Freund, S.M.

1979-01-01

U(BH 4 ) 4 and U(BD 4 ) 4 are observed to undergo complex degradation reactions promoted by broadband UV radiation. The primary products of these reactions appear to be U(BH 4 ) 3 , B 2 H 6 , H 2 , U(BD 4 ) 3 , B 2 D 6 and D 2 . Further, U(BD 4 ) 4 undergoes a related decomposition reaction under the influence of CO 2 laser irradiation at 924.97 cm -1 . (author)

Psychometric properties of the Ruminative Response Scale-short form in a clinical sample of patients with major depressive disorder

Directory of Open Access Journals (Sweden)

Parola N

2017-05-01

Full Text Available Nathalie Parola,1,2,* Xavier Yves Zendjidjian,1,3,* Marine Alessandrini,1 Karine Baumstarck,1 Anderson Loundou,1 Guillaume Fond,4,5 Fabrice Berna,4,6 Christophe Lançon,1–3 Pascal Auquier,1 Laurent Boyer1 1Public Health, Chronic Diseases and Quality of Life – Research Unit EA 3279, Aix-Marseille University, Marseille, 2Department of Psychiatry, Sainte-Marguerite University Hospital, Marseille, 3Department of Psychiatry, La Conception University Hospital, Marseille, 4Fondation FondaMental, Créteil, 5Department of Psychiatry and Addictology, Henri Mondor University Hospital, INSERM U955, Eq 15 Genetic Psychiatry and Psychopathology, Paris Est-Créteil University, Créteil, 6Department of Psychiatry, INSERM U1114, Fédération de Médecine Translationnelle de Strasbourg, Strasbourg University Hospital, Strasbourg, France *These authors contributed equally to this work Background: The Ruminative Response Scale (RRS-short form is one of the most widely used measures of rumination, comprising ten items and two components: reflection and brooding. The aim of this study was to investigate RRS validity and reliability in a clinical sample of French patients with major depressive disorder (MDD.Subjects and methods: Outpatients with a DSM-IV-TR diagnosis of MDD were recruited from a public academic hospital in France. Depressive symptoms were evaluated by the Beck Depression Inventory, anxiety by the State-Trait Anxiety Inventory – state scale, and quality of life by the 36-Item Short Form Health Survey (SF-36 questionnaire. Confirmatory factor analyses, item-dimension correlations, Cronbach’s α-coefficients, Rasch statistics, and external validity were tested. Differential item functioning analyses were performed for sex.Results: A total of 109 patients participated. The final reflection–brooding two-factor model of the RRS showed a good fit (root-mean-square error of approximation 0.041, comparative fit index 0.987, standardized root

Supersymmetric U boson and the old U(1) problem

International Nuclear Information System (INIS)

Kim, B.R.

1983-01-01

In the supersymmetric SU(3)xSU(2)xU(1)xUsup(')(1) model the new gauge group Usup(')(1) enforces the introduction of mirror fermions. In this note we address the inverse question. If one starts with SU(3)xSU(2)xU(1) including mirror fermions, what physical arguments other than the supersymmetric require the introduction of a new gauge group Usup(')(1). It turns out that the old U(1) problem is closely related with this question. Further we give an estimate for the upper bound for the parameter of the supersymmetric U boson r and x. (orig.)

Evolucija softvera u Turskoj

OpenAIRE

Mishra, Alok; Yazici, Ali; Cetin, Semih

2016-01-01

Prema zadnjem izvještaju Gartnera, Turska se sada treba uzeti u obzir jer si je osigurala mjesto među 30 vodećih zemalja na svijetu u području inormacijske tehnologije (IT) i inozemnih usluga. Tijekom zadnjeg desetljeća postignut je izvanredan napredak u području izrade kompjutorskih programa, a to je rezultiralo porastom izvoza u mnoge zemlje. U ovom radu dajemo pregled pomaka koji je Turska učinila u izradi programa, uključujući postojeće trendove, ispitivanja, kvalitetu i prihvaćanje agiln...

Contribution to the study of U-Ti and U-Pu-Ti carbides

International Nuclear Information System (INIS)

Milet, C.A.

1968-01-01

After having discussed the reasons to use (U,Pu) carbides as fast reactor fuel, we examine the influence of the addition of titanium to these carbides. A preliminary study has been done on the system of U-C-Ti and some properties have been measured such as: density, thermal expansion, electrical resistivity, atmospheric corrosion and compatibility with stainless steel. The systems U-Pu-C-Ti (Pu/U + Pu equal to 15 per cent) and U-C-Ti have been found to be very similar. There exists a two phases region (U,Pu)C + TiC, an eutectic between (U,Pu)C and TiC for approximately 15 at %. The solubilities of U + Pu in TiC and of Ti in (U,Pu)C is less than 1 % at. The addition of titanium does not markedly change thermal expansion coefficients of (U,Pu)C. However the resistance to atmospheric corrosion and compatibility with stainless steel is improved. Thermal conductivity, calculated from electrical resistivity, has increased. On the other side, the density of fissile material is lowered. The combination of (U,Pu)C + TiC seems to be the most promising alloy for application as nuclear fuel. (author) [fr

Science et littérature : mélange des genres

OpenAIRE

Lissalde, Claire

2016-01-01

Cet article expose les démarches et les enjeux de l’organisation de l’exposition Science/Fiction, voyage au cœur du vivant par l’INSERM. Il souligne également l’innovation proposée par une médiation qui utilise le mélange des genres littéraires et scientifiques pour atteindre son public.

Impact of the 1998 Football World Cup on Suicide Rates in France: Results from the National Death Registry

Science.gov (United States)

Encrenaz, Gaelle; Contrand, Benjamin; Leffondre, Karen; Queinec, Raphaelle; Aouba, Albertine; Jougla, Eric; Miras, Alain; Lagarde, Emmanuel

2012-01-01

Our objective was to determine whether the Federation Internationale de Football Association (FIFA) World Cup in 1998 had a short-term impact on the number of suicides in France. Exhaustive individual daily data on suicides from 1979 to 2006 were obtained from the French epidemiological center on the medical causes of death (CepiDC-INSERM;…

All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA

Science.gov (United States)

Gerbi, Susan A.; Lange, Thilo Sascha

2002-01-01

Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120

Sexual Trauma and Adverse Health and Occupational Outcomes Among Men Serving in the U.S. Military.

Science.gov (United States)

Millegan, Jeffrey; Wang, Lawrence; LeardMann, Cynthia A; Miletich, Derek; Street, Amy E

2016-04-01

Although absolute counts of U.S. service men who experience sexual trauma are comparable to service women, little is known about the impact of sexual trauma on men. The association of recent sexual trauma (last 3 years) with health and occupational outcomes was investigated using longitudinal data (2004-2013) from the Millennium Cohort Study. Of 37,711 service men, 391 (1.0%) reported recent sexual harassment and 76 (0.2%) sexual assault. In multivariable models, sexual harassment or assault, respectively, was associated with poorer mental health: AOR = 1.60, 95% CI [1.22, 2.12], AOR = 4.39, 95% CI [2.40, 8.05]; posttraumatic stress disorder: AOR = 2.50, 95% CI [1.87, 3.33], AOR = 6.63, 95% CI [3.65, 12.06]; depression: AOR = 2.37, 95% CI [1.69, 3.33], AOR = 5.60, 95% CI [2.83, 11.09]; and multiple physical symptoms: AOR = 2.22, 95% CI [1.69, 2.92]; AOR = 3.57, 95% CI [1.98, 6.42], after adjustment for relevant covariates. Sexual harassment was also associated with poorer physical health: AOR = 1.68, 95% CI [1.27, 2.22]. Men who reported sexual trauma were more likely to have left military service: AOR = 1.60, 95% CI [1.14, 2.24], and be disabled/unemployed postservice: AOR = 1.76, 95% CI [1.02, 3.02]. Results suggest that sexual trauma was significantly associated with adverse health and functionality extending to postmilitary life. Findings support the need for developing better prevention strategies and services to reduce the burden of sexual trauma on service men. Copyright © 2016 International Society for Traumatic Stress Studies.

Razlika između klasične i keynesijanske ekonomske doktrine u 20. stoljeću s implikacijama na hrvatsku tranziciju

OpenAIRE

Brumec, Dino

2017-01-01

U dvadeseto stoljeće svijet je ušao s nepoljuljanom vjerom u snagu slobodnog tržišta koje će regulirati odnose među ljudima na svakoj razini. Prvi znanstvenik koji se suprostavio toj vjeri na jasno strukturiran način bio je John Maynard Keynes koji je ponudio državi doktrinu u kojoj njeno djelovanje ima velik prostor te je u vrlo kratkom roku postao najutjecajniji ekonomist na svijetu. Nasuprot njemu stajao je Friedrich Hayek koji je državi nudio mnogo manje utjecaja u gos...

Istraživanje virusnih bolesti u nekih slatkovodnih riba u Republici Kosovo.

OpenAIRE

Rexhepi, Agim; Bërxholi, Kristaq; Scheinert, Peter; Hamidi, Afrim; Sherifi, Kurtesh

2011-01-01

U radu je istražena prisutnost virusne hemoragijske septikemije, zarazne hematopoetske nekroze i zarazne nekroze gušterače u potočne pastrve te proljetne viremije šarana u šarana i bijelog glavaša na Kosovu. Uzeti materijal bio je pretražen RT-PCR-om i ugniježđenim PCR-om u laboratoriju službe za životinjsko zdravlje u Münchenu u Njemačkoj. Uzorci šarana i bijeloga glavaša bili su prikupljeni na šaranskom ribnjačarstvu, na jezeru i rijeci, a uzorci potočne pastrve na pet rijeka. U razdoblju o...

Fluorescence excitation analysis by two-photon confocal laser scanning microscopy: a new method to identify fluorescent nanoparticles on histological tissue sections

Directory of Open Access Journals (Sweden)

Kahn E

2012-10-01

Full Text Available Edmond Kahn,1 Nicolas Tissot,3 Perrine Frere,3 Aurélien Dauphin,3 Mohamed Boumhras,2,4 Claude-Marie Bachelet,3 Frédérique Frouin,1 Gérard Lizard21Institut National de la Santé et de la Recherche Médicale (INSERM U678/UMR-S UPMC, CHU Pitié-Salpêtrière, Paris, France; 2Equipe Biochimie du Peroxysome, Inflammation et Métabolisme Lipidique EA7270, Faculté des Sciences Gabriel, Université de Bourgogne-INSERM Dijon, France; 3Plateforme d'Imagerie cellulaire, UPMC, Paris, France; 4Laboratory of Biochemistry and Neuroscience, Applied Toxicology Group, Faculty of Science and Technology, Settat, MoroccoAbstract: In the present study, we make use of the ability of two-photon confocal laser scanning microscopes (CLSMs equipped with tunable lasers to produce spectral excitation image sequences. Furthermore, unmixing, which is usually performed on emission image sequences, is performed on these excitation image sequences. We use factor analysis of medical image sequences (FAMIS, which produces factor images, to unmix spectral image sequences of stained structures in tissue sections to provide images of characterized stained cellular structures. This new approach is applied to histological tissue sections of mouse aorta containing labeled iron nanoparticles stained with Texas Red and counterstained with SYTO13, to obtain visual information about the accumulation of these nanoparticles in the arterial wall. The possible presence of Texas Red is determined using a two-photon CLSM associated with FAMIS via the excitation spectra. Texas Red and SYTO13 are thus differentiated, and corresponding factor images specify their possible presence and cellular localization. In conclusion, the designed protocol shows that sequences of images obtained by excitation in a two-photon CLSM enables characterization of Texas Red-stained nanoparticles and other markers. This methodology offers an alternative and complementary solution to the conventional use of emission

The brain signature of paracetamol in healthy volunteers: a double-blind randomized trial

Directory of Open Access Journals (Sweden)

Pickering G

2015-07-01

Full Text Available Gisèle Pickering,1–3 Adrian Kastler,4 Nicolas Macian,1,2 Bruno Pereira,5 Romain Valabrègue,6 Stéphane Lehericy,6 Louis Boyer,4,7 Claude Dubray,1–3 Betty Jean4 1CHU Clermont-Ferrand, Centre de Pharmacologie Clinique, 2Centre d’Investigation Clinique – Inserm 1405, 3Clermont Université, Laboratoire de Pharmacologie, Faculté de médecine, 4CHU Gabriel Montpied, Clermont-Ferrand, Service d’Imagerie Ostéo-articulaire thoracique et neurologique, 5CHU Clermont-Ferrand, Délégation Recherche Clinique et à l’Innovation, Clermont-Ferrand, France; 6Institut du Cerveau et de la Moelle epiniere – ICM, Centre de NeuroImagerie de Recherche CENIR, Inserm U1127, CNRS UMR 7225, Sorbonne Universités, UPMC University Paris, Paris, France, Department of Neuroradiology, Groupe Hospitalier Pitié-Salpêtrière, Paris, France; 7UMR CNRS UdA 6284, Clemont-Ferrand, France Background: Paracetamol’s (APAP mechanism of action suggests the implication of supraspinal structures but no neuroimaging study has been performed in humans.Methods and results: This randomized, double-blind, crossover, placebo-controlled trial in 17 healthy volunteers (NCT01562704 aimed to evaluate how APAP modulates pain-evoked functional magnetic resonance imaging signals. We used behavioral measures and functional magnetic resonance imaging to investigate the response to experimental thermal stimuli with APAP or placebo administration. Region-of-interest analysis revealed that activity in response to noxious stimulation diminished with APAP compared to placebo in prefrontal cortices, insula, thalami, anterior cingulate cortex, and periaqueductal gray matter.Conclusion: These findings suggest an inhibitory effect of APAP on spinothalamic tracts leading to a decreased activation of higher structures, and a top-down influence on descending inhibition. Further binding and connectivity studies are needed to evaluate how APAP modulates pain, especially in the context of repeated

U-Shaped Interest in U-Shaped Development--and What It Means

Science.gov (United States)

Siegler, Robert S.

2004-01-01

Interest in U-shaped development has itself undergone a U-shaped progression. Twenty-five years ago, interest in U-shaped development was high. This interest was evident at a 1978 conference in Tel Aviv on "U-shaped Behavioral Growth" that resulted in the publication of a book of the same title 4 years later (Strauss, 1982). The breadth…

Usne u lavi

Directory of Open Access Journals (Sweden)

Una Krizmanić Ožegović

2017-06-01

Full Text Available [...] opatica je žena, ali žena koju se ne vidi svaki dan. Muškarci je se ne mogu nauživati u svakodnevnom ophođenju, stoga je žele s još većim žarom, skrivena je, zakukuljena, odsječena od svijeta u samostanu, u zatvoru, u beskrajnom zdanju u kojem se iza svakih vrata skrivaju još jedna. Carlos Fuentes, Constancia i druge priče za djeviceBože, oprosti mi. Možeš razumjeti silnu mahnitost u mojim prstima, vulkansku i suspregnutu potrebu mojih usana, vrelinu, i, o moj Bože, miris. Mnoštvo mirisa, otporne dlačice, znoj, znoj, prosta ruka, neobuzdana, poremećena, gruba. Gruba ruka kreće se u rupi, u kaljuži mojega bića. Svjedok – noć: pozornica za nasuprotnosti, noge i raskriljene proscenije, predstava uživo odakle se mrijeste strašne sablasti. Hitnem se s vrhunca svoje vjere, tijelo mi se razvaljuje u prah: prah koji se slobodno kreće, prah koji živi, prah koji je daleko od tebe, Gospodine. Jer griješim s golemim užitkom! I griješim misleći oživjeti. Gospodine, ja umirem od užitka u rukama, jezik traži ono što ne može dodirnuti, slina curi preko otvora; stenjem od trenja grješnih ruku, stenjem, vapim nijemo, ne da bih ti protuslovila, stenjem ne bih li te spoznala; pripojila. Svaka moja pora mjesto je otvorena dijaloga – začepljena znojem i magijom, bludi i slinom. Ruke, nezaustavljive, diraju mi kožu, rupe, mrse dlačice, prodiru divlje kao da nisam ni svoja, ni njihova gospodarica. Ruke puštaju da po njima curi slina s kojom prvo nisam znala što bih, onda sam je prisvojila, pa poslije tražila u iskusnu ritmu. Slina, proziran mulj, nedolično teče iz duše, predaje me na milost noći i mene same, curi, širi se prema netaknutim otvorima, olakšava mi pristup uskim, zabranjenim prolazima, Gospodine. Jer nastojala sam biti, bila sam u zabranjenim i uskim prolazima; zato griješim, Gospodine: s glazbom koja mi klizi niz dušu, s mutnom slinom, obilatom, demonskom, kola mi utrobom, prodire mirisom, miluje

Tank 241-U-102, Grab Samples 2U-99-1, 2U-99-2 and 2U-99-3 Analytical Results for the Final Report

International Nuclear Information System (INIS)

STEEN, F.H.

1999-01-01

This document is the final report for tank 241-U-102 grab samples. Five grab samples were collected from riser 13 on May 26, 1999 and received by the 222-S laboratory on May 26 and May 27, 1999. Samples 2U-99-3 and 2U-99-4 were submitted to the Process Chemistry Laboratory for special studies. Samples 2U-99-1, 2U-99-2 and 2U-99-5 were submitted to the laboratory for analyses. Analyses were performed in accordance with the Compatibility Grab Sampling and Analysis Plan for Fiscal year 1999 (TSAP) (Sasaki, 1999) and the Data Quality Objectives for Tank Farms Waste Compatibility Program (DQO) (Fowler 1995, Mulkey and Miller 1998). The analytical results are presented in the data summary report. None of the subsamples submitted for differential scanning calorimetry (DSC), total organic carbon (TOC) and plutonium 239 (Pu239) analyses exceeded the notification limits as stated in TSAP

Master formula approach to broken chiral U(3)xU(3) symmetry

Energy Technology Data Exchange (ETDEWEB)

Hiroyuki Kamano

2010-04-01

The master formula approach to chiral symmetry breaking proposed by Yamagishi and Zahed is extended to the U_R(3)xU_L(3) group, in which effects of the U_A(1) anomaly and the flavor symmetry breaking m_u \

U(1) x U(1) x U(1) symmetry of the Kimura 3ST model and phylogenetic branching processes

International Nuclear Information System (INIS)

Bashford, J D; Jarvis, P D; Sumner, J G; Steel, M A

2004-01-01

An analysis of the Kimura 3ST model of DNA sequence evolution is given on the basis of its continuous Lie symmetries. The rate matrix commutes with a U(1) x U(1) x U(1) phase subgroup of the group GL(4) of 4 x 4 invertible complex matrices acting on a linear space spanned by the four nucleic acid base letters. The diagonal 'branching operator' representing speciation is defined, and shown to intertwine the U(1) x U(1) x U(1) action. Using the intertwining property, a general formula for the probability density on the leaves of a binary tree under the Kimura model is derived, which is shown to be equivalent to established phylogenetic spectral transform methods. (letter to the editor)

Measurement of the 235U/238U fission cross section ratio in the 235U fission neutron spectrum

International Nuclear Information System (INIS)

Azimi-Garakani, D.; Bagheri-Darbandi, M.

1983-06-01

Fission cross section ratio of 235 U to 238 U has been measured in the fast neutron field generated by the 235 U fission plate installed on the thermal column of the Tehran Research Reactor (TRR) with a Makrofol solid state nuclear track detector. The experiments were carried out with a set of total six enriched 235 U and depleted 238 U deposits with different masses and Makrofol films of 0.025mm and 0.060mm thicknesses. The chemically etched tracks were counted by an optical microscope. No significant differences were observed with the thin and the thick films. The results showed that the average fission cross section ratio is 3.83+-0.25. (author)

The fission cross sections of 230Th, 232Th, 233U, 234U, 236U, 238U, 237Np, 239Pu and 242Pu relative 235U at 14.74 MeV neutron energy

International Nuclear Information System (INIS)

Meadows, J.W.

1986-12-01

The measurement of the fission cross section ratios of nine isotopes relative to 235 U at an average neutron energy of 14.74 MeV is described with particular attention to the determination of corrections and to sources of error. The results are compared to ENDF/B-V and to other measurements of the past decade. The ratio of the neutron induced fission cross section for these isotopes to the fission cross section for 235 U are: 230 Th - 0.290 +- 1.9%; 232 Th - 0.191 +- 1.9%; 233 U - 1.132 +- 0.7%; 234 U - 0.998 +- 1.0%; 236 U - 0.791 +- 1.1%; 238 U - 0.587 +- 1.1%; 237 Np - 1.060 +- 1.4%; 239 Pu - 1.152 +- 1.1%; 242 Pu - 0.967 +- 1.0%. 40 refs., 11 tabs., 9 figs

DENSITY-FUNCTIONAL STUDY OF U-Mo AND U-Zr ALLOYS

Energy Technology Data Exchange (ETDEWEB)

Landa, A; Soderlind, P; Turchi, P A

2010-11-01

Density-functional theory previously used to describe phase equilibria in U-Zr alloys [A. Landa, P. Soederlind, P.E.A. Turchi, J. Alloys Comp. 478 (2009) 103-110] is extended to investigate the ground-state properties of U-Mo solid solutions. We discuss how the heat of formation in both alloys correlates with the charge transfer between the alloy components, and how the specific behavior of the density of states in the vicinity of the Fermi level promotes the stabilization of the U{sub 2}Mo compound. Our calculations prove that, due to the existence of a single {gamma}-phase over the typical fuel operation temperatures, {gamma}-U-Mo alloys should indeed have much lower constituent redistribution than {gamma}-U-Zr alloys for which binodal decomposition causes a high degree of constituent redistribution.

42 CFR 64.2 - Definitions.

Science.gov (United States)

2010-10-01

... Health and Human Services. Nonprofit private entity means an agency, organization, institution, or other entity which may not lawfully hold or use any part of its net earnings to the benefit of any private... means those costs other than stipends, such as tuition, fees, and trainee travel, which are directly...

U enrichment and Th/U fractionation in Archean boninites: Implications for paleo-ocean oxygenation and U cycling at juvenile subduction zones

Science.gov (United States)

Manikyamba, C.; Said, Nuru; Santosh, M.; Saha, Abhishek; Ganguly, Sohini; Subramanyam, K. S. V.

2018-05-01

Phanerozoic boninites record enrichments of U over Th, giving Th/U: 0.5-1.6, relative to intraoceanic island arc tholeiites (IAT) where Th/U averages 2.6. Uranium enrichment is attributed to incorporation of shallow, oxidized fluids, U-rich but Th-poor, from the slab into the melt column of boninites which form in near-trench to forearc settings of suprasubduction zone ophiolites. Well preserved Archean komatiite-tholeiite, plume-derived, oceanic volcanic sequences have primary magmatic Th/U ratios of 4.4-3.6, and Archean convergent margin IAT volcanic sequences, having REE and HFSE compositions similar to Phanerozoic IAT equivalents, preserve primary Th/U of 4-3.6. The best preserved Archean boninites of the 3.0 Ga Olondo and 2.7 Ga Gadwal greenstone belts, hosted in convergent margin ophiolite sequences, also show relative enrichments of U over Th, with low average Th/U ∼3 relative to coeval IAT, and Phanerozoic counterparts which are devoid of crustal contamination and therefore erupted in an intraoceanic setting, with minimal contemporaneous submarine hydrothermal alteration. Later enrichment of U is unlikely as Th-U-Nb-LREE patterns are coherent in these boninites whereas secondary effects induce dispersion of Th/U ratios. The variation in Th/U ratios from Archean to Phanerozoic boninites of greenstone belts to ophiolitic sequences reflect on genesis of boninitic lavas at different tectono-thermal regimes. Consequently, if the explanation for U enrichment in Phanerozoic boninites also applies to Archean examples, the implication is that U was soluble in oxygenated Archean marine water up to 600 Ma before the proposed great oxygenation event (GOE) at ∼2.4 Ga. This interpretation is consistent with large Ce anomalies in some hydrothermally altered Archean volcanic sequences aged 3.0-2.7 Ga.

Thinking about U : Theorizing and testing U - and inverted U-shaped relationships in strategy research

NARCIS (Netherlands)

Haans, Richard; Pieters, Constant; He, Zilin

U- and inverted U-shaped relationships are increasingly explored in strategy research, with 11 percent of all articles published in Strategic Management Journal (SMJ) in 2008–2012 investigating such quadratic relationships. Moreover, a movement towards introducing moderation to quadratic

Axially symmetric U-O-Ln- and U-O-U-containing molecules from the control of uranyl reduction with simple f-block halides

International Nuclear Information System (INIS)

Arnold, Polly L.; Cowie, Bradley E.; Suvova, Marketa; Zegke, Markus; Love, Jason B.; Magnani, Nicola; Colineau, Eric; Griveau, Jean-Christophe; Caciuffo, Roberto

2017-01-01

The reduction of U"V"I uranyl halides or amides with simple Ln"I"I or U"I"I"I salts forms highly symmetric, linear, oxo-bridged trinuclear U"V/Ln"I"I"I/U"V, Ln"I"I"I/U"I"V/Ln"I"I"I, and U"I"V/U"I"V/U"I"V complexes or linear Ln"I"I"I/U"V polymers depending on the stoichiometry and solvent. The reactions can be tuned to give the products of one- or two-electron uranyl reduction. The reactivity and magnetism of these compounds are discussed in the context of using a series of strongly oxo-coupled homo- and heterometallic poly(f-block) chains to better understand fundamental electronic structure in the f-block. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

Axially symmetric U-O-Ln- and U-O-U-containing molecules from the control of uranyl reduction with simple f-block halides

Energy Technology Data Exchange (ETDEWEB)

Arnold, Polly L.; Cowie, Bradley E.; Suvova, Marketa; Zegke, Markus; Love, Jason B. [EaStCHEM School of Chemistry, University of Edinburgh (United Kingdom); Magnani, Nicola; Colineau, Eric; Griveau, Jean-Christophe; Caciuffo, Roberto [European Commission, Directorate for Nuclear Safety and Security, Joint Research Centre, Karlsruhe (Germany)

2017-08-28

The reduction of U{sup VI} uranyl halides or amides with simple Ln{sup II} or U{sup III} salts forms highly symmetric, linear, oxo-bridged trinuclear U{sup V}/Ln{sup III}/U{sup V}, Ln{sup III}/U{sup IV}/Ln{sup III}, and U{sup IV}/U{sup IV}/U{sup IV} complexes or linear Ln{sup III}/U{sup V} polymers depending on the stoichiometry and solvent. The reactions can be tuned to give the products of one- or two-electron uranyl reduction. The reactivity and magnetism of these compounds are discussed in the context of using a series of strongly oxo-coupled homo- and heterometallic poly(f-block) chains to better understand fundamental electronic structure in the f-block. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

Moral u Hrvatskoj u sociologijskoj perspektivi

OpenAIRE

ČRPIĆ, Gordan; VALKOVIĆ, Marijan

2000-01-01

U radu se obrađuje stanje morala u Republici Hrvatskoj na temelju empirijskih socioreligijskih istraživanja provedenih na općoj populaciji građana koncem 1997. i početkom 1998. godine na uzorku od 1245 ispitanika, te na populaciji studenata hrvatskih sveučilišta 1999. godine na uzorku od 692 ispitanika. Rezultati su prikazani kroz sedam poglavlja rada i pokazuju da su mladi općenito permisivniji s obzirom na sve promatrane dimenzije morala. Religioznost se pokazala kao jasan kriterij zauziman...

Limitations on the precision of 238U/235U measurements and implications for environmental monitoring

International Nuclear Information System (INIS)

Russ III, G.P.

1997-01-01

The ability to determine the isotopic composition of uranium in environmental samples is an important component of the International Atomic Energy Agency's (IAEA) safeguards program, and variations in the isotopic ratio 238 U/ 235 U provide the most direct evidence of isotopic enrichment activities. The interpretation of observed variations in 238 U/ 235 U depends on the ability to distinguish enrichment from instrumental biases and any variations occurring in the environment but not related to enrichment activities. Instrumental biases that have historically limited the accuracy of 238 U/ 235 U determinations can be eliminated by the use of the 233 U/ 236 U double-spike technique. With this technique, it is possible to determine the 238 U/ 235 U in samples to an accuracy equal to the precision of the measurement, ca. 0.1% for a few 10's of nanograms of uranium. Given an accurate determination of 238 U/ 235 U, positive identification of enrichment activities depends on the observed value being outside the range of 238 U/ 235 U's expected as a result of natural or environmental variations. Analyses of a suite of soil samples showed no variation beyond 0.2% in 238 U/ 235 U

U Shrinivasa

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. U Shrinivasa. Articles written in Resonance – Journal of Science Education. Volume 17 Issue 4 April 2012 pp 365-377 General Article. The Evolution of Diesel Engines · U Shrinivasa · More Details Fulltext PDF ...

234U/238U activity ratio in groundwater - an indicator of past hydrogeological processes

International Nuclear Information System (INIS)

Rasilainen, K.; Suksi, J.; Marcos, N.; Nordman, H.

2005-01-01

In this report we describe the long-term behaviour of the uranium isotopes, U-234 and U-238 in groundwater systems. U is a redox sensitive element what for its behaviour is largely controlled by changes in the environmental conditions. A striking feature in U isotope geochemistry is seemingly different behaviour of U-238 and U-234. U isotopes fractionate at the rock-groundwater interface depending on chemical and radiological factors. Changes of the redox conditions in groundwater may thus affect the behaviour of U and its isotopes resulting in variable U concentration and U-234/U-238 activity ratios (AR). We examined the formation of ARs in different groundwater types from a geochemical and a physical/radiological point of view. It was envisaged that AR in groundwater is the consequence of radiological, chemical and hydrological processes. Groundwater condition (redox, flow, etc.) play a very important role in controlling the mass flow of U isotopes. Quantitative α-recoil modelling showed that α-recoil induced flux can be considered insignificant in cases of high-flow. This was an important finding because the exclusion of direct a-recoil means that it is groundwater chemistry and its variations which controls the U-234 mass flow and the formation of AR. Therefore, AR values could be used more confidently to indicate past redox changes and possibly flow paths. (orig.)

Higgs phenomenology in the minimal S U (3 )L×U (1 )X model

Science.gov (United States)

Okada, Hiroshi; Okada, Nobuchika; Orikasa, Yuta; Yagyu, Kei

2016-07-01

We investigate the phenomenology of a model based on the S U (3 )c×S U (3 )L×U (1 )X gauge theory, the so-called 331 model. In particular, we focus on the Higgs sector of the model which is composed of three S U (3 )L triplet Higgs fields and is the minimal form for realizing a phenomenologically acceptable scenario. After the spontaneous symmetry breaking S U (3 )L×U (1 )X→S U (2 )L×U (1 )Y , our Higgs sector effectively becomes that with two S U (2 )L doublet scalar fields, in which the first- and the second-generation quarks couple to a different Higgs doublet from that which couples to the third-generation quarks. This structure causes the flavor-changing neutral current mediated by Higgs bosons at the tree level. By taking an alignment limit of the mass matrix for the C P -even Higgs bosons, which is naturally realized in the case with the breaking scale of S U (3 )L×U (1 )X much larger than that of S U (2 )L×U (1 )Y, we can avoid current constraints from flavor experiments such as the B0-B¯ 0 mixing even for the Higgs bosons masses that are O (100 ) GeV . In this allowed parameter space, we clarify that a characteristic deviation in quark Yukawa couplings of the Standard Model-like Higgs boson is predicted, which has a different pattern from that seen in two Higgs doublet models with a softly broken Z2 symmetry. We also find that the flavor-violating decay modes of the extra Higgs boson, e.g., H /A →t c and H±→t s , can be dominant, and they yield the important signature to distinguish our model from the two Higgs doublet models.

Resonance Region Covariance Analysis Method and New Covariance Data for Th-232, U-233, U-235, U-238, and Pu-239

International Nuclear Information System (INIS)

Leal, Luiz C.; Arbanas, Goran; Derrien, Herve; Wiarda, Dorothea

2008-01-01

Resonance-parameter covariance matrix (RPCM) evaluations in the resolved resonance region were done for 232Th, 233U, 235U, 238U, and 239Pu using the computer code SAMMY. The retroactive approach of the code SAMMY was used to generate the RPCMs for 233U, 235U. RPCMs for 232Th, 238U and 239Pu were generated together with the resonance parameter evaluations. The RPCMs were then converted in the ENDF format using the FILE32 representation. Alternatively, for computer storage reasons, the FILE32 was converted in the FILE33 cross section covariance matrix (CSCM). Both representations were processed using the computer code PUFF-IV. This paper describes the procedures used to generate the RPCM with SAMMY.

Uranium 234U and 238U isotopes in the southern Baltic environment

International Nuclear Information System (INIS)

Borylo, A.; Skwarzec, B.

2002-01-01

The concentration and distribution of uranium in water and sediment of selected basins of the southern Baltic Sea have been analysed. It was observed that the concentration of uranium in sediments increases with core depth. This is probably connected to diffusion processes from sediments to water through interstitial water where uranium concentration is much higher than in bottom water. The measurements of 234 U/ 238 U activity ratios indicate that sedimentation of terrigenic material and transport through Vistula river are the major sources of uranium in sediments of the southern Baltic Sea. Estimation of the 234 U/ 238 U ratios in reduction areas of the Baltic Deep and the Bornholm Deep suggest that the processes of reduction of U(VI) to U(IV) and of removal of authogenic uranium from seawater to sediments do not play major roles in the Gdansk Deep. (author)

Seoska prehrana u Baranji

OpenAIRE

Somek-Machala, Božica

1993-01-01

Način prehrane seoskog stanovništva u uskoj je vezi s krajem, društvenim i povijesnim prilikama u kojima živi, te duhovnom kulturnom vezom uz tradiciju, običaje i religiju, koji diktiraju izbor hrane, način pripreme i broj obroka u svakodnevnoj prehrani i u onoj koja prati određene rituale.

Kemija u nastavi: Etimološki pristup učenju kemije

OpenAIRE

Raos, Nenad; Raos (ur.), Nenad

2018-01-01

Etimološki pristup učenju kemije je u tome da ne objasnimo samo što ime ili termin znači nego i da ukažemo na njegovo izvorno značenje te objasnimo kako je našao svoj put do kemije. U članku se razmatra povijest anorganske kemije kroz povijest imenovanja kemijskih elemenata. Povijest pak organske kemije otkriva, upravo kroz imena spojeva, da se temeljila prije svega na izolaciji čistih tvari iz prirodnih materijala. Etimološki pristup učenju kemije olakšava usvajanje kemijske nomenklature i t...

U.S. Level III and IV Ecoregions (U.S. EPA)

Data.gov (United States)

U.S. Environmental Protection Agency — This map service displays Level III and Level IV Ecoregions of the United States and was created from ecoregion data obtained from the U.S. Environmental Protection...

Thermodynamic calculation of phase equilibria of the U-Ga and U-W systems

International Nuclear Information System (INIS)

Wang, J.; Liu, X.J.; Wang, C.P.

2008-01-01

The thermodynamic assessments of the U-Ga and U-W systems have been carried out by using the CALPHAD (calculation of phase diagrams) method using experimental data including thermodynamic properties and phase equilibria. Gibbs free energies of the solution phases were described by the subregular solution models with the Redlich-Kister equation, and those of the intermetallic compounds were described by the sublattice models. A consistent set of thermodynamic parameters has been derived for the Gibbs free energy of each phase in the U-Ga and U-W binary systems, respectively. The calculated phase diagrams and thermodynamic properties in the U-Ga and U-W systems are in good agreement with experimental data

Algebraic formulas for some nontrivial U/sub n/ 6j symbols and U/sub m/n contains U/sub m/ x U/sub n/ 3jm symbols

International Nuclear Information System (INIS)

Haase, R.W.; Butler, P.H.

1985-01-01

We give tables of algebraic formulas for some nontrivial 6j symbols and 3jm symbols of the unitary groups. The tables demonstrate that the building-up method can be used successfully to obtain the rank dependence of unitary group j and jm symbols. To emphasize the rank-dependent nature of this calculation, we have employed the composite Young tableaux notation (or back-to-back notation) to label the unitary group irreps. In using this notation, the transpose conjugate symmetry of the corresponding composite Young diagram leads to a new symmetry of the unitary group 6j and 3jm symbols. The transposition of the groups U/sub m/ and U/sub n/ gives rise to a further symmetry of the 3jm symbols of U/sub m/n contains U/sub m/ x U/sub n/

Path integral for coherent states of the dynamical U2 group and U2/1 supergroup

International Nuclear Information System (INIS)

Kochetov, E.A.

1992-01-01

A part-integral formulation in the representation of coherent states for the unitary U 2 group and U 2/1 supergroup is introduced. U 2 and U 2/1 path integrals are shown to be defined on the coset spaces U 2 /U 1 xU 1 and U 2/1 /U 1/1 xU 1 , respectively. These coset appears as curved classical phase spaces. Partition functions are expressed as path integrals over these spaces. In the case when U 2 and U 2/1 are the dynamical groups, the corresponding path integrals are evaluated with the help of linear fractional transformations that appear as the group (supergroup) action in the coset space (superspace). Possible applications for quantum models are discussed. 9 refs

U.S.-South Korea Relations

Science.gov (United States)

2012-05-15

After Realignment Plan Is Implemented................................................... 22 Tables Table 1. Annual U.S.-South Korea Merchandise ...In addition to their formal dinner, Obama and Lee had a private dinner at a local Korean restaurant and made a joint visit to a General Motors...U.S. trade. Table 1. Annual U.S.-South Korea Merchandise Trade, Selected Years (Billions of Nominal U.S. Dollars) Year U.S. Exports U.S. Imports

The urokinase receptor (uPAR) and the uPAR-associated protein (uPARAP/Endo180)

DEFF Research Database (Denmark)

Behrendt, Niels

2004-01-01

The breakdown of the barriers formed by extracellular matrix proteins is a pre-requisite for all processes of tissue remodeling. Matrix degradation reactions take part in specific physiological events in the healthy organism but also represent a crucial step in cancer invasion. These degradation...... on the surface of various cell types that serves to bind the urokinase plasminogen activator and localize the activation reactions in the proteolytic cascade system of plasminogen activation. uPARAP is an integral membrane protein with a pronounced role in the internalization of collagen for intracellular...... degradation. Both receptors have additional functions that are currently being unraveled. The present discussion of uPAR and uPARAP is centered on their protein structure and molecular and cellular function....

Using the Estimating Supplies Program to Develop Materiel Solutions for the U.S. Air Force Aeromedical Evacuation In-Flight Kit (FFQDM)

Science.gov (United States)

2008-07-07

1INX10YD 12S RO 071 INSERT NG/OG TUBE 8105008357212 BAG MOTION SICK 1000S EA 6530008368134 BASIN EMESIS KIDNEY 10IN DISP 250S EA 6510015016024...WATER FOR IRRIGATION STER 1000ML BT 12S BT 075 IRRIGATE NG/OG TUBE 6530008368134 BASIN EMESIS KIDNEY 10IN DISP 250S EA 6515014618929 GLOVE EXAM...2.96 0.14 0.00 $11.83 B 6510002011755 BANDAGE MUSLIN CAMOUFLAGE 37X37X52IN EA 3 12 0.390 6.150 $6.42 1.56 24.60 $25.68 B 6530008368134 BASIN EMESIS

235U and 238U (n,xn gamma) cross-sections

International Nuclear Information System (INIS)

Bacquias, A.; Dessagne, Ph.; Kerveno, M.; Rudolf, G.; Thiry, J.C.; Borcea, C.; Negret, A.L.; Drohe, J.C.; Nankov, N.; Nyman, M.; Plompen, A.; Rouki, C.; Stanoiu, M.

2014-01-01

The (n,n') and (n,2n) are important processes in the energy domain of fission neutrons, but the cross-sections suffer from large uncertainties, not compatible with the objectives fixed for future and advanced nuclear reactors. This paper presents our experimental effort to improve 235 U and 238 U (n,xnγ) cross-section data. The experiments were performed at the GELINA facility (Belgium), which provides a pulsed (800 Hz) neutron beam covering a wide energy spectrum (from a few eV to about 20 MeV). The GRAPhEME set-up is designed for prompt gamma spectroscopy and time-of-flight measurement. The analysis methods are presented. Already published results on 235 U are shown, as well as results on 238 U. The interpretation and discussion rely on the comparison with TALYS and EMPIRE predictions. (authors)

Antibody-based PET of uPA/uPAR signaling with broad applicability for cancer imaging

DEFF Research Database (Denmark)

Yang, Dongzhi; Severin, Gregory; Dougherty, Casey A.

2016-01-01

Mounting evidence suggests that the urokinase plasminogen activator (uPA) and its receptor (uPAR) play a central role in tumor progression. The goal of this study was to develop an 89Zr-labeled, antibody-based positron emission tomography (PET) tracer for quantitative imaging of the uPA/uPAR system....... An anti-uPA monoclonal antibody (ATN-291) was conjugated with a deferoxamine (Df) derivative and subsequently labeled with 89Zr. Flow cytometry, microscopy studies, and competitive binding assays were conducted to validate the binding specificity of Df-ATN-291 against uPA. PET imaging with 89Zr-Df-ATN-291...... was carried out in different tumors with distinct expression levels of uPA. Biodistribution, histology examination, and Western blotting were performed to correlate tumor uptake with uPA or uPAR expression. ATN-291 retained uPA binding affinity and specificity after Df conjugation. 89Zr-labeling of ATN-291...

U.S. uranium supply outlook

International Nuclear Information System (INIS)

Hogerton, J.F.

1977-01-01

The subject is analysed in the light of figures and forecasts contained in the following diagrams: forecasts of U.S. uranium production, 1977 to 1990; indicated relationship between annual U.S. uranium supply and demand, 1977 to 1986; presently indicated cumulative U.S. uranium supply/demand balance, 1977 to 1990; indicated cumulative U.S. supply/demand balance (shortage or surpluses) 1976 to 1990; presently indicated balance between outstanding U.S. utility procurement needs and uncommitted domestic supply capability 1977 to 1986; projected U.S. uranium requirements in relation to existing supply base and presently indicated additional domestic resource potential, 1977 to 2000. (U.K.)

Modern applied U-statistics

CERN Document Server

Kowalski, Jeanne

2008-01-01

A timely and applied approach to the newly discovered methods and applications of U-statisticsBuilt on years of collaborative research and academic experience, Modern Applied U-Statistics successfully presents a thorough introduction to the theory of U-statistics using in-depth examples and applications that address contemporary areas of study including biomedical and psychosocial research. Utilizing a "learn by example" approach, this book provides an accessible, yet in-depth, treatment of U-statistics, as well as addresses key concepts in asymptotic theory by integrating translational and cross-disciplinary research.The authors begin with an introduction of the essential and theoretical foundations of U-statistics such as the notion of convergence in probability and distribution, basic convergence results, stochastic Os, inference theory, generalized estimating equations, as well as the definition and asymptotic properties of U-statistics. With an emphasis on nonparametric applications when and where applic...

The Effect of Early Diagenesis on the 238U/235U Ratio of Platform Carbonates.

Science.gov (United States)

Tissot, F.; Chen, C.; Go, B. M.; Naziemiec, M.; Healy, G.; Swart, P. K.; Dauphas, N.

2017-12-01

In the past 15 years, the so-called non-traditional stable isotopes systems (e.g., Mg, Fe, Mo, U) have emerged as powerful tracers of both high-T and low-T geochemical processes (e.g., [1]). Of particular interest for paleoredox studies is the ratio of "stable" isotopes of U (238U/235U), which has the potential to track the global extent of oceanic anoxia (e.g., [2, 3]). Indeed, in the modern ocean, U exists in two main oxidation states, soluble U6+ and insoluble U4+, and has a mean residence time of 400 kyr ([4]), much longer than the global ocean mixing time (1-2 kyr). As such the salinity-normalized ocean is homogeneous with regards to both U concentrations and isotopes (δ238USW = -0.392±0.005 ‰, [2]). The value of δ238USW at any given time is therefore the balance between U input to the ocean, mainly from rivers, and U removal, mostly into biogenic carbonates, anoxic/euxinic sediments and suboxic/hypoxic sediments (e.g., [2, 5]). Because the 238U/235U ratio of the past ocean cannot be measured directly, it has to be estimated from the measurement of the 238U/235U ratio of a sedimentary rock and assuming a constant fractionation factor. Carbonates appear as a promising record since they span most of Earth's history, and the δ238U values of modern primary carbonate precipitates and well-preserved fossil aragonitic coral up to 600 ka are indistinguishable from that of seawater (e.g., [2, 6, 7]). Yet, the effect of secondary processes on the δ238U values of non-coral carbonates, which represent the bulk of the rock record, has only been studied in a handful of shallow samples (down to 40cm, [6]) and remains poorly understood. To investigate the effect of early diagenesis on the 238U/235U ratio of carbonates on the 30kyr to 1Myr timescale, we measured δ13C, δ18O, and δ238U in samples from a 220m long drill core from the Bahamas carbonate platform. In order to separate lattice bound U from secondary U we developed a leaching protocol applicable to carbonate

Interdiffusion between U(Mo,Pt) or U(Mo,Zr) and Al or Al A356 alloy

International Nuclear Information System (INIS)

Komar Varela, C.; Mirandou, M.; Arico, S.; Balart, S.; Gribaudo, L.

2009-01-01

Solid state reactions in chemical diffusion couples U-7 wt.%Mo-0.9 wt.%Pt/Al at 580 deg. C and U-7 wt.%Mo-0.9 wt.%Pt/Al A356 alloy, U-7 wt.%Mo-1 wt.%Zr/Al and U-7 wt.%Mo-1 wt.%Zr/Al A356 alloy at 550 deg. C were characterized. Results were obtained from optical and scanning electron microscopy, electron probe microanalysis and X-ray diffraction. The UAl 3, UAl 4 and Al 20 Mo 2 U phases were identified in the interaction layers of γU(Mo,Pt)/Al and γU(Mo,Zr)/Al diffusion couples. Al 43 Mo 4 U 6 ternary compound was also identified in γU(Mo,Zr)/Al due to the decomposition of γU(Mo,Zr) phase. The U(Al,Si) 3 and U 3 Si 5 phases were identified in the interaction layers of γU(Mo,Pt)/Al A356 and γU(Mo,Zr)/Al A356 diffusion couples. These phases are formed due to the migration of Si to the interaction layer. In the diffusion couple U(Mo,Zr)/Al A356, Zr 5 Al 3 phase was also identified in the interaction layer. The use of synchrotron radiation at Brazilian Synchrotron Light Laboratory (LNLS, CNPq, Campinas, Brazil) was necessary to achieve a complete crystallographic characterization.

Ekvivalences pamata kategorijas , tulkojot specializētos tekstus ar angļu-latviešu un latviešu-angļu tulkojumu piemēriem

OpenAIRE

Saveļjevs, Jurijs

2014-01-01

Maģistra darbs ar nosaukumu „Ekvivalences pamata kategorijas, tulkojot specializētos tekstus, ar angļu-latviešu un latviešu-angļu tulkojumu piemēriem” ir veltīts dabiskās un virzītās, kā arī formālās un dinamiskās ekvivalences jēdzienu pētījumam. Darba teorētiskajā daļā tiek iztirzāta leksiski-sintaktisko valodas elementu ekvivalences jēdziena izcelsme un attīstība, tā pašreizējais stāvoklis un dažādu pētnieku tā redzējums. tāpat tiek izvērtētas ekvivalences jēdziena pamata kategorijas – dabi...

γ-U phase in U-Pt system retained to low temperatures by means of rapid cooling

Energy Technology Data Exchange (ETDEWEB)

Kim-Ngan, N.-T.H., E-mail: tarnawsk@up.krakow.pl [Institute of Physics, Pedagogical University, Podchorazych 2, 30 084 Kraków (Poland); Paukov, M. [Faculty of Mathematics and Physics, Charles University, Ke Karlovu 5, 12116 Prague (Czech Republic); Tarasenko, R. [Faculty of Mathematics and Physics, Charles University, Ke Karlovu 5, 12116 Prague (Czech Republic); Institute of Physics, Faculty of Science, P.J. Šafárik University, Park Angelinum 9, 04154 Košice (Slovakia); Tkáč, V.; Minarik, P.; Drozdenko, D.; Havela, L. [Faculty of Mathematics and Physics, Charles University, Ke Karlovu 5, 12116 Prague (Czech Republic)

2016-10-15

Splat-cooling technique with a cooling rate better than 10{sup 6} K/s helps to increase the Pt solubility in the (cubic) γ-U phase and retain such γ-U phase in U-15 at.% Pt splat down to low temperatures. The splat-cooled U-Pt alloys are very stable in exposing to air. The γ-U phase (U-15 at.% Pt splat) is characterized by a negative temperature coefficient of the resistivity (dρ/dT < 0). The splats become superconducting below 1.1 K. - Highlights: • γ-U phase stabilization in U-15 at.% Pt splat-cooled alloys. • Splat-cooling helps to increase the Pt solubility in cubic γ-U phase. • All U-Pt alloys (0–15 at.% Pt) become superconducting below 1.1 K.

238U, 234U and 230Th in uranium miners' lungs

International Nuclear Information System (INIS)

Singh, M.P.; Wrenn, M.E.; Archer, V.E.; Saccomanno, G.

1981-01-01

Fourteen uranium miners' lungs from Colorado plateau were collected at autopsy and the concentrations of 238 U, 234 U and 230 Th were determined by radiochemical procedures utilizing solvent extraction - alpha spectrometric techniques. The uranium and thorium isotopes are in near equilibrium with average concentrations of 238 U, 234 U and 230 Th being 89.3, 95.2 and 91.1 pCi/kg respectively. The combined average radiation dose rate to lung from these three isotopes is about 24.2 mrad/year at death excluding the unmeasured contribution from the 226 Ra and daughters. The average concentration of 230 Th is about 65 times higher than the mean concentration of 230 Th in lungs of non-miners dying at comparable ages from the same region

222Rn content and 234U/238U activity ratio in groundwaters

International Nuclear Information System (INIS)

Olguin, M.T.; Segovia, N.; Ordonez, E.; Iturbe, J.L.; Bulbulian, S.; Carrillo, J.

1990-01-01

Geochemical radioanalytical studies of ground water were perfomed in the valleys of Villa de Reyes and San Luis Potosi, Mexico. The experiments were designed to measure radon and uranium content and 234 U/ 238 U activity ratio in ground water samples taken from wells in these sites and at the Nuclear Center of Salazar, Mexico. 222 Rn content varied depending on the sample source, reaching a maximum value of 235 pCi/l; uranium concentration results were less than 1 μg/l and 234 U/ 238 U activity ratios were close to equilibrium. (author) 9 refs.; 1 fig.; 1 tab

Hydration structures of U(III) and U(IV) ions from ab initio molecular dynamics simulations

International Nuclear Information System (INIS)

Leung, Kevin; Nenoff, Tina M.

2012-01-01

We apply DFT+U-based ab initio molecular dynamics simulations to study the hydration structures of U(III) and U(IV) ions, pertinent to redox reactions associated with uranium salts in aqueous media. U(III) is predicted to be coordinated to 8 water molecules, while U(IV) has a hydration number between 7 and 8. At least one of the innershell water molecules of the hydrated U(IV) complex becomes spontaneously deprotonated. As a result, the U(IV)–O pair correlation function exhibits a satellite peak at 2.15 Å associated with the shorter U(IV)–(OH − ) bond. This feature is not accounted for in analysis of extended x-ray absorption fine structure and x-ray adsorption near edge structure measurements, which yield higher estimates of U(IV) hydration numbers. This suggests that it may be useful to include the effect of possible hydrolysis in future interpretation of experiments, especially when the experimental pH is close to the reported hydrolysis equilibrium constant value.

Abreniešu identitāte atmiņu stāstos

OpenAIRE

Rātfeldere, Linda

2013-01-01

Izmantojot gan biogrāfiskās intervijas ar abreniešiem, gan muzejos un arhīvos iegūtos materiālus, bakalaura darba "Abreniešu identiāte atmiņu stāstos" mērķis ir caur atmiņu stāstiem pētīt abreniešu identitāti, tās trīs komponentus: vietu, valodu un savstarpējās attiecības. Šim nolūkam, pirmkārt, sniegts Abrenes vēsturiskais, sociālais un kultūras konteksts, plašāk aplūkojot tos aspektus, kas ir būtiski tieši identitātes izpētē. Otrkārt, analizētas abreniešu personiskās atmiņas par Abrenes kul...

Intake of 210Po, 234U and 238U radionuclides with beer in Poland

International Nuclear Information System (INIS)

Skwarzec, B.; Struminska, D.I.; Borylo, A.; Falandysz, J.

2004-01-01

238 U, 234 U and 210 Po activity concentrations were determined in beer in Poland by alpha-spectrometry with low-level activity silicon detectors. The results revealed that the mean concentrations of 238 U, 234 U and 210 Po in the analyzed beer samples were 4.63, 4.11 and 4.94 mBq x dm -3 , respectively, the highest in Tyskie (5.71 for 210 Po, 5.06 for 234 U and 6.11 for 238 U) and the lowest in Lech (2.49 for 210 Po). The effective radiation dose due to uranium and polonium ingestions by beer was calculated and were compared to the effective radiation dose from drinking water. (author)

Geochemical control on the reduction of U(VI) to mononuclear U(IV) species in lacustrine sediments

Science.gov (United States)

Stetten, L.; Mangeret, A.; Brest, J.; Seder-Colomina, M.; Le Pape, P.; Ikogou, M.; Zeyen, N.; Thouvenot, A.; Julien, A.; Alcalde, G.; Reyss, J. L.; Bombled, B.; Rabouille, C.; Olivi, L.; Proux, O.; Cazala, C.; Morin, G.

2018-02-01

Contaminated systems in which uranium (U) concentrations slightly exceed the geochemical background are of particular interest to identify natural processes governing U trapping and accumulation in Earth's surface environments. For this purpose, we examined the role of early diagenesis on the evolution of U speciation and mobility in sediments from an artificial lake located downstream from a former mining site. Sediment and pore water chemistry together with U and Fe solid state speciation were analyzed in sediment cores sampled down to 50 cm depth at four locations in the lake. These organic-rich sediments (∼12% organic C) exhibited U concentrations in the 40-80 mg kg-1 range. The sediment columns were anoxic 2-3 mm below the sediment-water interface and pore waters pH was circumneutral. Pore water chemistry profiles showed that organic carbon mineralization was associated with Fe and Mn reduction and was correlated with a decrease in dissolved U concentration with depth. Immobilization of U in the sediment was correlated with the reduction of U(VI) to U(IV) at depth, as shown by U LIII-edge XANES spectroscopic analysis. XANES and EXAFS spectroscopy at the Fe K-edge showed the reduction of structural Fe(III) to Fe(II) in phyllosilicate minerals with depth, coincident with U(VI) to U(IV) reduction. Thermodynamic modeling suggests that Fe(II) could act as a major reducing agent for U(VI) during early diagenesis of these sediments, leading to complete U reduction below ∼30 cm depth. Shell-by-shell and Cauchy-Wavelet analysis of U LIII-EXAFS spectra indicates that U(VI) and U(IV) are mainly present as mononuclear species bound to C, P or Si ligands. Chemical extractions confirmed that ∼60-80% of U was present as non-crystalline species, which emphasizes that such species should be considered when evaluating the fate of U in lacustrine environments and the efficiency of sediment remediation strategies.

Quantum algebra U{sub qp}(u{sub 2}) and application to the rotational collective dynamics of the nuclei; Algebre quantique U{sub qp}(u{sub 2}) et application a la dynamique collective de rotation dans les noyaux

Energy Technology Data Exchange (ETDEWEB)

Barbier, R

1995-09-22

This thesis concerns some aspects of new symmetries in Nuclear Physics. It comprises three parts. The first one is devoted to the study of the quantum algebra U{sub qp}(u{sub 2}). More precisely, we develop its Hopf algebraic structure and we study its co-product structure. The bases of the representation theory of U{sub qp}(u{sub 2}) are introduced. On one hand, we construct the finite-dimensional irreducible representations of U{sub qp}(u{sub 2}). On the other hand, we calculate the Clebsch-Gordan coefficients with the projection operator method. To complete our study, we construct some deformed boson mappings of the quantum algebras U{sub qp}(u{sub 2}), U{sub q{sup 2}}(su{sub 2}) and U{sub qp}(u{sub 1,1}). The second part deals with the construction of a new phenomenological model of the non rigid rotator. This model is based on the quantum algebra U{sub qp}(u{sub 2}). The rotational energy and the E2 reduced transition probabilities are obtained. They depend on the two deformation parameters q and p of the quantum algebra. We show how the use of the two-parameter deformation of the algebra U{sub qp}(u{sub 2}) leads to a generalization of the U{sub q}(su{sub 2})-rotator model. We also introduce a new model of the anharmonic oscillator on the basis of the quantum algebra U{sub qp}(u{sub 2}). We show that the system of the U{sub q}(su{sub 2})-rotator and of the anharmonic oscillator can be coupled with the use of the deformation parameters of U{sub qp}(u{sub 2}). A ro-vibration energy formula and expansion `a la` Dunham are obtained. The aim of the last part is to apply our non rigid rotator model to the rotational collective dynamics of the superdeformed nuclei of the A{approx}130 - 150 and A{approx}190 mass regions and deformed nuclei of the actinide and rare earth series. We adjust the free parameters of our model and compare our results with those from four other models of the non rigid rotator. A comparative analysis is given in terms of transition energies.

uPA/uPAR system activation drives a glycolytic phenotype in melanoma cells.

Science.gov (United States)

Laurenzana, Anna; Chillà, Anastasia; Luciani, Cristina; Peppicelli, Silvia; Biagioni, Alessio; Bianchini, Francesca; Tenedini, Elena; Torre, Eugenio; Mocali, Alessandra; Calorini, Lido; Margheri, Francesca; Fibbi, Gabriella; Del Rosso, Mario

2017-09-15

In this manuscript, we show the involvement of the uPA/uPAR system in the regulation of aerobic glycolysis of melanoma cells. uPAR over-expression in human melanoma cells controls an invasive and glycolytic phenotype in normoxic conditions. uPAR down-regulation by siRNA or its uncoupling from integrins, and hence from integrin-linked tyrosine kinase receptors (IL-TKRs), by an antagonist peptide induced a striking inhibition of the PI3K/AKT/mTOR/HIF1α pathway, resulting into impairment of glucose uptake, decrease of several glycolytic enzymes and of PKM2, a checkpoint that controls metabolism of cancer cells. Further, binding of uPA to uPAR regulates expression of molecules that govern cell invasion, including extracellular matrix metallo-proteinases inducer (EMPPRIN) and enolase, a glycolytyc enzyme that also serves as a plasminogen receptor, thus providing a common denominator between tumor metabolism and phenotypic invasive features. Such effects depend on the α5β1-integrin-mediated uPAR connection with EGFR in melanoma cells with engagement of the PI3K-mTOR-HIFα pathway. HIF-1α trans-activates genes whose products mediate tumor invasion and glycolysis, thus providing the common denominator between melanoma metabolism and its invasive features. These findings unveil a unrecognized interaction between the invasion-related uPAR and IL-TKRs in the control of glycolysis and disclose a new pharmacological target (i.e., uPAR/IL-TKRs axis) for the therapy of melanoma. © 2017 UICC.

Bruksizam u djece

OpenAIRE

Crnić, Kristina

2017-01-01

Bruksizam se definira kao parafunkcijsko škripanje ili stiskanje zubima. Etiologija je nejasna, ali se danas smatra da postoji više uzročnih faktora. Među primarnim faktorima smatra se psihološki stres djeteta. Postoji manjak informacija o bruksizmu u djece zbog komplikacija provođenja istraživanja jer su ispitanici maloljetnici. Razne su metode koje se koriste u dijagnozi bruksizma. Uključuju stručno konstruirane upitnike i intervjue namijenjene i djeci i roditeljima te klinički pregled ...

A contribution to the kinetic study of the metatectic reaction U+U{sub 3}Si{sub 2}{yields}U{sub 3}Si; Contribucion al Estudio cinetico de la Reaccion Metatectica U+U{sub 3}Si{sub 2} U{sub 3}Si

Energy Technology Data Exchange (ETDEWEB)

Arroyo Ruiperez, J; Esteban Hernandez, J A

1962-07-01

An experimental study has been made to decide upon the advantages and drawbacks of the different methods and reagents employed in the metallography of U-Si alloys. It has been observed that all samples thermally treated to form the epsilon-phase undergo from the beginning a coalescence of the U{sub 3}Si{sub 2} particles, which makes practically useless any fine state of dispersion that might be present originally, as recommended by some authors. The coalescence of the U{sub 3}Si{sub 2} particle decreases the surface available for reaction and consequently the reaction rate. (Author) 7 refs.

Periodic light variations of young stars U X Orion and S U Auriga

International Nuclear Information System (INIS)

Minikulov, N.Kh.; Abdulloev, S.Kh.

2007-01-01

The light curves of young variable stars U X Orion and S U Auriga are created from archive data of Institute of Astrophysics of the Academy of Sciences of the Republic of Tajikistan and other sources. It is established that periodic light variations of young stars U X Orion and S U Auriga occurs to duration of 36.4 and 29.8 years, accordingly. It is supposed that such periodic light variations are connected with existence a planetary system around these stars

Pusaudžu trauksmes, pašcieņas un viņu māšu audzināšanas stilu saistība.

OpenAIRE

Valere, Linda

2007-01-01

Bakalaura darba tēma ir „Pusaudžu trauksmes, pašcieņas un viņu māšu audzināšanas stilu saistība”. Pusaudžu trauksme ir ļoti aktuāla problēma. Trauksmes traucējumu izplatība pusaudžiem svārstās no 12% līdz 17,3 % (Vasey & Ollendick, 2000 kā minēts Fraire, 2006), un tie rada lielu risku atkārtotiem trauksmes traucējumiem jau pieaugušā vecumā (Pine, Cohen, Gurley, Brook & Ma, 1998). Pētījuma mērķis ir noskaidrot, vai pastāv saistība starp pusaudžu trauksmi, pašcieņu un viņu māšu audzināšanas sti...

238U, 234U and 230Th in uranium miners' lungs

International Nuclear Information System (INIS)

Singh, N.P.; Wrenn, M.E.; Bennett, D.B.; Archer, V.; Saccomanno, G.

1982-01-01

Fourteen uranium miners' lungs from the Colorado Plateau were collected at autopsy and the concentrations of 238 U, 234 U and 230 Th were determined by radiochemical procedures utilizing solvent extraction and alpha spectrometric techniques. The uranium and thorium isotopes are in near equilibrium with average concentrations of 238 U, 234 U and 230 Th being 89.3, 95.2, and 91.1 pCi/kg respectively. The combined average radiation dose rate to lung from these three isotopes is about 24.1 mrad/year at death excluding the unmeasured contribution from the 226 Ra and daughters. The average concentration of 230 Th is about 65 times higher than the mean concentration of 230 Th in lungs of non-miners from the same region dying at comparable ages

Nu2U

DEFF Research Database (Denmark)

Sørensen, Hans Eibe; Williamson, Trevor

Abstract In September 2014, nine months after launching a major growth opportunity, Jenny Dunne, managing director of Nu2U, called for an extraordinary status meeting with her COO and CMO. A fast-growing online retailer of refurbished household appliances, Nu2U planned to acquire market share...... by improving internal logistics and delivery services, aided by a new, fully integrated software system. The company's gross profit had been increasing steadily, but recent accounts revealed a fall in net profit margins. It became apparent that implementation of the business plan for the project...... was problematic because of loose governance and poor communication across Nu2U's different specialist functions during planning and implementation. The Nu2U case illustrates how executives' cognition and span of control/overview may be hampered in fast-growing firms and how this ...

Uranium ((234)U, (235)U and (238)U) contamination of the environment surrounding phosphogypsum waste heap in Wiślinka (northern Poland).

Science.gov (United States)

Olszewski, Grzegorz; Boryło, Alicja; Skwarzec, Bogdan

2015-08-01

The aim of this work was to determine the uranium concentration ((234)U, (235)U and (238)U) and values of the activity ratio (234)U/(238)U in soil samples collected near phosphogypsum waste heap in Wiślinka (northern Poland). On the basis of the studies it was found that the values of the (234)U/(238)U activity ratio in the analyzed soils collected in the vicinity of phosphogypsum dump in Wiślinka are in most cases close to one and indicate the phosphogypsum origin of the analyzed nuclides. The obtained results of uranium concentrations are however much lower than in previous years before closing of the phosphogypsum stockpile. After this process and covering the phosphogypsum stockpile in Wiślinka with sewage sludge, phosphogypsum particles are successfully immobilized. In the light of the results the use of phosphate fertilizers seems to be a major problem. Prolonged and heavy rains can cause leaching accumulated uranium isotopes in the phosphogypsum stockpile, which will be washed into the Martwa Wisła and on the fields in the immediate vicinity of this storage. Copyright © 2015 Elsevier Ltd. All rights reserved.

U(VI) sorption on kaolinite. Effects of pH, U(VI) concentration and oxyanions

International Nuclear Information System (INIS)

Liang Gao; Ziqian Yang; Keliang Shi; Xuefeng Wang; Zhijun Guo; Wangsuo Wu

2010-01-01

U(VI) sorption on kaolinite was studied as functions of contact time, pH, U(VI) concentration, solid-to-liquid ratio (m/V) by using a batch experimental method. The effects of sulfate and phosphate on U(VI) sorption were also investigated. It was found that the sorption kinetics of U(VI) can be described by a pseudo-second-order model. Potentiometric titrations at variable ionic strengths indicated that the titration curves of kaolinite were not sensitive to ionic strength, and that the pH of the zero net proton charge (pH PZNPC ) was at 6.9. The sorption of U(VI) on kaolinite increased with pH up to 6.5 and reached a plateau at pH >6.5. The presence of phosphate strongly increased U(VI) sorption especially at pH <5.5, which may be due to formation of ternary surface complexes involving phosphate. In contrast, the presence of sulfate did not cause any apparent effect on U(VI) sorption. A double layer model was used to interpret both results of potentiometric titrations and U(VI) sorption on kaolinite. (author)

Ground water contamination with (238)U, (234)U, (235)U, (226)Ra and (210)Pb from past uranium mining: cove wash, Arizona.

Science.gov (United States)

Dias da Cunha, Kenya Moore; Henderson, Helenes; Thomson, Bruce M; Hecht, Adam A

2014-06-01

The objectives of the study are to present a critical review of the (238)U, (234)U, (235)U, (226)Ra and (210)Pb levels in water samples from the EPA studies (U.S. EPA in Abandoned uranium mines and the Navajo Nation: Red Valley chapter screening assessment report. Region 9 Superfund Program, San Francisco, 2004, Abandoned uranium mines and the Navajo Nation: Northern aum region screening assessment report. Region 9 Superfund Program, San Francisco, 2006, Health and environmental impacts of uranium contamination, 5-year plan. Region 9 Superfund Program, San Franciso, 2008) and the dose assessment for the population due to ingestion of water containing (238)U and (234)U. The water quality data were taken from Sect. "Data analysis" of the published report, titled Abandoned Uranium Mines Project Arizona, New Mexico, Utah-Navajo Lands 1994-2000, Project Atlas. Total uranium concentration was above the maximum concentration level for drinking water (7.410-1 Bq/L) in 19 % of the water samples, while (238)U and (234)U concentrations were above in 14 and 17 % of the water samples, respectively. (226)Ra and (210)Pb concentrations in water samples were in the range of 3.7 × 10(-1) to 5.55 × 102 Bq/L and 1.11 to 4.33 × 102 Bq/L, respectively. For only two samples, the (226)Ra concentrations exceeded the MCL for total Ra for drinking water (0.185 Bq/L). However, the (210)Pb/(226)Ra ratios varied from 0.11 to 47.00, and ratios above 1.00 were observed in 71 % of the samples. Secular equilibrium of the natural uranium series was not observed in the data record for most of the water samples. Moreover, the (235)U/(total)U mass ratios ranged from 0.06 to 5.9 %, and the natural mass ratio of (235)U to (total)U (0.72 %) was observed in only 16 % of the water samples, ratios above or below the natural ratio could not be explained based on data reported by U.S. EPA. In addition, statistical evaluations showed no correlations among the distribution of the radionuclide concentrations

Investigating Uranium Mobility Using Stable Isotope Partitioning of 238U/235U and a Reactive Transport Model

Science.gov (United States)

Bizjack, M.; Johnson, T. M.; Druhan, J. L.; Shiel, A. E.

2015-12-01

We report a numerical reactive transport model which explicitly incorporates the effectively stable isotopes of uranium (U) and the factors that influence their partitioning in bioactive systems. The model reproduces trends observed in U isotope ratios and concentration measurements from a field experiment, thereby improving interpretations of U isotope ratios as a tracer for U reactive transport. A major factor contributing to U storage and transport is its redox state, which is commonly influenced by the availability of organic carbon to support metal-reducing microbial communities. Both laboratory and field experiments have demonstrated that biogenic reduction of U(VI) fractionates the stable isotope ratio 238U/235U, producing an isotopically heavy solid U(IV) product. It has also been shown that other common reactive transport processes involving U do not fractionate isotopes to a consistently measurable level, which suggests the capacity to quantify the extent of bioreduction occurring in groundwater containing U using 238U/235U ratios. A recent study of a U bioremediation experiment at the Rifle IFRC site (Colorado, USA) applied Rayleigh distillation models to quantify U stable isotope fractionation observed during acetate amendment. The application of these simplified models were fit to the observations only by invoking a "memory-effect," or a constant source of low-concentration, unfractionated U(VI). In order to more accurately interpret the measured U isotope ratios, we present a multi-component reactive transport model using the CrunchTope software. This approach is capable of quantifying the cycling and partitioning of individual U isotopes through a realistic network of transport and reaction pathways including reduction, oxidation, and microbial growth. The model incorporates physical heterogeneity of the aquifer sediments through zones of decreased permeability, which replicate the observed bromide tracer, major ion chemistry, U concentration, and U

Enzymatic reduction of U(VI) in groundwaters; Reduction enzymatique de U(VI) dans des eaux souterraines

Energy Technology Data Exchange (ETDEWEB)

Addelouas, A.; Gong, W. [Center for Radioactive Waste Management, Advanced Materials Laboratory, 1001 University, Albuquerque (United States); Lutze, W.; Nuttall, E. [New Mexico Univ., Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Fritz, B.; Crovisier, J.L. [Centre National de la Recherche Scientifique (CNRS), 67 - Strasbourg (France). Centre de Sedimentologie et Geochimie de la Surface

1999-03-01

The use of enzymatic reduction of U(VI) in remediation of groundwater contaminated with U(VI) is receiving considerable attention. Certain strains of bacteria can combine the oxidation of an organic compound to the reduction of U(VI) to U(IV), which precipitates as uraninite. In the present study, we tested the reduction of U(VI) in groundwaters with various origins and compositions. In all groundwaters u(VI) was reduced by sulfate reducing bacteria that had been activated by ethanol and tri-metaphosphate. The reduction rate of U(VI) depends on sulfate concentration in water and the abundance of bacteria in the system. This work shows that bacteria capable of U(VI) reduction are ubiquitous in nature, and suggests the possibility of a large application of the enzymatic reduction of U(VI) for in situ clean up of groundwaters contaminated with uranium. (authors) 12 refs.

International Aviation: Competition Issues in the U.S. - U.K. Market

Science.gov (United States)

1997-06-04

Access to London's Heathrow Airport is important to any airline that desires to : be a major participant in the transatlantic market. Current U.S. bilateral : aviation agreement with the United Kingdom restricts the number of U.S. airlines : that can...

Isothermal section of diagram of U-Mo-B and U-Re-B systems

International Nuclear Information System (INIS)

Val'ovka, I.P.; Kuz'ma, Yu.B.

1986-01-01

The methods of X-ray analysis are used to study the U-Mo-B and U-Re-B systems and to plot phase equilibrium diagrams at 1000 and 800 deg C, respectively. A formation of boride UMoB 4 (structure of the ThMoB 4 type) is confirmed in the U-Mo-B system and new compounds are found: U 2 MoB 6 (rhombic structure of the Y 2 ReB 6 type, a=0.9301(9), b=1.1434(11), c=0.3678(4) nm), ∼UMo 2 B 6 and ∼ UMo 4 B 4 with unknown structures. In the U-Re-B system besides previously known boride UReB 4 (the ThMoB 4 structure type), new ones are obtained: U 2 ReB 6 (Y 2 ReB 6 type, a=0.9373(9), b=1.1529(13), c0.3653(4) nm) and UReB 3 (hexagonal structure of the proper type, a=0.5083(1), c=0.5095(1) nm)

Azimuthal Anisotropy in U +U and Au +Au Collisions at RHIC

Science.gov (United States)

Adamczyk, L.; Adkins, J. K.; Agakishiev, G.; Aggarwal, M. M.; Ahammed, Z.; Alekseev, I.; Alford, J.; Aparin, A.; Arkhipkin, D.; Aschenauer, E. C.; Averichev, G. S.; Banerjee, A.; Bellwied, R.; Bhasin, A.; Bhati, A. K.; Bhattarai, P.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Bordyuzhin, I. G.; Bouchet, J.; Brandin, A. V.; Bunzarov, I.; Burton, T. P.; Butterworth, J.; Caines, H.; Calderón de la Barca Sánchez, M.; Campbell, J. M.; Cebra, D.; Cervantes, M. C.; Chakaberia, I.; Chaloupka, P.; Chang, Z.; Chattopadhyay, S.; Chen, J. H.; Chen, X.; Cheng, J.; Cherney, M.; Christie, W.; Contin, G.; Crawford, H. J.; Das, S.; De Silva, L. C.; Debbe, R. R.; Dedovich, T. G.; Deng, J.; Derevschikov, A. A.; di Ruzza, B.; Didenko, L.; Dilks, C.; Dong, X.; Drachenberg, J. L.; Draper, J. E.; Du, C. M.; Dunkelberger, L. E.; Dunlop, J. C.; Efimov, L. G.; Engelage, J.; Eppley, G.; Esha, R.; Evdokimov, O.; Eyser, O.; Fatemi, R.; Fazio, S.; Federic, P.; Fedorisin, J.; Feng, Z.; Filip, P.; Fisyak, Y.; Flores, C. E.; Fulek, L.; Gagliardi, C. A.; Garand, D.; Geurts, F.; Gibson, A.; Girard, M.; Greiner, L.; Grosnick, D.; Gunarathne, D. S.; Guo, Y.; Gupta, S.; Gupta, A.; Guryn, W.; Hamad, A.; Hamed, A.; Haque, R.; Harris, J. W.; He, L.; Heppelmann, S.; Heppelmann, S.; Hirsch, A.; Hoffmann, G. W.; Hofman, D. J.; Horvat, S.; Huang, H. Z.; Huang, B.; Huang, X.; Huck, P.; Humanic, T. J.; Igo, G.; Jacobs, W. W.; Jang, H.; Jiang, K.; Judd, E. G.; Kabana, S.; Kalinkin, D.; Kang, K.; Kauder, K.; Ke, H. W.; Keane, D.; Kechechyan, A.; Khan, Z. H.; Kikola, D. P.; Kisel, I.; Kisiel, A.; Koetke, D. D.; Kollegger, T.; Kosarzewski, L. K.; Kotchenda, L.; Kraishan, A. F.; Kravtsov, P.; Krueger, K.; Kulakov, I.; Kumar, L.; Kycia, R. A.; Lamont, M. A. C.; Landgraf, J. M.; Landry, K. D.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, J. H.; Li, W.; Li, Y.; Li, C.; Li, Z. M.; Li, X.; Li, X.; Lisa, M. A.; Liu, F.; Ljubicic, T.; Llope, W. J.; Lomnitz, M.; Longacre, R. S.; Luo, X.; Ma, L.; Ma, R.; Ma, Y. G.; Ma, G. L.; Magdy, N.; Majka, R.; Manion, A.; Margetis, S.; Markert, C.; Masui, H.; Matis, H. S.; McDonald, D.; Meehan, K.; Minaev, N. G.; Mioduszewski, S.; Mohanty, B.; Mondal, M. M.; Morozov, D. A.; Mustafa, M. K.; Nandi, B. K.; Nasim, Md.; Nayak, T. K.; Nigmatkulov, G.; Nogach, L. V.; Noh, S. Y.; Novak, J.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Oh, K.; Okorokov, V.; Olvitt, D. L.; Page, B. S.; Pak, R.; Pan, Y. X.; Pandit, Y.; Panebratsev, Y.; Pawlik, B.; Pei, H.; Perkins, C.; Peterson, A.; Pile, P.; Planinic, M.; Pluta, J.; Poljak, N.; Poniatowska, K.; Porter, J.; Posik, M.; Poskanzer, A. M.; Pruthi, N. K.; Putschke, J.; Qiu, H.; Quintero, A.; Ramachandran, S.; Raniwala, S.; Raniwala, R.; Ray, R. L.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Roy, A.; Ruan, L.; Rusnak, J.; Rusnakova, O.; Sahoo, N. R.; Sahu, P. K.; Sakrejda, I.; Salur, S.; Sandweiss, J.; Sarkar, A.; Schambach, J.; Scharenberg, R. P.; Schmah, A. M.; Schmidke, W. B.; Schmitz, N.; Seger, J.; Seyboth, P.; Shah, N.; Shahaliev, E.; Shanmuganathan, P. V.; Shao, M.; Sharma, B.; Sharma, M. K.; Shen, W. Q.; Shi, S. S.; Shou, Q. Y.; Sichtermann, E. P.; Sikora, R.; Simko, M.; Skoby, M. J.; Smirnov, D.; Smirnov, N.; Song, L.; Sorensen, P.; Spinka, H. M.; Srivastava, B.; Stanislaus, T. D. S.; Stepanov, M.; Stock, R.; Strikhanov, M.; Stringfellow, B.; Sumbera, M.; Summa, B. J.; Sun, X.; Sun, X. M.; Sun, Z.; Sun, Y.; Surrow, B.; Svirida, D. N.; Szelezniak, M. A.; Tang, Z.; Tang, A. H.; Tarnowsky, T.; Tawfik, A. N.; Thomas, J. H.; Timmins, A. R.; Tlusty, D.; Tokarev, M.; Trentalange, S.; Tribble, R. E.; Tribedy, P.; Tripathy, S. K.; Trzeciak, B. A.; Tsai, O. D.; Ullrich, T.; Underwood, D. G.; Upsal, I.; Van Buren, G.; van Nieuwenhuizen, G.; Vandenbroucke, M.; Varma, R.; Vasiliev, A. N.; Vertesi, R.; Videbaek, F.; Viyogi, Y. P.; Vokal, S.; Voloshin, S. A.; Vossen, A.; Wang, F.; Wang, Y.; Wang, H.; Wang, J. S.; Wang, Y.; Wang, G.; Webb, G.; Webb, J. C.; Wen, L.; Westfall, G. D.; Wieman, H.; Wissink, S. W.; Witt, R.; Wu, Y. F.; Xiao, Z.; Xie, W.; Xin, K.; Xu, Y. F.; Xu, N.; Xu, Z.; Xu, Q. H.; Xu, H.; Yang, Y.; Yang, Y.; Yang, C.; Yang, S.; Yang, Q.; Ye, Z.; Yepes, P.; Yi, L.; Yip, K.; Yoo, I.-K.; Yu, N.; Zbroszczyk, H.; Zha, W.; Zhang, X. P.; Zhang, J. B.; Zhang, J.; Zhang, Z.; Zhang, S.; Zhang, Y.; Zhang, J. L.; Zhao, F.; Zhao, J.; Zhong, C.; Zhou, L.; Zhu, X.; Zoulkarneeva, Y.; Zyzak, M.; STAR Collaboration

2015-11-01

Collisions between prolate uranium nuclei are used to study how particle production and azimuthal anisotropies depend on initial geometry in heavy-ion collisions. We report the two- and four-particle cumulants, v2{2 } and v2{4 }, for charged hadrons from U +U collisions at √{sNN }=193 GeV and Au +Au collisions at √{sNN}=200 GeV . Nearly fully overlapping collisions are selected based on the energy deposited by spectators in zero degree calorimeters (ZDCs). Within this sample, the observed dependence of v2{2 } on multiplicity demonstrates that ZDC information combined with multiplicity can preferentially select different overlap configurations in U +U collisions. We also show that v2 vs multiplicity can be better described by models, such as gluon saturation or quark participant models, that eliminate the dependence of the multiplicity on the number of binary nucleon-nucleon collisions.

Azimuthal Anisotropy in U+U and Au+Au Collisions at RHIC.

Science.gov (United States)

Adamczyk, L; Adkins, J K; Agakishiev, G; Aggarwal, M M; Ahammed, Z; Alekseev, I; Alford, J; Aparin, A; Arkhipkin, D; Aschenauer, E C; Averichev, G S; Banerjee, A; Bellwied, R; Bhasin, A; Bhati, A K; Bhattarai, P; Bielcik, J; Bielcikova, J; Bland, L C; Bordyuzhin, I G; Bouchet, J; Brandin, A V; Bunzarov, I; Burton, T P; Butterworth, J; Caines, H; Calderón de la Barca Sánchez, M; Campbell, J M; Cebra, D; Cervantes, M C; Chakaberia, I; Chaloupka, P; Chang, Z; Chattopadhyay, S; Chen, J H; Chen, X; Cheng, J; Cherney, M; Christie, W; Contin, G; Crawford, H J; Das, S; De Silva, L C; Debbe, R R; Dedovich, T G; Deng, J; Derevschikov, A A; di Ruzza, B; Didenko, L; Dilks, C; Dong, X; Drachenberg, J L; Draper, J E; Du, C M; Dunkelberger, L E; Dunlop, J C; Efimov, L G; Engelage, J; Eppley, G; Esha, R; Evdokimov, O; Eyser, O; Fatemi, R; Fazio, S; Federic, P; Fedorisin, J; Feng, Z; Filip, P; Fisyak, Y; Flores, C E; Fulek, L; Gagliardi, C A; Garand, D; Geurts, F; Gibson, A; Girard, M; Greiner, L; Grosnick, D; Gunarathne, D S; Guo, Y; Gupta, S; Gupta, A; Guryn, W; Hamad, A; Hamed, A; Haque, R; Harris, J W; He, L; Heppelmann, S; Heppelmann, S; Hirsch, A; Hoffmann, G W; Hofman, D J; Horvat, S; Huang, H Z; Huang, B; Huang, X; Huck, P; Humanic, T J; Igo, G; Jacobs, W W; Jang, H; Jiang, K; Judd, E G; Kabana, S; Kalinkin, D; Kang, K; Kauder, K; Ke, H W; Keane, D; Kechechyan, A; Khan, Z H; Kikola, D P; Kisel, I; Kisiel, A; Koetke, D D; Kollegger, T; Kosarzewski, L K; Kotchenda, L; Kraishan, A F; Kravtsov, P; Krueger, K; Kulakov, I; Kumar, L; Kycia, R A; Lamont, M A C; Landgraf, J M; Landry, K D; Lauret, J; Lebedev, A; Lednicky, R; Lee, J H; Li, W; Li, Y; Li, C; Li, Z M; Li, X; Li, X; Lisa, M A; Liu, F; Ljubicic, T; Llope, W J; Lomnitz, M; Longacre, R S; Luo, X; Ma, L; Ma, R; Ma, Y G; Ma, G L; Magdy, N; Majka, R; Manion, A; Margetis, S; Markert, C; Masui, H; Matis, H S; McDonald, D; Meehan, K; Minaev, N G; Mioduszewski, S; Mohanty, B; Mondal, M M; Morozov, D A; Mustafa, M K; Nandi, B K; Nasim, Md; Nayak, T K; Nigmatkulov, G; Nogach, L V; Noh, S Y; Novak, J; Nurushev, S B; Odyniec, G; Ogawa, A; Oh, K; Okorokov, V; Olvitt, D L; Page, B S; Pak, R; Pan, Y X; Pandit, Y; Panebratsev, Y; Pawlik, B; Pei, H; Perkins, C; Peterson, A; Pile, P; Planinic, M; Pluta, J; Poljak, N; Poniatowska, K; Porter, J; Posik, M; Poskanzer, A M; Pruthi, N K; Putschke, J; Qiu, H; Quintero, A; Ramachandran, S; Raniwala, S; Raniwala, R; Ray, R L; Ritter, H G; Roberts, J B; Rogachevskiy, O V; Romero, J L; Roy, A; Ruan, L; Rusnak, J; Rusnakova, O; Sahoo, N R; Sahu, P K; Sakrejda, I; Salur, S; Sandweiss, J; Sarkar, A; Schambach, J; Scharenberg, R P; Schmah, A M; Schmidke, W B; Schmitz, N; Seger, J; Seyboth, P; Shah, N; Shahaliev, E; Shanmuganathan, P V; Shao, M; Sharma, B; Sharma, M K; Shen, W Q; Shi, S S; Shou, Q Y; Sichtermann, E P; Sikora, R; Simko, M; Skoby, M J; Smirnov, D; Smirnov, N; Song, L; Sorensen, P; Spinka, H M; Srivastava, B; Stanislaus, T D S; Stepanov, M; Stock, R; Strikhanov, M; Stringfellow, B; Sumbera, M; Summa, B J; Sun, X; Sun, X M; Sun, Z; Sun, Y; Surrow, B; Svirida, D N; Szelezniak, M A; Tang, Z; Tang, A H; Tarnowsky, T; Tawfik, A N; Thomas, J H; Timmins, A R; Tlusty, D; Tokarev, M; Trentalange, S; Tribble, R E; Tribedy, P; Tripathy, S K; Trzeciak, B A; Tsai, O D; Ullrich, T; Underwood, D G; Upsal, I; Van Buren, G; van Nieuwenhuizen, G; Vandenbroucke, M; Varma, R; Vasiliev, A N; Vertesi, R; Videbaek, F; Viyogi, Y P; Vokal, S; Voloshin, S A; Vossen, A; Wang, F; Wang, Y; Wang, H; Wang, J S; Wang, Y; Wang, G; Webb, G; Webb, J C; Wen, L; Westfall, G D; Wieman, H; Wissink, S W; Witt, R; Wu, Y F; Xiao, Z; Xie, W; Xin, K; Xu, Y F; Xu, N; Xu, Z; Xu, Q H; Xu, H; Yang, Y; Yang, Y; Yang, C; Yang, S; Yang, Q; Ye, Z; Yepes, P; Yi, L; Yip, K; Yoo, I-K; Yu, N; Zbroszczyk, H; Zha, W; Zhang, X P; Zhang, J B; Zhang, J; Zhang, Z; Zhang, S; Zhang, Y; Zhang, J L; Zhao, F; Zhao, J; Zhong, C; Zhou, L; Zhu, X; Zoulkarneeva, Y; Zyzak, M

2015-11-27

Collisions between prolate uranium nuclei are used to study how particle production and azimuthal anisotropies depend on initial geometry in heavy-ion collisions. We report the two- and four-particle cumulants, v_{2}{2} and v_{2}{4}, for charged hadrons from U+U collisions at sqrt[s_{NN}]=193  GeV and Au+Au collisions at sqrt[s_{NN}]=200  GeV. Nearly fully overlapping collisions are selected based on the energy deposited by spectators in zero degree calorimeters (ZDCs). Within this sample, the observed dependence of v_{2}{2} on multiplicity demonstrates that ZDC information combined with multiplicity can preferentially select different overlap configurations in U+U collisions. We also show that v_{2} vs multiplicity can be better described by models, such as gluon saturation or quark participant models, that eliminate the dependence of the multiplicity on the number of binary nucleon-nucleon collisions.

Colorimetric on-line control of U

International Nuclear Information System (INIS)

Perez, J.J.; Boisde, G.; Dedaldechamp, P.; Dureault, B.

The instrumentation developed for the automatic colorimetric control of U is presented. Two techniques are used: absorptiometry of U ions using optical probes enabling to measure in situ the solutions containing 0.5 g U(IV)/l or 1 g U(VI)/l; colorimetry of the U-DBM complexe after separation of U by TOPO (this technique is applied to the control of U at the ppm level). The automatic devices used are described. They are experimented in laboratory or in pilot-plant [fr

Žalba u upravnom sporu

OpenAIRE

Đerđa, Dario; Galić, Ante

2014-01-01

U radu se razmatra uvođenje dvostupanjskog sustava upravnog sudovanja u Hrvatskoj 2010. godine. Utvrđuje se potreba uvođenja žalbe u upravnosudski sustav te se pojedinačno analiziraju ograničenja vezana uz ovaj institut. Najprije se razmatra ograničenje izjavljivanja žalbe protiv rješenja, zatim stavljanje nekih prvostupanjskih upravnih sporova u nadležnost Visokog upravnog suda Republike Hrvatske te, konačno, ograničenja izjavljivanja žalbe na neke vrste presuda upravnih sudova. Nadalje se u...

Optogalvanic measurement of isotope shifts of doubly ionized uranium (U III) made using natural-U samples

International Nuclear Information System (INIS)

Piyakis, K.N.; Gagne, J.

1989-01-01

An efficient method of identifying 235 U III (in natural-U samples), with the help of the optogalvanic effect in a hollow-cathode discharge, is presented. The use of this method enabled us to carry out the measurement of isotope shifts and the preliminary investigation of hyperfine structures of U III. The 238 U-- 235 U shifts for the 591.313-, 586.045-, and 610.497-nm U III lines are found to be 921(3), 417(6), and 392(12) mK, respectively

Theoretical modeling of the uranium 4f XPS for U(VI) and U(IV) oxides

Energy Technology Data Exchange (ETDEWEB)

Bagus, Paul S. [Department of Chemistry, University of North Texas, Denton, Texas 76203-5017 (United States); Nelin, Connie J. [Consulting and Services, 6008 Maury' s Trail, Austin, Texas 78730 (United States); Ilton, Eugene S. [Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

2013-12-28

A rigorous study is presented of the physical processes related to X-Ray photoelectron spectroscopy, XPS, in the 4f level of U oxides, which, as well as being of physical interest in themselves, are representative of XPS in heavy metal oxides. In particular, we present compelling evidence for a new view of the screening of core-holes that extends prior understandings. Our analysis of the screening focuses on the covalent mixing of high lying U and O orbitals as opposed to the, more common, use of orbitals that are nominally pure U or pure O. It is shown that this covalent mixing is quite different for the initial and final, core-hole, configurations and that this difference is directly related to the XPS satellite intensity. Furthermore, we show that the high-lying U d orbitals as well as the U(5f) orbital may both contribute to the core-hole screening, in contrast with previous work that has only considered screening through the U(5f) shell. The role of modifying the U-O interaction by changing the U-O distance has been investigated and an unexpected correlation between U-O distance and XPS satellite intensity has been discovered. The role of flourite and octahedral crystal structures for U(IV) oxides has been examined and relationships established between XPS features and the covalent interactions in the different structures. The physical views of XPS satellites as arising from shake processes or as arising from ligand to metal charge transfers are contrasted; our analysis provides strong support that shake processes give a more fundamental physical understanding than charge transfer. Our theoretical studies are based on rigorous, strictly ab initio determinations of the electronic structure of embedded cluster models of U oxides with formal U(VI) and U(IV) oxidation states. Our results provide a foundation that makes it possible to establish quantitative relationships between features of the XPS spectra and materials properties.

Theoretical modeling of the uranium 4f XPS for U(VI) and U(IV) oxides

Science.gov (United States)

Bagus, Paul S.; Nelin, Connie J.; Ilton, Eugene S.

2013-12-01

A rigorous study is presented of the physical processes related to X-Ray photoelectron spectroscopy, XPS, in the 4f level of U oxides, which, as well as being of physical interest in themselves, are representative of XPS in heavy metal oxides. In particular, we present compelling evidence for a new view of the screening of core-holes that extends prior understandings. Our analysis of the screening focuses on the covalent mixing of high lying U and O orbitals as opposed to the, more common, use of orbitals that are nominally pure U or pure O. It is shown that this covalent mixing is quite different for the initial and final, core-hole, configurations and that this difference is directly related to the XPS satellite intensity. Furthermore, we show that the high-lying U d orbitals as well as the U(5f) orbital may both contribute to the core-hole screening, in contrast with previous work that has only considered screening through the U(5f) shell. The role of modifying the U-O interaction by changing the U-O distance has been investigated and an unexpected correlation between U-O distance and XPS satellite intensity has been discovered. The role of flourite and octahedral crystal structures for U(IV) oxides has been examined and relationships established between XPS features and the covalent interactions in the different structures. The physical views of XPS satellites as arising from shake processes or as arising from ligand to metal charge transfers are contrasted; our analysis provides strong support that shake processes give a more fundamental physical understanding than charge transfer. Our theoretical studies are based on rigorous, strictly ab initio determinations of the electronic structure of embedded cluster models of U oxides with formal U(VI) and U(IV) oxidation states. Our results provide a foundation that makes it possible to establish quantitative relationships between features of the XPS spectra and materials properties.

IAEA CIELO Evaluation of Neutron-induced Reactions on 235U and 238U Targets

Science.gov (United States)

Capote, R.; Trkov, A.; Sin, M.; Pigni, M. T.; Pronyaev, V. G.; Balibrea, J.; Bernard, D.; Cano-Ott, D.; Danon, Y.; Daskalakis, A.; Goričanec, T.; Herman, M. W.; Kiedrowski, B.; Kopecky, S.; Mendoza, E.; Neudecker, D.; Leal, L.; Noguere, G.; Schillebeeckx, P.; Sirakov, I.; Soukhovitskii, E. S.; Stetcu, I.; Talou, P.

2018-02-01

Evaluations of nuclear reaction data for the major uranium isotopes 238U and 235U were performed within the scope of the CIELO Project on the initiative of the OECD/NEA Data Bank under Working Party on Evaluation Co-operation (WPEC) Subgroup 40 coordinated by the IAEA Nuclear Data Section. Both the mean values and covariances are evaluated from 10-5 eV up to 30 MeV. The resonance parameters of 238U and 235U were re-evaluated with the addition of newly available data to the existing experimental database. The evaluations in the fast neutron range are based on nuclear model calculations with the code EMPIRE-3.2 Malta above the resonance range up to 30 MeV. 235U(n,f), 238U(n,f), and 238U(n,γ) cross sections and 235U(nth,f) prompt fission neutron spectrum (PFNS) were evaluated within the Neutron Standards project and are representative of the experimental state-of-the-art measurements. The Standards cross sections were matched in model calculations as closely as possible to guarantee a good predictive power for cross sections of competing neutron scattering channels. 235U(n,γ) cross section includes fluctuations observed in recent experiments. 235U(n,f) PFNS for incident neutron energies from 500 keV to 20 MeV were measured at Los Alamos Chi-Nu facility and re-evaluated using all available experimental data. While respecting the measured differential data, several compensating errors in previous evaluations were identified and removed so that the performance in integral benchmarks was restored or improved. Covariance matrices for 235U and 238U cross sections, angular distributions, spectra and neutron multiplicities were evaluated using the GANDR system that combines experimental data with model uncertainties. Unrecognized systematic uncertainties were considered in the uncertainty quantification for fission and capture cross sections above the thermal range, and for neutron multiplicities. Evaluated files were extensively benchmarked to ensure good performance in

Review of the thermodynamics of the U--C, Pu--C, and U--Pu--C systems

International Nuclear Information System (INIS)

Tetenbaum, M.; Sheth, A.; Olson, W.

1975-06-01

Thermodynamic properties such as enthalpy, heat capacity, entropy, heat and free energy of formation, and vaporization behavior are presented for the U--C, Pu--C, and U--Pu--C systems. These properties are of interest to scientists and engineers involved in the expanding field of advanced fuel LMFBR systems. The information on these systems has been derived largely from the discussions of the IAEA Panel on the assessment of thermodynamic properties of the U--C, Pu--C, and U--Pu--C systems. (U.S.)

uPAR as anti-cancer target

DEFF Research Database (Denmark)

Lund, Ida K; Illemann, Martin; Thurison, Tine

2011-01-01

, and a potential diagnostic and predictive impact of the different uPAR forms has been reported. Hence, pericellular proteolysis seems to be a suitable target for anti-cancer therapy and numerous approaches have been pursued. Targeting of this process may be achieved by preventing the binding of uPA to u...... using mouse monoclonal antibodies (mAbs) against mouse uPA or uPAR. These reagents will target uPA and uPAR in both stromal cells and cancer cells, and their therapeutic potential can now be assessed in syngenic mouse cancer models....

Biological and Clinical Study of 6-Deoxy-6-Iodo-D-Glucose: a iodinated tracer of glucose transport and of insulin-resistance in human

International Nuclear Information System (INIS)

Barone-Rochette, Gilles

2013-01-01

Insulin resistance (IR), characterized by a depressed cellular sensitivity to insulin in insulin-sensitive organs, is a central feature to obesity, the metabolic syndrome, and diabetes mellitus and leads to increase cardiovascular diseases, particularly heart failure. All these events are today serious public health problems. But actually, there is no simple tool to measure insulin resistance. The gold standard technique remains the hyperinsulinemic euglycemic clamp. However, the complexity and length of this technique render it unsuitable for routine clinical use. Many methods or index have been proposed to assess insulin resistance in human, but none have shown enough relevance to be used in clinical use. The U1039 INSERM unit previously has validated a new tracer of glucose transport, radiolabelled with 123 iodine and has developed a fast and simple imaging protocol with a small animal gamma camera, which allows the obtaining of an IR index for each organ, showing more discriminating for the heart. The project of my thesis was the human transfer of this measurement technique, perfectly validated in animal. The first part of this thesis evaluated to tolerance, in vivo kinetics, distribution and dosimetry of novel tracer of glucose transport, the [ 123 I]-6DIG. The safeties of new tracer and measurement technique were adequate. There were no adverse effects with excellent tolerance of the whole protocol. 6DIG eliminating was fast, primarily in the urine and complete within 72 h. The effective whole-body absorbed dose for a complete scan with injection of 92.5 * 2 MBq was between 3 to 4 mSv. The second part of this thesis evaluated in human feasibility and reproducibility of the measurement technique validated in animal. The third part showed techniques used to allow human transfer of this method. The study protocol was applied on 12 subjects (healthy volunteers (n=6) and type 2 diabetic patients (n=6)). With a method adapted to measure in humans, we determined an

Dissolution behaviour of 238U, 234U and 230Th deposited on filters from personal dosemeters

International Nuclear Information System (INIS)

Beckova, V.; Malatova, I.

2008-01-01

Kinetics of dissolution of 238 U, 234 U and 230 Th dust deposited on filters from personal alpha dosemeters was studied by means of a 26-d in vitro dissolution test with a serum ultra-filtrate simulant. Dosemeters had been used by miners at the uranium mine 'Dolni Rozinka' at Rozna, Czech Republic. The sampling flow-rate as declared by the producer is 4 l h -1 and the sampling period is typically 1 month. Studied filters contained 125 ± 6 mBq 238 U in equilibrium with 234 U and 230 Th; no 232 Th series nuclides were found. Half-time of rapid dissolution of 1.4 d for 238 U and 234 U and slow dissolution half-times of 173 and 116 d were found for 238 U and 234 U, respectively. No detectable dissolution of 230 Th was found. (authors)

Multichannel interactions in the (1σ/sub g/)2(1σ/sub u/)nsσ, ndλ(3Σ+/sub u/,3Σ+/sub u/,3Pi/sub u/,3Δ/sub u/) Rydberg structures of He2

International Nuclear Information System (INIS)

Ginter, D.S.; Ginter, M.L.

1988-01-01

We show that a minimal parameter coupled channel model based on eigenquantum defect theory can reproduce quantitatively the known Rydberg structures associated with six channels of nsσ,ndλ( 3 Σ + /sub u/, 3 Σ + /sub u/, 3 Pi/sub u/, 3 Δ/sub u/) v = 0 ancestry in He 2 . Except for a few levels affected by accidental perturbations, these extensive level structures can be reproduced to within average experimental uncertainties. Previously unreported spectral analyses for transitions to the b 3 Pi/sub g/ state from rotational levels in the nl channel segments with n = 12--18 are included in this work. These spectral transitions were predicted and observed in the early stages of this investigation and were used to determine a number of new energy levels for the n = 3--18 data base used in subsequent calculations. The model uses a U matrix modified slightly from a Hund's case (b) to case (d) transformation and energy dependent eigenquantum defects μ/sub α/. Discussed in detail is a specific 14 parameter representation for ∼500 energy levels in which 2 parameters modify U to include interactions between ns and nd and 12 parameters describe the variation of the μ/sub α/'s with energy

A contribution to the kinetic study of the metatectic reaction U+U3Si2→U3Si

International Nuclear Information System (INIS)

Arroyo Ruiperez, J.; Esteban Hernandez, J. A.

1962-01-01

An experimental study has been made to decide upon the advantages and drawbacks of the different methods and reagents employed in the metallography of U-Si alloys. It has been observed that all samples thermally treated to form the epsilon-phase undergo from the beginning a coalescence of the U 3 Si 2 particles, which makes practically useless any fine state of dispersion that might be present originally, as recommended by some authors. The coalescence of the U 3 Si 2 particle decreases the surface available for reaction and consequently the reaction rate. (Author) 7 refs

Photochemistry of U(BH/sub 4/)/sub 4/ and U(BD/sub 4/)/sub 4/

Energy Technology Data Exchange (ETDEWEB)

Paine, R T; Schonberg, P R; Light, R W [New Mexico Univ., Albuquerque (USA). Dept. of Chemistry; Danen, W C; Freund, S M

1979-01-01

U(BH/sub 4/)/sub 4/ and U(BD/sub 4/)/sub 4/ are observed to undergo complex degradation reactions promoted by broadband UV radiation. The primary products of these reactions appear to be U(BH/sub 4/)/sub 3/, B/sub 2/H/sub 6/, H/sub 2/, U(BD/sub 4/)/sub 3/, B/sub 2/D/sub 6/ and D/sub 2/. Further, U(BD/sub 4/)/sub 4/ undergoes a related decomposition reaction under the influence of CO/sub 2/ laser irradiation at 924.97 cm/sup -1/.

Uranium contents and 234U/238U activity ratios of modern and fossil marine bivalle molluscan shells

International Nuclear Information System (INIS)

Mitsuda, Hiroshi

1984-01-01

Uranium contents and 234 U/ 238 U activity ratios in modern and fossil marine bivalle molluscan shells were measured by alpha-spectrometry. Uranium contents and 234 U/ 238 U activity ratios in modern shells were averaged to be 0.266 (dpm/g), and 1.18, respectively and those in fossil shells were averaged to be 0.747 (dpm/g), and 1.19, respectivily. Uranium contents in fossil shells were obviously higher than those in modern shells. It can be explained by the addition of uranium to shell during the deposition. In fossil shells, 234 U/ 238 U activity ratio decreases as 238 U content increases the same tendency is not found in modern shells. The author proposed a mechanism of selective loss of 238 U from the fossil shells for the explanation of this tendency. The height activity ratio of 234 U/ 238 U measured on the fossil shells than that measured on the modern shells, also support the selective loss of 238 U from the fossil shells. (author)

Oltar Sv. Jeronima u crkvi Sv. Šime u Zadru i radionica Bettamelli

Directory of Open Access Journals (Sweden)

Bojan Goja

2012-12-01

Full Text Available U radu se na temelju arhivskih podataka govori o oltaru Sv. Jeronima u crkvi Sv. Šime u Zadru. Od ranije se zna da je oltar dala podići i o njegovu se uređenju brinula bratovština hrvatskih i albanskih vojnika (Croatti a cavallo i Soldati Albanesi u službi Mletačke Republike, osnovana 1675. godine u Zadru. Novim je arhivskim istraživanjima utvrđeno da je dana 26. rujna 1694. godine bratovština odobrila izdatak u iznosu od 200 srebrnih dukata, namijenjenih venecijanskim klesarima braći Bettamelli kao predujam za izradu oltara te da su radovi na njegovu podizanju započeti u travnju 1696. godine. Na temelju zapisa o gradnji oltara iznijeta je pretpostavka da se grb na istočnom pilastru stipesa oltara, ranije povezivan s predstavnicima obitelji Civran, odnosi na zadarskog plemića i istaknutog zapovjednika u mletačkoj vojsci, Šimuna Fanfognu (Zadar, 7. travnja 1663. - Lendinara, 6. ožujka 1707. koji je obavljao i dužnost prokuratora oltara. Brojni radovi na uređenju oltara i kapele Sv. Jeronima obavljani su i tijekom čitavog 18. stoljeća, a na njima su bili uposleni brojni mjesni majstori različitih struka: graditelji Antonio Piovesana (1742. i Antonio Bernardini (1789., oltarist Girolamo Picco (1756., marangon Domenico Tomaselli (1743., kovač Antonelli (1744. te zlatari Zorzi Cullisich (1738., Nicolò Giurovich (1752. i Giuseppe Rado (1755.. Donose se još neke zanimljivosti vezane uz uređenje oltara i djelovanje bratovštine Sv. Jeronima.

Dissolution behaviour of 238U, 234U and 230Th deposited on filters from personal dosemeters.

Science.gov (United States)

Becková, Vera; Malátová, Irena

2008-01-01

Kinetics of dissolution of (238)U, (234)U and (230)Th dust deposited on filters from personal alpha dosemeters was studied by means of a 26-d in vitro dissolution test with a serum ultrafiltrate simulant. Dosemeters had been used by miners at the uranium mine 'Dolní Rozínka' at Rozná, Czech Republic. The sampling flow-rate as declared by the producer is 4 l h(-1) and the sampling period is typically 1 month. Studied filters contained 125 +/- 6 mBq (238)U in equilibrium with (234)U and (230)Th; no (232)Th series nuclides were found. Half-time of rapid dissolution of 1.4 d for (238)U and (234)U and slow dissolution half-times of 173 and 116 d were found for (238)U and (234)U, respectively. No detectable dissolution of (230)Th was found.

Reduction of U3O8 to U by a metallic reductant, Li

International Nuclear Information System (INIS)

Jin-Mok Hur; Sun-Seok Hong; Hansoo Lee

2010-01-01

Reduction of U 3 O 8 was investigated for the recycling of spent oxide fuel from a commercial nuclear power plant. The possible reduction methods were proposed and compared. Based on the thermodynamic analysis, Li metal was selected as a reductant. The optimum reaction temperature for the reduction of U 3 O 8 was investigated at the wider reaction temperature range. The adverse oxidation of U metal by Li 2 O at 1,000 deg C was experimentally verified. Ellingham diagram was constructed to investigate the extent of the uranium oxides reduction when the reaction was carried out above melting point of U metal. (author)

U and Th background contents in the Crimea rocks, Th/U ratio interpretation

International Nuclear Information System (INIS)

Gerasimov, Yu.G.; Voronova, M.A.; AN Ukrainskoj SSR, Kiev. Inst. Geologicheskikh Nauk)

1981-01-01

Radiogeochemical sampling of rocks in the Crimea is carried out. Analyses for U are made by luminescence method, while for Th by X-ray one. About 1000 samples, characterizing the whole stratigraphical cross section except Pz of crystalline rocks, have been analyzed. Low background values for U and Th are established; U content of 1.3-2.3 g/kg and Th content of 7.0-9.0 g/kg are predominant, that is lower than the clark of the earth crust. The distribution of radioelements in stepper and submontane Crimea is gradual, while in mountain part - the mosaic one. Results of Th/U ratios interpretation are presented [ru

Extreme fractionation of 234U 238U and 230Th 234U in spring waters, sediments, and fossils at the Pomme de Terre Valley, southwestern Missouri

Science.gov (United States)

Szabo, B. J.

1982-01-01

Isotopic fractionation as great as 1600% exists between 234U and 238U in spring waters, sediments, and fossils in the Pomme de Terre Valley, southwestern Missouri. The activity ratios of 234U 238U in five springs range from 7.2 to 16 in water which has been discharged for at least the past 30,000 years. The anomalies in 234U 238U ratio in deep water have potential usefulness in hydrologic investigations in southern Missouri. Clayey units overlying the spring bog sediments of Trolinger Spring are enriched in 230Th relative to their parent 234U by as much as 720%. The results indicate that both preferential displacement via alpha recoil ejection and the preferential emplacement via recoiling and physical entrapment are significant processes that are occurring in the geologic environment. ?? 1982.

U Ananth Kini

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. U Ananth Kini. Articles written in Resonance – Journal of Science Education. Volume 6 Issue 12 December 2001 pp 69-79 General Article. Peer-to-Peer Networking - Is this the Future of Network Computing? U Ananth Kini Samarth M Shetty · More Details Fulltext ...

A U Ubale

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. A U Ubale. Articles written in Bulletin of Materials Science. Volume 28 Issue 1 February 2005 pp 43-47 Thin Films. Preparation and study of thickness dependent electrical characteristics of zinc sulfide thin films · A U Ubale D K Kulkarni · More Details Abstract Fulltext PDF.

Izvršilne funkcije pri učencih s primanjkljaji na posameznih področjih učenja

OpenAIRE

Senekovič, Jasna

2017-01-01

V magistrskem delu z naslovom Izvršilne funkcije pri učencih s primanjkljaji na posameznih področjih učenja v prvem delu predstavljamo dosedanja spoznanja o izvršilnih funkcijah in učnih težavah v osnovni šoli, še posebej učencev s primanjkljaji na posameznih področjih učenja (PPPU). Tako smo v teoretičnem delu najprej opredelili osnovne pojme izvršilne funkcije, samoregulacija, metakognicija, učenje učenja in učne težave, posebej še primanjkljaje na posameznih področjih učenja. Podrobneje sm...

Etika u poduzetništvu

OpenAIRE

Ivančir, Monika

2018-01-01

Ovim diplomskim radom ukazuje se na problematiku današnjice glede poslovne etike. Naglasak se stavlja na etiku u poduzetništvu. Istaknuti su najčešći moralni problemi s kojima se susreću današnji poduzetnici i želi se naglasiti važnost etike u svim poslovnim odnosima i odlukama. Zadaća svakog poduzetnika, koji se želi voditi načelima etike, jest da uspostavi ravnotežu između ekonomske i društveno odgovorne strane poslovanja. Samo na taj način, na današnjem promjenjivom tržištu, poduzetnik...

Radiation-Induced Germ Cell Mutations-Their Detection and Modification.

Science.gov (United States)

1987-06-30

the zygote before or soon after implantation. Boue et. al (13) estimate that 66% of all early abortuses have chromosomal anomalies, and the...Ann. Hum. Genet. 36: 185-194, 1972. 6. Lazar, P., S. Gueguen, J. Boue and A. Boue . Epidemiologie des avortements 0 spontanes precoces: A propos de 1...469 avortements caryotypes, in: A. Boue * and C. Thibault (eds.), Les Accidents Chromosomniques de la Reproduction, .INSERM, Paris, 1973, pp. 319-331. 7

Regulation in the face of uncertainty: the evidence on electronic nicotine delivery systems (e-cigarettes)

OpenAIRE

Farsalinos, Konstantinos E; Le Houezec, Jacques

2015-01-01

Konstantinos E Farsalinos,1,2 Jacques Le Houezec3,4 1Department of Cardiology, Onassis Cardiac Surgery Center, Kallithea, 2Department of Pharmacy, University of Patras, Patras, Greece; 3Division of Epidemiology and Public Health, UK Centre for Tobacco and Alcohol Studies, University of Nottingham, Nottingham, England, UK; 4Addiction Research Unit, INSERM 1178 (Mental and Public Health), Paris, France Abstract: Tobacco smoking is the largest single preventable cause of many chronic diseases a...

Edward U Lorenz

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. Edward U Lorenz. Articles written in Resonance – Journal of Science Education. Volume 20 Issue 3 March 2015 pp 260-263 Classics. Predictability: Does the Flap of a Butterfly's Wings in Brazil Set off a Tornado in Texas? Edward U Lorenz · More Details Fulltext ...

The inflow of 234U and 238U from the River Odra drainage basin to the Baltic Sea

Directory of Open Access Journals (Sweden)

Bogdan Skwarzec

2010-12-01

Full Text Available In this study the activity of uranium isotopes 234U and 238U in Odra river water samples, collected from October 2003 to July2004, was measured using alpha spectrometry. The uranium concentrations were different in each of the seasons analysed; the lowest values were recorded in summer. In all seasons, uranium concentrations were the highest in Bystrzyca river waters (from 27.81 ± 0.29Bq m-3 of 234U and 17.82 ± 0.23 Bq m-3 of 238U in spring to 194.76 ± 3.43 Bq m-3 of 234U and 134.88 ± 2.85 Bq m-3 of 238U in summer. The lowest concentrations were noted in the Mała Panew (from 1.33 ± 0.02 Bq m-3 of 234U and 1.06 ± 0.02 Bq m-3 of 238U in spring to 3.52 ± 0.05 Bq m-3 of 234U and 2.59± 0.04 Bq m-3 of 238U in autumn. The uranium radionuclides 234U and 238U in the water samples were not in radioactive equilibrium. The 234U / 238U activity ratios were the highest in Odra water samples collected at Głogów (1.84 in autumn, and the lowest in water from the Noteć (1.03 in winter and spring. The 234U / 238U activity ratio decreases along the main stream of the Odra, owing to changes in the salinity of the river's waters. Annually, 8.19 tons of uranium (126.29 G Bq of 234U and 100.80 G Bq of 238U flow into the Szczecin Lagoon with Odra river waters.

Joint U. S. --U. S. S. R. test of U. S. MHD electrode systems in U. S. S. R. U-02 MHD facility (phase I). Final report

Energy Technology Data Exchange (ETDEWEB)

Hosler, W R [ed.

1976-01-01

The first (Phase I) joint U.S.-U.S.S.R. test of U.S. electrode materials was carried out in Moscow between September 25 and October 8, 1975 in the Soviet U-02 MHD facility. The test procedure followed closely a predetermined work plan designed to test five different zirconia based materials and the cathode and anode electrode wall modules under MHD operating conditions. The materials which were selected were 88Zr0/sub 2/-12Y/sub 2/0/sub 3/, 82Zr0/sub 2/-18Ce02, 50Zr0/sub 2/-50Ce0/sub 2/, 25Zr0/sub 2/-75Ce0/sub 2/ and 20Zr0/sub 2/-78Ce0/sub 2/-2Ta/sub 2/0/sub 5/. The electrode modules were constructed by Westinghouse Research and Development Laboratory. Each of the five electrode materials had four different current densities established between the anode and cathode during the experiment which lasted a total of 127 hours. There were four main phases in the test schedule: (1) start-up of the channel over a specific heating period. No seed (K/sub 2/C0/sub 3/) introduction - 18 hours. (2) Electrical tests at operating temperature to investigate electro-physical characteristics of the channel and electrodes - 6 hours. (3) Operating life test - 94 hours. (4) Shut-down of the channel over a specific cool down period - 9 hours. All except six electrode pairs performed satisfactorily during the entire test. These were the pairs which were designated to carry maximum or near maximum current density. Five pairs failed early in the life test and the sixth pair failed in the last several hours. Failure was not due to the electrode materials, however, but due to lead-out melting caused by joule heating in the platinum wires. The U-02 facility is described and the operational parameters are given for each phase of the test. The electrode and insulating walls are described and the appropriate parameters that are used to predict the performance of the module are given.

G U Kulkarni

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. G U Kulkarni. Articles written in Bulletin of Materials Science. Volume 24 Issue 5 October 2001 pp 515-521 Magnetic Materials. Submicron particles of Co, Ni and Co–Ni alloys · P Saravanan T A Jose P John Thomas G U Kulkarni · More Details Abstract Fulltext PDF. Magnetic ...

U.V.-enhanced reactivation of u.v.-irradiated herpes virus by primary cultures of rat hepatocytes

International Nuclear Information System (INIS)

Zurlo, J.; Yager, J.D.

1984-01-01

Carcinogen treatment of cultured mammalian cells prior to infection with u.v.-irradiated virus results in enhanced virus survival and mutagenesis suggesting the induction of SOS-type processes. In this paper, we report the development of a primary rat hepatocyte culture system to investigate cellular responses to DNA damage which may be relevant to hepatocarcinogenesis in vivo. We have obtained data demonstrating that enhanced reactivation of u.v.-irradiated Herpes simplex virus type 1 (HSV-1) occurs in hepatocytes irradiated with u.v. Cultured hepatocytes were pretreated with u.v. at the time of enhanced DNA synthesis. These treatments caused an inhibition followed by a recovery of DNA synthesis. At various times after pretreatment, the hepatocytes were infected with control or u.v.-irradiated HSV-1 at low multiplicity, and virus survival was measured by direct plaque assay. U.v.-irradiated HSV-1 exhibited the expected two-component survival curve in control or u.v. pretreated hepatocytes. The magnitude of enhanced reactivation of HSV-1 was dependent on the u.v. dose to the hepatocytes, the time of infection following u.v. pretreatment, and the level of DNA synthesis at the time of pretreatment. These results suggest that u.v. treatment of rat hepatocytes causes the induction of SOS-type functions that may have a role in the initiation of hepatocarcinogenesis

Uniqueness of Positive Solutions of Δu+f(u)=0 in N, N<=3

Science.gov (United States)

Cortázar, Carmen; Elgueta, Manuel; Felmer, Patricio

We study the uniqueness of radial ground states for the semilinear elliptic partial differential equation $Δ u+f(u)=0 {(*)}$ in N. We assume that the function f has two zeros, the origin and u0>0. Above u0 the function f is positive, is locally Lipschitz continuous and satisfies convexity and growth conditions of a superlinear nature. Below u0, f is assumed to be non-positive, non-identically zero and merely continuous. Our results are obtained through a careful analysis of the solutions of an associated initial-value problem, and the use of a monotone separation theorem. It is known that, for a large class of functions f, the ground states of (*) are radially symmetric. In these cases our result implies that (*) possesses at most one ground state.

Nizozemska bolest u Bolivarijanskoj Republici Venezueli

OpenAIRE

Jošić, Doc. dr. sc. Hrvoje; Maček Pandak, Fran

2017-01-01

Venezuela je od svog osamostaljenja gospodarstvo temeljila na proizvodnji i izvozu jednog proizvoda. U 19. stoljeću to su bili kava i kakaovac koje je u 20. stoljeću zamijenila nafta. Navedeno je dovelo do nizozemske bolesti koja je gušila ostale gospodarske grane, pa su često korumpirane vlasti kupovale socijalni mir socijalističkim politikama i državnom potrošnjom. 1980-ih došlo je do prvog značajnijeg pada cijene nafte u 20. stoljeću te je Venezuela morala provesti liberalne reforme kako b...

The fission cross sections of /sup 230/Th, /sup 232/Th, /sup 233/U, /sup 234/U, /sup 236/U, /sup 238/U, /sup 237/Np, /sup 239/Pu and /sup 242/Pu relative /sup 235/U at 14. 74 MeV neutron energy

Energy Technology Data Exchange (ETDEWEB)

Meadows, J.W.

1986-12-01

The measurement of the fission cross section ratios of nine isotopes relative to /sup 235/U at an average neutron energy of 14.74 MeV is described with particular attention to the determination of corrections and to sources of error. The results are compared to ENDF/B-V and to other measurements of the past decade. The ratio of the neutron induced fission cross section for these isotopes to the fission cross section for /sup 235/U are: /sup 230/Th - 0.290 +- 1.9%; /sup 232/Th - 0.191 +- 1.9%; /sup 233/U - 1.132 +- 0.7%; /sup 234/U - 0.998 +- 1.0%; /sup 236/U - 0.791 +- 1.1%; /sup 238/U - 0.587 +- 1.1%; /sup 237/Np - 1.060 +- 1.4%; /sup 239/Pu - 1.152 +- 1.1%; /sup 242/Pu - 0.967 +- 1.0%. 40 refs., 11 tabs., 9 figs.

Preparation of D-[U-14C]galactose and α-D-[U-14C]galactose-1-phosphate

International Nuclear Information System (INIS)

Kolina, J.; Hromadkova, B.

1989-01-01

Optically pure D-[U- 14 C]galactose was prepared on a preparatory scale using the galactokinase enzyme. The suggested procedure allows to also prepare a α-D-[U- 14 C]galactose-1-phosphate and L-[U- 14 ]galactose giving good yield. The experiments proved that the raw fraction isolated from yeast of the Kluyveromyces fragilis strain or the Kluyveromyces lactis strain shows sufficient activity. Phosphorylation of D-[U- 14 C]galactose practically terminates after 30 mins of incubation. DL-[U- 14 C]galactose isolated using preparatory paper chromatography from the acid hydrolyzate of [U- 14 C] polysaccharide is a satisfactory radioactive precursor. The developed preparation procedure theoretically contributed towards the further elucidation of the problem of the proportional representation of galactose stereo-isomers in extracellular polysaccharide isolated from red algae. In this respect data in the literature differ and some sources state a significantly higher propertion of L-galactose. The experiments showed that [U- 14 C] polysaccharide isolated from the red algae Porphyridium cruentum prevalently contains D-[U- 14 C]galactose, which confirms the process of enzyme reaction. (author). 1 tab., 4 refs

Kinetics and mechanism of photoaccelerated isotope exchange between U(VI) and U(IV) in oxalate solutions

International Nuclear Information System (INIS)

Shaban, I.S.; Owreit, M.F.; Nikitenko, S.I.

1992-01-01

A kinetic study of thermal and photoaccelerated U(IV)-U(VI) isotope exchange has been carried out in oxalate solutions at 11-40 deg C. The rate and quantum yield were determined as a function of U(IV), U(VI) and oxalate concentration, wavelength of incident light, temperature and absorbed dose of γ-radiation. The kinetic equations for thermal and photoaccelerated exchange have been obtained. It was assumed that the mechanism of exchange involves formation of U(V) as an intermediate, followed by slow exchange between U(V) and U(IV). The isokinetic dependence confirms the identity of limiting stages for thermal and photostimulated exchange. The upper component of photoexcited T 1 level of uranyl is supposed to be the most reactive in the process of U(V) generation. It was observed that the small doses of γ-radiation evoke the acceleration of isotope exchange, however, at D>100 krad the rate of exchange is reduced to the level of thermal exchange. (author) 8 refs.; 4 figs.; 2 tabs

OSNOVNA PODRUČJA PRIMJENE MARKETINGA U FINANCIJSKIM INSTITUCIJAMA U TRANZICIJSKIM I NEDOVOLJNO RAZVIJENIM ZEMLJAMA

OpenAIRE

Tomašević Lišanin, Marija; Pavičić, Jurica; Renko, Fran

2000-01-01

Autori ovog članka smatraju da se efikasan marketing u financijskim institucijama u tranzicijskim i u nedovoljno razvijenim zemljama mora usmjeravati na rješavanje triju osnovnih marketinških problema tih institucija: na izgradnju povjerenja, na informiranje i na izgradnju kvalitetnih dugoročnih odnosa s komitentima, pa su stoga tome problemu posvetili posebnu pažnju.

Fission Product Yields of 233U, 235U, 238U and 239Pu in Fields of Thermal Neutrons, Fission Neutrons and 14.7-MeV Neutrons

Science.gov (United States)

Laurec, J.; Adam, A.; de Bruyne, T.; Bauge, E.; Granier, T.; Aupiais, J.; Bersillon, O.; Le Petit, G.; Authier, N.; Casoli, P.

2010-12-01

The yields of more than fifteen fission products have been carefully measured using radiochemical techniques, for 235U(n,f), 239Pu(n,f) in a thermal spectrum, for 233U(n,f), 235U(n,f), and 239Pu(n,f) reactions in a fission neutron spectrum, and for 233U(n,f), 235U(n,f), 238U(n,f), and 239Pu(n,f) for 14.7 MeV monoenergetic neutrons. Irradiations were performed at the EL3 reactor, at the Caliban and Prospero critical assemblies, and at the Lancelot electrostatic accelerator in CEA-Valduc. Fissions were counted in thin deposits using fission ionization chambers. The number of fission products of each species were measured by gamma spectrometry of co-located thick deposits.

KONJOGOJSTVO U REPUBLICI HRVATSKOJ - STANJE I PERSPEKTIVA

OpenAIRE

Baban, Mirjana; Gregić, Maja; Korabi, Nidal; Antunović, Boris

2013-01-01

Ulaskom Republike Hrvatske u Europsku uniju u posljednjih nekoliko godina implementiraju se prilagodbe koje će osigurati usklađivanje konjogojstva s važećim europskim propisima. Unatoč globalnoj ekonomskoj krizi i u sektoru konjogojstva, ukupan broj konja se u Hrvatskoj kontinuirano povećava i nastavljaju se pozitivni trendovi u uzgoju. No, iako postoji uzlazni trend, posljedice recesije zasigurno će ostaviti traga i na brojnom stanju konja u Hrvatskoj. U posljednjem desetljeću broj konja pod...

Optimization of the binary breeder reactor. VIII annular core fueled with 233U - 238U and Pu-238U

International Nuclear Information System (INIS)

Nascimento, J.A. do; Ishiguro, Y.

1988-04-01

First cycle burnup characteristics of a 1200 MWe binary breeder reactor with annular core fueled with metallic 233 U- 238 U-Zr, Pu- 238 U-Zr and Th in the blankets have been analysed. The Doppler effect is small as expected in a metal fueled fast reactor. The sodium void reactivity is, in general, smaller than in metal fueled homogeneous fast reactors of 1 m core height. The estimates of the required and available control rod worths show a large shutdown margin throughout the operational cycle. There are flexibilities in the blanket fueling and well balanced breeding in the two cycles, uranium and thorium, with doubling times of about 20 years are possible. (author) [pt

Coral Sr-U Thermometry

Science.gov (United States)

DeCarlo, T. M.; Gaetani, G. A.; Cohen, A. L.; Foster, G. L.; Alpert, A.; Stewart, J.

2016-12-01

Coral skeletons archive the past two millennia of climate variability in the oceans with unrivaled temporal resolution. However, extracting accurate temperature information from coral skeletons is confounded by "vital effects", which often override the temperature dependence of geochemical proxies. Here, we present a new approach to coral paleothermometry based on results of abiogenic precipitation experiments interpreted within a framework provided by a quantitative model of the coral biomineralization process. We conducted laboratory experiments to test the temperature and carbonate chemistry controls on abiogenic partitioning of Sr/Ca and U/Ca between aragonite and seawater, and we modeled the sensitivity of skeletal composition to processes occurring at the site of calcification. The model predicts that temperature can be accurately reconstructed from coral skeleton by combining Sr/Ca and U/Ca ratios into a new proxy, Sr-U. We tested the model predictions with measured Sr/Ca and U/Ca ratios of fourteen Porites sp. corals collected from the tropical Pacific Ocean and the Red Sea, with a subset also analyzed using the boron isotope (δ11B) pH proxy. Observed relationships among Sr/Ca, U/Ca, and δ11B agree with model predictions, indicating that the model accounts for the key features of the coral biomineralization process. We calibrated Sr-U to instrumental temperature records and found that it captures 93% of mean annual variability (26-30 °C) and predicts temperature within 0.5 °C (1 σ). Conversely, Sr/Ca alone has an error of prediction of 1 °C and often diverges from observed temperature by 3 °C or more. Many of the problems afflicting Sr/Ca - including offsets among neighboring corals and decouplings from temperature during coral stress events - are reconciled by Sr-U. By accounting for the influence of the coral biomineralization process, the Sr-U thermometer may offer significantly improved reliability for reconstructing ocean temperatures from coral

Augmented reality building operations tool

Science.gov (United States)

Brackney, Larry J.

2014-09-09

A method (700) for providing an augmented reality operations tool to a mobile client (642) positioned in a building (604). The method (700) includes, with a server (660), receiving (720) from the client (642) an augmented reality request for building system equipment (612) managed by an energy management system (EMS) (620). The method (700) includes transmitting (740) a data request for the equipment (612) to the EMS (620) and receiving (750) building management data (634) for the equipment (612). The method (700) includes generating (760) an overlay (656) with an object created based on the building management data (634), which may be sensor data, diagnostic procedures, or the like. The overlay (656) is configured for concurrent display on a display screen (652) of the client (642) with a real-time image of the building equipment (612). The method (700) includes transmitting (770) the overlay (656) to the client (642).

Relativistic U(3) symmetry and pseudo-U(3) symmetry of the Dirac Hamiltonian

International Nuclear Information System (INIS)

Ginocchio, Joseph N.

2010-01-01

The Dirac Hamiltonian with relativistic scalar and vector harmonic oscillator potentials has been solved analytically in two limits. One is the spin limit for which spin is an invariant symmetry of the the Dirac Hamiltonian and the other is the pseudo-spin limit for which pseudo-spin is an invariant symmetry of the Dirac Hamiltonian. The spin limit occurs when the scalar potential is equal to the vector potential plus a constant, and the pseudospin limit occurs when the scalar potential is equal in magnitude but opposite in sign to the vector potential plus a constant. Like the non-relativistic harmonic oscillator, each of these limits has a higher symmetry. For example, for the spherically symmetric oscillator, these limits have a U(3) and pseudo-U(3) symmetry respectively. We shall discuss the eigenfunctions and eigenvalues of these two limits and derive the relativistic generators for the U(3) and pseudo-U(3) symmetry. We also argue, that, if an anti-nucleon can be bound in a nucleus, the spectrum will have approximate spin and U(3) symmetry.

Annex 5 - Fabrication of U-Al alloy; Prilog 5 - Dobijanje legure U-Al

Energy Technology Data Exchange (ETDEWEB)

Drobnjak, Dj; Lazarevic, Dj; Mihajlovic, A [Institute of Nuclear Sciences Boris Kidric, Vinca, Beograd (Serbia and Montenegro)

1961-12-15

Alloy U-Al with low content of aluminium is often used for fabrication of fuel elements because it is stable under moderate neutron flux density. Additionally this type of alloys show much better characteristics than pure uranium under reactor operating conditions (temperature, mechanical load, corrosion effect of water). This report contains the analysis of the phase diagram of U-Al alloy with low content of aluminium, applied procedure for alloying and casting with detailed description of equipment. Characteristics of the obtained alloy are described and conclusions about the experiment and procedure are presented. Sistem U-Al sa niskim sadrzajem aluminijuma jedan je od cesto koriscenih za izradu gorivnih elemenata, jer je dovoljno stabilan pri umerenim gustinama fluksa. Pored toga, u uslovima karakteristicnim za rad nuklearnog reaktora (temperatura, gradijent temperature, mehanicka naprezanja, koroziono dejstvo vode) legure ovog sistema pokazuju daleko bolja svojstva od nelegiranog urana. Referat sadrzi analizu dijagrama stanja U-Al legure sa niskim sadrzajem aluminijuma, primenjeni postupak legiranja i livenja sa opisom pojedinih uredjaja i operacija. Takodje su opisana svojstva dobijene legure i dat je zakljucak o eksperimentu i tehnici rada (author)

Evaluation of fission cross sections and covariances for 233U, 235U, 238U, 239Pu, 240Pu, and 241Pu

International Nuclear Information System (INIS)

Kawano, Toshihiko; Matsunobu, Hiroyuki; Murata, Toru

2000-02-01

A simultaneous evaluation code SOK (Simultaneous evaluation on KALMAN) has been developed, which is a least-squares fitting program to absolute and relative measurements. The SOK code was employed to evaluate the fission cross sections of 233 U, 235 U, 238 U, 239 Pu, 240 Pu, and 241 Pu for the evaluated nuclear data library JENDL-3.3. Procedures of the simultaneous evaluation and the experimental database of the fission cross sections are described. The fission cross sections obtained were compared with evaluated values given in JENDL-3.2 and ENDF/B-VI. (author)

Patient preferences and perspectives regarding reducing alcohol consumption: role of nalmefene

Directory of Open Access Journals (Sweden)

Luquiens A

2014-09-01

Full Text Available Amandine Luquiens, Henri-Jean Aubin INSERM U669, Université Paris Sud, Hôpital Paul Brousse, Assistance Publique – Hôpitaux de Paris (AP-HP, Villejuif, France Abstract: Alcohol use disorder is a major public health issue. The absolute mortality burden of alcohol-attributable death has increased over the last 20 years. However, access to care remains very poor and many people with alcohol use disorder are untreated. The main limiting factor for access to care in alcohol use disorder appears to be the reluctance to engage in abstinence. Risk reduction is a developing approach in the treatment of alcohol use disorders, drawing its inspiration, with quite a delay, from the decades-long dominant approach in other substance use disorders. A paradigm shift has recently occurred that places more of an emphasis on reducing alcohol as a therapeutic strategy for patients with alcohol use disorder, to better meet the patients’ preferences and needs. The development and recent approval of nalmefene, in alcohol-dependent adults with a high drinking risk level, contributes to enlarging the therapeutic arsenal for alcohol dependence, strengthening the legitimacy of alcohol reduction strategies. Keywords: harm reduction, alcohol use disorder, therapeutic goal, patients’ satisfaction

Preparation of U-Si/U-Me (Me = Fe, Ni, Mn) aluminum-dispersion plate-type fuel (miniplates) for capsule irradiation

International Nuclear Information System (INIS)

Ugajin, Mitsuhiro; Itoh, Akinori; Akabori, Mitsuo

1993-06-01

Details of equipment installed, method adopted and final products were described on the preparation of uranium silicides and other fuels for capsule irradiation. Main emphasis was placed on the preparation of laboratory-scale aluminum-dispersion plate-type fuel (miniplates) loaded to the first and second JMTR silicide capsules. Fuels contained in the capsules are as follows: (A) uranium-silicide base alloys U 3 Si 2 , Mo- added U 3 Si 2 , U 3 Si 2 +U 3 Si, U 3 Si 2 +USi, U 3 Si, U 3 (Si 0.8 Ge 0.2 ), U 3 (Si 0.6 Ge 0.4 ) (B) U 6 Me-type alloys with higher uranium density U 6 Mn, U 6 Ni, U 6 (Fe 0.4 Ni 0.6 ), U 6 (Fe 0.6 Mn 0.4 ) The powder-metallurgical picture-frame method was adopted and laboratory-scale technique was established for the preparation of miniplates. As a result of inspection for capsule irradiation, miniplates were prepared to meet the requirements of specification. (author)

Using 238U/235U ratios to understand the formation and oxidation of reduced uranium solids in naturally reduced zones

Science.gov (United States)

Jemison, N.; Johnson, T. M.; Druhan, J. L.; Davis, J. A.

2016-12-01

Uranium occurs in groundwater primarily as soluble and mobile U(VI), which can be reduced to immobile U(IV), often observed in sediments as uraninite. Numerous U(VI)-contaminated sites, such as the DOE field site in Rifle, CO, contain naturally reduced zones (NRZ's) that have relatively high concentrations of organic matter. Reduction of heavy metals occurs within NRZ's, producing elevated concentrations of iron sulfides and U(IV). Slow, natural oxidation of U(IV) from NRZ's may prolong U(VI) contamination of groundwater. The reduction of U(VI) produces U(IV) with a higher 238U/235U ratio. Samples from two NRZ sediment cores recovered from the Rifle site revealed that the outer fringes of the NRZ contain U(IV) with a high 238U/235U ratio, while lower values are observed in the center . We suggest that as aqueous U(VI) was reduced in the NRZ, it was driven to lower 238U/235U values, such that U(IV) formed in the core of the NRZ reflects a lower 238U/235U. Two oxidation experiments were conducted by injecting groundwater containing between 14.9 and 21.2 mg/L dissolved O2 as an oxidant into the NRZ. The oxidation of U(IV) from this NRZ increased aqueous U(VI) concentrations and caused a shift to higher 238U/235U in groundwater as U(IV) was oxidized primarily on the outer fringes of the NRZ. In total these observations suggest that the stability of solid phase uranium is governed by coupled reaction and transport processes. To better understand various reactive transport scenarios we developed a model for the formation and oxidation of NRZ's utilizing the reactive transport software CrunchTope. These simulations suggest that the development of isotopically heterogeneous U(IV) within NRZ's is largely controlled by permeability of the NRZ and the U(VI) reduction rate. Oxidation of U(IV) from the NRZ's is constrained by the oxidation rate of U(IV) as well as iron sulfides, which can prevent oxidation of U(IV) by scavenging dissolved oxygen.

234U and 238U in the Carrizo Sandstone aquifer of South Texas

International Nuclear Information System (INIS)

Cowart, J.B.; Osmond, J.K.

1974-01-01

The waters of the Carrizo Sand formation of South Texas, United States of America, exhibit a pattern of uranium isotopic disequilibrium, described in terms of 234 U/ 238 U activity ratio ('A.R.') and uranium concentration, which may be a function of geochemical factors and the hydrologic history of the area. In terms of uranium, two regimes seem to exist. The first, including outcrop and near outcrop sample locations, has waters with relatively high concentration and low A.R. Somewhat downdip, the uranium concentration decreases sharply at the downdip limit of the oxidation environment, a zone of uranium precipitation. Recoil of daughter products from the precipitated uranium causes an increase of A.R. of the water. Water of low uranium concentration and high A.R. is found throughout the downdip regime. If a constant input of 234 U through time is assumed, the downdip decrease in A.R. after the initial introduction of 234 U into the water may be ascribed to radioactive decay of 234 U. However, this assumption leads to the calculation of a water flow rate one twentieth that determined by other means. Alternatively, this pattern may be an artifact of a change of climate from 20,000 years to 10,000 years ago. In this case, the decrease in A.R. downdip is a function of a varying input of 234 U as well as decay. (author)

Mass spectrometric 230Th-234U-238U dating of the Devils Hole calcite vein

International Nuclear Information System (INIS)

Ludwig, K.R.; Simmons, K.R.; Szabo, B.J.; Riggs, A.C.; Winograd, I.J.; Landwehr, J.M.; Hoffman, R.J.

1992-01-01

The Devils Hole calcite vein contains a long-term climatic record, but requires accurate chronologic control for its interpretation. Mass-spectrometric U-series ages for samples from core DH-11 yielding 230 Th ages with precisions ranging from less than 1,000 years (2σ) for samples younger than ∼140 ka (thousands of years ago) to less than 50,000 years for the oldest samples (∼566 ka). The 234 U/ 238 U ages could be determined to a precision of ∼20,000 years for all ages. Calcite accumulated continuously from 566 ka until ∼60 ka at an average rate of 0.7 millimeter per 10 3 years. The precise agreement between replicate analyses and the concordance of the 230 Th/ 238 U and 234 U/ 238 U ages for the oldest samples indicate that the DH-11 samples were closed systems and validate the dating technique in general

Digitalni otisak u fiksnoprotetskoj terapiji

OpenAIRE

Cvitković, Alen

2016-01-01

Otisak u fiksnoprotetskoj terapiji najvažnije je sredstvo komunikacije između kliničara i laboratorijskog tehničara. Budući da se otisak nalazi na početku "proizvodnog lanca", eventualne greške odrazit će se na sve naredne korake u izradi protetskog rada i na njegovu konačnu preciznost. Zbog toga se nastavlja potraga za boljim materijalima i tehnologijama koji će pogreške svesti na najmanju moguću mjeru. Suvremene digitalne metode razvijene su kako bi ubrzale i pojedno...

U.S. phosphate industry as a source of U3O8 to the year 2000

International Nuclear Information System (INIS)

Borg, I.Y.

1976-01-01

U 3 O 8 recovered as a by-product of the phosphate fertilizer industry may equal 3600-5200 tons by 1985 and represent 7-10 percent of the anticipated annual U.S. demand. If the enormous U.S. phosphate reserves and resources are mined primarily for their uranium content they appear sufficient to fill more than twice the projected cumulative U.S. demand to the year 2000

U.S.-born compared to non-U.S.-born abused women: analysis of baseline data.

Science.gov (United States)

Montalvo-Liendo, Nora; Koci, Anne; McFarlane, Judith; Gilroy, Heidi; Maddoux, John

2013-01-01

It is evident from recent studies that a woman's citizenship status does not exempt her from exposure to partner violence. The purpose of this article was to examine if social support, self-efficacy, and marginalization of abused women differ based on U.S. born compared to non-U.S. born with and without documentation. The findings suggest that women who were born in the United States had significantly higher self-efficacy scores compared to non-U.S.-born women without documents. There were no significant differences in social support among abused women who are U.S. born compared to non-U.S. born with and without documentation. In addition, women who were not born in the United States and did not have documents had higher marginalization.

Razvoj bioetike u Hrvatskoj

OpenAIRE

Tomašević, Luka

2013-01-01

Bioetika je postala tema koju svakodnevno susrećemo, tema o kojoj je potrebno znati barem osnovne pojmove, jer se danas u svijetu o njoj možda i najviše raspravlja. O njoj raspravljaju osobe svih znanstvenih i neznanstvenih profila, o njoj se govori s religioznoga, kulturalnoga, filozofskoga, pravnoga, sociološkoga, pa čak i političkog stajališta. Hrvatska je po bioetici već poznata diljem svijeta. Uz nekolicinu začetnika, u raznim sredinama, bioetika se u Hrvatskoj proširila kroz teološko-ka...

Corrective action baseline report for underground storage tanks 0439-U, 0440-U, 2073-U, 2074-U, and 2075-U at the East End Fuel Station, Buildings 9754 and 9754-2, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Facility ID No. 0-010117

International Nuclear Information System (INIS)

1994-01-01

The purpose of this report is to provide baseline geochemical and hydrogeologic data relative to corrective action for underground storage tanks (USTs) 0439-U, 0440-U, 2073-U, 2074-U, and 2075-U at the East End Fuel Station, Buildings 9754 and 9754-2 at the Oak Ridge Y-12 Plant. Progress in support of corrective action at the East End Fuel Station has included monitoring well installation, tank removal, and baseline groundwater sampling and analysis. This document represents the baseline report for corrective action at the East End Fuel Station and is organized into three sections. Section 1 presents introductory information relative to the site, including the regulatory initiative, site description, and progress to date. Section 2 includes a summary of additional monitoring well installation activities, the results of baseline groundwater sampling, a summary of tank removal activities, and the results of confirmatory soil sampling performed during tank removal. Section 3 presents the baseline hydrogeology and planned zone of influence for groundwater remediation

Nuclear reactor for breeding 233U

International Nuclear Information System (INIS)

Bohanan, C.S.; Jones, D.H.; Raab, H.F. Jr.; Radkowsky, A.

1976-01-01

A light-water-cooled nuclear reactor capable of breeding 233 U for use in a light-water breeder reactor includes physically separated regions containing 235 U fissile material and 238 U fertile material and 232 Th fertile material and 239 Pu fissile material, if available. Preferably the 235 U fissile material and 238 U fertile material are contained in longitudinally movable seed regions and the 239 Pu fissile material and 232 Th fertile material are contained in blanket regions surrounding the seed regions. 1 claim, 5 figures

Odjeci talijanskoga kolonijalizma u Africi s kraja XIX. stoljeća u Istri prema pisanju Naše sloge

OpenAIRE

Orlović, David

2013-01-01

Članak se bavi analizom percepcije talijanskoga kolonijalizma u Africi s kraja XIX. stoljeća među istarskim Hrvatima koristeći pisanje Naše sloge, prvoga lista na hrvatskome jeziku u Istri. Rano talijansko kolonijalno širenje u Africi – od 1885. i zauzimanja luke Massawe u Eritreji do 1896. i poraza kod Adue u Etiopiji – u potpunosti se odvija za vrijeme izlaženja Naše sloge (1870. – 1915.). Naša sloga je čitatelje izvještavala o talijanskom kolonijalizmu isključivo u vrijeme eskalacije te...

Maestro di Pico i iluminacije u inkunabuli De Civitate Dei (Nicolas Jenson, Venecija, 1475. u samostanu Sv. Duje u Kraju na Pašmanu

Directory of Open Access Journals (Sweden)

Bojan Goja

2014-12-01

Full Text Available U franjevačkom samostanu Sv. Duje u Kraju na otoku Pašmanu čuva se inkunabula „O državi Božjoj“ (De Civitate Dei Sv. Aurelija Augustina koju je 1475. godine u Veneciji tiskao Nicolas Jenson. Inkunabula je na f. 17 (kako je naknadno označena paginacija grafitnom olovkom, tj. stranici incipita – liber primus kao i na više drugih stranica ukrašena lijepim višebojnim iluminacijama renesansnih stilskih karakteristika izrađenih temperom, zlatnim listićima, zlatnim prahom, sepijom, tintom i akvarelom. Iluminacije f. 17 sastoje se od dva fitomorfna inicijala, dekorativnog okvira i slobodnih figurativnih prizora tj. minijatura, dok su pojedine druge stranice ukrašene fitomorfnim i brojnim inicijala tipa littera notabilior visine dva retka izrađenima u crvenoj ili plavoj boji. Dekorativni ornamentirani okvir zaključen trolistima ispunjava gornju i lijevu marginu početne stranice. Osnovu dekoracije čini traka sastavljena od pet tankih linija koja se spiralno povija i tvori kružnice koje su ispunjene cvjetovima, listovima i bobicama u plavoj i zelenoj boji i boji ciklame te stiliziranim zlatnim cvjetovima čička (lat. Arctium lappa; pojedini autori nazivaju ove ukrasne motive bottoni dorati ili gold dots. U gornjem lijevom uglu okvira naslikan je češljugar. Na mjestu gdje započinje tekst lijevog stupca naslikan je unutar pravokutnog polja na zlatnoj pozadini inicijal „I“ sastavljen od fitomorfnih motiva plave, zelene i boje ciklame s osjenčanjima u različitim nijansama. Unutar dekorativnog okvira, na sredini visine inicijala, nalazi se medaljon unutar kojeg je naslikano poprsje Sv. Aurelija Augustina. Dekorativni ornamentirani okvir koji ispunjava gornju marginu ukrašen je na isti način kao i onaj uz desnu ali skromnije. Ime tiskara dodatno je naznačeno tako da je sa gornje i donje strane okvira ukrašeno sa po jednim stiliziranim zlatnim cvijetom čička sa gornje i češljugovine (lat. Dipsacus fullonum sa donje strane

[23 and Me: how to make (a lot of) money out of your customers].

Science.gov (United States)

Jordan, Bertrand

2015-04-01

The announcement of several deals between the DTC genetics firm 23 and Me and Genentech, Pfizer and other corporations reveals the real business model of the company: selling access to sets of characterized patients for targeted drug development. This may be a useful strategy, but it raises a number of questions concerning the privacy of the company's customers and also of adequate compensation when they become valuable currency. © 2015 médecine/sciences – Inserm.

Assembly and dynamics of the U4/U6 di-snRNP by single-molecule FRET

Science.gov (United States)

Hardin, John W.; Warnasooriya, Chandani; Kondo, Yasushi; Nagai, Kiyoshi; Rueda, David

2015-01-01

In large ribonucleoprotein machines, such as ribosomes and spliceosomes, RNA functions as an assembly scaffold as well as a critical catalytic component. Protein binding to the RNA scaffold can induce structural changes, which in turn modulate subsequent binding of other components. The spliceosomal U4/U6 di-snRNP contains extensively base paired U4 and U6 snRNAs, Snu13, Prp31, Prp3 and Prp4, seven Sm and seven LSm proteins. We have studied successive binding of all protein components to the snRNA duplex during di-snRNP assembly by electrophoretic mobility shift assay and accompanying conformational changes in the U4/U6 RNA 3-way junction by single-molecule FRET. Stems I and II of the duplex were found to co-axially stack in free RNA and function as a rigid scaffold during the entire assembly, but the U4 snRNA 5′ stem-loop adopts alternative orientations each stabilized by Prp31 and Prp3/4 binding accounting for altered Prp3/4 binding affinities in presence of Prp31. PMID:26503251

Preserving high-purity 233U

International Nuclear Information System (INIS)

Krichinsky, Alan; Giaquinto, Joe; Canaan, Doug

2016-01-01

The MARC X Conference hosted a workshop for the scientific community to communicate needs for high-purity 233 U and its by-products in order to preserve critical items otherwise slated for downblending and disposal. Currently, only small portions of the U.S. holdings of separated 233 U are being preserved. However, many additional kilograms of 233 U (>97 % pure) still are destined to be disposed, and it is unlikely that this material will ever be replaced due to a lack of operating production capability. Summaries of information conveyed at the workshop and feedback obtained from the scientific community are presented herein. (author)

The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.

Science.gov (United States)

Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel

2012-12-01

In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.

Periotron: Suvremena sijalometrijska metoda u dijagnostici i u nadzoru liječenja kserostomije

OpenAIRE

Alajbeg, I.; Hladki, N.; Cekić-Arambašin, A.; Alajbeg, IŽ.

2003-01-01

Periotron (Oraflow, Plainview, SAD), mjerač mikrokoličine vlažnosti, elektronički je instrument napravljen za mjerenje gingivne tekućine, eksudata parodontnoga džepa, lučenja sline i debljine filma sline. U mjerenju se rabe različiti papirni mediji za sakupljanje uzorka. Ti se mediji (Periopaper strips, PeroCol strips, Sialopaper strips) stave na željeno mjesto u ustima i ostave tijekom određenog vremena, nakon čega se odloži između elektroda Periotrona. Poseban oblog elektroda omogućuje im d...

Oxidation behaviour of plutonium rich (U, Pu)C and (U, Pu)O{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Sali, S.K., E-mail: sksali@barc.gov.in [Fuel Chemistry Division (India); Kulkarni, N.K.; Phatak, Rohan [Fuel Chemistry Division (India); Agarwal, Renu [Product Development Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085 (India)

2016-10-15

Oxidation behaviour of (U{sub 0.3}Pu{sub 0.7})C{sub 1.06} was investigated in air by heating samples up to 1073 K and 1273 K. Thermogravimetry (TG) of the samples and X-ray powder diffraction (XRD) of the intermediate products were used to understand the phenomenon taking place during this process. Theoretical calculations were carried out to understand the multiple phase changes taking place during oxidation of carbide. Theoretical results were validated by XRD analysis of the products obtained at different stages of oxidation. The final oxidized products were found to be a single FCC phase with O/M = 2.15 (M = U + Pu). Oxidation kinetic studies of (U{sub 0.3}Pu{sub 0.7})O{sub 2} and (U{sub 0.47}Pu{sub 0.53})O{sub 2} were carried out in dry air, using thermogravimetry, under non-isothermal conditions. The activation energy of oxidation was found to be 49 and 70 kJ/mol, respectively. Lattice parameter dependence on Pu/M and O/M of plutonium rich mixed oxide (MOX) was established using combined results of XRD and TG analysis of (U{sub 0.3}Pu{sub 0.7})O{sub 2+x} and (U{sub 0.47}Pu{sub 0.53})O{sub 2+x}.

Double U-Core Switched Reluctance Machine

DEFF Research Database (Denmark)

2016-01-01

The present invention relates to an electrical machine stator comprising a plurality of stator segments (131,132,133), each segment comprises a first U-core and a second U-core wound with a winding, where the winding being arranged with at least one coil turn, each coil turn comprises a first axial......(s), wherein the first U-core and the second U-core are located adjacent to each other, whereby the winding spans the first and second U-cores. The invention also relates to a SRM machine with a stator mentioned above and a rotor....

Postirradiation examination of high-U-loaded, low-enriched U3O8, UAl2, and U3Si test fuel plates

International Nuclear Information System (INIS)

Gomez, J.; Morando, R.; Perez, E.E.; Giorsetti, D.R.; Copeland, G.L.; Hofman, G.L.; Snelgrove, J.L.

1985-01-01

The scope of this work is to present an evaluation of the postirradiation examination of the second set of high-U-loaded, low-enriched U 3 O 8 , UAl 2 and U 3 Si miniature plates manufactured by the Comision Nacional de Energia Atomica (CNEA) of Argentina, and irradiated and examined, within the framework of the Reduced Enrichment Research and Test Reactor (RERTR) Program, at Oak Ridge National Laboratory and Argonne National Laboratory. This paper includes fabrication details of the plates, their irradiation history and the results of postirradiation examination which are compared to those of the previous test and to present results from other laboratories participating in the RERTR Program. Postirradiation examination of these plates showed satisfactory performance for the oxides, aluminides and silicides (except for the highest-loaded U 3 Si plate) with the only indication of detrimental behavior being the slight bowing of some plates at about 80% burnup

Postirradiation examination of high-U-loaded, low-enriched U3O8, UAl2, and U3Si test fuel plates

International Nuclear Information System (INIS)

Gomez, J.; Morando, R.; Perez, E.E.; Giorsetti, D.R.; Copeland, G.L.; Hofman, G.L.; Snelgrove, J.L.

1985-01-01

The scope of this work is to present an evaluation of the postirradiation examination of the second set of high-U-loaded, low-enriched U 3 O 8 , UAl 2 and U 3 Si miniature plates manufactured by the Comision Nacional de Energia Atomica (CNEA) of Argentina, and irradiated and examined, within the framework of the Reduced Enrichment Research and Test Reactor (RERTR) Program, at Oak Ridge National Laboratory and Argonne National Laboratory. This paper includes fabrication details of the plates, their irradiation history and the results of postirradiation examination which are compared to those of the previous test and to present results from other laboratories participating in the REM Program. Postirradiation examination of these plates showed satisfactory performance for the oxides, aluminides and silicides (except for the highest-loaded U 3 Si plate) with the only indication of detrimental behavior being the slight bowing of some plates at about 80% burnup. (author)

Postirradiation examination of high-U-loaded low-enriched U3O8, UAl2, and U3Si test fuel plates

International Nuclear Information System (INIS)

Gomez, J.; Morando, R.; Perez, E.E.; Giorsetti, D.R.; Copeland, G.L.; Hofmann, G.; Snelgrove, J.L.

1984-01-01

The scope of this work is to present an evaluation of the postirradiation examination of the second set of high-U-loaded low-enriched U 3 O 8 , UAl 2 and U 3 Si miniature plates manufactured by the Comision Nacional de Energia Atomica (CNEA) of Argentina, and irradiated and examinated, within the framework of the Reduced Enrichment Research and Test Reactor (RERTR) Program, at Oak Ridge National Laboratory and Argonne National Laboratory. This paper includes fabrication details of the plates, their irradiation history and the results of postirradiation examination which are compared to those of the previous test and to present results from other laboratories participating in the RERTR Program. Postirradiation examination of these plates showed satisfactory poerformance for the oxides, aluminides and silicides (except for the highest-loaded U 3 Si plate) with the only indication of detrimental behavior during the slight bowing of some plates at about 80% burnup

U.S.-Mexico energy

International Nuclear Information System (INIS)

1991-05-01

This paper reports that while Mexico's petrochemical industry has grown rapidly, it now faces shortages both in investment funds and in supplies of basic petrochemicals due to a financial crisis in the 1980s. Mexico has undertaken a series of policy reforms aimed at encouraging foreign and private investment, but these efforts have generally failed to entice U.S. investment in Mexico. U.S. petrochemical companies have cited unfavorable market conditions, insufficient basic petrochemical capacity in Mexico, concern about the reversibility of Mexican reforms, inadequate Mexican protection of intellectual property rights, and lack of investment protection for U.S. businesses as impediments to investment in Mexico. Cooperation between the two nations in overcoming these obstacles could help U.S. petrochemical companies maintain their positions in a competitive global market, while at the same time provide Mexico with much needed capital investment and technological expertise

Performance evaluation of indigenous thermal ionization mass spectrometer for determination of 235U/238U atom ratios

International Nuclear Information System (INIS)

Alamelu, D.; Parab, A.R.; Sasi Bhushan, K.; Shah, Raju V.; Jagdish Kumar, S.; Rao, Radhika M.; Aggarwal, S.K.; Bhatia, R.K.; Yadav, V.K.; Sharma, Madhavi P.; Tulsyan, Puneet; Chavda, Pradip; Sriniwasan, P.

2014-07-01

A magnetic sector based Thermal Ionization Mass Spectrometer (TIMS) designed and developed at Technical Physics Division, B.A.R.C., was evaluated for its performance for the determination of 235 U/ 238 U atom ratios in uranium samples. This consisted of evaluating the precision and accuracy on the 235 U/ 238 U atom ratios in various isotopic reference materials as well as indigenously generated uranium samples. The results obtained by the indigenous TIMS were also compared with those obtained using a commercially available TIMS system. The internal and external precision were found to be around 0.1% for determining 235 U/ 238 U atom ratios close to those of natural uranium ( i.e. 0.00730). (author)

Calorimetric investigations of U-Bi system

International Nuclear Information System (INIS)

Agarwal, Renu; Joshi, A.R.

2013-01-01

U 0.333 Bi 0.667 is a compound that may form on breach of clad during reactor operation with metallic fuel and lead-bismuth coolant. Therefore, enthalpy of mixing of U-Bi liquid solution in limited composition range and enthalpy of formation of U 0.333 Bi 0.667 compound were measured by high temperature calorimetry. The enthalpy of mixing follows subregular solution model and enthalpy of formation U 0.333 Bi 0.667 from U(l) and Bi(l) at 843 K was -52.5 kJ/mol and -40.8 kJ/mol from U(s) and Bi(s) at 298.15 K. Both enthalpy of mixing and enthalpy of formation of intermetallic compound obtained experimentally were compared with Miedema model values. (author)

Enzymatic reduction of U(VI) in groundwaters

International Nuclear Information System (INIS)

Addelouas, A.; Gong, W.; Lutze, W.; Nuttall, E.; Fritz, B.; Crovisier, J.L.

1999-01-01

The use of enzymatic reduction of U(VI) in remediation of groundwater contaminated with U(VI) is receiving considerable attention. Certain strains of bacteria can combine the oxidation of an organic compound to the reduction of U(VI) to U(IV), which precipitates as uraninite. In the present study, we tested the reduction of U(VI) in groundwaters with various origins and compositions. In all groundwaters u(VI) was reduced by sulfate reducing bacteria that had been activated by ethanol and tri-metaphosphate. The reduction rate of U(VI) depends on sulfate concentration in water and the abundance of bacteria in the system. This work shows that bacteria capable of U(VI) reduction are ubiquitous in nature, and suggests the possibility of a large application of the enzymatic reduction of U(VI) for in situ clean up of groundwaters contaminated with uranium. (authors)

Smile characterization by U.S. white, U.S. Asian Indian, and Indian populations.

Science.gov (United States)

Sharma, Neeru; Rosenstiel, Stephen F; Fields, Henry W; Beck, F Mike

2012-05-01

With growing demand for high esthetic standards, dentists must understand patient perception and incorporate their preferences into treatment. However, little is known about how cultural and ethnic differences influence esthetic perception. The purpose of this study was to determine whether differences in ethnic background, including the possibility of assimilation, affected a layperson's perception of esthetic and smile characteristics. A survey was developed containing images that were digitally manipulated into a series of barely perceptible steps, changing 1 smile parameter to form a strip of images that displayed that parameter over a wide range. Data were collected with a customized program which randomly displayed a single image and allowed the subject to use the mouse to adjust an on-screen slider according to displayed instructions, that is, "Please move the slider to select the image you find to be most ideal"; or "Please move the slider to select the first image that you find unattractive." A convenience sample (n=288) comprised of U.S. whites, U.S. Asian Indians, and Indians living in India was surveyed. This sample provided a power of .86 to detect a difference of ±1.5 mm. Subjects evaluated images showing the smile arc, buccal corridor, gingival display, vertical overlap, lateral incisal step, maxillary midline to midface, and maxillary to mandibular midline. Rater reliability was assessed with the Fleiss-Cohen weighted Kappa (Kw) statistic and corresponding 95% confidence interval after each question was repeated in a random sequence. Choice differences due to ethnicity were assessed with a multiple randomization test and the adjusted P value with the step-down Bonferrroni method of Holm (α=.05). The Kw for the 17 variables in all 3 groups ranged from 0.11 for ideal vertical overlap to 0.64 for ideal buccal corridor space. Overall reliability was fair to moderate. Differences attributed to ethnicity were demonstrated between the Asian Indians and U

Studies on some uranium oxides in the composition range U O3 -U3 O8-z. Vol. 3

International Nuclear Information System (INIS)

El-Fekey, S.A.; El-Mamoon Yahia, M.; Abd El-Razek, A.M.

1996-01-01

Four different crystallographic modifications of U O 3 designated as α, β, γ and δ, as well as the amorphous (A)-U O 3 have been prepared by calcining washed and unwashed uranium peroxide, washed ammonium uranate, uranyl nitrate crystals, and U O 3 .H 2 O at different temperatures. The U O 3 powders obtained were calcined at 650 degree C for 3 h in nitrogen atmosphere. Methanol, ethanol, benzene, toluene, hexane, pentane, acetone, petroleum ether, and kerosene were used as organic liquids for apparent density measurements and kerosene was found most appropriate. The results indicated that the different densities of α, β and A-U O 3 are inversely proportional to uranium concentration and temperature during precipitation while directly proportional with duration and final pH. The sequence of density of U O 3 powders appeared as follows: β>γ>δ>α>A-U O 3 . The porosity of the U O 3 phases was calculated using the equation P=D T - D p . The sequence of porosity appeared as follows A-U O 3 >α>δ>γ>β. The stoichiometry of the U 3 O 8 phase was determined titrimetrically. The use of O/U sequence appeared as follows: δ>γ>α>A-U O 3 >β indicating that the stoichiometry of the U 3 O 8 phase depends on the porosity of the U O 3 from which it was prepared. 1 figs., 3 tabs

Calibration of 232U solution; Calibracion de una disolucion de 232U

Energy Technology Data Exchange (ETDEWEB)

Galan Valera, M P; Acena Berrenechea, M L

1988-07-01

A method for as certain the activity by alpha spectroscopy with semiconductor detectors, of a solution of 232U is presented. It consists of the comparison with a 233U solution activity previously measured in a gridded ionization chamber of 2{pi} geometry. The total measurement uncertainty is about + - 0,02. (Author) 9 refs.

Impact of uranium (U) on the cellular glutathione pool and resultant consequences for the redox status of U.

Science.gov (United States)

Viehweger, Katrin; Geipel, Gerhard; Bernhard, Gert

2011-12-01

Uranium (U) as a redox-active heavy metal can cause various redox imbalances in plant cells. Measurements of the cellular glutathione/glutathione disulfide (GSH/GSSG) by HPLC after cellular U contact revealed an interference with this essential redox couple. The GSH content remained unaffected by 10 μM U whereas the GSSG level immediately increased. In contrast, higher U concentrations (50 μM) drastically raised both forms. Using the Nernst equation, it was possible to calculate the half-cell reduction potential of 2GSH/GSSG. In case of lower U contents the cellular redox environment shifted towards more oxidizing conditions whereas the opposite effect was obtained by higher U contents. This indicates that U contact causes a consumption of reduced redox equivalents. Artificial depletion of GSH by chlorodinitrobenzene and measuring the cellular reducing capacity by tetrazolium salt reduction underlined the strong requirement of reduced redox equivalents. An additional element of cellular U detoxification mechanisms is the complex formation between the heavy metal and carboxylic functionalities of GSH. Because two GSH molecules catalyze electron transfers each with one electron forming a dimer (GSSG) two UO(2) (2+) are reduced to each UO(2) (+) by unbound redox sensitive sulfhydryl moieties. UO(2) (+) subsequently disproportionates to UO(2) (2+) and U(4+). This explains that in vitro experiments revealed a reduction to U(IV) of only around 33% of initial U(VI). Cellular U(IV) was transiently detected with the highest level after 2 h of U contact. Hence, it can be proposed that these reducing processes are an important element of defense reactions induced by this heavy metal.

A year-by-year record of 236-U/238-U in coral as a step towards establishing 236-U from nuclear weapons testing fall-out as oceanic tracer

Energy Technology Data Exchange (ETDEWEB)

Winkler, Stephan; Steier, Peter [University of Vienna, Faculty of Physics, Vienna (Austria); Carilli, Jessica [Australian Nuclear Science and Technology Organisation, Lucas Heights (Australia)

2012-07-01

Since uranium is known to behave conservatively in ocean waters, 236-U has great potential in application as oceanic tracer. 236-U (t1/2=23.4 Ma) was introduced into the oceans by atmospheric nuclear weapon testing with amount estimates ranging from 700 kg to 1500 kg. Thus a resulting initial average 236-U/238-U ratio of at least 5e-9 is expected for an oceanic mixed layer depth of 100 m. This ratio is already higher than the natural pre-nuclear background, which is expected to be at 10e-14 levels. Even the elevated ratios of global stratospheric fall-out are beyond the capabilities of ICPMS and TIMS methods. However, the exceptional sensitivity and ultra-low background for 236-U of the Vienna Environmental Research Accelerator's Accelerator Mass Spectrometry system allows us to measure down to 10-13 detection limits. We present a year-by-year record of 236-U/238-U for a Caribbean coral core covering years 1944 to 2006, thus allowing to us put constraints on the oceanic input of 236-U by atmospheric testing. Moreover modeling of the results also demonstrates the capabilities of 236-U as oceanic tracer.

The [U{sub 2}F{sub 12}]{sup 2-} anion of Sr[U{sub 2}F{sub 12}

Energy Technology Data Exchange (ETDEWEB)

Scheibe, Benjamin; Pietzonka, Clemens; Conrad, Matthias; Kraus, Florian [Fachbereich Chemie, Philipps-Universitaet Marburg (Germany); Mustonen, Otto; Karppinen, Maarit; Karttunen, Antti J. [Department of Chemistry, Aalto University (Finland); Atanasov, Mihail; Neese, Frank [Max-Planck Institute for Chemical Energy Conversion, Muelheim an der Ruhr (Germany)

2018-03-05

The D{sub 2h}-symmetric dinuclear complex anion [U{sub 2}F{sub 12}]{sup 2-} of pastel green Sr[U{sub 2}F{sub 12}] shows a hitherto unknown structural feature: The coordination polyhedra around the U atoms are edge-linked monocapped trigonal prisms, the U{sup V} atoms are therefore seven-coordinated. This leads to a U-U distance of 3.8913(6) Aa. A weak U{sup V}-U{sup V} interaction is observed for the dinuclear [U{sub 2}F{sub 12}]{sup 2-} complex and described by the antiferromagnetic exchange J{sub exp} of circa -29.9 cm{sup -1}. The crystalline compound can be easily prepared from SrF{sub 2} and β-UF{sub 5} in anhydrous hydrogen fluoride (aHF) at room temperature. It was studied by means of single crystal X-ray diffraction, IR, Raman and UV/VIS spectroscopy, magnetic measurements, and by molecular as well as by solid-state quantum chemical calculations. (copyright 2018 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

Why linear Birch and U/sub s/-U/sub p/ expansions work

International Nuclear Information System (INIS)

Grover, R.

1987-07-01

The equivalence of the Birch-Murnoghan equation to a linear U/sub s/-U/sub p/ equation was illustrated in the previous paper. Here it is shown in a direct manner how the virial theorem boundary localization of valence electron kinetic energy changes lead to the convergence of the Eulerian strain expansion about the zero-pressure state

Post-match recovery methods used by U19 and U21 provincial ...

African Journals Online (AJOL)

The aim of the study was to identify the most preferred post-match recovery methods utilized by U19 and U21 provincial rugby union players (n=97; Mean age: ± 20.2 years) in Gauteng Province of South Africa. Questionnaire-based data were collected from a purposive sample size of 97 rugby players. The findings ...

Beta decay heat following U-235, U-238 and Pu-239 neutron fission

Science.gov (United States)

Li, Shengjie

1997-09-01

This is an experimental study of beta-particle decay heat from 235U, 239Pu and 238U aggregate fission products over delay times 0.4-40,000 seconds. The experimental results below 2s for 235U and 239Pu, and below 20s for 238U, are the first such results reported. The experiments were conducted at the UMASS Lowell 5.5-MV Van de Graaff accelerator and 1-MW swimming-pool research reactor. Thermalized neutrons from the 7Li(p,n)7Be reaction induced fission in 238U and 239Pu, and fast neutrons produced in the reactor initiated fission in 238U. A helium-jet/tape-transport system rapidly transferred fission fragments from a fission chamber to a low background counting area. Delay times after fission were selected by varying the tape speed or the position of the spray point relative to the beta spectrometer that employed a thin-scintillator-disk gating technique to separate beta-particles from accompanying gamma-rays. Beta and gamma sources were both used in energy calibration. Based on low-energy(energies 0-10 MeV. Measured beta spectra were unfolded for their energy distributions by the program FERD, and then compared to other measurements and summation calculations based on ENDF/B-VI fission-product data performed on the LANL Cray computer. Measurements of the beta activity as a function of decay time furnished a relative normalization. Results for the beta decay heat are presented and compared with other experimental data and the summation calculations.

U-TH-REE mobility and diffusion in granitic environments during alteration of accessory minerals and U-ores

International Nuclear Information System (INIS)

Cathelineau, M.; Vergneaud, M.

1989-01-01

U, Th and REE concentrations and distributions have been studied in granitic rocks, using a multidisciplinary approach involving micromapping of cracks in oriented samples, together with mineralogical and geochemical studies of the different U-Th-REE bearing phases. The behavior of U, Th and Nd, considered as chemical analogue elements of the radiotoxic nuclides, was investigated either in the vicinity of microsites (accessory mineral enviornment) or along plurimetric sections around U-ore bodies. The different granite minerals, especially the accessory minerals (uraninite, monazite, thorite, apatite, xeonotime), as well as U-ores, present different initial concentrations of U, Th and REE. Limitations to the analogy between these U-Th-REE concentrations and the radwastes is discussed as a function of their mineralogical features, chemical compostion, size and solubilities. These primary concentrations present different behavior when subjected to hydrothermal alteration, such as propylitization, phyllite type alteration, or clay alteration. Results show that in reduced media, in the temperature range 80-2000 0 C, the rate of mobilization of U, Th, REE is relatively moderate. However, fluids enriched in flourides, phosphates or carbonates may significantly solubilize and transport U and REE under specific conditions. In addition, the degree of opening of the microcracks and faults, as well as the oxidation-reduction processes, are critical parameters for the efficiency of the granitic geological barrier

Activation Doppler Measurements on U 238 and U 235 in Some Fast Reactor Spectra

Energy Technology Data Exchange (ETDEWEB)

Tiren, L I; Gustafsson, I

1968-03-15

Measurements of the Doppler effect in U-238 capture and U-235 fission have been made by means of the activation technique in three different neutron spectra in the fast critical assembly FR0. The experiments involved the irradiation of thin uranium metal foils or oxide disks, which were heated in a small oven located at the core centre. The measurements on U-238 were extended to 1780 deg K and on U-235 to 1470 deg K. A core region surrounding the oven was homogenized in order to facilitate the interpretation of results. The reaction rates in the uranium samples were detected by gamma counting. The experimental method was checked with regard to systematic errors by irradiations in a thermal spectrum. The data obtained for U-238 capture were corrected for the effect of neutron collisions in the oven wall, and were extrapolated to zero sample thickness. In the softest spectrum (core 5) a Doppler effect (relative increase in capture rate) of 0.260 {+-} 0.018 was obtained on heating from 343 to 1780 deg K, and in the hardest spectrum (core 3) the corresponding value was 0.030 {+-} 0.003. An appreciable Doppler effect in U-235 fission was obtained only in the softest spectrum, in which the measured increase in fission rate on heating from 320 to 1470 deg K was 0.007 {+-} 0.003.

Distinct 238U/235U ratios and REE patterns in plutonic and volcanic angrites: Geochronologic implications and evidence for U isotope fractionation during magmatic processes

Science.gov (United States)

Tissot, François L. H.; Dauphas, Nicolas; Grove, Timothy L.

2017-09-01

Angrites are differentiated meteorites that formed between 4 and 11 Myr after Solar System formation, when several short-lived nuclides (e.g., 26Al-26Mg, 53Mn-53Cr, 182Hf-182W) were still alive. As such, angrites are prime anchors to tie the relative chronology inferred from these short-lived radionuclides to the absolute Pb-Pb clock. The discovery of variable U isotopic composition (at the sub-permil level) calls for a revision of Pb-Pb ages calculated using an ;assumed; constant 238U/235U ratio (i.e., Pb-Pb ages published before 2009-2010). In this paper, we report high-precision U isotope measurement for six angrite samples (NWA 4590, NWA 4801, NWA 6291, Angra dos Reis, D'Orbigny, and Sahara 99555) using multi-collector inductively coupled plasma mass-spectrometry and the IRMM-3636 U double-spike. The age corrections range from -0.17 to -1.20 Myr depending on the samples. After correction, concordance between the revised Pb-Pb and Hf-W and Mn-Cr ages of plutonic and quenched angrites is good, and the initial (53Mn/55Mn)0 ratio in the Early Solar System (ESS) is recalculated as being (7 ± 1) × 10-6 at the formation of the Solar System (the error bar incorporates uncertainty in the absolute age of Calcium, Aluminum-rich inclusions - CAIs). An uncertainty remains as to whether the Al-Mg and Pb-Pb systems agree in large part due to uncertainties in the Pb-Pb age of CAIs. A systematic difference is found in the U isotopic compositions of quenched and plutonic angrites of +0.17‰. A difference is also found between the rare earth element (REE) patterns of these two angrite subgroups. The δ238U values are consistent with fractionation during magmatic evolution of the angrite parent melt. Stable U isotope fractionation due to a change in the coordination environment of U during incorporation into pyroxene could be responsible for such a fractionation. In this context, Pb-Pb ages derived from pyroxenes fraction should be corrected using the U isotope composition

The Effectiveness of Trace DNA Profiling-A Comparison Between a U.S. and a U.K. Law Enforcement Jurisdiction.

Science.gov (United States)

Bond, John W; Weart, Jocelyn R

2017-05-01

Recovery, profiling, and speculative searching of trace DNA (not attributable to a body fluid/cell type) over a twelve-month period in a U.S. Crime Laboratory and U.K. police force are compared. Results show greater numbers of U.S. firearm-related items submitted for analysis compared with the U.K., where greatest numbers were submitted from burglary or vehicle offenses. U.S. multiple recovery techniques (double swabbing) occurred mainly during laboratory examination, whereas the majority of U.K. multiple recovery techniques occurred at the scene. No statistical difference was observed for useful profiles from single or multiple recovery. Database loading of interpretable profiles was most successful for U.K. items related to burglary or vehicle offenses. Database associations (matches) represented 7.0% of all U.S. items and 13.1% of all U.K. items. The U.K. strategy for burglary and vehicle examination demonstrated that careful selection of both items and sampling techniques is crucial to obtaining the observed results. © 2016 American Academy of Forensic Sciences.

New explanation for extreme u-234 u-238 disequilibria in a dolomitic aquifer

CSIR Research Space (South Africa)

Kronfeld, J

1994-05-01

Full Text Available High U-234/U-238 activity ratios are found in the shallow groundwater of the phreatic Transvaal Dolomite Aquifer. The aquifer is uranium poor, while the waters are oxygen rich and young. Tritium and C-14 are used to show that the disequilibrium...

Critical evaluation and thermodynamic optimization of the U-Pb and U-Sb binary systems

International Nuclear Information System (INIS)

Wang, Jian; Jin, Liling; Chen, Chuchu; Rao, Weifeng; Wang, Cuiping; Liu, Xingjun

2016-01-01

A complete literature review, critical evaluation and thermodynamic optimization of the phase diagrams and thermodynamic properties of U-Pb and U-Sb binary systems are presented. The CALculation of PHAse Diagrams (CALPHAD) method was used for the thermodynamic optimization, the results of which can reproduce all available reliable experimental phase equilibria and thermodynamic data. The modified quasi-chemical model in the pair approximation (MQMPA) was used for modeling the liquid solution. The Gibbs energies of all terminal solid solutions and intermetallic compounds were described by the compound energy formalism (CEF) model. All reliable experimental data of the U-Pb and U-Sb systems have been reproduced. A self-consistent thermodynamic database has been constructed for these binary systems; this database can be used in liquid-metal fuel reactor (LMFR) research.

A Stable U Isotopic Perspective on the U Budget and Global Extent of Modern Anoxia in the Ocean.

Science.gov (United States)

Tissot, F.; Dauphas, N.

2015-12-01

Isotopic fractionation between U4+ and U6+makes U stable isotopes potential tracers of global paleoredox conditions. In this work [1], we put the U-proxy up to a test against a highly constrained system: the modern ocean. We measured a large number of seawater samples from geographically diverse locations and found that the open ocean has a homogenous isotopic composition at δ238USW= -0.392 ± 0.005 ‰ (rel. to CRM-112a). From our measurement of rock samples (n=64) and compilations of literature data (n=380), we then estimated the U isotopic compositions of the various reservoirs involved in the modern oceanic U budget, as well as the fractionation factors associated with U incorporation into those reservoirs. Using a steady-state model, we compared the isotopic composition of the seawater predicted by the four most recent U oceanic budgets [2-5] to the modern seawater value we measured. Three of these budgets [2-4] predict a seawater isotopic composition in very good agreement with the observed δ238USW, which strengthens our confidence in the isotopic fractionation factors associated with each deposition environment and the fact that U is at steady-state in the modern ocean. The U oceanic budget of Henderson and Anderson (2003) does not reproduce the observed seawater composition because the U flux to anoxic/euxinic sediments relative to the total U flux out of the ocean is high in their model, which our analysis shows cannot be correct. The U isotopic composition of seawater is used to constrain the extent of anoxia in the modern ocean (% of seafloor covered by anoxic/euxinic sediments), which is 0.21 ± 0.09 %. This work demonstrates that stable isotopes of U can indeed trace the extent of anoxia in the modern global ocean, thereby validating the application of U isotope measurements to paleoredox reconstructions. Based on the above work, we will present the best estimate of the modern oceanic U budget. [1] Tissot F.L.H., Dauphas N. (2015) Geochim Cosmochim

Determination of the activity of the uranium isotopes U-234, U-235 and U-238 in environmental samples by alpha spectrometry

International Nuclear Information System (INIS)

Kromphorn, G.

1996-02-01

Different materials containing urandium are regularly investigated in the Laboratory for Environmental Radioactivity of the Physikalisch-Technische Bundesanstalt (PTB) with respect to the activity of the uranium isotopes ( 234 U, 235 U, and 238 U). Moreover for reasons of quality assurance, the PTB takes part in international comparisons where also uranium contents are to be determined in environmental samples and in the framework of which reference materials can be certified. Finally in national comparisons the PTB has the task to determine values of the specific activity for the different isotopes which can play the role of nominal (orientation) values. The single steps of uranium analyses are described after a compilation of the most important data of the uranium isotopes contained in natural uranium: The use of 232 U as tracer, the chemical separation analytics, the production of α-sources and the measuring methods. Analyses of a soil sample and a waste water sample with respect to their specific uranium activity have been chosen as examples of a practical application. (orig.) [de

U.S.-EU Cooperation Against Terrorism

Science.gov (United States)

2014-12-01

of Colombia (FARC), some Palestinian groups (including Hamas’ military and political wings in 2001 and 2003 respectively), and Hezbollah’s military...a “European TFTP” would be aimed at enabling the EU to extract SWIFT data on European soil and send the targeted results onward to U.S. authorities...whether U.S. laws provide adequate protection for PNR data saved in cloud systems operating on U.S. soil . U.S.-EU Data Privacy and Protection

Mössbauer spectroscopic studies in U-Fe and U-Fe-Zr alloys

Energy Technology Data Exchange (ETDEWEB)

Panda, Alaka; Singh, L. Herojit; Rajagopalan, S.; Govindaraj, R., E-mail: govind@igcar.gov.in; Ramachandran, Renjith; Kalavathi, S.; Amarendra, G. [Materials Science Group, Indira Gandhi Centre for Atomic Research, Kalpakkam (India)

2016-05-23

{sup 57}Fe Mössbauer studies have been carried out in an alloy of U and Fe with atomic percentage in the ratio of 68%:32% in order to understand the local structure and valence of Fe atoms associated with different phases that may get formed. The effect of changes in the hyperfine parameters such as isomer shift and quadrupole splitting at Fe sites due to additional alloying of Zr has been studied in an alloy of U, Fe and Zr in the ratio of 44%:33%:23% respectively with respect to that of the U-Fe alloy chosen in the present study. Possible effect of solute clustering in these systems has been addressed in an analogous alloy of uranium and zirconium using positron lifetime spectroscopy.

U.S. contributions to ITER

International Nuclear Information System (INIS)

Sauthoff, Ned R.

2006-01-01

The United States participates in the ITER project to undertake the study of the science and technology of burning plasmas. The 2003 U.S. decision to enter the ITER negotiations followed an extensive series of community and governmental reviews of the benefits, readiness, and approaches to the study of burning plasmas. This paper describes both the technical and the organizational preparations and plans for U.S. participation in the ITER construction activity: in-kind contributions, staff contributions, and cash contributions as well as supporting physics and technology research. Near-term technical activities focus on the completion of R and D and design and mitigation of risks in the areas of provisionally assigned US contributions. Outside the project, the U.S. is engaged in preparations for the test blanket module program. Organizational activities focus on preparations of the project management arrangements to maximize the overall success of the ITER project: elements include refinement of U.S. positions on the international arrangements, the establishment of the U.S. Domestic Agency, progress along the path of the U.S. Department of Energy's Project Management Order, and overall preparations for commencement of the fabrication of major items of equipment and for provision of staff and cash as specified in the upcoming ITER agreement

Uloga iskustva rodno neravnopravnog tretmana u obitelji u percepciji, stavovima i sklonosti rodnoj diskriminaciji

OpenAIRE

Kamenov, Željka; Huić, Aleksandra; Jugović, Ivana

2011-01-01

Cilj ovog istraživanja bio je provjeriti kakvu ulogu ima rano iskustvo rodne diskriminacije u kasnijem načinu gledanja na rodnu neravnopravnost i s tim povezano ponašanje. Internaliziraju li osobe koje su u primarnoj obitelji doživjele neravnopravan tretman zbog svojeg spola tradicionalne rodne uloge, kako bismo očekivali prema teorijama socijalnog učenja, ili su, kako bismo očekivali prema kognitivističkim teorijama, zbog snažnog negativnog iskustva nepravde postale osjetljivije na pitanja r...

U S spacesuits

CERN Document Server

Thomas, Kenneth S

2012-01-01

Spacesuits are far more than garments. They are a personalized spacecraft that allows direct contact and interaction with everything beyond our world, and a last refuge for survival in a disaster. Creating safe, reliable, and comfortable spacesuits is an ongoing challenge that has spanned over four decades. "U. S. Spacesuits, 2nd Edition" by Kenneth S. Thomas and Harold J. McMann details the technical evolution of U. S. spacesuits from their roots in high altitude aviation and vacuum tube development to present day, with an additional look into the future. This primary source of spacesuit information explains the functions, historical development, and use of spacesuits from a worldwide perspective. In this new edition, the authors update the story of U.S. spacesuit development and efforts, from the design challenges modern engineers face to the latest roles of spacesuits in space exploration. The book also provides a close up look at NASA's new Constellation Space Suit System as well as Apollo prototype confi...

Synthesis of disodium [benzene-U-{sup 14}C]-(4-chlorophenylthio)methylenediphosphonate, [benzene-U-{sup 14}C]-tiludronate

Energy Technology Data Exchange (ETDEWEB)

Burgos, Alain; Ellames, G.J. [Alnwick Research Centre (United Kingdom). Dept. of Metabolism and Pharmacokinetics

1995-12-31

Disodium [benzene-U-{sup 14}C]-(4-chlorophenylithio)methylenediphosphonate, [benzene-{sup 14}C]-Tiludronate, 2, has been prepared in six steps from [benzene-U-{sup 14}C]-acetanilide in an overall radiochemical yield of 41%. A key step in this transformation was the efficient conversion of [U-{sup 14}C]-4-chloroaniline to [benzene-U-{sup 14}C]-4-chlorophenylthiocyanate, 5, in 83% yield by treatment of the corresponding diazonium salt, 9 with iron(111) thiocyanate. It should be noted that formation of the isomeric [benzene-U-{sup 14}C]-4-chlorophenylisothiocyanate, 11, as a byproduct, was observed in only {approx} 1% yield. (author).

Geometric U-folds in four dimensions

Science.gov (United States)

Lazaroiu, C. I.; Shahbazi, C. S.

2018-01-01

We describe a general construction of geometric U-folds compatible with a non-trivial extension of the global formulation of four-dimensional extended supergravity on a differentiable spin manifold. The topology of geometric U-folds depends on certain flat fiber bundles which encode how supergravity fields are globally glued together. We show that smooth non-trivial U-folds of this type can exist only in theories where both the scalar and space-time manifolds have non-trivial fundamental group and in addition the scalar map of the solution is homotopically non-trivial. Consistency with string theory requires smooth geometric U-folds to be glued using subgroups of the effective discrete U-duality group, implying that the fundamental group of the scalar manifold of such solutions must be a subgroup of the latter. We construct simple examples of geometric U-folds in a generalization of the axion-dilaton model of \

Myelodysplastic Syndrome, Unclassifiable (MDS-U) With 1% Blasts Is a Distinct Subgroup of MDS-U With a Poor Prognosis.

Science.gov (United States)

Margolskee, Elizabeth; Hasserjian, Robert P; Hassane, Duane; Tam, Wayne; Mathew, Susan; Ok, Chi Young; Wang, Sa A; Oak, Jean; Arber, Daniel A; Orazi, Attilio

2017-07-01

Three situations qualify as myelodysplastic syndrome, unclassifiable (MDS-U): (1) refractory cytopenia with dysplasia and 1% blasts in peripheral blood (BL), (2) pancytopenia with unilineage dysplasia (Pan), and (3) persistent cytopenia, less than 5% bone marrow blasts, and less than 10% dysplastic cells and presence of MDS-defining cytogenetic abnormalities (CG). We compared the clinicopathologic features and mutational profiles for these three groups. MDS-U cases were reviewed at four major academic institutions. Targeted next-generation sequencing for genes implicated in myeloid neoplasms was performed in a subset of cases. Twenty-seven patients were identified (six MDS-U BL, 13 MDS-U Pan, and eight MDS-U CG). Clonal cytogenetic abnormalities were found in six of six, seven of 13, and eight of eight cases in MDS-U BL, Pan, and CG, respectively (P > .05). Overall, four of six patients with MDS-U BL progressed to acute myeloid leukemia; no MDS-U Pan or CG patients did. The rates of progression-free survival and mortality (overall survival) were significantly higher in MDS-U BL compared with Pan and CG (P MDS-U BL is a distinct subset of MDS-U with a poor prognosis, while MDS-U Pan and CG are relatively indolent. Evaluation of peripheral blood smears in patients with MDS is essential for accurate classification and prognosis. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Reply to Comment on "Zircon U-Th-Pb dating using LA-ICP-MS: Simultaneous U-Pb and U-Th dating on the 0.1 Ma Toya Tephra, Japan"

Science.gov (United States)

Ito, Hisatoshi

2015-04-01

Guillong et al. (2015) mentioned that corrections for abundance sensitivity for 232Th and molecular zirconium sesquioxide ions (Zr2O3+) are critical for reliable determination of 230Th abundances in zircon for LA-ICP-MS analyses. There is no denying that more rigorous treatments are necessary to obtain more reliable ages than those in Ito (2014). However, as shown in Fig. 2 in Guillong et al. (2015), the uncorrected (230Th)/(238U) for reference zircons except for Mud Tank are only 5-20% higher than unity. Since U abundance of Toya Tephra zircons that have U-Pb ages Ito (2014) obtained U-Th ages of the Toya Tephra by comparison with Fish Canyon Tuff (FCT) data. Because both the FCT and the Toya Tephra have similar trends of overestimation of 230Th, the effect of overestimation of 230Th to cause overestimation of U-Th age should be cancelled out or negligible. Therefore the pivotal conclusion in Ito (2014) that simultaneous U-Pb and U-Th dating using LA-ICP-MS is possible and useful for Quaternary zircons holds true.

U-Mo fuel qualification program in HANARO

International Nuclear Information System (INIS)

Lee, K.H.; Lee, C.S.; Kim, H.R.; Kuk, I.H.; Kim, C.K.

2000-01-01

Atomized U-Mo fuel has shown good performance from the results of previous out-of-pile tests and post-irradiation examinations. A qualification program of rod type U-Mo fuel is in progress and the fuel will be irradiated in HANARO. 6 gU/cm 3 U-7Mo, U-8Mo and U-9Mo are considered in this program. The laboratory test results of porosity, mechanical property, thermal conductivity, and thermal compatibility test are discussed in this paper. In parallel with this qualification program, the feasibility study on the core conversion from the present U 3 Si fuel to U-Mo in HANARO will be initiated to provide technical bases for the policy making. Several options of core conversion for HANARO are proposed and each option will be addressed briefly in terms of the operation policy, fuel management, and licensing of HANARO. (author)

SPECIFIČNOSTI RADA SA SLIJEPIM DJETETOM U VRTIĆU I ŠKOLI S POSEBNIM NAGLASKOM NA SLUŠNU PERCEPCIJU

OpenAIRE

Zrilić, Smiljana; Košta, Tomislav

2008-01-01

Odgoj i obrazovanje djece s oštećenjima vida, a bez drugih utjecajnih teškoća u razvoju, u redovnim vrtićima i osnovnim školama u RH pravo je djeteta zagarantirano važećim Zakonom o predškolskom odgoju i Zakonom o osnovnom školstvu, te pravilnicima vezanima uz zakone. Ipak, često mediji naglašavaju uspješnu integraciju slijepog djeteta kao neobičnu pojavu. U činjenici da se slijepi školuju nema ničeg neobičnog. Slijepo dijete, kao i sva druga djeca, želi igru i druženje s djecom u vrtiću, a u...

Agresīvu datorspēļu spēlēšana saistībā ar pusaudžu un jauniešu agresiju

OpenAIRE

Vītols, Krists

2012-01-01

Bakalaura darba mērķis bija noskaidrot, vai pastāv nozīmīgas saistības starp agresīvu datorspēļu spēlēšanu, datorspēļu spēlēšanas biežumu un agresijas izpausmju līmeni pusaudžu un jauniešu vidū. Pētījumā tika aptaujāti 50 Latvijas skolu skolēni, vecumā no 12-16 gadiem. Pētījuma izlases tika viedotas pēc brīvprātības principa, pētījuma aptaujas tika izdalītas skolēnu klasēs. Pētījuma metodē tika izmantotas divas aptaujas: 1. “Datorspēļu aptauja” (Video Game Questionnaire, Anderson & ...

Studies of U-Pu-C-Ti compounds

International Nuclear Information System (INIS)

Milet, C.

1967-01-01

The U-Pu-C-Ti compounds (5 to 20 atoms per cent Ti) have been studied in order to improve some properties of U-Pu-C carbides and to extend the existence field of the (U, Pu) C phase. The Pu/(U+Pu) ratio has been fixed to 15 per cent. All the alloys were elaborated and cast in an arc furnace. A two-phases field (U, Pu) C + Ti C exists which permits to avoid di- and sesqui-carbides and the (U, Pu) phase. An eutectic between (U, Pu) C and Ti C was found around 15 atoms per cent Ti. Practically the whole of the titanium is in Ti C form, titanium solubility in (U, Pu) C being inferior to 1 atom per cent. The most promising alloy are those containing two phases: (U, Pu) C+ Ti C. In comparison with the (U, Pu) C phase, titanium addition does not change very much the thermal expansion coefficients nor the thermal cycling behaviour between 160 and 1000 Celsius degrees which is excellent. On the other hand atmospheric corrosion behaviour is improved; compatibility with stainless steel is better; thermal conductivity, calculated from electrical resistivity K is enhanced: for U(0.85)-Pu(0.15)-C alloy we have K 0.179 W/cm.C at 1000 C and K = 0.187 W/cm.C at 1500 C, for U-Pu-C-Ti (10 atoms % Ti) alloy we have K = 0.193 W/cm.C at 1000 C and K = 0.205 W/cm.C at 1500 C. (author) [fr

Why linear Birch and U/sub s/-U/sub p/ expansions work

International Nuclear Information System (INIS)

Grover, R.

1987-11-01

The equivalence of the Birch-Murnaghan equation to a linear U/sub s/-U/sub p/ equation was illustrated in the previous paper. Here we show in a direct manner how the virial theorem and the effect of core exclusion on valence electron kinetic energy changes lead to the convergence of the Eulerian strain expansion about the zero-pressure state. 7 refs., 4 tabs

Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1

DEFF Research Database (Denmark)

Raffi, François; Babiker, Abdel G; Richert, Laura

2014-01-01

BACKGROUND: Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. METHODS: Between August, 2010......-inferior to standard treatment and represents a treatment option for patients with CD4 cell counts higher than 200 cells per μL. FUNDING: European Union Sixth Framework Programme, Inserm-ANRS, Gilead Sciences, Janssen Pharmaceuticals, Merck Laboratories....

Scientific publishing online,and the question of open access. Why such a long delay?

Directory of Open Access Journals (Sweden)

Christine Kosmopoulos

2005-05-01

Full Text Available In October of 2003 in Berlin, twenty directors of European research institutes (the CNRS, INSERM, the Max Plank Institute, ratified a Berlin Declaration on Open Access to Knowledge in the Sciences and Humanities, in which they committed themselves to supporting all initiatives based on the paradigm of free access on the Internet. In February 2005, the Berlin 3 Conference, held in Southampton, encouraged researchers to publish in journals offering free access. But while this model is being in...

Forward J /ψ production in U + U collisions at √{sN N}=193 GeV

Science.gov (United States)

Adare, A.; Aidala, C.; Ajitanand, N. N.; Akiba, Y.; Akimoto, R.; Alexander, J.; Alfred, M.; Aoki, K.; Apadula, N.; Asano, H.; Atomssa, E. T.; Awes, T. C.; Azmoun, B.; Babintsev, V.; Bai, M.; Bai, X.; Bandara, N. S.; Bannier, B.; Barish, K. N.; Bathe, S.; Baublis, V.; Baumann, C.; Baumgart, S.; Bazilevsky, A.; Beaumier, M.; Beckman, S.; Belmont, R.; Berdnikov, A.; Berdnikov, Y.; Black, D.; Blau, D. S.; Bok, J. S.; Boyle, K.; Brooks, M. L.; Bryslawskyj, J.; Buesching, H.; Bumazhnov, V.; Butsyk, S.; Campbell, S.; Chen, C.-H.; Chi, C. Y.; Chiu, M.; Choi, I. J.; Choi, J. B.; Choi, S.; Christiansen, P.; Chujo, T.; Cianciolo, V.; Citron, Z.; Cole, B. A.; Cronin, N.; Crossette, N.; Csanád, M.; Csörgő, T.; Danley, T. W.; Datta, A.; Daugherity, M. S.; David, G.; Deblasio, K.; Dehmelt, K.; Denisov, A.; Deshpande, A.; Desmond, E. J.; Ding, L.; Dion, A.; Diss, P. B.; Do, J. H.; D'Orazio, L.; Drapier, O.; Drees, A.; Drees, K. A.; Durham, J. M.; Durum, A.; Engelmore, T.; Enokizono, A.; Esumi, S.; Eyser, K. O.; Fadem, B.; Feege, N.; Fields, D. E.; Finger, M.; Finger, M.; Fleuret, F.; Fokin, S. L.; Frantz, J. E.; Franz, A.; Frawley, A. D.; Fukao, Y.; Fusayasu, T.; Gainey, K.; Gal, C.; Gallus, P.; Garg, P.; Garishvili, A.; Garishvili, I.; Ge, H.; Giordano, F.; Glenn, A.; Gong, X.; Gonin, M.; Goto, Y.; Granier de Cassagnac, R.; Grau, N.; Greene, S. V.; Grosse Perdekamp, M.; Gu, Y.; Gunji, T.; Guragain, H.; Hachiya, T.; Haggerty, J. S.; Hahn, K. I.; Hamagaki, H.; Hamilton, H. F.; Han, S. Y.; Hanks, J.; Hasegawa, S.; Haseler, T. O. S.; Hashimoto, K.; Hayano, R.; He, X.; Hemmick, T. K.; Hester, T.; Hill, J. C.; Hollis, R. S.; Homma, K.; Hong, B.; Hoshino, T.; Hotvedt, N.; Huang, J.; Huang, S.; Ichihara, T.; Ikeda, Y.; Imai, K.; Imazu, Y.; Inaba, M.; Iordanova, A.; Isenhower, D.; Isinhue, A.; Ivanishchev, D.; Jacak, B. V.; Jeon, S. J.; Jezghani, M.; Jia, J.; Jiang, X.; Johnson, B. M.; Joo, K. S.; Jouan, D.; Jumper, D. S.; Kamin, J.; Kanda, S.; Kang, B. H.; Kang, J. H.; Kang, J. S.; Kapustinsky, J.; Kawall, D.; Kazantsev, A. V.; Key, J. A.; Khachatryan, V.; Khandai, P. K.; Khanzadeev, A.; Kijima, K. M.; Kim, C.; Kim, D. J.; Kim, E.-J.; Kim, G. W.; Kim, M.; Kim, Y.-J.; Kim, Y. K.; Kimelman, B.; Kistenev, E.; Kitamura, R.; Klatsky, J.; Kleinjan, D.; Kline, P.; Koblesky, T.; Kofarago, M.; Komkov, B.; Koster, J.; Kotchetkov, D.; Kotov, D.; Krizek, F.; Kurita, K.; Kurosawa, M.; Kwon, Y.; Lacey, R.; Lai, Y. S.; Lajoie, J. G.; Lebedev, A.; Lee, D. M.; Lee, G. H.; Lee, J.; Lee, K. B.; Lee, K. S.; Lee, S.; Lee, S. H.; Leitch, M. J.; Leitgab, M.; Lewis, B.; Li, X.; Lim, S. H.; Liu, M. X.; Lynch, D.; Maguire, C. F.; Makdisi, Y. I.; Makek, M.; Manion, A.; Manko, V. I.; Mannel, E.; Maruyama, T.; McCumber, M.; McGaughey, P. L.; McGlinchey, D.; McKinney, C.; Meles, A.; Mendoza, M.; Meredith, B.; Miake, Y.; Mibe, T.; Mignerey, A. C.; Milov, A.; Mishra, D. K.; Mitchell, J. T.; Miyasaka, S.; Mizuno, S.; Mohanty, A. K.; Mohapatra, S.; Montuenga, P.; Moon, T.; Morrison, D. P.; Moskowitz, M.; Moukhanova, T. V.; Murakami, T.; Murata, J.; Mwai, A.; Nagae, T.; Nagamiya, S.; Nagashima, K.; Nagle, J. L.; Nagy, M. I.; Nakagawa, I.; Nakagomi, H.; Nakamiya, Y.; Nakamura, K. R.; Nakamura, T.; Nakano, K.; Nattrass, C.; Netrakanti, P. K.; Nihashi, M.; Niida, T.; Nishimura, S.; Nouicer, R.; Novák, T.; Novitzky, N.; Nyanin, A. S.; O'Brien, E.; Ogilvie, C. A.; Oide, H.; Okada, K.; Orjuela Koop, J. D.; Osborn, J. D.; Oskarsson, A.; Ozawa, K.; Pak, R.; Pantuev, V.; Papavassiliou, V.; Park, I. H.; Park, J. S.; Park, S.; Park, S. K.; Pate, S. F.; Patel, L.; Patel, M.; Peng, J.-C.; Perepelitsa, D. V.; Perera, G. D. N.; Peressounko, D. Yu.; Perry, J.; Petti, R.; Pinkenburg, C.; Pinson, R.; Pisani, R. P.; Purschke, M. L.; Qu, H.; Rak, J.; Ramson, B. J.; Ravinovich, I.; Read, K. F.; Reynolds, D.; Riabov, V.; Riabov, Y.; Richardson, E.; Rinn, T.; Riveli, N.; Roach, D.; Rolnick, S. D.; Rosati, M.; Rowan, Z.; Rubin, J. G.; Ryu, M. S.; Sahlmueller, B.; Saito, N.; Sakaguchi, T.; Sako, H.; Samsonov, V.; Sarsour, M.; Sato, S.; Sawada, S.; Schaefer, B.; Schmoll, B. K.; Sedgwick, K.; Seele, J.; Seidl, R.; Sekiguchi, Y.; Sen, A.; Seto, R.; Sett, P.; Sexton, A.; Sharma, D.; Shaver, A.; Shein, I.; Shibata, T.-A.; Shigaki, K.; Shimomura, M.; Shoji, K.; Shukla, P.; Sickles, A.; Silva, C. L.; Silvermyr, D.; Singh, B. K.; Singh, C. P.; Singh, V.; Skolnik, M.; Slunečka, M.; Snowball, M.; Solano, S.; Soltz, R. A.; Sondheim, W. E.; Sorensen, S. P.; Sourikova, I. V.; Stankus, P. W.; Steinberg, P.; Stenlund, E.; Stepanov, M.; Ster, A.; Stoll, S. P.; Stone, M. R.; Sugitate, T.; Sukhanov, A.; Sumita, T.; Sun, J.; Sziklai, J.; Takahara, A.; Taketani, A.; Tanaka, Y.; Tanida, K.; Tannenbaum, M. J.; Tarafdar, S.; Taranenko, A.; Tennant, E.; Tieulent, R.; Timilsina, A.; Todoroki, T.; Tomášek, M.; Torii, H.; Towell, C. L.; Towell, R.; Towell, R. S.; Tserruya, I.; van Hecke, H. W.; Vargyas, M.; Vazquez-Zambrano, E.; Veicht, A.; Velkovska, J.; Vértesi, R.; Virius, M.; Vrba, V.; Vznuzdaev, E.; Wang, X. R.; Watanabe, D.; Watanabe, K.; Watanabe, Y.; Watanabe, Y. S.; Wei, F.; Whitaker, S.; White, A. S.; Wolin, S.; Woody, C. L.; Wysocki, M.; Xia, B.; Xue, L.; Yalcin, S.; Yamaguchi, Y. L.; Yanovich, A.; Yokkaichi, S.; Yoo, J. H.; Yoon, I.; You, Z.; Younus, I.; Yu, H.; Yushmanov, I. E.; Zajc, W. A.; Zelenski, A.; Zhou, S.; Zou, L.; Phenix Collaboration

2016-03-01

The invariant yields, d N /d y , for J /ψ production at forward rapidity (1.2 <|y |<2.2 ) in U +U collisions at √{sNN}=193 GeV have been measured as a function of collision centrality. The invariant yields and nuclear-modification factor RA A are presented and compared with those from Au +Au collisions in the same rapidity range. Additionally, the direct ratio of the invariant yields from U +U and Au +Au collisions within the same centrality class is presented, and used to investigate the role of c c ¯ coalescence. Two different parametrizations of the deformed Woods-Saxon distribution were used in Glauber calculations to determine the values of the number of nucleon-nucleon collisions in each centrality class, Ncoll, and these were found to give significantly different Ncoll values. Results using Ncoll values from both deformed Woods-Saxon distributions are presented. The measured ratios show that the J /ψ suppression, relative to binary collision scaling, is similar in U +U and Au +Au for peripheral and midcentral collisions, but that J /ψ show less suppression for the most central U +U collisions. The results are consistent with a picture in which, for central collisions, increase in the J /ψ yield due to c c ¯ coalescence becomes more important than the decrease in yield due to increased energy density. For midcentral collisions, the conclusions about the balance between c c ¯ coalescence and suppression depend on which deformed Woods-Saxon distribution is used to determine Ncoll.

U.S. Pacific Command > Leadership

Science.gov (United States)

USPACOM U.S. Pacific Command Search USPACOM: Search Search Search USPACOM: Search Home Leadership Directory Media Inquiries Home : Leadership Admiral Harry B. Harris, Jr., U.S. Navy Read the full biography

SU(2) x U(1) x U'(1) models which are slightly different from the Weinberg-Salam model

International Nuclear Information System (INIS)

Gao, C.; Wu, D.

1981-01-01

We discuss SU(2) x U(1) x U'(1) models by a uniform formula which is convenient for their comparison with the standard Weinberg-Salam model. As examples, we give three interesting models which are based on different grand unification models. In one model, U'(1) does not contribute to the electromagnetic interaction; in the other two, both U(1) and U'(1) do contribute to the electromagnetic interaction. Also, the first two models can approach the standard Weinberg-Salam model as close as one wants; but the third model has limitations on it

U-Science (Invited)

Science.gov (United States)

Borne, K. D.

2009-12-01

The emergence of e-Science over the past decade as a paradigm for Internet-based science was an inevitable evolution of science that built upon the web protocols and access patterns that were prevalent at that time, including Web Services, XML-based information exchange, machine-to-machine communication, service registries, the Grid, and distributed data. We now see a major shift in web behavior patterns to social networks, user-provided content (e.g., tags and annotations), ubiquitous devices, user-centric experiences, and user-led activities. The inevitable accrual of these social networking patterns and protocols by scientists and science projects leads to U-Science as a new paradigm for online scientific research (i.e., ubiquitous, user-led, untethered, You-centered science). U-Science applications include components from semantic e-science (ontologies, taxonomies, folksonomies, tagging, annotations, and classification systems), which is much more than Web 2.0-based science (Wikis, blogs, and online environments like Second Life). Among the best examples of U-Science are Citizen Science projects, including Galaxy Zoo, Stardust@Home, Project Budburst, Volksdata, CoCoRaHS (the Community Collaborative Rain, Hail and Snow network), and projects utilizing Volunteer Geographic Information (VGI). There are also scientist-led projects for scientists that engage a wider community in building knowledge through user-provided content. Among the semantic-based U-Science projects for scientists are those that specifically enable user-based annotation of scientific results in databases. These include the Heliophysics Knowledgebase, BioDAS, WikiProteins, The Entity Describer, and eventually AstroDAS. Such collaborative tagging of scientific data addresses several petascale data challenges for scientists: how to find the most relevant data, how to reuse those data, how to integrate data from multiple sources, how to mine and discover new knowledge in large databases, how to

Useful to Usable (U2U): Transforming climate information into usable tools to support Midwestern agricultural production

Science.gov (United States)

Prokopy, L. S.; Widhalm, M.

2014-12-01

There is a close connection between weather and climate patterns and successful agricultural production. Therefore, incorporating climate information into farm management is likely to reduce the risk of economic losses and increase profitability. While weather and climate information is becoming ever more abundant and accessible, the use of such information in the agricultural community remains limited. Useful to Usable (U2U): Transforming Climate Variability and Change Information for Cereal Crop Producers is a USDA-NIFA funded research and extension project focused on improving the use of climate information for agricultural production in the Midwestern United States by developing user-driven decision tools and training resources. The U2U team is a diverse and uniquely qualified group of climatologists, crop modelers, agronomists, and social scientists from 9 Midwestern universities and two NOAA Regional Climate Centers. Together, we strive to help producers make better long-term plans on what, when and where to plant and also how to manage crops for maximum yields and minimum environmental damage. To ensure relevance and usability of U2U products, our social science team is using a number of techniques including surveys and focus groups to integrate stakeholder interests, needs, and concerns into all aspects of U2U research. It is through this coupling of physical and social science disciplines that we strive to transform existing climate information into actionable knowledge.

K X-rays and nuclear reaction times in the deep inelastic reactions U+U and U+Pb at 7.5 MeV/amu

International Nuclear Information System (INIS)

Stoller, C.

1985-01-01

The K-shell ionisation probability of the heavy reaction products emerging from binary deep inelastic collisions of U + U and U + Pb at 7.5 MeV/amu has been measured as a function of the total kinetic energy loss - Q. After subtraction of the ionisation probability due to internal conversion of γ-rays, a strongly Q-dependent Psub(K) is found, in agreement with theoretical predictions relating the change in ionisation probability to the nuclear sticking time. The deduced nuclear reaction times are in qualitative agreement with predictions from nuclear models of deep inelastic reactions. (orig.)

U.S. nuclear industry

International Nuclear Information System (INIS)

Sherman, R.

1979-01-01

At present, 72 power reactors are in the condition of being able to operate in U.S., and the total installation capacity has reached 55 million kW, which is equivalent to about 9.5% of the total power generation capacity in U.S. The nuclear power stations produced 12.5% of the total electricity consumption in 1978. Especially in the north eastern part of the U.S., the nuclear power generation occupied 42% of the total power generation at the time of recent peak load, and 47 million barrels of crude oil and 517 million dollars of foreign currency were able to be saved. Moreover, 96 plants amounting to 105 million kW are under construction, and 30 plants of 35 million kW were ordered. Electric power companies, nuclear reactor makers, nuclear fuel and other related industries believe the merits of nuclear power generation and expect that it will flourish if a certain problem is solved. Especially serious problem to which the U.S. nuclear industry is facing now is the problem of uncertainty. Many orders of nuclear power plants have been canceled, and the constructions have been postponed. The capability of the U.S. nuclear industry to construct more than the required facilities, and its extent and the necessary conditions have been investigated by the Atomic Industrial Forum. The important national and international problems of atomic energy are discussed. (Kako, I.)

Transparency about multidimensional activities and performance: What can U-map and U-multirank contribute?

NARCIS (Netherlands)

Westerheijden, Donald F.; Rosa, Maria Joao; Amaral, Alberto

2014-01-01

Two new, user-driven and web-based transparency tools for higher education are presented: U-Map, a classification of higher education institutions according to their actual activities, and U-Multirank, a multidimensional ranking of higher education institutions’ and study fields’ performances. The

Preliminary assessment of the availability of U.S. natural gas resources to meet U.S. transportation energy demand

International Nuclear Information System (INIS)

Singh, M. K.; Moore, J. S.

2002-01-01

Recent studies have indicated that substitutes for conventional petroleum resources will be needed to meet U.S. transportation energy demand in the first half of this century. One possible substitute is natural gas which can be used as a transportation fuel directly in compressed natural gas or liquefied natural gas vehicles or as resource fuel for the production of hydrogen for fuel cell vehicles. This paper contains a preliminary assessment of the availability of U.S. natural gas resources to meet future U.S. transportation fuel demand. Several scenarios of natural gas demand, including transportation demand, in the U.S. to 2050 are developed. Natural gas resource estimates for the U. S. are discussed. Potential Canadian and Mexican exports to the U.S. are estimated. Two scenarios of potential imports from outside North America are also developed. Considering all these potential imports, U.S. natural gas production requirements to 2050 to meet the demand scenarios are developed and compared with the estimates of U.S. natural gas resources. The comparison results in a conclusion that (1) given the assumptions made, there are likely to be supply constraints on the availability of U.S. natural gas supply post-2020 and (2) if natural gas use in transportation grows substantially, it will have to compete with other sectors of the economy for that supply-constrained natural gas

The distribution of {sup 236}U/{sup 238}U in the North Atlantic and adjacent oceans; Die Verteilung von {sup 236}U/{sup 238}U im Nordatlantik und den angrenzenden Ozeanen

Energy Technology Data Exchange (ETDEWEB)

Christl, Marcus; Casacuberta, Nuria; Lachner, Johannes; Maxeiner, Sascha; Vockenhuber, Christof; Synal, Hans-Arno [Labor fuer Ionenstrahlphysik, ETH Zuerich (Switzerland); Herrmann, Juergen [Bundesamt fuer Seeschifffahrt und Hydroghraphie, Hamburg (Germany); Castrillejo, Maxi; Masque, Pere [Universitat Autonoma de Barcelona (Spain); Rutgers van der Loeff, Michiel [Alfred-Wegener-Institut, Bremerhaven (Germany)

2015-07-01

The technical developments of recent years, such as the introduction of helium as a stripping gas, make compact AMS systems probably among the most sensitive analyzers available for ultra-trace analyzes of actinides in the environment. Such systems are particularly suitable for the trace analysis of {sup 236}U since conventional mass spectrometry does not provide the necessary suppression of the substrate caused by molecules or neighboring masses. Over the past few years, unique data sets of {sup 236}U/{sup 238}U have been produced at the AMS System Tandy of the ETH Zurich in the Atlantic and Arctic Ocean as well as in the Mediterranean and the North Sea. This lecture will provide a brief overview of the latest technical developments in the field of heavy ion analysis at compact AMS plants at ETH Zurich. In the second part, the produced data sets are then assembled and the current understanding of this new ocean tracer discussed. [German] Die technischen Entwicklungen der letzten Jahre, wie zum Beispiel die Einfuehrung von Helium als stripper Gas, machen kompakte AMS Systeme wahrscheinlich zu den sensitivsten verfuegbaren Analysegeraeten fuer Ultra-Spurenstoffanalysen von Aktiniden in der Umwelt. Solche Systeme eignen sich im Besonderen zur Spurenanalyse von {sup 236}U, da konventionelle Massenspektrometrie hier nicht die erforderliche Unterdrueckung des durch Molekuele oder Nachbarmassen verursachten Untergrundes bietet. Am AMS System Tandy der ETH Zuerich wurden waehrend der letzten Jahre einzigartige Datensaetze von {sup 236}U/{sup 238}U im Atlantischen und Arktischen Ozean, sowie im Mittelmeer und der Nordsee produziert. In diesem Vortrag soll zunaechst ein kurzer Ueberblick ueber die neuesten technischen Entwicklungen im Bezug auf Schwerionen Analysen an kompakten AMS Anlagen der ETH Zuerich gegeben werden. Im zweiten Teil werden dann die produzierten Datensaetze zusammengefuegt und das gegenwaertige Verstaendnis dieses neuen Ozean-Tracers diskutiert.

Walls of massive K\\"ahler sigma models on SO(2N)/U(N) and Sp(N)/U(N)

OpenAIRE

Arai, Masato; Shin, Sunyoung

2011-01-01

We study the Bogomol'nyi-Prasad-Sommerfield wall solutions in massive K\\"ahler nonlinear sigma models on SO(2N)/U(N) and Sp(N)/U(N) in three-dimensional spacetime. We show that SO(2N)/U(N) and Sp(N)/U(N) models have 2^{N-1} and 2^N discrete vacua, respectively. We explicitly construct the exact BPS multiwall solutions for N\\le 3.

U.S. Coastal Relief Model

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

KARAKTERISTIKE I DJELOVANJE NASILJA U VIDEOIGRAMA

OpenAIRE

Valković, Jerko

2009-01-01

Nasilje u medijima nije samo preslika nasilja prisutnog u životu pojedinaca ili društva jer treba uvijek imati u vidu da medijska posredovanje nasilja koje se prezentim dobiva nove funkcije i novo značenje. Govor o utjecaju nasilja u medijima pretpostavlja razumijevanje funkcioniranja i specifičnosti samoga medija, značenja koje taj medij ima za pojedinca i širi društveni ambijent te, na osobit način, poznavanje dinamike koja se razvija prigodom konzumiranja medija. Jedno je od važnih obiljež...

Cyberinfrastructure for the collaborative development of U2U decision support tools

Directory of Open Access Journals (Sweden)

Larry L. Biehl

2017-01-01

Full Text Available This paper describes the use of cyberinfrastructure to create interactive applications as part of the Useful to Usable (U2U project. These applications transform historical climate data, knowledge, and models into decision support tools for end users such as crop farmers, university Extension educators, and other agricultural advisors. In creating a cyberinfrastructure to support the U2U project, four major challenges have been addressed: designing and developing highly usable web applications with frequent feedback, establishing a software engineering environment to support iterative development, integrating and synthesizing historical and current datasets from a variety of sources (local vs. remote, different access methods, and formats, and supporting project collaboration needs of data and document sharing, project management, and public outreach. The overall goals of the cyberinfrastructure and its architecture design are described. Methods for data retrieval and synthesis, as well as the various software components utilized are discussed. The development and integration of tools into the collaborative HUBzero framework are highlighted, including the use of HUBzero’s core features to share ideas, algorithms, and results. A highly iterative development process that includes feedback from experts and end-users to feed requirement definition, design and application updates are also examined.

Report on the Synchrotron Characterization of U-Mo and U-Zr Alloys and the Modeling Results

Energy Technology Data Exchange (ETDEWEB)

Okuniewski, Maria A. [Purdue Univ., West Lafayette, IN (United States); Ganapathy, Varsha [Purdue Univ., West Lafayette, IN (United States); Hamilton, Brenden [Purdue Univ., West Lafayette, IN (United States); Cassutt, Paul [Purdue Univ., West Lafayette, IN (United States); Zhang, Fan [Purdue Univ., West Lafayette, IN (United States); Velaquez, Daniel [Illinois Inst. of Technology, Chicago, IL (United States); Seibert, Rachel [Illinois Inst. of Technology, Chicago, IL (United States); Terry, Jeff [Illinois Inst. of Technology, Chicago, IL (United States); Sprouster, David [Brookhaven National Lab. (BNL), Upton, NY (United States); Ecker, Lynne [Brookhaven National Lab. (BNL), Upton, NY (United States); Elbakhshwan, Mohamed [Brookhaven National Lab. (BNL), Upton, NY (United States)

2016-09-01

ABSTRACT Uranium-molybdenum (U-Mo) and uranium-zirconium (U-Zr) are two promising fuel candidates for nuclear transmutation reactors which burn long-lived minor actinides and fission products within fast spectrum reactors. The objectives of this research are centered on understanding the early stages of fuel performance through the examination of the irradiation induced microstructural changes in U-Zr and U-Mo alloys subjected to low neutron fluences. Specimens that were analyzed include those that were previously irradiated in the Advanced Test Reactor at INL. This most recent work has focused on a sub-set of the irradiated specimens, specifically U-Zr and U-Mo alloys that were irradiated to 0.01 dpa at temperatures ranging from (150-800oC). These specimens were analyzed with two types of synchrotron techniques, including X-ray absorption fine structure and X-ray diffraction. These techniques provide non-destructive microstructural analysis, including phase identification and quantitation, lattice parameters, crystallite sizes, as well as bonding, structure, and chemistry. Preliminary research has shown changes in the phase fractions, crystallite sizes, and lattice parameters as a function of irradiation and temperature. Future data analyses will continue to explore these microstructural changes.

Analiza učinkovitosti učenja strojnika na stroju za sečnjo

OpenAIRE

Pezdevšek Malovrh, Špela; Košir, Boštjan; Krč, Janez

2004-01-01

Članek obravnava načine učenja bodočih strojnikov za delo s strojem za sečnjo.Na prvem takšnem primeru v Sloveniji je opisan in analiziran potek učenja s simulatorjem in merjeni so časi posameznih postopkov pri dveh kandidatih. Opisano je delovanje simulatorja za učenje na stroju Timberjack 1270 D in potek enotedenskega tečaja. Narejena je primerjava med kandidatoma glede porabe časa in števila poškodb na virtualnem stroju in sestoju, ki jih je beležil program simulatorja. Podane so usmeritve...

Norms and stigma regarding pregnancy decisions during an unintended pregnancy: Development and predictors of scales among young women in the U.S. South.

Directory of Open Access Journals (Sweden)

Whitney S Rice

Full Text Available Norms and stigma regarding pregnancy decisions (parenting, adoption, and abortion are salient to maternal well-being, particularly for groups disproportionately affected by unintended pregnancy. However, there are few validated measures of individual-level perceptions of norms and stigma around pregnancy decisions. Additionally, little is known about variation in the content of norms regarding pregnancy decisions, and in stigma related to violations of these norms, across socio-demographic groups.To create measures of perceived norms and stigma around pregnancy decisions, we developed and pre-tested 97 survey items using a mixed methods approach. The resulting survey was administered to 642 young adult women recruited from health department clinics and a public university campus in Birmingham, Alabama. Principal components factor analyses, reliability analyses, independent t-tests, and correlation analyses were conducted to establish the reliability and validity of scales. Additionally, multiple linear regression was used to identify demographic predictors of higher scale scores.Factor analyses revealed four subscales for each pregnancy decision: conditional acceptability, anticipated reactions, stereotypes/misperceptions, and attitudes. The total scales and their subscales demonstrated good internal reliability (alpha coefficients 0.72-0.94. The mean scores for each scale were significantly associated with each other, with related measures, and differed by sociodemographic characteristics. Specifically, in adjusted analyses, women in the university setting and White women expressed more negative attitudes and stigma around parenting. Minority women endorsed more negative norms and stigma around adoption. Finally, women from the health department, White women, and religious women expressed more negative norms and stigma around abortion.Findings suggest that our multidimensional measures have good psychometric properties in our sample of young

Norms and stigma regarding pregnancy decisions during an unintended pregnancy: Development and predictors of scales among young women in the U.S. South.

Science.gov (United States)

Rice, Whitney S; Turan, Bulent; Stringer, Kristi L; Helova, Anna; White, Kari; Cockrill, Kate; Turan, Janet M

2017-01-01

Norms and stigma regarding pregnancy decisions (parenting, adoption, and abortion) are salient to maternal well-being, particularly for groups disproportionately affected by unintended pregnancy. However, there are few validated measures of individual-level perceptions of norms and stigma around pregnancy decisions. Additionally, little is known about variation in the content of norms regarding pregnancy decisions, and in stigma related to violations of these norms, across socio-demographic groups. To create measures of perceived norms and stigma around pregnancy decisions, we developed and pre-tested 97 survey items using a mixed methods approach. The resulting survey was administered to 642 young adult women recruited from health department clinics and a public university campus in Birmingham, Alabama. Principal components factor analyses, reliability analyses, independent t-tests, and correlation analyses were conducted to establish the reliability and validity of scales. Additionally, multiple linear regression was used to identify demographic predictors of higher scale scores. Factor analyses revealed four subscales for each pregnancy decision: conditional acceptability, anticipated reactions, stereotypes/misperceptions, and attitudes. The total scales and their subscales demonstrated good internal reliability (alpha coefficients 0.72-0.94). The mean scores for each scale were significantly associated with each other, with related measures, and differed by sociodemographic characteristics. Specifically, in adjusted analyses, women in the university setting and White women expressed more negative attitudes and stigma around parenting. Minority women endorsed more negative norms and stigma around adoption. Finally, women from the health department, White women, and religious women expressed more negative norms and stigma around abortion. Findings suggest that our multidimensional measures have good psychometric properties in our sample of young women in the U

2010 U.S. Lighting Market Characterization

Energy Technology Data Exchange (ETDEWEB)

Ashe, Mary [Navigant Consulting, Inc., Chicago, IL (United States); Chwastyk, Dan [Navigant Consulting, Inc., Chicago, IL (United States); de Monasterio, Caroline [Navigant Consulting, Inc., Chicago, IL (United States); Gupta, Mahima [Navigant Consulting, Inc., Chicago, IL (United States); Pegors, Mika [Navigant Consulting, Inc., Chicago, IL (United States)

2012-01-01

The 2010 U.S. Lighting Market Characterization is the second report released by the U.S. Department of Energy’s Solid State Lighting Program that provides summary estimates of the installed stock, energy use, and lumen production of all lamps operating in the U.S, the first version being released in 2002.

U.S. - UK - Canada Trilateral Symposium

Science.gov (United States)

2009-10-02

e . 4. Procedures for intra-community arms transfers simplified. 5 Retransfer controls disco raged b t m st be. u u u complied with. Li d...IRIS – T • Airbus A310 refueller 10 FUTURE OF TRANSATLANTIC ARMAMENTS COOPERATION 1996 VISION – “I believe that national security – ours and that

China-U.S. Trade Issues

National Research Council Canada - National Science Library

Morrison, Wayne M

2005-01-01

.... With a huge population and a rapidly expanding economy, China is becoming a large market for U.S. exporters. Yet, U.S.-China commercial ties have been strained by a number of issues, including a surging...

Interdiffusion and reaction between U and Zr

Science.gov (United States)

Park, Y.; Newell, R.; Mehta, A.; Keiser, D. D.; Sohn, Y. H.

2018-04-01

The microstructural development and diffusion kinetics were examined for the binary U vs. Zr system using solid-to-solid diffusion couples, U vs. Zr, annealed at 580 °C for 960 h, 650 °C for 480 h, 680 °C for 240 h, and 710 °C for 96 h. Scanning and transmission electron microscopies with X-ray energy dispersive spectroscopy were employed for detailed microstructural and compositional analyses. Interdiffusion and reaction in U vs. Zr diffusion couples primarily produced: δ-UZr2 solid solution (hP3) and α‧-U at 580 °C; and (γU,βZr) solid solution (cI2) and α‧-U at 650°, 680° and 710 °C. The α‧-phase was confirmed as a reduced variant of the α-U orthorhombic structure with lattice parameters, a × b × c = 2.65 × 5.40 × 4.75 (Å) with a negligible solubility for Zr at room temperature. Concentration profiles were examined to determine interdiffusion coefficients, integrated interdiffusion coefficients, and intrinsic diffusion coefficients using Boltzmann-Matano, Wagner, and Heumann analyses, respectively. Composition-dependence of interdiffusion coefficients were documented for α-U, δ-UZr2 (at 580 °C) and (γU,βZr) solid solution (at 650°, 680° and 710 °C). U was determined to intrinsically diffuse faster than Zr, approximately by an order of magnitude, in the δ-UZr2 at 580 °C, and (γU,βZr) phases at 650°, 680° and 710 °C. Based on Darken's approach, thermodynamic data available in literature were coupled to estimate the tracer diffusion coefficients and atomic mobilities of U and Zr.

The U(3) principle as base of a microscopical U(3) model for the clarification of the phenomenon of nuclear molecules

International Nuclear Information System (INIS)

Bader, R.

1985-01-01

The tenor of this thesis is the regarding of the U(3) symmetry in the study of nuclear reactions. By the description of the two colliding fragments and their relative motion by means of U(3) quantum numbers U(3) channels and U(3) channel sets are defined. It is shown that in certain collisions the U(3) symmetry of U(3) channels is incompatible with the U(3) symmetry of the compound nucleus. For these U(3) channels the formation of the compound nucleus is forbidden. In this framework a microscopical U(3) model for the phenomenon of the nuclear molecule resonances is developed. U(3) barriers which play an important role in this model are responsible for the repulsion between the two fragments. By microscopical calculations it is confirmed that by the U(3) channels allowed above the U(3) barriers an attraction between the two fragments arises. This interchange of attraction and repulsion leads to the formation of nuclear molecules. Furthermore it is shown that this incompatibility and by this the phenomenon of nuclear molecule resonances can be reduced to an U(3) principle in which the Pauli principle is contained. Basing on this U(3) principle selection rules are formulated which predict candidates for nuclear molecule resonances. This explains why only some binary systems tend to the molecule formation. (orig./HSI) [de

78 FR 11141 - BE-577: Quarterly Survey of U.S. Direct Investment Abroad- Direct Transactions of U.S. Reporter...

Science.gov (United States)

2013-02-15

... BE-577: Quarterly Survey of U.S. Direct Investment Abroad-- Direct Transactions of U.S. Reporter With... that it is conducting the mandatory surveys titled BE-577, Quarterly Survey of U.S. Direct Investment Abroad--Direct Transactions of U.S. Reporter with Foreign Affiliate. This survey is authorized by the...

Search for Coulomb-induced multifragmentation in the reaction Gd+U at 36 MeV/u

International Nuclear Information System (INIS)

Bacri, C.O.; Squalli, M.; Borderie, B.; Frankland, J.D.; Parlog, M.; Rivet, M.F.; Tassan-Got, L.; Charvet, J.L.

1996-03-01

Coulomb-induced multifragmentation is looked for in the study of the system Gd+U at 36 MeV/u with the 4π INDRA detector. Events corresponding to fragment emission from a single source were selected in the system Gd+U using global variables. Different kinematical correlations between the emitted fragments are discussed. Comparisons with simulations are used to extract the shape of the system which decays by multifragmentation, and also to obtain quantitative information about possible expansion effects. (K.A.)

Community-based Approaches to Improving Accuracy, Precision, and Reproducibility in U-Pb and U-Th Geochronology

Science.gov (United States)

McLean, N. M.; Condon, D. J.; Bowring, S. A.; Schoene, B.; Dutton, A.; Rubin, K. H.

2015-12-01

The last two decades have seen a grassroots effort by the international geochronology community to "calibrate Earth history through teamwork and cooperation," both as part of the EARTHTIME initiative and though several daughter projects with similar goals. Its mission originally challenged laboratories "to produce temporal constraints with uncertainties approaching 0.1% of the radioisotopic ages," but EARTHTIME has since exceeded its charge in many ways. Both the U-Pb and Ar-Ar chronometers first considered for high-precision timescale calibration now regularly produce dates at the sub-per mil level thanks to instrumentation, laboratory, and software advances. At the same time new isotope systems, including U-Th dating of carbonates, have developed comparable precision. But the larger, inter-related scientific challenges envisioned at EARTHTIME's inception remain - for instance, precisely calibrating the global geologic timescale, estimating rates of change around major climatic perturbations, and understanding evolutionary rates through time - and increasingly require that data from multiple geochronometers be combined. To solve these problems, the next two decades of uranium-daughter geochronology will require further advances in accuracy, precision, and reproducibility. The U-Th system has much in common with U-Pb, in that both parent and daughter isotopes are solids that can easily be weighed and dissolved in acid, and have well-characterized reference materials certified for isotopic composition and/or purity. For U-Pb, improving lab-to-lab reproducibility has entailed dissolving precisely weighed U and Pb metals of known purity and isotopic composition together to make gravimetric solutions, then using these to calibrate widely distributed tracers composed of artificial U and Pb isotopes. To mimic laboratory measurements, naturally occurring U and Pb isotopes were also mixed in proportions to mimic samples of three different ages, to be run as internal

[Torque resistance of three different types of nickel-titanium rotary instruments].

Science.gov (United States)

Sun, Wei; Hou, Ben-xiang

2010-10-01

To compare torsional fracture of three different types of nickel-titanium rotary instruments ProTaper, Hero642 and Mtwo by making a stimulate models in vitro. Through the establishment of model in vitro, compared the different time with 3 kinds of nickel titanium file in cutting-edge bound occurs, and to observe the section of fractured instruments by scanning electron microscope. The resistence to torque was different from three types of nickel titanium instruments. The time to fracture of Mtwo was significantly longer than ProTaper's and Hero642's, but ProTaper's and Hero642's had no significant difference. Three kinds cross-sectional design were different, a lot of toughness nests were seen in broken surface. Most of them were ductile fracture. Time to fracture was influenced by the quality disfigurement. The resistance to torque of Mtwo was better than ProTaper and Hero642. The lifespan was influenced by the design of cross-section. The quality disfigurement of the files reduced the resistance to flexual fatigue.

31 CFR 800.226 - U.S. business.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. business. 800.226 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.226 U.S. business. The term U.S. business means any entity... subsidiary is a U.S. business. Corporation A and its branch or subsidiary is each also a foreign person...

Experiences in accessing the U.S. equity markets

International Nuclear Information System (INIS)

Gosbee, G. F. J.

1998-01-01

This paper was designed to deal with three issues: (1) reasons for the difficulty of attracting U.S. capital into Canada; (2) Canadian companies' need for U.S. capital, and (3) how to successfully attract U.S. capital. As far as the reasons for the difficulties of attracting U.S. capital are concerned, intense world-wide competition for U.S. capital, the relatively small capital needs in Canada, the relatively poorly developed reporting practices, passive management and shareholders, and Canada's more stringent regulatory practices were highlighted as being most responsible. As to whether Canadian companies need U.S. capital, the answer was in the affirmative, citing multiple expansion, shareholder base diversification and the large equity raising power of the U.S. market as contributing factors. With regard to attracting U.S. capital into Canada, the advice given included differentiating the company, adopting U.S. reporting practices, addressing regulatory concerns, obtaining U.S.listings, and outperforming competitors

Differences in U root-to-shoot translocation between plant species explained by U distribution in roots

Energy Technology Data Exchange (ETDEWEB)

Straczek, Anne; Duquene, Lise [Belgium Nuclear Research Centre (SCK.CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Wegrzynek, Dariusz [IAEA, Seibersdorf Laboratories, A-2444 Seibersdorf (Austria); Faculty of Physics and Applied Computer Science, AGH University of Science and Technology, Al. Mickiewicza 30, 30-059 Krakow (Poland); Chinea-Cano, Ernesto [IAEA, Seibersdorf Laboratories, A-2444 Seibersdorf (Austria); Wannijn, Jean [Belgium Nuclear Research Centre (SCK.CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium); Navez, Jacques [Royal Museum of Africa, Department of Geology, Leuvensesteenweg 13, 3080 Tervuren (Belgium); Vandenhove, Hildegarde, E-mail: hvandenh@sckcen.b [Belgium Nuclear Research Centre (SCK.CEN), Biosphere Impact Studies, Boeretang 200, 2400 Mol (Belgium)

2010-03-15

Accumulation and distribution of uranium in roots and shoots of four plants species differing in their cation exchange capacity of roots (CECR) was investigated. After exposure in hydroponics for seven days to 100 mumol U L{sup -1}, distribution of uranium in roots was investigated through chemical extraction of roots. Higher U concentrations were measured in roots of dicots which showed a higher CECR than monocot species. Chemical extractions indicated that uranium is mostly located in the apoplasm of roots of monocots but that it is predominantly located in the symplasm of roots of dicots. Translocation of U to shoot was not significantly affected by the CECR or distribution of U between symplasm and apoplasm. Distribution of uranium in roots was investigated through chemical extraction of roots for all species. Additionally, longitudinal and radial distribution of U in roots of maize and Indian mustard, respectively showing the lowest and the highest translocation, was studied following X-ray fluorescence (XRF) analysis of specific root sections. Chemical analysis and XRF analysis of roots of maize and Indian mustard clearly indicated a higher longitudinal and radial transport of uranium in roots of Indian mustard than in roots of maize, where uranium mostly accumulated in root tips. These results showed that even if CECR could partly explain U accumulation in roots, other mechanisms like radial and longitudinal transport are implied in the translocation of U to the shoot.

Differences in U root-to-shoot translocation between plant species explained by U distribution in roots

International Nuclear Information System (INIS)

Straczek, Anne; Duquene, Lise; Wegrzynek, Dariusz; Chinea-Cano, Ernesto; Wannijn, Jean; Navez, Jacques; Vandenhove, Hildegarde

2010-01-01

Accumulation and distribution of uranium in roots and shoots of four plants species differing in their cation exchange capacity of roots (CECR) was investigated. After exposure in hydroponics for seven days to 100 μmol U L -1 , distribution of uranium in roots was investigated through chemical extraction of roots. Higher U concentrations were measured in roots of dicots which showed a higher CECR than monocot species. Chemical extractions indicated that uranium is mostly located in the apoplasm of roots of monocots but that it is predominantly located in the symplasm of roots of dicots. Translocation of U to shoot was not significantly affected by the CECR or distribution of U between symplasm and apoplasm. Distribution of uranium in roots was investigated through chemical extraction of roots for all species. Additionally, longitudinal and radial distribution of U in roots of maize and Indian mustard, respectively showing the lowest and the highest translocation, was studied following X-ray fluorescence (XRF) analysis of specific root sections. Chemical analysis and XRF analysis of roots of maize and Indian mustard clearly indicated a higher longitudinal and radial transport of uranium in roots of Indian mustard than in roots of maize, where uranium mostly accumulated in root tips. These results showed that even if CECR could partly explain U accumulation in roots, other mechanisms like radial and longitudinal transport are implied in the translocation of U to the shoot.

U-Th Burial Dates on Ostrich Eggshell

Science.gov (United States)

Sharp, W. D.; Fylstra, N. D.; Tryon, C. A.; Faith, J. T.; Peppe, D. J.

2015-12-01

Obtaining precise and accurate dates at archaeological sites beyond the range of radiocarbon dating is challenging but essential for understanding human origins. Eggshells of ratites (large flightless birds including ostrich, emu and others) are common in many archaeological sequences in Africa, Australia and elsewhere. Ancient eggshells are geochemically suitable for the U-Th technique (1), which has about ten times the range of radiocarbon dating (>500 rather than 50 ka), making eggshells attractive dating targets. Moreover, C and N isotopic studies of eggshell provide insights into paleovegetation and paleoprecipitation central to assessing past human-environment interactions (2,3). But until now, U-Th dates on ratite eggshell have not accounted for the secondary origin of essentially all of their U. We report a novel approach to U-Th dating of eggshell that explicitly accounts for secondary U uptake that begins with burial. Using ostrich eggshell (OES) from Pleistocene-Holocene east African sites, we have measured U and 232Th concentration profiles across OES by laser ablation ICP-MS. U commonly peaks at 10s to 100s of ppb and varies 10-fold or more across the ~2 mm thickness of OES, with gradients modulated by the layered structure of the eggshell. Common Th is high near the shell surfaces, but low in the middle "pallisade" layer of OES, making it optimal for U-Th dating. We determine U-Th ages along the U concentration gradient by solution ICP-MS analyses of two or more fractions of the pallisade layer. We then estimate OES burial dates using a simple model for diffusive uptake of uranium. Comparing such "U-Th burial dates" with radiocarbon dates for OES calcite from the same shells, we find good agreement in 7 out of 9 cases, consistent with rapid burial and confirming the accuracy of the approach. The remaining 2 eggshells have anomalous patterns of apparent ages that reveal they are unsuitable for U-Th dating, thereby providing reliability criteria innate

U.S. Contributions to ITER

International Nuclear Information System (INIS)

Sauthoff, Ned R.

2005-01-01

The United States participates in the ITER project and program to enable the study of the science and technology of burning plasmas, a key programmatic element missing from the world fusion program. The 2003 U.S. decision to enter the ITER negotiations followed an extensive series of community and governmental reviews of the benefits, readiness, and approaches to the study of burning plasmas. This paper describes both the technical and the organizational preparations and plans for U.S. participation in the ITER construction activity: in-kind contributions, staff contributions, and cash contributions as well as supporting physics and technology research. Near-term technical activities focus on the completion of R and D and design and mitigation of risks in the areas of the central solenoid magnet, shield/blanket, diagnostics, ion cyclotron system, electron cyclotron system, pellet fueling system, vacuum system, tritium processing system, and conventional systems. Outside the project, the U .S. is engaged in preparations for the test blanket module program. Organizational activities focus on preparations of the project management arrangements to maximize the overall success of the ITER Project; elements include refinement of U.S. directions on the international arrangements, the establishment of the U.S. Domestic Agency, progress along the path of the U.S. Department of Energy's Project Management Order, and overall preparations for commencement of the fabrication of major items of equipment and for provision of staff and cash as specified in the upcoming ITER agreement

Strateški značaj informacijsko-komunikacijske tehnologije u suvremenom međunarodnom okolišu

OpenAIRE

Svete, Uroš

2006-01-01

Podaci, informacije, razumijevanje i znanje kao elementi kognitivne sheme uvijek determiniraju društvenu moć, isto tako uvijek posebno značajno utječu na političku i vojnu sferu. Za njihovu važnost znali su već u starom vijeku (Sun Tzu), te je stoga potpuno razumljivo da će i u vremenu opće društvene uporabe informacijsko-komunikacijske tehnologije (IKT) imati posebno velik utjecaj na međunarodne odnose, stanje sigurnosti te odnose sila u svijetu. Uporaba IKT je naime promijenila odnose izmeđ...

Boje u marketinškoj komunikaciji: određenje uloge boje kao medijatorne varijable u procesu komunikacije

OpenAIRE

Tkalac Verčič, Ana; Kuharić Smrekar, Anita

2007-01-01

Unatoč neospornoj važnosti boje u oglašavanju i marketinškoj komunikaciji općenito, broj istraživanja utjecaja boje na ovim je područjima vrlo malen. Stoga je primarni cilj ovog rada bio ponuditi neke osnovne smjernice i uvid u korištenje boja u komunikaciji. U radu se detaljnije istražuje percepcija boja, odnosno analizira povezivanje toplih i hladnih boja s proizvodima odnosno poduzećima; određuju se emocionalne asocijacije koje pojedine boje izazivaju, te se mjeri zapaženost primarnih, sek...

The Influence of Uranium Content and PVA/U Ratio on Physical Propertiesof PVA-U Gel and Its Oxide

International Nuclear Information System (INIS)

Damunir; W, Bangun; Indra-Suryawan; Endang-Nawangsih

2000-01-01

The influence of uranium content and PVA/U ratio on physical propertiesof PVA-U gel and its oxide has been investigated. Fifty milliliters of uranylnitrate solution containing 100 g U/l was neutralized using 1M NH 4 0H. Thesolution was converted into PVA-U sol by adding 9.18 % PVA while mixed andheated at 80 o C for 20 minutes. In order to find spherical gel, the solsolution was dropped into a 5 M NH 4 0H solution at room temperature. Theshape formed of the gels small spherical, shape of the formed gels werefiltered, washed and heated at 120 o C. After that the gels were calcined at800 o C for 4 hours. The formed U 3 O 8 particles. Under a similar method, theinfluence of uranium content from 150-400 g/l and the influence of PVA/Uratio of 6.5-12.5 % in 100 g U/l were studied. Characterization of the resultwas obtained from physical properties of the gel and its oxide in the form ofdensity using pycnometer, surface area using surface areameter with N 2 asabsorbent and particle size/ shape using a loop and optical microscope. Theexperimental results showed that both uranium content and PVA/U ratioaffected the physical properties of the kernel properties. The best resultoccurred at uranium content of 100 g/l and PVA/U 9.18 %. The resulted gelwith solid content of 89.17 %, density of 3.36 g/l and size of 124 μm. Theresulted oxide U 3 0 8 had density of 7.98 g U/l, surface area of specific of0.449 m 2 /g and grain size of 810 μm. (author)

Introduction: U.S. Homophile Internationalism.

Science.gov (United States)

Stein, Marc

2017-01-01

This article introduces "U.S. Homophile Internationalism," a special issue of the Journal of Homosexuality. The introduction provides a broad overview of the "U.S. Homophile Internationalism" archive and exhibit, which was published on the Outhistory Web site in 2015. The archive and exhibit consists of more than 800 U.S. homophile magazine articles, letters, and other items that referenced non-U.S. regions of the world from 1953 to 1964. The essays in the special issue focus on (1) Africa; (2) Asia and the Pacific; (3) Canada; (4) Latin America and the Caribbean; (5) the Middle East; and (6) Russia, the Soviet Union, and Eastern Europe. There is also an article that addresses the public history and digital humanities dimensions of the project. The introduction concludes by discussing the essays' common goals, themes, and concerns.

Strategie řízení třídy u studentů učitelství na praxi

OpenAIRE

Lojdová Kateřina; Škarková Lucie; Lukas Josef

2016-01-01

Cílem výzkumu je popsat strategie řízení třídy u studentů učitelství na praxi na druhém stupni českých základních škol. Právě řízení třídy je pro studenty učitelství na praxi obtížné. Nezvládnutí práce se třídou může vést až ke změně kariérní dráhy. Výzkum hloubkově interpretuje strategie řízení třídy u studentů učitelství na praxi a popisuje některé problémy, se kterými se studenti učitelství potýkají. Skrze strategie řízení třídy učitel ovlivňuje fyzický a sociální prostor školní třídy za ú...

Atomization of U3Si2/U3Si for research reactor fuel

International Nuclear Information System (INIS)

Kuk, Il Hiun

2004-01-01

Instead of comminuting, U 3 Si 2 /U 3 Si powders are produced by atomizating directly from the molten alloys. Many benefits are introduced by applying the atomization technique: reduction of the process, homogeneous alloy composition within a particle and between particles, increase of the thermal conductivity and decrease of the chemical reactivity with aluminium due to particle's spherical shape. (author)

Convergence of exterior solutions to radial Cauchy solutions for $\\partial_t^2U-c^2\\Delta U=0$

Directory of Open Access Journals (Sweden)

Helge Kristian Jenssen

2016-09-01

Full Text Available Consider the Cauchy problem for the 3-D linear wave equation $\\partial_t^2U-c^2\\Delta U=0$ with radial initial data $U(0,x=\\Phi(x=\\varphi(|x|$, $U_t(0,x=\\Psi(x=\\psi(|x|$. A standard result states that $U$ belongs to $C([0,T];H^s(\\mathbb{R}^3$ whenever $(\\Phi,\\Psi\\in H^s\\times H^{s-1}(\\mathbb{R}^3$. In this article we are interested in the question of how U can be realized as a limit of solutions to initial-boundary value problems on the exterior of vanishing balls $B_\\varepsilon$ about the origin. We note that, as the solutions we compare are defined on different domains, the answer is not an immediate consequence of $H^s$ well-posedness for the wave equation.

NESMRTONOSNO ORUŽJE: NAČELO RAZMJERNOSTI U ORUŽANOM SUKOBU I PRAVO NA ZDRAVLJE U POLICIJSKIM POSTUPANJIMA

Directory of Open Access Journals (Sweden)

Elisabeth Hoffberger

2017-01-01

Full Text Available Kada se govori o oružju, obično se pod njime podrazumijeva primjena smrtonosne tehnologije. S druge strane, u i izvan oružanih sukoba, često se koristi i tzv. nesmrtonosno oružje, kojemu svrha nije ubijanje, već oneposobljavanje pojedinaca ili vojnih ciljeva. Budući da nesmrtonosno oružje ne mora nužno uzrokovati smrt, ali uzrokuje ozbiljna ranjavanja i velike patnje, korištenje takvih sredstava otvara brojna humanitarna pitanja i pitanja zaštite ljudskih prava. Zabrana uzrokovanja suvišnih ozljeda i nepotrebne patnje, kao i zabrana neselektivnih napada su jedne od najznačajnijih zabrana u međunarodnom ratnom pravu, a koje se mogu primijeniti i na korištenje nesmrtonosnog oružja u oružanom sukobu. Međutim, primjena načela razmjernosti može dovesti do opravdavanja korištenja nesmrtonosnog oružja. To se opravdava očekivanim prednostima njegove primjene u oružanom sukobu, koje pretežu u odnosu na uzrokovane ljudske patnje. Stoga se postavlja pitanje postoji li „crvena linija“ njegove primjene. Učestalo pozivanje na primjenu načela razmjernosti može poništiti cilj i svrhu Ženevskih konvencija te dovesti do opravdavanja nezakonitog korištenja nesmrtonosnog oružja. Osim u oružanim sukobima, nesmrtonosno se oružje može koristiti i u policijskim postupanjima. U tim slučajevima osobito značenje ima zaštita ljudskih prava. Pri tomu se u obzir ne smije uzeti samo zabrana mučenja i uzrokovanja nečovječnih ili ponižavajućih patnji te pravo na život, već i pravo na zdravlje. Pravo na zdravlje ograničava i postavlja granice uporabe nesmrtonosnog oružja izvan okvira oružanog sukoba.

u-Constacyclic codes over F_p+u{F}_p and their applications of constructing new non-binary quantum codes

Science.gov (United States)

Gao, Jian; Wang, Yongkang

2018-01-01

Structural properties of u-constacyclic codes over the ring F_p+u{F}_p are given, where p is an odd prime and u^2=1. Under a special Gray map from F_p+u{F}_p to F_p^2, some new non-binary quantum codes are obtained by this class of constacyclic codes.

Temperature behavior of 12 wt.% U TRIGA fuel

Energy Technology Data Exchange (ETDEWEB)

Levine, S H; Geisler, G C; Totenbier, R E [Pennsylvania State University (United States)

1974-07-01

Stainless steel clad 12 wt % U TRIGA fuel elements have been used to refuel the Penn State University's Breazeale Reactor (PSBR). When 12 wt % U fuel containing nominally 55 gms of {sup 235}U per fuel element is substituted for the 8.5 wt % U fuel containing nominally 38 gms {sup 235}U, higher fuel temperatures were produced in the 12 wt % U fuel than in the 8.5 wt % U fuel at the same reactor powers. The higher fuel temperature can be related to the higher power densities in the 12 wt % U fuel. The power density is calculated to be 35% higher in the 12 wt % U fuel when 6 of these fuel elements are substituted for 8.5 wt % U fuel in the innermost ring, the B ring. Temperatures have been calculated for the 12 wt % U fuel in the above configuration for both steady state and pulse conditions, assuming a 35% higher fuel density in the 12 wt % U fuel and the results compare favorably with the experimental measurements. This is particularly true when the comparison is made with temperature data taken after exposing the new fuel elements to a series of pulses. These calculations and data will be presented at the meeting. (author)

I.L.U. kauplused = I.L.U. stores

Index Scriptorium Estoniae

2010-01-01

Tallinnas Rocca al Mare kaubanduskeskuses, Tartus Lõunakeskuses ja Pärnus Pärnu Keskuses asuvate I.L.U. kosmeetikakaupkuste sisekujundusest. Sisekujunduse autorid: Triinu Kuub, Andro Kööp, Andri Valk (Torpedo OÜ), nende tähtsamate tööde loetelu. Graafiline disain: reklaamifirma Tank

Sindromi prenaprezanja u području koljena

OpenAIRE

Pećina, Marko; Bojanić, Ivan; Hašpl, Miroslav

2002-01-01

Koljenski zglob sudjeluje praktički u svim aktivnostima pri radu i sportu (hodanje, trčanje, skakanje, udaranje nogom, klečanje, čučanje, penjanje). Oko koljenskog zgloba nalazi se mnogo hvatišta tetiva i mnogo sluznih vreća, a u cjelinu zgloba pripada i posebno građeni patelofemoralni zglob. Stoga ne začuđuje što se u koljenskom zglobu i oko njega često pojavljuju mikrotraumatska kumulirana oštećenja koja se manifestiraju ponajprije pojavom bolnih sindroma poznatih pod imenom sindroma prenap...

Odgovornost za svijet u misli Romana Guardinija

OpenAIRE

Domazet, Anđelko

2014-01-01

Teološki opus Romana Guardinija snažno je svjedočanstvo nastojanja da se katolička teologija izvede iz tjesnoće stoljećima dugog nepovjerenja prema svijetu i otvori za istinsko evanđeosko zalaganje u svijetu. U ovom razmišljanju sažeto iznosimo na vidjelo autorovo poimanje kršćanske odgovornosti u svijetu i za svijet. Rad je podijeljen u dva dijela. U prvom dijelu analizira se Gaurdinijev pogled na moderno doba (novi vijek). Svjestan dvoznačnosti moderne svijesti, on pozitivnu dimenziju moder...

Search for surviving actinides and superheavy nuclei in damped collisions of 238U with 238U and 248Cm

International Nuclear Information System (INIS)

Kratz, J.V.

1980-03-01

In the present talk aspects of the reaction mechanism related to the survival probability of the heaviest fragments in 238 U + 238 U collisions are discussed first. This is followed by a description of the experiments that have been performed to search for surviving superheavy fragments in the 238 U + 238 U reaction and by a presentation of the results obtained so far. In a third section our recent first attempts with the 238 U + 248 Cm reaction are described and preliminary results are discussed. (orig.)

Pub Culture in the U.K.

Institute of Scientific and Technical Information of China (English)

孙鑫

2015-01-01

In the U.K., pubs can be seen everywhere. They play an important role in the British society. How pubs came into being in the U.K.? Why is pub culture formed and what makes it prosperous? What effects does pub culture make on British society both in the past and in the present? Does any British character be shown in pub culture in the U.K.? In this paper, I will give a brief in-troduction of pub culture's history and development in the U.K.. Besides, the above questions will be explored and analyzed one by one.

7 CFR 51.3741 - U.S. Commercial.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Commercial. 51.3741 Section 51.3741 Agriculture... Standards for Grades of Honey Dew and Honey Ball Type Melons Grades § 51.3741 U.S. Commercial. “U.S. Commercial” consists of honey dew or honey ball type melons which meet the requirements of U.S. No. 1 grade...

29 CFR 6.42 - Amendments to pleadings.

Science.gov (United States)

2010-07-01

... scope of the original complaint and are tried by express or implied consent of the parties, they shall... Administrative Law Judge and upon such terms as he/she may approve. Such amendments shall be allowed when justice... such terms as are just, permit supplemental pleadings setting forth transactions, occurrences or events...

34 CFR 642.34 - Priorities for funding.

Science.gov (United States)

2010-07-01

... personnel, may select one or more of the following subjects as training priorities: (1) Basic skills instruction in reading, mathematics, written and oral communication, and study skills. (2) Counseling. (3...) Tutorial programs. (10) Retention and graduation strategies. (11) Support services for persons of limited...

Search Results | Page 642 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Search Results. Showing 6411 - 6420 of 9601 results. Project ... STI for Development in Asia : a Platform for Information Sharing and Learning. This project is based on the premise that science, technology and innovation (STI) are critical ...

47 CFR 73.642 - Subscription TV service.

Science.gov (United States)

2010-10-01

... expressed or implied, that: (1) Prevents or hinders it from rejecting or refusing any subscription TV..., service may be terminated. (ii) Charges, terms and conditions of service to subscribers must be applied... impositions of different sets of terms and conditions may be applied to subscribers in different...

Knjižnična podrška studentskom učenju i istraživanju: ocjena kvalitete hrvatskih visokoškolskih knjižnica u postupku reakreditacije visokih učilišta

Directory of Open Access Journals (Sweden)

Aleksandra Pikić

2016-12-01

Full Text Available Potpisivanjem Bolonjske deklaracije Republika Hrvatska obavezala se na kontinuirano praćenje kvalitete sustava za visoko obrazovanje, koje se u praksi između ostaloga odvija postupkom reakreditacije. Cilj ovog istraživanja bio je ispitati razinu uspješnosti hrvatskih visokoškolskih knjižnica pomoću analize ocjena knjižničnih resursa koje su dali članovi stručnih povjerenstava prvog ciklusa reakreditacije hrvatskih visokih učilišta. Istraživanje obuhvaća sva hrvatska visoka učilišta koja su prošla postupak reakreditacije od samog početka njezina provođenja (ak. god. 2010./11. pa do kraja 2015. U tom periodu kroz postupak je prošlo ukupno 129 visokih učilišta ili dijelova visokih učilišta. Rezultati su pokazali da su, ukupno gledajući, hrvatske visokoškolske knjižnice u prosjeku dobile ocjenu 3. Također se pokazalo da nema razlike u ocjeni knjižničnih resursa između sveučilišnih sastavnica te veleučilišta i visokih škola, zatim između javnih i privatnih visokih učilišta te na kraju između glavnih sveučilišnih središta: Zagreba, Splita, Rijeke i Osijeka.

Determination of 233U, 235U, 238U and 239Pu fission yields induced by fission and 14.7 MeV neutrons

International Nuclear Information System (INIS)

Laurec, Jean; Adam, Albert; Bruyne, Thierry de.

1981-12-01

The 233 U, 235 U, 238 U, 239 Pu fission yields have been determined by a radiochemical method. A target and a fission chamber made of same fissible material are irradied together. The total fission number is measured from the fission chamber. The fission product activities are directly measured on the target using calibrated Ge-Li detectors. The fissible material masses are determined by alpha and mass spectrometries. The irradiations were made on the critical assemblies PROSPERO and CALIBAN and on the 14 MeV neutron generator of C.E. VALDUC. 3 to 5% fission yield errors are got for the most measured nuclides: 95 Zr, 97 Zr, 99 Mo, 103 Ru, 131 I, 132 Te, 140 Ba, 141 Ce, 143 Ce, 144 Ce, 147 Nd [fr

U.S. Provides Support During Pakistan Flooding

Science.gov (United States)

U.S. Relief Continues in Pakistan U.S. Helicopters, Cargo Planes Continue Aid U.S., Pakistani Forces History Frequently Asked Questions Available jobs with DOD Top Issues Targeted Operations Against ISIL

Dark U (1)

International Nuclear Information System (INIS)

Chang, Chia-Feng; Ma, Ernest; Yuan, Tzu-Chiang

2015-01-01

In this talk we will explore the possibility of adding a local U(1) dark sector to the standard model with the Higgs boson as a portal connecting the visible standard model sector and the dark one. We will discuss existing experimental constraint on the model parameters from the invisible width of Higgs decay. Implications of such a dark U(1) sector on phenomenology at the Large Hardon Collider will be addressed. In particular, detailed results for the non-standard signals of multi-lepton-jets that arise from this simple dark sector will be presented. (paper)

PENGARUH SERBUK U-Mo HASIL PROSES MEKANIK DAN HYDRIDE – DEHYDRIDE – GRINDING MILL TERHADAP KUALITAS PELAT ELEMEN BAKAR U-Mo/Al

Directory of Open Access Journals (Sweden)

Supardjo Supardjo

2015-07-01

Full Text Available PENGARUH SERBUK U-Mo HASIL PROSES MEKANIK DAN HYDRIDE – DEHYDRIDE – GRINDING MILL TERHADAP KUALITAS PELAT ELEMEN BAKAR U-Mo/Al. Penelitian bahan bakar U-7Mo/Al tipe pelat dilakukan dalam rangka pengembangan bahan bakar U3Si2/Al untuk mendapatkan bahan bakar baru yang memiliki densitas uranium lebih tinggi, stabil selama digunakan sebagai bahan bakar di dalam reaktor dan mudah dilakukan proses olah ulangnya. Lingkup penelitian meliputi pembuatan: paduan U-7Mo dengan teknik peleburan, pembuatan serbuk U-7Mo dengan dikikir dan hydride - dehydride - grinding mill, IEB U-7Mo/Al dengan teknik kompaksi pada tekanan 20 bar, dan PEB U-7Mo/Al dengan teknik pengerolan panas pada temperatur 425oC. Paduan U-7Mo hasil proses peleburan cukup homogen, berat jenis 16,34 g/cm3 dan bersifat ulet, kemudian dibuat menjadi serbuk dengan cara dikikir dan hydride - dehydride - grinding mill. Serbuk U-7Mo hasil proses kikir berbentuk pipih, kontaminan Fe cukup tinggi, sedangkan serbuk hasil proses hydride - dehydride - grinding mill, cenderung equiaxial dengan kontaminan yang rendah. Kedua jenis serbuk U-7Mo tersebut digunakan sebagai bahan baku pembuatan IEB U-7Mo/Al dan PEB U-7Mo/Al dengan densitas uranium 7 gU/cm3 dan diperoleh produk dengan kualitas yang hampir sama. Hasil uji IEB U-7Mo/Al berukuran 25 x 15 x 3,15±0,05 mm, tidak terdapat cacat/retak, distribusi U-7Mo di dalam matriks cukup homogen dan tidak terdapat pengelompokan/aglomerasi U-7Mo yang berdimensi >1 mm. PEB U-7Mo/Al hasil pengerolan dengan tebal akhir 1,45 mm, memiliki ketebalan meat rerata 0,60 mm dan tebal kelongsong 0,4 mm dan terdapat 1 titik pengukuran kelongsong dengan ketebalan 0,15 mm. Dengan membandingkan penggunaan kedua jenis serbuk U-7Mo tersebut, IEB U-7Mo/Al dan PEB U-7Mo/Al yang dihasilkan memiliki kualitas hampir sama. Namun demikian penggunaan serbuk U- 7Mo hasil proses hydride - dehydride - grinding mill lebih baik karena proses pengerjaannya lebih cepat dan impuritas dalam

Global implications of U.S. power deregulation

International Nuclear Information System (INIS)

Maschoff, D.C.

1996-01-01

With U.S. power deregulation remaining a topic that is dominating the entire North American energy marketplace, this paper provides an update of events occurring in U.S. electric power markets, offering some observations about changes due to increasing competition in electric power markets, and discusses some reasons why the events in U.S. electric power markets will soon transform global energy markets. How quickly is the move from local service territory to global markets proceeding? More than fifty U.S. utility companies with revenues of over $1 billion (U.S.) will soon be actively seeking and participating in global business opportunities. Using the same logic that led them to pursue utility initiatives nationally, U.S. utilities will use their core capabilities to compete in global energy services markets. In connection with these global initiatives, U.S. utilities will bring the same fuel-neutral, gas-electric perspective to international electric power and natural gas markets. (Author)

Meet-U: Educating through research immersion.

Science.gov (United States)

Abdollahi, Nika; Albani, Alexandre; Anthony, Eric; Baud, Agnes; Cardon, Mélissa; Clerc, Robert; Czernecki, Dariusz; Conte, Romain; David, Laurent; Delaune, Agathe; Djerroud, Samia; Fourgoux, Pauline; Guiglielmoni, Nadège; Laurentie, Jeanne; Lehmann, Nathalie; Lochard, Camille; Montagne, Rémi; Myrodia, Vasiliki; Opuu, Vaitea; Parey, Elise; Polit, Lélia; Privé, Sylvain; Quignot, Chloé; Ruiz-Cuevas, Maria; Sissoko, Mariam; Sompairac, Nicolas; Vallerix, Audrey; Verrecchia, Violaine; Delarue, Marc; Guérois, Raphael; Ponty, Yann; Sacquin-Mora, Sophie; Carbone, Alessandra; Froidevaux, Christine; Le Crom, Stéphane; Lespinet, Olivier; Weigt, Martin; Abboud, Samer; Bernardes, Juliana; Bouvier, Guillaume; Dequeker, Chloé; Ferré, Arnaud; Fuchs, Patrick; Lelandais, Gaëlle; Poulain, Pierre; Richard, Hugues; Schweke, Hugo; Laine, Elodie; Lopes, Anne

2018-03-01

We present a new educational initiative called Meet-U that aims to train students for collaborative work in computational biology and to bridge the gap between education and research. Meet-U mimics the setup of collaborative research projects and takes advantage of the most popular tools for collaborative work and of cloud computing. Students are grouped in teams of 4-5 people and have to realize a project from A to Z that answers a challenging question in biology. Meet-U promotes "coopetition," as the students collaborate within and across the teams and are also in competition with each other to develop the best final product. Meet-U fosters interactions between different actors of education and research through the organization of a meeting day, open to everyone, where the students present their work to a jury of researchers and jury members give research seminars. This very unique combination of education and research is strongly motivating for the students and provides a formidable opportunity for a scientific community to unite and increase its visibility. We report on our experience with Meet-U in two French universities with master's students in bioinformatics and modeling, with protein-protein docking as the subject of the course. Meet-U is easy to implement and can be straightforwardly transferred to other fields and/or universities. All the information and data are available at www.meet-u.org.

The Danish FoU Programme

DEFF Research Database (Denmark)

Magnussen, Lisbeth; Gottlieb, Susanne; Maaløe, Inger

I 1999 modtog det danske erhvervsuddannelsessystem Bertelsmann Prisen for dets innovative kapacitet. En af de vigtigste faktorer for den kontinuerlige fornyelse af det danske erhvervsuddannelsessystem er det danske Forsøgs- og Udviklingsprogram (FoU). Publikationen beskriver det danske FoU progra...

Giant U waves: an important clinical clue

Directory of Open Access Journals (Sweden)

Verma N

2011-04-01

Full Text Available Nitin Verma, Vincent M Figueredo, Allan M Greenspan, Gregg S PressmanAlbert Einstein Medical Center, Philadelphia, PA, USAAbstract: Electrocardiographic U waves are a common clinical finding, and yet are poorly understood by many physicians. They can be seen in many clinical conditions, most importantly hypokalemia and ischemic heart disease. Over the years, many theories have been put forth to explain their origin. While still not completely understood, it now appears that mechanoelectrical interactions are responsible for normal U waves. Pathologic U waves may be seen in ischemic heart disease where they sometimes point to acute ischemic events. The large U waves of hypokalemia are most likely not true U waves but rather the terminal deflection in a bifid T wave.Keywords: U waves, hypokalemia, myocardial ischemia, electrocardiogram

[Laboratory diagnosis of mucormycosis].

Science.gov (United States)

Garcia-Hermoso, Dea

2013-03-01

Mucormycosis are deep infections caused by ubiquitous filamentous fungi of the order of Mucorales. The disease occurs mostly in immunocompromised, diabetic or solid organ transplant recipients. There are currently no specific diagnostic guidelines for mucormycosis. The histological examination and culture of the clinical sample remain the most useful approaches for diagnosis. Furthermore, alternative methods to the fungal culture are yet to be standardized. Here we review the current microbiological approaches used for the diagnosis and identification of Mucorales. © 2013 médecine/sciences – Inserm / SRMS.

Irradiation behaviour of solid and hollow U{sub 3}Si fuel elements: results to 15,000 MWd/tonne U

Energy Technology Data Exchange (ETDEWEB)

Feraday, M A; Chalder, G H; Cotnam, K D

1969-06-15

U{sub 3}Si fuel elements clad in zirconium alloy sheaths have been irradiated to burnups close to 15,000 MWd/tonne U in pressurized water at 220{sup o}C, 98 bars. The results show that the external swelling can be controlled by incorporating free volume in the element. The dimensional stability of such elements is adequate to permit their use in power reactor fuel bundles. A diameter increase of 1.2% had occurred in an element initially containing 12.8% total free volume, after a burnup of 14,700 MWd/tonne U. There was no change in diameter between burnups of 5200 and 14,700 MWd/tonne U. Elements containing 3% total free volume had increased in diameter about 2.5% at 2000 MWd/tonne U compared to 0.2% at 9500 MWd/tonne U for elements containing 22% total free volume. The observed swelling in the U{sub 3}Si is discussed in terms of possible mechanisms. (author)

Deploying the advanced U.S. EPR

International Nuclear Information System (INIS)

Hagan, C.

2007-01-01

As electricity demand, clean air concerns and energy prices increase in the U.S., interest in new nuclear reactors is also on the rise. These factors - along with decades of outstanding performance of the nation's existing nuclear fleet - have contributed to a favorable market for new nuclear power in the U.S. Although no U.S. company has declared it actually will buy and build new reactors, many have actively expressed their interest through investment and regulatory interaction. The timing is also right for new reactors in terms of public perception, government policy and acceptance of the investment community. Amid this environment, the U.S. commercial power industry recently has begun pursuing new nuclear generation in earnest. AREVA, whose ongoing global market analyses indicated the need for additional baseload nuclear generation in the U.S., chose to license its EPR design to meet that need. This article will discuss the American market landscape for new nuclear and how AREVA is approaching it, present an overview of the company's U.S. EPR technology, and provide an update on the regulatory status of the design and deployment schedule. (orig.)

U bodies respond to nutrient stress in Drosophila

International Nuclear Information System (INIS)

Buckingham, Mickey; Liu, Ji-Long

2011-01-01

The neurodegenerative disease spinal muscular atrophy (SMA) is caused by mutation of the survival motor neuron 1 (SMN1) gene. Cytoplasmic SMN protein-containing granules, known as U snRNP bodies (U bodies), are thought to be responsible for the assembly and storage of small nuclear ribonucleoproteins (snRNPs) which are essential for pre-mRNA splicing. U bodies exhibit close association with cytoplasmic processing bodies (P bodies), which are involved in mRNA decay and translational repression. The close association of the U body and P body in Drosophila resemble that of the stress granule and P body in yeast and mammalian cells. However, it is unknown whether the U body is responsive to any stress. Using Drosophila oogenesis as a model, here we show that U bodies increase in size following nutritional deprivation. Despite nutritional stress, U bodies maintain their close association with P bodies. Our results show that U bodies are responsive to nutrition changes, presumably through the U body–P body pathway.

U bodies respond to nutrient stress in Drosophila

Energy Technology Data Exchange (ETDEWEB)

Buckingham, Mickey; Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk

2011-12-10

The neurodegenerative disease spinal muscular atrophy (SMA) is caused by mutation of the survival motor neuron 1 (SMN1) gene. Cytoplasmic SMN protein-containing granules, known as U snRNP bodies (U bodies), are thought to be responsible for the assembly and storage of small nuclear ribonucleoproteins (snRNPs) which are essential for pre-mRNA splicing. U bodies exhibit close association with cytoplasmic processing bodies (P bodies), which are involved in mRNA decay and translational repression. The close association of the U body and P body in Drosophila resemble that of the stress granule and P body in yeast and mammalian cells. However, it is unknown whether the U body is responsive to any stress. Using Drosophila oogenesis as a model, here we show that U bodies increase in size following nutritional deprivation. Despite nutritional stress, U bodies maintain their close association with P bodies. Our results show that U bodies are responsive to nutrition changes, presumably through the U body-P body pathway.

75 FR 14135 - U.S. Travel And Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board

Science.gov (United States)

2010-03-24

... DEPARTMENT OF COMMERCE International Trade Administration U.S. Travel And Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade Administration, U.S. Department of Commerce. ACTION: Notice of an open meeting. SUMMARY: The U.S. Travel and Tourism Advisory...

75 FR 39496 - U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board

Science.gov (United States)

2010-07-09

... DEPARTMENT OF COMMERCE International Trade Administration U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade Administration, U.S. Department of Commerce. ACTION: Notice of an open meeting. SUMMARY: The U.S. Travel and Tourism Advisory...

Isoforms of U1-70k control subunit dynamics in the human spliceosomal U1 snRNP.

Directory of Open Access Journals (Sweden)

Helena Hernández

2009-09-01

Full Text Available Most human protein-encoding genes contain multiple exons that are spliced together, frequently in alternative arrangements, by the spliceosome. It is established that U1 snRNP is an essential component of the spliceosome, in human consisting of RNA and ten proteins, several of which are post-translationally modified and exist as multiple isoforms. Unresolved and challenging to investigate are the effects of these post translational modifications on the dynamics, interactions and stability of the particle. Using mass spectrometry we investigate the composition and dynamics of the native human U1 snRNP and compare native and recombinant complexes to isolate the effects of various subunits and isoforms on the overall stability. Our data reveal differential incorporation of four protein isoforms and dynamic interactions of subunits U1-A, U1-C and Sm-B/B'. Results also show that unstructured post-translationally modified C-terminal tails are responsible for the dynamics of Sm-B/B' and U1-C and that their interactions with the Sm core are controlled by binding to different U1-70k isoforms and their phosphorylation status in vivo. These results therefore provide the important functional link between proteomics and structure as well as insight into the dynamic quaternary structure of the native U1 snRNP important for its function.

Phenolic indeno[1,2-b]indoles as ABCG2-selective potent and non-toxic inhibitors stimulating basal ATPase activity

Directory of Open Access Journals (Sweden)

Gozzi GJ

2015-07-01

Full Text Available Gustavo Jabor Gozzi,1,2 Zouhair Bouaziz,3 Evelyn Winter,1,4 Nathalia Daflon-Yunes,1 Mylène Honorat,1 Nathalie Guragossian,3 Christelle Marminon,3 Glaucio Valdameri,1,2 Andre Bollacke,5 Jean Guillon,6 Noël Pinaud,7 Mathieu Marchivie,8 Silvia M Cadena,2 Joachim Jose,5 Marc Le Borgne,3 Attilio Di Pietro11Equipe Labellisée Ligue 2014, BMSSI UMR5086 CNRS/Lyon I University, IBCP, Lyon, France; 2Department of Biochemistry and Molecular Biology, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Faculty of Pharmacy – ISPB, EA 4446 Biomolecules, Cancer and Chemoresistance, Health SFR of East Lyon CNRS UMS3453 - INSERM US7, University of Lyon, Lyon I University, Lyon Cedex 8, France; 4Department of Pharmaceutical Sciences, PGFAR, Federal University of Santa Catarina, Florianopolis, Santa Catarina, Brazil; 5Institute of Pharmaceutical and Medicinal Chemistry, University of Münster, Münster, Germany; 6ARNA Laboratory, Pharmaceutical Sciences UFR, INSERM U869, University of Bordeaux, Bordeaux Cedex, France; 7ISM – CNRS UMR 5255, University of Bordeaux Cedex, France; 8ICMCB CNRS-UPR 9048, University of Bordeaux, Pessac Cedex, FranceAbstract: Ketonic indeno[1,2-b]indole-9,10-dione derivatives, initially designed as human casein kinase II (CK2 inhibitors, were recently shown to be converted into efficient inhibitors of drug efflux by the breast cancer resistance protein ABCG2 upon suited substitutions including a N5-phenethyl on C-ring and hydrophobic groups on D-ring. A series of ten phenolic and seven p-quinonic derivatives were synthesized and screened for inhibition of both CK2 and ABCG2 activities. The best phenolic inhibitors were about threefold more potent against ABCG2 than the corresponding ketonic derivatives, and showed low cytotoxicity. They were selective for ABCG2 over both P-glycoprotein and MRP1 (multidrug resistance protein 1, whereas the ketonic derivatives also interacted with MRP1, and they additionally displayed a lower

Figlina u Fažani i njezina preobrazba u kasnoj antici

OpenAIRE

Bulić, Davor; Koncani Uhač, Ida

2011-01-01

Figlina u Fažani prvi se put spominje u stručnoj literaturi početkom XX. stoljeća. Proučavanje proizvoda i njihove distribucije na tržište te pitanje vlasništva figline intenzivira se kroz zadnja tri desetljeća prošlog stoljeća. Zaštitna arheološka istraživanja (2007. - 2009.) omogućila su prikupljanje više ili manje cjelovitih podataka o mikrolokaciji radioničkog kompleksa i keramičkih proizvoda. Ovaj prilog predstavlja pokušaj sistematizacije dostupnih podataka i njihov...

Method of preparing D-mannose(U-14C) from glucons(U-14C) separated from natural material

International Nuclear Information System (INIS)

Kucar, S.; Zemek, J.; Bilik, V.; Kolina, J.

1981-01-01

Glucans(U- 14 C) separated from green or blue-green algae are hydrolysed using diluted mineral acids in the presence of small amounts of molybdate ions to D-glucose(U- 14 C) which, at a temperature of 60 to 100 degC epimerizes to D-mannose(U- 14 C). The epimeric aldoses are separated from the reaction mixture by paper chromatography. (H.S.)

New zircon (U-Th)/He and U/Pb eruption age for the Rockland tephra, western USA

Science.gov (United States)

Coble, Matthew A.; Burgess, Seth D.; Klemetti, Erik W.

2017-09-01

Eruption ages of a number of prominent Quaternary volcanic deposits remain inaccurately and/or imprecisely constrained, despite their importance as regional stratigraphic markers in paleo-environment reconstruction and as evidence of climate-altering eruptions. Accurately dating volcanic deposits presents challenging analytical considerations, including poor radiogenic yield, scarcity of datable minerals, and contamination of crystal populations by magma, eruption, and transport processes. One prominent example is the Rockland tephra, which erupted from the Lassen Volcanic Center in the southern Cascade arc. Despite a range in published eruption ages from 0.40 to 0.63 Ma, the Rockland tephra is extensively used as a marker bed across the western United States. To more accurately and precisely constrain the age of the Rockland tephra-producing eruption, we report U/Pb crystallization dates from the outermost ∼2 μm of zircon crystal faces (surfaces) using secondary ion mass spectrometry (SIMS). Our new weighted mean 238U/206Pb age for Rockland tephra zircon surfaces is 0.598 ± 0.013 Ma (2σ) and MSWD = 1.11 (mean square weighted deviation). As an independent test of the accuracy of this age, we obtained new (U-Th)/He dates from individual zircon grains from the Rockland tephra, which yielded a weighted mean age of 0.599 ± 0.012 Ma (2σ, MSWD = 5.13). We also obtained a (U-Th)/He age of 0.628 ± 0.014 Ma (MSWD = 1.19) for the Lava Creek Tuff member B, which was analyzed as a secondary standard to test the accuracy of the (U-Th)/He technique for Quaternary tephras, and to evaluate assumptions made in the model-age calculation. Concordance of new U/Pb and (U-Th)/He zircon ages reinforces the accuracy of our preferred Rockland tephra eruption age, and confirms that zircon surface dates sample zircon growth up to the time of eruption. We demonstrate the broad applicability of coupled U/Pb zircon-surface and single-grain zircon (U-Th)/He geochronology to accurate

Activity profiles in U17, U20 and senior women's Brazilian National soccer teams during international competitions: Are there meaningful differences?

Science.gov (United States)

Ramos, Guilherme P; Nakamura, Fábio Y; Penna, Eduardo M; Wilke, Carolina Franco; Pereira, Lucas A; Loturco, Irineu; Capelli, Luciano; Mahseredjian, Fábio; Silami-Garcia, Emerson; Coimbra, Cândido C

2017-07-31

The aim of this study was to compare locomotor activity profiles of Brazilian top-class female soccer players competing at distinct age brackets (U17, U20, and Senior). External match load of 14 U17, 14 U20, and 17 Senior female soccer players competing in 6-7 full official international matches were assessed using global positioning systems (GPS). Total distance covered, distance covered in high intensity (HID:15.6-20 kmh), distance covered in sprints (sprint:>20 kmh), number of accelerations (Acc)>1 ms, decelerations (Dec) >-1 ms, and Player Load generally increased across the age brackets (U17Senior). For all playing positions, Senior athletes presented greater total distance, accelerations, and decelerations than U20 players. For high-intensity distance and sprints, only central defender and midfielder senior players presented greater values than U20 players. Senior players demonstrated higher values in all locomotor activities in comparison to U17 players, irrespective of playing positions. Except for central defenders that presented similar total distance, sprint distance, and number of accelerations between U20 and U17, the majority of match external loads evaluated in all playing positions were greater in U20 than in U17 players. These results provide useful information for player development and should be used to establish appropriate match-specific conditioning drills according to age categories.

75 FR 80039 - U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board

Science.gov (United States)

2010-12-21

... DEPARTMENT OF COMMERCE International Trade Administration U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade Administration, U.S... agenda for an open meeting of the U.S. Travel and Tourism Advisory Board (Board). The agenda may change...

76 FR 21703 - U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board

Science.gov (United States)

2011-04-18

... DEPARTMENT OF COMMERCE International Trade Administration U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade Administration, U.S... agenda for an open meeting of the U.S. Travel and Tourism Advisory Board (Board). The agenda may change...

76 FR 53666 - U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board

Science.gov (United States)

2011-08-29

... DEPARTMENT OF COMMERCE International Trade Administration U.S. Travel and Tourism Advisory Board: Meeting of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade Administration, U.S... agenda for an open meeting of the U.S. Travel and Tourism Advisory Board (Board). The agenda may change...

Assessing Hubbard-corrected AM05+U and PBEsol+U density functionals for strongly correlated oxides CeO_2 and Ce_2O_3

International Nuclear Information System (INIS)

Weck, Philippe F.; Kim, Eunja

2016-01-01

The structure–property relationships of bulk CeO_2 and Ce_2O_3 have been investigated using AM05 and PBEsol exchange–correlation functionals within the frameworks of Hubbard-corrected density functional theory (DFT+U) and density functional perturbation theory (DFPT+U). Compared with conventional PBE+U, RPBE+U, PW91+U and LDA+U functionals, AM05+U and PBEsol+U describe experimental crystalline parameters and properties of CeO_2 and Ce_2O_3 with superior accuracy, especially when +U is chosen close to its value derived by the linear-response approach. Lastly, the present findings call for a reexamination of some of the problematic oxide materials featuring strong f- and d-electron correlation using AM05+U and PBEsol+U.

Microstructural and thermodynamic evaluation of as-cast U-rich U-Zr alloys

International Nuclear Information System (INIS)

Basak, Chandrabhanu; Prasad, G.J.; Kamath, H.S.

2009-01-01

The present study involves evaluation of microstructures and some basic properties of as-cast uranium rich U-Zr alloys; i.e. uranium alloys containing 2wt%, 5wt%, 7wt% and 10 wt% zirconium. Microstructural evaluation, both optical and SEM, with hardness values are reported. It was shown that a definite correlation exists between the microstructure and the hardness of the alloy. Lattice parameter and densities are determined with the help of XRD analysis. Also the phase transformation mechanism is proposed based on the microstructures and XRD analysis. Thermodynamic analysis coupled with the experimental observation reveals that the lamellar structure found in the as-cast U-rich U-Zr alloys originates from the monotectoid reaction (γ→β + γ'). As Zr concentration increases in the alloy the gamma phase can remain in the metastable state even at lower T. So, with increasing Zr content the monotectoid reaction takes place at lower temperature causing generation of finer lamellae. (author)

Conditions of integrability of two equations of the type usub(t)=A(u)usub(xx) + F(u, usub(x)). 1

International Nuclear Information System (INIS)

Mikhajlov, A.V.; Shabat, A.B.; AN SSSR, Ufa. Bashkirskij Filial)

1985-01-01

Necessary conditions of the existence of nontrivial conservation laws for systems of nonlinear equations usub(t)=a(u, ν)usub(xx)+b(u, ν)νsub(xx)+f(u, ν, usub(x), νsub(x)); -νsub(t)=c(u, ν)usub(xx)+d(u, ν)νsub(xx)+g(u, ν, usub(x), νsub(x) are found. They are of the form of densities of local conservation laws constructed from the coefficients of the system. They can easily be checked in each concrete case. Modulus of simple invertible substitutions is discussed which makes it possible to bring the system into the canonical form if certain integrability conditions are fulfilled

Behaviour of high O/U fuel

International Nuclear Information System (INIS)

Davies, J.H.; Hoshi, E.V.; Zimmerman, D.L.

2000-01-01

Full text: The effect of increased fuel oxygen potential on fuel behaviour has been studied by fabricating and irradiating urania fuel with an average O/U ratio of 2.05. The fuel was fabricated by re-sintering standard urania pellets in a controlled oxygen potential environment and irradiated in a segmented rod bundle in a U.S. BWR. Preirradiation ceramographic characterization of the pellets revealed the well-known Widmanstaetten precipitation of U-409 platelets in the UO 2 matrix. The high O/U fuel pellets were clad in Zircaloy-2 and irradiated to over 20 GWd/MT. Ramp tests were performed in a test reactor and detailed postirradiation examinations of both ramped and nonramped rods have been performed. The cladding inner surface condition, fission gas release and swelling behavior of high O/U fuel have been characterized and compared with standard UO 2 pellets. Although fuel microstructural features in ramp-tested high O/U fuel showed evidence of higher fuel temperatures and/or enhanced transport processes, fission gas release to the fuel rod free space was less than for similarly tested standard UO 2 fuel. However, fuel swelling and cladding strains were significantly greater. In spite of high cladding strains, PCI crack propagation was inhibited in the high O/U fuel I rods. Evidence is presented that the crystallographically oriented etch features often noted in peripheral regions of high burnup fuels are not an indication of higher oxides of uranium. (author)

Nuclear proliferation: the U.S.-Indian conflict

International Nuclear Information System (INIS)

Chellaney, Brahma.

1993-01-01

The history of the present conflicting positions of U.S. and India on the issue of nuclear proliferation is narrated and various aspects of this U.S. India controversy are studied. These aspects are: U.S.-India cooperation in the nuclear field in the fifties and sixties; India's peaceful nuclear explosion (PNE) in 1974 and U.S. policy of containment through denial of nuclear fuel and spare parts supply for Tarapur Atomic Power Station; and the political, technical and legal aspects of the nuclear conflict between U.S. and India. Since India's PNE in 1974, U.S. has made India a target of its non-proliferation strategy and is coordinating multinational efforts in erecting barriers in the flow of dual-use sensitive technologies to India. The recent instance is U.S. pressure on Russia to cancel the contract with India to sell cryogenic rocket engine technology required for India's civilian space programme. Even though apparently the conflict is over nuclear proliferation issue, in essence it is a conflict between U.S. determination to restrict high-technology transfer to India on one hand and India's resolve to maintain its nuclear independence on the other hand. The study is based on primary sources in the form of U.S. and Indian government documents. Texts of important government documents are given in appendices and bibliographies of primary and secondary sources used in the study are included. (M.G.B.)

State diagram of U-Al-Si as a basis for analysis of the processes in nuclear fuel compositions based on U(Al, Si)3 and U3Si compounds

International Nuclear Information System (INIS)

Chebotarev, N.T.; Konovalov, L.N.; Zhmak, V.A.; Chebotarev, Ya.N.

1996-01-01

Results of studies into the Al-UAl 3 -USi 3 -Si of the U-Al-Si ternary system are presented. It is established that phase equilibrium between the intermetallic compound U(Al, Si) 3 and the aluminium-silicon alloys may be presented in form of conodes on the isothermal cross-section of the state diagram. It is shown that the U(Al, Si) 3 intermetallic compound, containing up to 6.5 at.% silicon, interacts both with liquid and solid aluminium with the U(Al, Si) 4 phase formation [ru

Study of U - Pu - Fe alloys (Masurca critical experiment); Etudes d'alliages U-Pu-Fe (experience critique MASURCA)

Energy Technology Data Exchange (ETDEWEB)

Barthelemy, P; Boucher, R [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1965-07-01

Three compositions have been studied: 73.5 U - 25 Pu - 1.5 Fe (weight %) 74 U - 25 Pu - 1 Fe 74.5 U - 25 Pu - 0.5 Fe Elaboration and Casting are easy. After two weeks in air 74.5 U - 25 Pu - 0.5 Fe alloys are reduced in powder. As-cast alloys containing 1 and 1,5% Fe are kept undamaged during several months. A rapid oxidisation of the alloys is however observed when the samples undergo the phase transformation (at 595 deg. C and 590 deg. C respectively). Ignition tests in the presence of air show that the oxidisation starts at about 250 deg. C and that the reaction does not spread. Ignition is not observed during heating from 20 to 660 deg. C. The transformation temperature, the melting temperature and the thermal expansion coefficients have been determined by dilatometry. Below the transformation temperature, the principal phases are U-Pu zeta and (U, Pu){sub 6}Fe. Thermal conductibility, Young modulus, density and heat of fusion have been measured. Compatibility tests show that between U-Pu-Fe and stainless steel a phase of (U, Pu){sub 6}Fe type is formed. The 74 U - 25 Pu - 1% Fe alloy seems to behave better than 73.5 U - 25 Pu - 1.5% Fe alloy because the (U, Pu){sub 6}Fe layer is two or three times smaller. Finally, the thermal stability has been studied with the 74 U - 25 Pu - 1% Fe alloy. A dilatometric anomaly (very weak expansion) occurs when the sample is heated above transformation temperature and cooled. But there is no anomaly by thermal cycling from 50 deg. C to 400 deg. C and there is no deterioration of alloys by heat treatments at 100 deg. C, 200 deg. C, 300 deg. C during 5 months under vacuum. (authors) [French] Trois compositions ont ete etudiees: 73,5 U - 25 Pu - 1,5 Fe (% ponderaux) 74 U - 25 Pu - 1 Fe 74,5 U - 25 Pu - 0,5 Fe Les elaborations et mises en forme sont-faciles. Les alliages a 0,5% de fer tombent en poudre apres 15 jours d'exposition a l'air. Les alliages a 1 et 1,5% de fer, bruts de coulee, se conservent plusieurs mois. Cependant

Activity disequilibrium between 234U and 238U isotopes in natural environment

OpenAIRE

Bory?o, Alicja; Skwarzec, Bogdan

2014-01-01

The aim of this work was to calculate the values of the 234U/238U activity ratio in natural environment (water, sediments, Baltic organisms and marine birds from various regions of the southern Baltic Sea; river waters (the Vistula and the Oder River); plants and soils collected near phosphogypsum waste heap in Wi?linka (Northern Poland) and deer-like animals from Northern Poland. On the basis of the studies it was found that the most important processes of uranium geochemical migration in th...

Theory U

DEFF Research Database (Denmark)

Guillet de Monthoux, Pierre; Statler, Matt

2017-01-01

The recent Carnegie report (Colby, et al., 2011) characterizes the goal of business education as the development of practical wisdom. In this chapter, the authors reframe Scharmer's Theory U as an attempt to develop practical wisdom by applying certain European philosophical concepts. Specifically...

Wi-Fi Coexistence with Duty Cycled LTE-U

Directory of Open Access Journals (Sweden)

Yimin Pang

2017-01-01

Full Text Available Coexistence of Wi-Fi and LTE-Unlicensed (LTE-U technologies has drawn significant concern in industry. In this paper, we investigate the Wi-Fi performance in the presence of duty cycle based LTE-U transmission on the same channel. More specifically, one LTE-U cell and one Wi-Fi basic service set (BSS coexist by allowing LTE-U devices to transmit their signals only in predetermined duty cycles. Wi-Fi stations, on the other hand, simply contend the shared channel using the distributed coordination function (DCF protocol without cooperation with the LTE-U system or prior knowledge about the duty cycle period or duty cycle of LTE-U transmission. We define the fairness of the above scheme as the difference between Wi-Fi performance loss ratio (considering a defined reference performance and the LTE-U duty cycle (or function of LTE-U duty cycle. Depending on the interference to noise ratio (INR being above or below −62 dbm, we classify the LTE-U interference as strong or weak and establish mathematical models accordingly. The average throughput and average service time of Wi-Fi are both formulated as functions of Wi-Fi and LTE-U system parameters using probability theory. Lastly, we use the Monte Carlo analysis to demonstrate the fairness of Wi-Fi and LTE-U air time sharing.

Comparison of U(VI) adsorption onto nanoscale zero-valent iron and red soil in the presence of U(VI)–CO_3/Ca–U(VI)–CO_3 complexes

International Nuclear Information System (INIS)

Zhang, Zhibin; Liu, Jun; Cao, Xiaohong; Luo, Xuanping; Hua, Rong; Liu, Yan; Yu, Xiaofeng; He, Likai

2015-01-01

Highlights: • NZVI can be used for adsorbing U(VI)–CO_3 complexes. • Use of NZVI is feasible for remediation of uranium-contaminated soils. • The mechanism of U(VI)–CO_3 complexes adsorbing onto NZVI has been explained. - Abstract: The influence of U(VI)–CO_3 and Ca–U(VI)–CO_3 complexes on U(VI) adsorption onto red soil and nanoscale zero-valent iron (NZVI) was investigated using batch adsorption and fixed-bed column experiments to simulate the feasibility of NZVI as the reactive medium in permeable- reactive barriers (PRB) for in situ remediation of uranium-contaminated red soils. The adsorption capacity (q_e) and distribution constant (K_d) of NZVI and red soil decreased with increasing pH, dissolved carbonate and calcium concentrations, but the q_e and K_d values of NZVI were 5–10 times higher than those of red soil. The breakthrough pore volume (PV) values increased with the decrease of pH, dissolved carbonate and calcium concentration; however, the breakthrough PV values of the PRB column filled with 5% NZVI were 2.0–3.5 times higher than the 100% red soil column. The U(VI)–CO_3 complexes adsorbed onto the surface of red soil/NZVI (≡SOH) to form SO–UO_2CO_3"− or SO–UO_2 (CO_3)_2"3"−. XPS and XRD analysis further confirmed the reduction of U(VI) to U(IV) and the formation of FeOOH on NZVI surfaces. The findings of this study are significant to the remediation of uranium-contaminated red soils and the consideration of practical U(VI) species in the natural environment.

Damage estimates for European and U.S.sites using the U.S. high-cycle fatigue data base

Energy Technology Data Exchange (ETDEWEB)

Sutherland, H J [Wind Energy Technology, Sandia National Lab., Albuquerque, NM (United States)

1996-09-01

This paper uses two high-cycle fatigue data bases, one for typical U.S. blade materials and one for European materials, to analyze the service lifetime of a wind turbine blade subjected to the WISPER load spectrum for northern European sites and the WISPER protocol load spectrum for U.S. wind farm sites. The U.S. data base contains over 2200 data points that were obtained using coupon testing procedures. These data are used to construct a Goodman diagram that is suitable for analyzing wind turbine blades. This result is compared to the Goodman diagram derived from the European fatigue data base FACT. The LIFE2 fatigue analysis code for wind turbines is then used to predict the service lifetime of a turbine blade subjected to the two loading histories. The results of this study indicate that the WISPER load spectrum from northern European sites significantly underestimates the WISPER protocol load spectrum from a U.S. wind farm site, i.e., the WISPER load spectrum significantly underestimates the number and magnitude of the loads observed at a U.S. wind farm site. Further, the analysis demonstrate that the European and the U.S. fatigue material data bases are in general agreement for the prediction of tensile failures. However, for compressive failures, the two data bases are significantly different, with the U.S. data base predicting significantly shorter service lifetimes than the European data base. (au) 14 refs.

Selective abrogation of the uPA-uPAR interaction in vivo reveals a novel role in suppression of fibrin-associated inflammation

DEFF Research Database (Denmark)

Connolly, Brian M; Choi, Eun Young; Gårdsvoll, Henrik

2010-01-01

the interaction between endogenous uPA and uPAR is selectively abrogated, whereas other functions of both the protease and its receptor are retained. Specifically, we introduced 4 amino acid substitutions into the growth factor domain (GFD) of uPA that abrogate uPAR binding while preserving the overall structure...... a principal in vivo role of the uPA-uPAR interaction in cell-associated fibrinolysis critical for suppression of fibrin accumulation and fibrin-associated inflammation and provides a valuable model for further exploration of this multifunctional receptor....

Perspectives on biogeochemistry

National Research Council Canada - National Science Library

Degens, Egon T

1989-01-01

... Heidelberg New York London Paris Tokyo CopyrightProfessor Dr. EGON T. DEGENS formerly Institute of Biogeochemistry and Marine Chemistry at the Center of Marine Research and Climatology University of Hamburg BundesstraBe 55 2000 Hamburg 13, FRG t ISBN 978-3-540-50191-6 DOl 10.1007/978-3-642-48879-5 ISBN 978-3-642-48879-5 (eBook) Library of Con...

Latvijas ozolu audžu augšņu raksturojums

OpenAIRE

Stalīdzāns, Didzis

2012-01-01

Maģistra darba mērķis ir noskaidrot augsnes faktora lomu parastā ozola (Quercus robur L.) izplatībai Latvijas teritorijā sastopamajās mežaudzēs. Maģistra darbā ir apkopota informācija par parastā ozola izplatības areālu Latvijas teritorijā un citviet pasaulē. Sniegts - parastā ozola ekoloģiskais raksturojums, raksturīgākie augšanas apstākļi, audžu atjaunošanās un ar to saistīto problēmu izklāsts. Pētījumā izlases veidā tika atlasīti 24 ozolu audžu parauglaukumi, kuros veikta audzes augsne...

Theoretical Model for Volume Fraction of UC, 235U Enrichment, and Effective Density of Final U 10Mo Alloy

Energy Technology Data Exchange (ETDEWEB)

Devaraj, Arun [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Prabhakaran, Ramprashad [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Joshi, Vineet V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Hu, Shenyang Y. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); McGarrah, Eric J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL); Lavender, Curt A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Environmental Molecular Sciences Lab. (EMSL)

2016-04-12

The purpose of this document is to provide a theoretical framework for (1) estimating uranium carbide (UC) volume fraction in a final alloy of uranium with 10 weight percent molybdenum (U-10Mo) as a function of final alloy carbon concentration, and (2) estimating effective ²³⁵U enrichment in the U-10Mo matrix after accounting for loss of ²³⁵U in forming UC. This report will also serve as a theoretical baseline for effective density of as-cast low-enriched U-10Mo alloy. Therefore, this report will serve as the baseline for quality control of final alloy carbon content

Bioaccumulation of uranium 234U and 238U in marine birds

International Nuclear Information System (INIS)

Borylo, A.; Skwarzec, B.

2010-01-01

In the paper was presented results of our study about uranium 234 U and 238 U radioactivity in the marine birds samples, collected in the Polish area of the southern Baltic Sea. We chose 11 species of sea birds: three species permanently residing at southern Baltic, four species of wintering birds and three species of migrating birds. The obtained results indicated that uranium is very irregularly distributed in organs and tissues of marine birds. The highest uranium content is characterized in liver, rest of viscera and feathers, the smallest in skin and muscles. The uranium concentration was higher for carnivorous species (long-tailed duck (C. hyemalis), common eider (S. mollissima), lower for species eating fish (great cormorant (P. carbo), common guillemot (U. aalge), red-throated diver (G. stellata) and razorbill (A. tarda)), but the biggest amounts for herbivorous species [tufted duck (A. fuligula) and eurasian coot (F. atra)]. About 63-67% of uranium, which was located in feathers of two species of marine birds: razorbill (A. tarda) and long-tailed duck (C. hymealis), was apparently adsorbed, which suggests that uranium adsorption on the feathers may be an important transfer from air to water. (author)

Motivacija u menadžmentu

OpenAIRE

Mudrovčić, Katarina

2016-01-01

Motivacija je proces u živom biću koji to živo biće pokreće prema određenom cilju. Svaka pobuda koja usmjerava to ponašanje prema određenom cilju, odražava to ponašanje i određuje mu intenzitet jest MOTIV. Teorija o motivaciji je mnogo, s obzirom da je motivaciju teško definirati, objasniti, predviđati i modelirati, ali i zbog njezine prevelike važnosti u poslovnom svijetu. Jedna od najčešće korištenih podjela motivacije jest na intrinzičnu i ekstrinzičnu motivaciju. Intrinzična motivacija je...

Phases in U-Si alloys

International Nuclear Information System (INIS)

Domagala, R.F.

1986-09-01

The binary (two component) U-Si system contains a total of seven ''compounds.'' The most U-rich compounds are of interest to the RERTR community because they are now being employed as fuels in research and test reactors. The nomenclature used in describing these fuels and the metallurgical significance of the notations recorded may have different meanings to people from different technical backgrounds. This paper is a succinct exploration of the principles of phase equilibria and the realities of commerical fabrication as applied to U-Si alloys. It is an attempt to record in referenceable and retrievable form information of value to the continued development, application and understanding of silicide fuels

Brazil-U.S. Relations

Science.gov (United States)

2007-02-28

Eduardo Lins, “La Casa Blanca y El Planalto: Respeto y Solidaridad,” Foreign Affairs En Español, January-March 2003. 31 See “President Bush Meets with...U.S. Department of State, Country Reports on Human Rights Practices 2005: Brazil, February 2006. 2 Lincoln Gordon, Brazil’s Second Change En Route...stabilizing force and skillful interlocutor in Latin America. U.S. officials tend to describe Brazil, similar to Chile , as a friendly country governed

Effect of U-238 and U-235 cross sections on nuclear characteristics of fast and thermal reactors

Energy Technology Data Exchange (ETDEWEB)

Akie, Hiroshi; Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kaneko, Kunio

1997-03-01

Benchmark calculation has been made for fast and thermal reactors by using ENDF/B-VI release 2(ENDF/B-VI.2) and JENDL-3.2 nuclear data. Effective multiplication factors (k{sub eff}s) calculated for fast reactors calculated with ENDF/B-VI.2 becomes about 1% larger than the results with JENDL-3.2. The difference in k{sub eff} is caused mainly from the difference in inelastic scattering cross section of U-238. In all thermal benchmark cores, ENDF/B-VI.2 gives smaller multiplication factors than JENDL-3.2. In U-235 cores, the difference is about 0.3%dk and it becomes about 0.6% in TCA U cores. The difference in U-238 data is also important in thermal reactors, while there are found 0.1-0.3% different v values of U isotopes in thermal energy between ENDF/B-VI.2 and JENDL-3.2. (author)

Community of solution for the U.S. health care system: lessons from the U.S. educational system.

Science.gov (United States)

Devoe, Jennifer E; Gold, Rachel

2013-01-01

The Folsom Group asserts that radical changes are needed to fix the health care system in the United States. The U.S. education system is one potential model to emulate. Could a future health care system-level community of solution be modeled after the U.S. education system? Could community health care services be planned, organized, and delivered at the neighborhood level by district, similar to the structure for delivering public education? Could community health centers, governed by community boards, serve every neighborhood? This essay imagines how U.S. health care system reforms could be designed using our public school system as a roadmap. Our intention is to challenge readers to recognize the urgent need for radical reform in the U.S. health care system, to introduce one potential model for reform, and to encourage creative thinking about other system-level communities of solution that could lead to profound change and improvements in the U.S. health care system.

Theory U

DEFF Research Database (Denmark)

Monthoux, Pierre Guillet de; Statler, Matt

2014-01-01

The recent Carnegie report (Colby, et al., 2011) characterizes the goal of business education as the development of practical wisdom. In this chapter, the authors reframe Scharmer’s Theory U as an attempt to develop practical wisdom by applying certain European philosophical concepts. Specifically...

Out-of-office blood pressure: from measurement to control

Directory of Open Access Journals (Sweden)

Baguet JP

2012-05-01

Full Text Available Jean-Philippe Baguet1,21Department of Cardiology, University Hospital, 2Bioclinic Radiopharmaceutics Laboratory, INSERM U1039, Joseph Fourier University, Grenoble, FranceAbstract: Hypertension is an important risk factor for the development of cardiovascular disease, and is a major cause of morbidity and mortality worldwide. Traditionally, hypertension diagnosis and treatment and clinical evaluations of antihypertensive efficacy have been based on office blood pressure (BP measurements; however, there is increasing evidence that office measures may provide inadequate or misleading estimates of a patient’s true BP status and level of cardiovascular risk. The introduction, and endorsement by treatment guidelines, of 24-hour ambulatory BP monitoring and self (or home BP monitoring has facilitated more reliable and reproducible estimations of true BP, including the identification of white-coat and masked hypertension, and evaluation of BP variability. In addition, ambulatory BP monitoring enables accurate assessment of treatment effectiveness over 24 hours and both ambulatory and self BP monitoring may lead to better tailoring of therapy according to BP profile and concomitant disease. This review describes the clinical benefits and limitations of out-of-office assessments and their applications for effective management of hypertension and attainment of BP control.Keywords: ambulatory, ABPM, SBPM, blood pressure measurement, hypertension

Remarks on the exotic U-meson

International Nuclear Information System (INIS)

Chan Hongmo; Tsou Sheungtsun

1991-12-01

In expectation of imminent results from the new hyperon beam experiment at CERN concerning the exotic U-meson at 3.1 GeV, we propose a detailed program of experimental tests to check the suggestion that U is a qqq-barq-bar ''M-diquonium'' state. Apart from some very characteristic decay modes, the U is expected to occur together with several analogous states with various quantum numbers to which it is intimately related. (author)

Thermal and x-ray studies on Tl2U(MoO4)3 and Tl4U(MoO4)4

International Nuclear Information System (INIS)

Dahale, N.D.; Keskar, Meera; Kulkarni, N.K.; Singh Mudher, K.D.

2006-01-01

In the quaternary Tl-U(IV)-Mo-O system, two new compounds namely Tl 2 U(MoO 4 ) 3 and Tl 4 U(MoO 4 ) 4 were prepared and characterized by powder X-ray diffraction and thermal methods. These compounds were prepared by solid state reactions of Tl 2 MoO 4 , UMoO 5 and MoO 3 in the required stoichiometric ratio at 500 deg C in evacuated sealed quartz ampoule. The XRD data of Tl 2 U(MoO 4 ) 3 and Tl 4 U(MoO 4 ) 4 were indexed on orthorhombic cell. TG curves of Tl 2 U(MoO 4 ) 3 and Tl 4 U(MoO 4 ) 4 did not show any weight change up to 700 deg C in an inert atmosphere. During heating in an inert atmosphere, Tl 2 U(MoO 4 ) 3 and Tl 4 U(MoO 4 ) 4 showed endothermic Dta peaks due to melting of the compounds at 519 and 565 deg C, respectively. (author)

Geodetski časopisi u Emerging Sources Citation Indexu

Directory of Open Access Journals (Sweden)

Nedjeljko Frančula

2016-06-01

U ESCI su uvršteni časopisi od regionalne važnosti i časopisi iz znanstvenih područja u nastajanju. Časopisi uvršteni u ESCI bit će nakon određenog vremena, ako zadovolje kriterije Thomson Reutersa, uvršten u SCIE, SSCI ili A&HCI. Za časopise uvrštene u ESCI, trenutno ih je 2589, ne izračunava se faktor odjeka.

U2 laulusõnade tundmine lennutab Hawaile

Index Scriptorium Estoniae

2006-01-01

Iiri bänd U2 algatas oma uue albumi "U2 18 Singles väljatuleku puhul internetis võistluse "Hunt The Lyric", kus fännidel on võimalus võita reis Hawaile (reisi paketis ka U2 "Vertigo" tuuri kontsert 9. dets.)

Electromagnetic interactions between the U-25 superconducting magnet and the U-25 B MHD flow train

International Nuclear Information System (INIS)

Smith, R.P.; Niemann, R.C.; Kraimer, M.R.; Zinneman, T.E.

1978-01-01

Fluctuating voltage signals on the potential taps of the Argonne National Laboratory (ANL) 5.0 Tesla MHD Superconducting Dipole Magnet have been observed during MHD power generation at the U-25 B Facility at the High Temperature Institute (IVAN), Moscow, U.S.S.R. The voltage fluctuations are analyzed with special emphasis on magnet stability. Various other thermodynamic and electrical parameters of the U-25 B flow train have been recorded and statistical correlations between these signals and the signals observed at the magnet terminals are described

Two-dimensional gauge model with vector U(1) and axial-vector U(1) symmetries

International Nuclear Information System (INIS)

Watabiki, Y.

1989-01-01

We have succeeded in constructing a two-dimensional gauge model with both vector U(1) and axial-vector U(1) symmetries. This model is exactly solvable. The Schwinger term vanishes in this model as a consequence of the above symmetries, and negative-norm states appear. However, the norms of physical states are always positive semidefinite due to the gauge symmetries

Neutronic Analysis of the RSG-GAS Compact Core without CIP Silicide 3.55 g U/cc and 4.8 g U/cc

International Nuclear Information System (INIS)

Jati S; Lily S; Tukiran S

2004-01-01

Fuel conversion from U 3 O 8 -Al to U 3 Si 2 -Al 2.96 g U/cc density in the RSG-GAS core had done successfully step by step since 36 th core until 44 th core. So that, since the 45 th core until now (48 th core) had been using full of silicide 2.96 g U/cc. Even though utilization program of silicide fuel with high density (3.55 g U/cc and 4.8 g U/cc) and optimize operation of RSG-GAS core under research. Optimalitation of core with increasing operation cycle have been analyzing about compact core. The mean of compact core is the RSG-GAS core with decrease number of IP or CIP position irradiation. In this research, the neutronic calculation to cover RSG-GAS core and RSG-GAS core without CIP that are using U 3 Si 2 -Al 2.96 g U/cc, 3.55 g U/cc and 4.8 g U/cc had done. Two core calculation done at 15 MW power using SRAC-ASMBURN code. The calculation result show that fuel conversion from 2.96 g U/cc density to 3.55 g U/cc and 4.8 g U/cc will increasing cycle length for both RSG-GAS core and RSG-GAS compact core without CIP. However, increasing of excess reactivity exceeded from nominal value of first design that 9.2%. Change of power peaking factor is not show significant value and still less than 1.4. Core fuelled with U 3 Si 2 -Al 4.8 g U/cc density have maximum discharge burn-up which exceeded from licensing value (70%). RSG-GAS compact core without CIP fuelled U 3 Si 2 -Al 2.96 g U/cc have longer cycle operation then RSG-GAS core and fulfil limitation neutronic parameter at the first design value. (author)

Comparison of the simulated diffusion of 238U and 234U isotopes with profile data from granite fractures

International Nuclear Information System (INIS)

Latham, A.G.

1991-01-01

The observed profiles of uranium content and 234 U/ 238 U activity ratios as they vary with distance into the rock at a granite fracture wall have been interpreted using a simple diffusion-sorption model. For simplicity, the model assumes a linear reversible isotherm. Using simple constraints, it has been possible to estimate long-term values appropriate for the distribution coefficient, K d for uranium in granite. A potential constraint on the uranium K d value is provided by the 234 U/ 238 U activity ratio variations. However, natural 234 U/ 238 U activity ratios seldom change monotonically with distance and it is suspected that they are the result, to some extent, of later uranium removal. To take this approach further, corresponding physical rock property data and closer sampling in the fracture profiles would be required. Estimates of K d are in the range 0.1 to 10 m 3 kg -1 , and are in agreement with the upper part of the range obtained from laboratory experiments. (author)

75 FR 63811 - The U.S. Travel & Tourism Advisory Board: Information-Gathering Session of the U.S. Travel and...

Science.gov (United States)

2010-10-18

... DEPARTMENT OF COMMERCE International Trade Administration The U.S. Travel & Tourism Advisory Board: Information-Gathering Session of the U.S. Travel and Tourism Advisory Board AGENCY: International Trade...: The U.S. Travel and Tourism Advisory Board (``Board'') will convene a public information-gathering...

Thermal compatibility of U-2wt.%Mo and U-10wt.%Mo fuel prepared by centrifugal atomization for high density research reactor fuels

International Nuclear Information System (INIS)

Kim Ki Hwan; Lee Don Bae; Kim Chang Kyu; Kuk Il Hyun; Hofman, G.E.

1997-01-01

Research on the intermetallic compounds of uranium was revived in 1978 with the decision by the international research reactor community to develop proliferation-resistant fuels. The reduction of 93% 235 U (HEU) to 20% 235 U (LEU) necessitates the use of higher U-loading fuels to accommodate the addition 238 U in the LEU fuels. While the vast majority of reactors can be satisfied with U 3 Si 2 -Al dispersion fuel, several high performance reactors require high loadings of up to 8-9 g U cm -3 . Consequently, in the renewed fuel development program of the Reduced Enrichment for Research and Test Reactors (RERTR) Program, attention has shifted to high density uranium alloys. Early irradiation experiments with uranium alloys showed promise of acceptable irradiation behavior, if these alloys can be maintained in their cubic γ-U crystal structure. It has been reported that high density atomized U-Mo powders prepared by rapid cooling have metastable isotropic γ-U phase saturated with molybdenum, and good γ-U phase stability, especially in U-10wt.%Mo alloy fuel. If the alloy has good thermal compatibility with aluminium, and this metastable gamma phase can be maintained during irradiation, U-Mo alloy would be a prime candidate for dispersion fuel for research reactors. In this paper, U-2w.%Mo and U-10w.%Mo alloy powder which have high density (above 15 g-U/cm 3 ), are prepared by centrifugal atomization. The U-Mo alloy fuel meats are made into rods extruding the atomized powders. The characteristics related to the thermal compatibility of U-2w.%Mo and U-10w.%Mo alloy fuel meat at 400 o C for time up to 2000 hours are examined. (author)

Atenica: u potrazi za izgubljenim spalištem

Directory of Open Access Journals (Sweden)

Staša Babić

2016-11-01

Full Text Available Funerarni konteksti svakako su arheološki zapisi u čijem formiranju značajnu ulogu igraju simboličke i kultne predstave zajednice. S druge strane, u odsustvu pisanih svedočanstava o tim predstavama, arheolozi su skloni da svoje interpretacije zasnivaju na uopštenim i pojednostavljenim idejama o „primitivnim” kultovima, kao što je „solarni kult”. U takvom postupku, tehnički aspekti zapisa zanemaruju se u korist tumačenja pretpostavljenih simboličkih „poruka”. Među kneževskim grobovima centralnog Balkana, humke u Atenici pored Čačka dugo su predstavljale jedini primer ove vrste sahrane koji je istražen u okviru sistematskih arheoloških istraživanja i stoga je čitav niz autora posvećivao posebnu pažnju konstrukciji ovih tumula i mogućnostima interpretacije rituala koji je pratio polaganje pokojnika. U ovom pogledu, naročito je značajna tzv. „ritualna površina” u okviru humke II – tri pravougaona prostora oivičena redovima oblutaka, sa pravilno raspoređenim levkastim jamama, ispunjenim tamnom zemljom, fragmentima keramike i gorelih kostiju. Interpretacije su se kretale od ideja o grobovima kremiranih ljudskih žrtava, preko replika svetilišta, sve do složene simbolike solarnog kulta, izražene numerološkim pravilnostima. S druge strane, budući da se radi o kremiranim pokojnicima, u okviru obe humke identifikovana su spališta – relativno male lučne konstrukcije od redova oblutaka, na kojima su takođe zapaženi tragovi gorenja. Niz praktičnih nelogičnosti koje proističu iz ovih tumačenja ostao je po strani, u nastojanju da se složeni ritual sahrane sa kremacijom poveže sa simboličkim predstavama percipiranim kao primerene za kulturni kontekst sahrana u Atenici – ljudske žrtve, solarni kult. U kružnom dokaznom postupku, ove su ideje, manje ili više prećutno, uzimane za početnu premisu šire interpretacije kultnih praksi zajednice koja je svoje istaknute članove sahranila pod humkama u

Application of the 226Ra-230Th-234U and 227Ac-231Pa-235U radiochronometers to uranium certified reference materials

International Nuclear Information System (INIS)

Rolison, J.M.; Treinen, K.C.; McHugh, K.C.; Gaffney, A.M.; Williams, R.W.

2017-01-01

Uranium certified reference materials (CRM) issued by New Brunswick Laboratory were subjected to dating using four independent uranium-series radiochronometers. In all cases, there was acceptable agreement between the model ages calculated using the 231 Pa- 235 U, 230 Th- 234 U, 227 Ac- 235 U or 226 Ra- 234 U radiochronometers and either the certified 230 Th- 234 U model date (CRM 125-A and CRM U630), or the known purification date (CRM U050 and CRM U100). The agreement between the four independent radiochronometers establishes these uranium certified reference materials as ideal informal standards for validating dating techniques utilized in nuclear forensic investigations in the absence of standards with certified model ages for multiple radiochronometers. (author)

U-series disequilibrium dating of Quaternary carbonates

International Nuclear Information System (INIS)

Stirling, C.

2006-01-01

One of the key dating methods used in paleoclimate research utilizes the natural radioactive decay of uranium to thorium in archives containing U-bearing minerals, such as the calcium carbonate forming the skeletons of fossil corals and speleothems. More specifically, this chronometer, commonly referred to as the U-series dating method, is based on the decay of 238 U to its longest-lived intermediate daughters, 234 U and 230 Th, and subsequent decay through to stable isotopes of Pb. It is the respective 250,000 and 75,000 year half-lives of these daughter isotopes, which make the U-series system particularly useful for dating Quaternary climate events spanning the last 600,000 years of Earth's history. The U-series thus bridges the gap between the ∼45,000 year upper limit of conventional radiocarbon dating and the ∼200,000 year lower limit of K-Ar and 40 Ar- 39 Ar dating. 2 refs., 5 figs

Reactive transport of uranium in a groundwater bioreduction study: Insights from high-temporal resolution 238U/235U data

Science.gov (United States)

Shiel, A. E.; Johnson, T. M.; Lundstrom, C. C.; Laubach, P. G.; Long, P. E.; Williams, K. H.

2016-08-01

We conducted a detailed investigation of U isotopes in conjunction with a broad geochemical investigation during field-scale biostimulation and desorption experiments. This investigation was carried out in the uranium-contaminated alluvial aquifer of the Rifle field research site. In this well-characterized setting, a more comprehensive understanding of U isotope geochemistry is possible. Our results indicate that U isotope fractionation is consistently observed across multiple experiments at the Rifle site. Microbially-mediated reduction is suggested to account for most or all of the observed fractionation as abiotic reduction has been demonstrated to impart much smaller, often near-zero, isotopic fractionation or isotopic fractionation in the opposite direction. Data from some time intervals are consistent with a simple model for transport and U(VI) reduction, where the fractionation factor (ε = +0.65‰ to +0.85‰) is consistent with experimental studies. However, during other time intervals the observed patterns in our data indicate the importance of other processes in governing U concentrations and 238U/235U ratios. For instance, we demonstrate that departures from Rayleigh behavior in groundwater systems arise from the presence of adsorbed species. We also show that isotope data are sensitive to the onset of oxidation after biostimulation ends, even in the case where reduction continues to remove contaminant uranium downstream. Our study and the described conceptual model support the use of 238U/235U ratios as a tool for evaluating the efficacy of biostimulation and potentially other remedial strategies employed at Rifle and other uranium-contaminated sites.

U.S.-China Counterterrorism Cooperation: Issues for U.S. Policy

National Research Council Canada - National Science Library

Kan, Shirley A

2008-01-01

... (Operation Enduring Freedom). Longer-term issues have concerned whether counterterrorism has strategically transformed bilateral relations and whether China's support has been valuable and not obtained at the expense of other U.S. interests...

Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a ...

Indian Academy of Sciences (India)

RESEARCH ARTICLE. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a child ... whereby genes are expressed in a parent-of-origin dependent manner. One of the ... lity, neurodevelopmental delay, features of attention deficit hyperactivity .... Received 16 December 2015; accepted 8 January 2016. Unedited ...

31 CFR 575.320 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 575.320... § 575.320 U.S. financial institution. The term U.S. financial institution means any U.S. person.... This term includes those branches, offices and agencies of foreign financial institutions which are...

31 CFR 585.318 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 585.318... General Definitions § 585.318 U.S. financial institution. The term U.S. financial institution means any U... foregoing. This term includes those branches, offices and agencies of foreign financial institutions which...

31 CFR 587.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 587.311... MONTENEGRO) MILOSEVIC SANCTIONS REGULATIONS General Definitions § 587.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity (including its foreign branches) that is engaged...

31 CFR 536.317 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 536.317... General Definitions § 536.317 U.S. financial institution. The term U.S. financial institution means any U... foregoing. This term includes those branches, offices and agencies of foreign financial institutions which...

31 CFR 586.317 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 586.317... & MONTENEGRO) KOSOVO SANCTIONS REGULATIONS General Definitions § 586.317 U.S. financial institution. The term U.S. financial institution means any U.S. entity (including foreign branches) that is engaged in the...

Counterinsurgency: A Forgotten U.S. Strategy

Science.gov (United States)

2014-06-13

doctrinal revamp of post-Vietnam was that the U.S. Army "threw away virtually everything it had learned there, slowly and painfully, about how to wage...slowly slipping into an insurgency, U.S. Secretary of Defense Donald Rumsfeld refused to accept the new reality . On June 30, 2003 at a press conference...knowledge, historical examples, and practical advice൓ but it suffered from the same myopia that crippled the U.S. efforts in Vietnam. It was strategic

Reactions at tens of MeV/u and a few GeV/u: Differences and similarities

International Nuclear Information System (INIS)

Henning, W.

1990-07-01

The increased interest in heavy-ion physics at GeV/u energies is still paralleled by intensive research at energies closer to the barrier up to tens of MeV/u. The new heavy-ion facility at GSI, consisting of the improved UNILAC and a new 2 GeV/u synchrotron SIS and the experimental storage ring ESR allow heavy-ion studies over the full energy range. An attempt is made to summarize the research proposals for these facilities in light of the differences and common aspects between the various energy regimes. (orig.)

7 CFR 51.2278 - U.S. Commercial.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Commercial. 51.2278 Section 51.2278 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Standards for Shelled English Walnuts (Juglans Regia) Grades § 51.2278 U.S. Commercial. “U.S. Commercial...

Percepcija korupcije i borba protiv korupcije u Republici Hrvatskoj

OpenAIRE

Zoran Malenica; Ranka Jeknić

2010-01-01

Polazeći od institucionalnih i financijskih pretpostavki borbe protiv korupcije, i prikaza dosadašnjih rezultata u borbi protiv korupcije, uključujući i statističke podatke o sudskim postupcima i presudama vezanim za to područje u zadnjih sedam godina, u radu se analiziraju neki rezultati relevantnih istraživanja percepcije korupcije u Hrvatskoj, s posebnim osvrtom na podatke u vezi s percepcijom korupcije i razinom (ne)povjerenja u institucije iz istraživanja provedenog u sklopu projekta „So...

Calibration of 232U solution

International Nuclear Information System (INIS)

Galan Valera, M. P.; Acena Berrenechea, M. L.

1988-01-01

A method for as certain the activity by alpha spectroscopy with semiconductor detectors, of a solution of 232U is presented. It consists of the comparison with a 233U solution activity previously measured in a gridded ionization chamber of 2π geometry. The total measurement uncertainty is about + - 0,02. (Author) 9 refs

The U.S. uranium market

International Nuclear Information System (INIS)

White, G. Jr.

1978-01-01

A brief analysis is presented of factors influencing buyers and sellers in the U.S. uranium market. Factors suggesting a reduction in uranium demand, increased supply and reduced uncertainty are set against factors suggesting the reverse of these trends. Prices and economic factors are considered, as well as political and business aspects. (U.K.)

On the necessity of U-shaped learning.

Science.gov (United States)

Carlucci, Lorenzo; Case, John

2013-01-01

A U-shaped curve in a cognitive-developmental trajectory refers to a three-step process: good performance followed by bad performance followed by good performance once again. U-shaped curves have been observed in a wide variety of cognitive-developmental and learning contexts. U-shaped learning seems to contradict the idea that learning is a monotonic, cumulative process and thus constitutes a challenge for competing theories of cognitive development and learning. U-shaped behavior in language learning (in particular in learning English past tense) has become a central topic in the Cognitive Science debate about learning models. Antagonist models (e.g., connectionism versus nativism) are often judged on their ability of modeling or accounting for U-shaped behavior. The prior literature is mostly occupied with explaining how U-shaped behavior occurs. Instead, we are interested in the necessity of this kind of apparently inefficient strategy. We present and discuss a body of results in the abstract mathematical setting of (extensions of) Gold-style computational learning theory addressing a mathematically precise version of the following question: Are there learning tasks that require U-shaped behavior? All notions considered are learning in the limit from positive data. We present results about the necessity of U-shaped learning in classical models of learning as well as in models with bounds on the memory of the learner. The pattern emerges that, for parameterized, cognitively relevant learning criteria, beyond very few initial parameter values, U-shapes are necessary for full learning power! We discuss the possible relevance of the above results for the Cognitive Science debate about learning models as well as directions for future research. Copyright © 2013 Cognitive Science Society, Inc.

31 CFR 546.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 546.311... Definitions § 546.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices, and agencies of foreign financial institutions that are...

31 CFR 538.316 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 538.316... Definitions § 538.316 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices and agencies of foreign financial institutions which are...

31 CFR 598.319 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 598.319... General Definitions § 598.319 U.S. financial institution. The term U.S. financial institution means any U..., offices, and agencies of foreign financial institutions which are located in the United States, but not...

31 CFR 548.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 548.311... Definitions § 548.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity... foregoing. This term includes those branches, offices, and agencies of foreign financial institutions that...

31 CFR 594.314 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 594.314... Definitions § 594.314 U.S. financial institution. The term U.S. financial institution means any U.S. person.... This term includes those branches, offices and agencies of foreign financial institutions that are...

31 CFR 537.320 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 537.320... Definitions § 537.320 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices and agencies of foreign financial institutions that are...

31 CFR 542.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 542.311... Definitions § 542.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices and agencies of foreign financial institutions that are...

31 CFR 541.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 541.311... Definitions § 541.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices and agencies of foreign financial institutions that are...

31 CFR 588.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 588.311... General Definitions § 588.311 U.S. financial institution. The term U.S. financial institution means any U... financial institutions that are located in the United States, but not such institutions' foreign branches...

31 CFR 543.311 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 543.311... Definitions § 543.311 U.S. financial institution. The term U.S. financial institution means any U.S. entity.... This term includes those branches, offices and agencies of foreign financial institutions that are...

31 CFR 545.314 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 545.314... General Definitions § 545.314 U.S. financial institution. The term U.S. financial institution means any U... financial institutions that are located in the United States, but not such institutions' foreign branches...

31 CFR 595.316 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 595.316... Definitions § 595.316 U.S. financial institution. The term U.S. financial institution means any U.S. person.... This term includes those branches, offices and agencies of foreign financial institutions which are...

31 CFR 551.310 - U.S. financial institution.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. financial institution. 551.310... Definitions § 551.310 U.S. financial institution. The term U.S. financial institution means any U.S. entity... foregoing. This term includes those branches, offices and agencies of foreign financial institutions that...

Određivanje kupnih ugljikohidrata u plodu kestena

OpenAIRE

Kovačec, Katarina

2015-01-01

Pitomi kesten (Castanea sativa Mill) pripada u skupinu listopadnog drveća, rjeđe grmova iz porodice Fagaceae. U ovom radu je analizirano je 7 uzoraka od tri francuska kultivara pitomog kestena: Maraval, Marsol i Bouche de Betizac, sakupljenih na području U.Š. Sisak, s ciljem određivanja ukupnog udjela ugljikohidrata u pojedinom uzorku. Za analizu je korištena spektrofotometrijska metoda određivanja ukupnog udjela ugljikohidrata u plodu kestena temeljena na korištenju Anthrona. Dobiveni re...

Redox equilibrium of U4+/U3+ in molten NaCl-2CsCl by UV-Vis spectrophotometry and cyclic voltammetry

International Nuclear Information System (INIS)

Nagai, Takayuki; Uehara, Akihiro; Fujii, Toshiyuki; Shirai, Osamu; Yamana, Hajimu; Sato, Nobuaki

2005-01-01

In order to investigate the redox equilibrium of uranium ions in molten NaCl-2CsCl, UV-Vis absorption spectro-photometry measurements were performed for U 4+ and U 3+ in molten NaCl-2CsCl at 923 K under simultaneous electrolytic control of their ratio. Prominent absorption bands at 480 and 570 nm were assigned to U 3+ , and their molar absorptivities were determined to be 1,260±42 and 963±32 mol -1 ·l·cm -1 respectively. From the dependence of the rest potential of the melt on the spectrophotometrically determined ratio of [U 4+ ]/[U 3+ ], the standard redox potential of the couple U 4+ /U 3+ at 923 K was determined to be -1.481±0.004 V vs. Cl 2 /Cl - . Cyclic voltammetry measurements were carried out for the couple U 4+ /U 3+ , and the results agreed well with this standard redox potential value. By the results of cyclic voltammetry, a temperature dependence of the standard redox potential was found to be -2.094+6.639 x 10 -4 T (T=823-923K). (author)

7 CFR 51.2647 - U.S. Commercial.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Commercial. 51.2647 Section 51.2647 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Standards for Grades for Sweet Cherries 1 Grades § 51.2647 U.S. Commercial. “U.S. Commercial” consists of...

7 CFR 51.1542 - U.S. Commercial.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Commercial. 51.1542 Section 51.1542 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Standards for Grades of Potatoes 1 Grades § 51.1542 U.S. Commercial. “U.S. Commercial” consists of potatoes...

U.S. International Trade: Trends and Forecasts

Science.gov (United States)

2008-11-26

Agreements: Impact on U.S. Trade and Implications for U.S. Trade Policy, by William H. Cooper;CRS Report RL32371, Trade Remedies: A Primer, by Vivian C...initial public offering of the Blackstone Group, a U.S. private equity group. Morgan Stanley research estimates that such sovereign wealth funds could

U-series isotopes in arc magma

Energy Technology Data Exchange (ETDEWEB)

Hawkesworth, C.; Turner, S.; McDermott, F.; Peate, D.; Van Calsteren, P.

1997-12-31

Thorium is not readily mobilized in the fluid component along destructive plate margins. Uranium is mobilized, and the resultant fractionation in U/Th can be used to estimate the rates of transfer slab derived components through the mantle wedge. The variations in Th/Yb, and by implication in the fractionation-corrected Th abundances of arc magmas largely depend on the contributions from subducted sediments. It is inferred that the distinctive high Th/Ta ratios of subduction related magmas primarily reflect the Th/Ta ratios of the subducted sediments, and that such high Th/Ta ratios are generated by processes other than those associated with recent subduction-related magmatism. Uranium and thorium isotopes have also been used to evaluate magma residence times within the crust. Thus, separated minerals and groundmass from six rocks erupted in the last 4,000 years from Soufriere on St. Vincent in the Lesser Antilles, scatter about a 50,000 year errorchron on the U-Th equiline diagram (Heath et al., 1977). Models are currently being developed to investigate how such apparent ages may relate to calculated replenishment times in steady state systems. Bulk continental crust has a lower U/Th ratio (0.25) than at least some estimates for the bulk Earth (0.26) and the depleted upper mantle (0.39). However, the island arc rocks with low U/Th ratios appear to have inherited those from subducted sediments, and arc rocks with a low sediment contribution have significantly higher U/Th. Consequently, the U/Th ratios of new crustal material generated along destructive plate margins are significantly higher than those of bulk continental crust. The low average U/Th of bulk crust may be primarily due to different crust generation processes in the Archaean, when U would be less mobile because conditions were less oxidising, and when residual garnet may have had more of a role in crust generation processes. Extended abstract. 4 figs., 23 refs.

233U Assay A Neutron NDA System

International Nuclear Information System (INIS)

Hensley, D.C.; Lucero, A.J.; Pierce, L.

1998-01-01

The assay of highly enriched 233 U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched 235 U do not convert easily over to the assay of 233 U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with γ ray isotopics information should give a good overall determination of 233 U material now stored in bldg. 3019 at the Oak Ridge National Laboratory

Transverse momentum dependence of the J/Ψ in the p-U, 16O-U and 32S-U interactions at 200 GeV/c per nucleon

International Nuclear Information System (INIS)

Drapier, O.

1990-05-01

We study in this thesis the transverse momentum dependence of dimuons produced with mass greated than 1.7 GeV/c 2 in p-U, 16 O-U and 32 S-U collisions at 200 GeV per nucleon. The NA38 experiment, performed at the CERN SPS, measures muon pairs produced in these collisions using the NA10 spectrometer. The neutral transverse energy, which is related to the centrality of the interaction, is deduced from the energy flow measured in an electromagnetic calorimeter located downstream an active target. Data are analysed with a method taking into account apparatus effects which are simulated through transfer matrices. The 16 O-U and 32 S-U results show that the T > and T 2 > values of J/Ψ dimuons increase with the measured neutral transverse energy and that such a correlation is not seen for the mass continuum dimuons. A comparison of these results with different models is presented. Results are first compared with quark-gluon plasma models which inhibits J/Ψ formation via a color screening effect. Models based on J/Ψ absorption in a dense hadron gas combined with parton multiple scattering in the entrance channel are also considered. Experimental data do not allow to distinguish between these different models [fr

7 CFR 51.883 - U.S. Fancy Export.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Fancy Export. 51.883 Section 51.883 Agriculture... Standards for Grades of Table Grapes (European or Vinifera Type) 1 Grades § 51.883 U.S. Fancy Export. “U.S. Fancy Export” consists of grapes which meet the requirements for U.S. Fancy Table, except that bunches...

Peculiarities of U-based Laves phases

Energy Technology Data Exchange (ETDEWEB)

Goncalves, A P; Henriques, M S; Waerenborgh, J C; Pereira, L C J; Lopes, E B; Almeida, M [Department of Chemistry, Instituto Tecnologico e Nuclear/CFMCUL, Estrada Nacional 10, 2686-953 Sacavem (Portugal); Maskova, S; Havela, L [Department of Condensed Matter Physics, Faculty of Mathematics and Physics, Charles University, Ke Karlovu 5, 12116, Prague (Czech Republic); Shick, A; Arnold, Z [Institute of Physics, Academy of Sciences of the Czech Republic, Prague 8 (Czech Republic); Berthebaud, D; Tougait, O; Noel, H, E-mail: apg@itn.pt [Sciences Chimiques de Rennes- Equipe Chimie du Solide et Materiaux. UMR CNRS 6226, Universite de Rennes 1, Avenue de General Leclerc, 35042 Rennes (France)

2010-03-15

This contribution focuses on the structural and physical properties of U-based Laves phases. It starts with the structural description of the different type of Laves phases, followed by a brief description of the factors that affect their stability. The majority of the uranium Laves phases show a weakly paramagnetic behaviour. The reason is the compact structure of the phases that leads to small a U-U spacing as well as very high coordination numbers, regarding both the uranium and the ligands sublattices, which brings a strong hybridization with non-f states. However, there are some exceptions of uranium Laves phases that do order magnetically (UFe{sub 2}, UNi{sub 2} and the recently discovered U{sub 2}Fe{sub 3}Ge compound). These exceptions are discussed in more detail in the present manuscript.

Irradiation performance of U-Mo-Ti and U-Mo-Zr dispersion fuels in Al-Si matrixes

Energy Technology Data Exchange (ETDEWEB)

Kim, Yeon Soo, E-mail: yskim@anl.gov [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439 (United States); Hofman, G.L. [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439 (United States); Robinson, A.B.; Wachs, D.M. [Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415-6188 (United States); Ryu, H.J.; Park, J.M.; Yang, J.H. [Korea Atomic Energy Research Institute, 150 Deokjin-dong, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)

2012-08-15

Performance of U-7 wt.%Mo with 1 wt.%Ti, 1 wt.%Zr or 2 wt.%Zr, dispersed in an Al-5 wt.%Si alloy matrix, was investigated through irradiation tests in the ATR at INL and HANARO at KAERI. Post-irradiation metallographic features show that the addition of Ti or Zr suppresses interaction layer growth between the U-Mo and the Al-5 wt.%Si matrix. However, higher fission gas swelling was observed in the fuel with Zr addition, while no discernable effect was found in the fuel with Ti addition as compared to U-Mo without the addition. Known to have a destabilizing effect on the {gamma}-phase U-Mo, Zr, either as alloy addition or fission product, is ascribed for the disadvantageous result. Considering its benign effect on fuel swelling, with slight disadvantage from neutron economy point of view, Ti may be a better choice for this purpose.

Characterization of the interaction layer in diffusion couples U-Mo-Zr/Al and U-Mo-Zr/Al-A356 at 550 C degrees; Caracterizacion de la zona de interaccion en pares de difusion a 550 grados C U-Mo-Zr/Al y U-Mo-Zr/Al-A356

Energy Technology Data Exchange (ETDEWEB)

Komar Varela, Carolina; Arico, Sergio; Mirandou, Marcela; Balart, Silvia; Gribaudo, Luis [Comision Nacional de Energia Atomica, General San Martin (Argentina). Dept. de Materiales; com, carolinakomar@gmail

2007-07-01

Out-of-pile diffusion experiments were performed between U-7 wt.% Mo-1 wt.% Zr and Al or Al A356 (7,1 wt.% Si) at 550 C degrees. In this work morphological characterization and phase identification on both interaction layers are presented. They were carried out by the use of different techniques: optical and scanning electron microscopy, X-ray diffraction and WDS microanalysis. In the interaction layer U-7 wt.% Mo-1 wt.% Zr/Al, the phases UAl{sub 3}, UAl{sub 4}, Al{sub 20}Mo{sub 2}U and Al{sub 43}Mo{sub 4}U{sub 6} were identified. Similar results in the interaction layer of the U-7 % Mo/Al at 580 C degrees were previously obtained. In the interaction layer U-7 wt.% Mo-1 wt.% Zr/Al A356, the phases U(Al,Si){sub 3} with 25 at.% Si and Si{sub 5}U{sub 3} were identified. This last phase, with a higher Si concentration, was identified with X-ray diffraction synchrotron radiation performed at the National Synchrotron Light Laboratory, Campinas, Brazil. (author) [Spanish] Se realizaron experiencias fuera de reactor en pares de difusion quimica U-7 % Mo-1 % Zr/Al y U-7 % Mo-1 % Zr/Al A356. En este trabajo se presentan los resultados de la caracterizacion morfologica e identificacion de fases presentes en la zona de interaccion que se forma al ser sometidos a un tratamiento isotermico de 1,5 h a 550 grados C. Las tecnicas utilizadas fueron: microscopia optica y electronica de barrido, difraccion de rayos X y microanalisis cuantitativo por sonda electronica. En la zona de interaccion correspondiente al par U-7 % Mo-1 % Zr/Al se identificaron las fases UAl{sub 3}, UAl{sub 4}, Al{sub 20}Mo{sub 2}U y Al{sub 43}Mo{sub 4}U{sub 6}. Estas cuatro fases fueron identificadas en pares U-7 % Mo/Al a 580 grados C en trabajos anteriores. En la zona de interaccion correspondiente al par U-7 % Mo-1 % Zr/Al A356 se identificaron las fases U(Al,Si){sub 3} (con una concentracion de 25 %at.Si) y Si{sub 5}U{sub 3}. Este compuesto rico en Si solo pudo ser identificado mediante la utilizacion de

Determination of 234U and 238U activity concentrations in groundwaters from three deep wells drilled in Itu Intrusive Suite (SP)

International Nuclear Information System (INIS)

Souza, Francisca de

2006-01-01

Activity concentrations of ( 234 U) and ( 238 U) were determined in groundwaters drawn from three deep wells drilled in rocks from Itu Intrusive Suite (SP), two located in Salto town (S and SY wells) and the other one in Itu (I well). Sampling was done from September, 2004 to December, 2005, and twelve samples of each well were collected monthly. For those determinations alpha spectrometry technique was used, providing high precision results, as shown by the very good agreement of the data obtained in the analyses of 23 duplicates. The waters from the three wells presented a considerable enrichment of 234 U in relation to 238 U, indicating an important radioactive disequilibrium of these isotopes. In well I, the activity concentrations of ( 238 U) varied from (1,06 +- 0,03) to (2,1+- 0,2) mBq/L and those of ( 234 U) spanned from (3,1 +- 0,2) to (6,0 +- 0,4) mBq/L, whereas ( 234 U/ 238 U) activity ratios did not present significant variation, during the sampling time interval, presenting an average of 2,8 +- 0,1. The S waters showed the lowest uranium concentrations and the largest diversity of ( 238 U) and ( 234 U) activity concentrations, which varied from (0,26 +- 0,02) to (1,07+- 0,08) mBq/L and from (1,8 +- 0,1) to (7,0 +- 0,5) mBq/L, respectively, and also presented variable ( 234 U/ 238 U) activity ratios, spanning from (2,79 +- 0,07) to (8,1+- 0,3). In SY well, ( 238 U) activities varied between (0,8 +- 0,1) and (4,2 +- 0,3) mBq/L and those ones of ( 234 U) from (14 +- 1) to (53 +- 4) mBq/L, whereas ( 234 U/ 238 U) ratios fell in the interval from 12,6 +- 0,3 to 18,3 +- 0,4, with the highest activities of both radioisotopes registered during the dry season and the lowest ones in the rainy time period. The ( 234 U/ 238 U) activity ratios, which were invariable during sampling period of well I, indicated the contribution of rainfall to recharge the aquifer. The observed correlation between those ratios and uranium concentrations, for S and SY wells, showed

Nastavna sredstva i pomagala u službi umjetnosti u nastavi glazbe

OpenAIRE

Novosel, Darko

2016-01-01

Svrha rada je utvrditi jesu li nastavna sredstva i pomagala potrebna u nastavi glazbe. Dok je vokalnoj glazbi dovoljan „glasovni aparat“ koji imamo kao dio našeg tijela, u instrumentalnoj glazbi nužno je pomagalo, glazbalo. Glazbu je moguće stvarati i izvoditi i na računalu, no za njegovu uporabu nije potrebna vještina sviranja već glazbeno i informatičko znanje pa ga još uvijek ne smatramo pravim glazbalom. Pomagala su potrebna i da bismo napravili notni ili zvučni zapis glazbe te za estetsk...

U.S. Coastal Relief Model - Hawaii

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

Dicty_cDB: Contig-U06307-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available Contig-U06307-1 no gap 637 6 29174 29801 PLUS 4 5 U06307 4 0 0 0 0 0 0 0 0 0 0 0 0 0 Show Contig...-U06307-1 Contig ID Contig-U06307-1 Contig update 2002. 9.13 Contig sequence >Contig-U06307-1 (Contig...-U06307-1Q) /CSM_Contig/Contig-U06307-1Q.Seq.d CCCGCGTCCGAATGCCTCGTATTTTACACACTATGCTCCGTGTGGGTAAT TTAG...ATAGTATTTTTATTTTATT CTTTTTCTTTTAAAAATTTTTTATATTGTCAACAATATAATCAAATAAAT GTATTTAATTATCGGGTATTAAAAAAAAAAAAAAAAA Gap no gap Contig...own update 2004. 6.10 Homology vs CSM-cDNA Query= Contig-U06307-1 (Contig-U06307-1Q) /CSM_Contig/Contig-U063

Välieluruumi ajakiri Õu = Õu, the Landscape Architecture Magazine

Index Scriptorium Estoniae

2016-01-01

Välieluruumi ajakirjast "Õu", peatoimetaja Anna-Liisa Unt, kolleegium Merle Karro-Kalberg ja Karin Bachmann, kujundaja Marje Eelmaa (Tuumik Stuudio). Maastikuarhitektuuri aastapreemia 2016 "Maastikuarhitektuuri tegu" laureaat

78 FR 9938 - U.S.-Korea Free Trade Agreement: Effects on U.S. Small and Medium-Sized Enterprises; Institution...

Science.gov (United States)

2013-02-12

... Trade Agreement on U.S. small and medium-sized enterprises (SMEs) since entry into force of the... effects of the agreement on the production, distribution, and export strategy of U.S. SMEs, as identified by those SMEs, and describing how U.S. SMEs have benefited from specific provisions of the agreement...

Technology Transfer in Poland: An Investment of U.S. Government, U.S. Corporate, and Polish Government Strategies