Microcystin-LR Induced Immunotoxicity in Mammals

Directory of Open Access Journals (Sweden)

Yaqoob Lone

2016-01-01

Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

Science.gov (United States)

Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

2013-05-01

Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

International Nuclear Information System (INIS)

Zeller, P.; Clement, M.; Fessard, V.

2011-01-01

Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

Science.gov (United States)

Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

2011-10-01

A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

International Nuclear Information System (INIS)

Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

2016-01-01

Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

Solving LR Conflicts Through Context Aware Scanning

Science.gov (United States)

Leon, C. Rodriguez; Forte, L. Garcia

2011-09-01

This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

Science.gov (United States)

Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

2017-07-01

In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Unifying LL and LR parsing

NARCIS (Netherlands)

W.H.L.M. Pijls (Wim)

1993-01-01

textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

Science.gov (United States)

Sellbom, Martin; Bagby, R. Michael

2008-01-01

In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

International Nuclear Information System (INIS)

Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

2006-01-01

The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

Science.gov (United States)

Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

2013-01-01

Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

Directory of Open Access Journals (Sweden)

Gábor Vasas

2013-09-01

Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

Science.gov (United States)

Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

2012-10-01

• The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

LR: Compact connectivity representation for triangle meshes

Energy Technology Data Exchange (ETDEWEB)

Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

2011-01-28

We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

Energy Technology Data Exchange (ETDEWEB)

Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

2016-11-01

Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

Directory of Open Access Journals (Sweden)

Jinlin Jiang

Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

Science.gov (United States)

Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

2013-01-01

Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

LRSYS, PASCAL LR(1) Parser Generator System

International Nuclear Information System (INIS)

O'Hair, K.

1991-01-01

Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

Directory of Open Access Journals (Sweden)

Xin Sui

Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

Science.gov (United States)

Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

2013-11-01

This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

Science.gov (United States)

Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

2015-06-01

Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

International Nuclear Information System (INIS)

Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

2016-01-01

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

Science.gov (United States)

Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

2017-03-01

The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

Science.gov (United States)

Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

2017-06-01

A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

Directory of Open Access Journals (Sweden)

Lorena Rosso

2014-04-01

Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

Approximate Solution of LR Fuzzy Sylvester Matrix Equations

Directory of Open Access Journals (Sweden)

Xiaobin Guo

2013-01-01

Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

Energy Technology Data Exchange (ETDEWEB)

Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

2016-12-15

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Accident dynamics of LR-0 reactor

International Nuclear Information System (INIS)

Vorisek, M.; Tinka, I.

1981-01-01

The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

2014-04-18

Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

The hydration enthalpies of Md3+ and Lr3+

International Nuclear Information System (INIS)

Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

1987-10-01

Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

Directory of Open Access Journals (Sweden)

Mawethu P. Bilibana

2016-11-01

Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

L-R asymmetry in gut's

International Nuclear Information System (INIS)

Karadayi, H.R.

1982-01-01

An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

Adaptive local surface refinement based on LR NURBS and its application to contact

Science.gov (United States)

Zimmermann, Christopher; Sauer, Roger A.

2017-12-01

A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

Science.gov (United States)

Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

Science.gov (United States)

González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

2017-10-01

This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

African Journals Online (AJOL)

Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

alpha-particle radioactivity from LR 115 by two methods of analysis

CERN Document Server

Azkour, K; Adloff, J C; Pape, A

1999-01-01

LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

DEFF Research Database (Denmark)

Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

2003-01-01

The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

International Nuclear Information System (INIS)

Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

2010-01-01

The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

Assessment of co-seismic landslide susceptibility using LR and ...

Indian Academy of Sciences (India)

Suchita Shrestha

2018-03-28

Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

Microcystin-LR equivalent concentrations in fish tissue during a ...

African Journals Online (AJOL)

The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

International Nuclear Information System (INIS)

Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

2016-01-01

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

2016-09-05

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

Directory of Open Access Journals (Sweden)

Vitor Vasconcelos

2011-12-01

Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

Science.gov (United States)

Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

2018-04-30

Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

Science.gov (United States)

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

Science.gov (United States)

Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

2017-06-05

A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

Science.gov (United States)

Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

2015-10-01

The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

International Nuclear Information System (INIS)

El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

2014-01-01

Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

Directory of Open Access Journals (Sweden)

Sérgio João de Luca

2010-03-01

Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

2018-03-01

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

Science.gov (United States)

He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

2015-01-01

A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

Science.gov (United States)

2012-01-01

visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

Cell shape regulates global histone acetylation in human mammaryepithelial cells

Energy Technology Data Exchange (ETDEWEB)

Le Beyec, Johanne; Xu, Ren; Lee, Sun-Young; Nelson, Celeste M.; Rizki, Aylin; Alcaraz, Jordi; Bissell, Mina J.

2007-02-28

Extracellular matrix (ECM) regulates cell morphology and gene expression in vivo; these relationships are maintained in three-dimensional (3D) cultures of mammary epithelial cells. In the presence of laminin-rich ECM (lrECM), mammary epithelial cells round up and undergo global histone deacetylation, a process critical for their functional differentiation. However, it remains unclear whether lrECM-dependent cell rounding and global histone deacetylation are indeed part of a common physical-biochemical pathway. Using 3D cultures as well as nonadhesive and micropatterned substrata, here we showed that the cell 'rounding' caused by lrECM was sufficient to induce deacetylation of histones H3 and H4 in the absence of biochemical cues. Microarray and confocal analysis demonstrated that this deacetylation in 3D culture is associated with a global increase in chromatin condensation and a reduction in gene expression. Whereas cells cultured on plastic substrata formed prominent stress fibers, cells grown in 3D lrECM or on micropatterns lacked these structures. Disruption of the actin cytoskeleton with cytochalasin D phenocopied the lrECM-induced cell rounding and histone deacetylation. These results reveal a novel link between ECM-controlled cell shape and chromatin structure, and suggest that this link is mediated by changes in the actin cytoskeleton.

Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

Science.gov (United States)

Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

2017-06-01

Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

Science.gov (United States)

McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

2002-01-01

A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

International Nuclear Information System (INIS)

Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

2006-01-01

The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

Science.gov (United States)

Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

2016-06-01

Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Detoxification of microcystin-LR in water by Portulaca oleracea cv.

Science.gov (United States)

Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

2014-03-01

Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Main: 1LR5 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

Some investigations and use of LR-115 track detectors for radon measurements

CERN Document Server

Amrani, D

2001-01-01

Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

Science.gov (United States)

Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

2018-06-01

A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

International Nuclear Information System (INIS)

Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

1998-01-01

Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

Energy Technology Data Exchange (ETDEWEB)

Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

International Nuclear Information System (INIS)

Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

2007-01-01

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

Action potential conduction between a ventricular cell model and an isolated ventricular cell

NARCIS (Netherlands)

Wilders, R.; Kumar, R.; Joyner, R. W.; Jongsma, H. J.; Verheijck, E. E.; Golod, D.; van Ginneken, A. C.; Goolsby, W. N.

1996-01-01

We used the Luo and Rudy (LR) mathematical model of the guinea pig ventricular cell coupled to experimentally recorded guinea pig ventricular cells to investigate the effects of geometrical asymmetry on action potential propagation. The overall correspondence of the LR cell model with the recorded

Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

Energy Technology Data Exchange (ETDEWEB)

Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

2013-02-15

In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

Science.gov (United States)

Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

2018-05-10

Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

Cell chirality: emergence of asymmetry from cell culture.

Science.gov (United States)

Wan, Leo Q; Chin, Amanda S; Worley, Kathryn E; Ray, Poulomi

2016-12-19

Increasing evidence suggests that intrinsic cell chirality significantly contributes to the left-right (LR) asymmetry in embryonic development, which is a well-conserved characteristic of living organisms. With animal embryos, several theories have been established, but there are still controversies regarding mechanisms associated with embryonic LR symmetry breaking and the formation of asymmetric internal organs. Recently, in vitro systems have been developed to determine cell chirality and to recapitulate multicellular chiral morphogenesis on a chip. These studies demonstrate that chirality is indeed a universal property of the cell that can be observed with well-controlled experiments such as micropatterning. In this paper, we discuss the possible benefits of these in vitro systems to research in LR asymmetry, categorize available platforms for single-cell chirality and multicellular chiral morphogenesis, and review mathematical models used for in vitro cell chirality and its applications in in vivo embryonic development. These recent developments enable the interrogation of the intracellular machinery in LR axis establishment and accelerate research in birth defects in laterality.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

International Nuclear Information System (INIS)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

Science.gov (United States)

Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

2018-06-01

To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

African Journals Online (AJOL)

Yomi

2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

Science.gov (United States)

2011-09-30

...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

Science.gov (United States)

Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

2016-05-01

Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

Science.gov (United States)

Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

2016-12-01

A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Main: 1LR4 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

WWER-440 control assembly local power peaking investigation on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

Cell Chirality Drives Left-Right Asymmetric Morphogenesis.

Science.gov (United States)

Inaki, Mikiko; Sasamura, Takeshi; Matsuno, Kenji

2018-01-01

Most macromolecules found in cells are chiral, meaning that they cannot be superimposed onto their mirror image. However, cells themselves can also be chiral, a subject that has received little attention until very recently. In our studies on the mechanisms of left-right (LR) asymmetric development in Drosophila , we discovered that cells can have an intrinsic chirality to their structure, and that this "cell chirality" is generally responsible for the LR asymmetric development of certain organs in this species. The actin cytoskeleton plays important roles in the formation of cell chirality. In addition, Myosin31DF ( Myo31DF ), which encodes Drosophila Myosin ID, was identified as a molecular switch for cell chirality. In other invertebrate species, including snails and Caenorhabditis elegans , chirality of the blastomeres, another type of cell chirality, determines the LR asymmetry of structures in the body. Thus, chirality at the cellular level may broadly contribute to LR asymmetric development in various invertebrate species. Recently, cell chirality was also reported for various vertebrate cultured cells, and studies suggested that cell chirality is evolutionarily conserved, including the essential role of the actin cytoskeleton. Although the biological roles of cell chirality in vertebrates remain unknown, it may control LR asymmetric development or other morphogenetic events. The investigation of cell chirality has just begun, and this new field should provide valuable new insights in biology and medicine.

Cell chirality: its origin and roles in left-right asymmetric development.

Science.gov (United States)

Inaki, Mikiko; Liu, Jingyang; Matsuno, Kenji

2016-12-19

An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by 'cortical inheritance'. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left-right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Authors.

Cell chirality: its origin and roles in left–right asymmetric development

Science.gov (United States)

Inaki, Mikiko; Liu, Jingyang

2016-01-01

An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by ‘cortical inheritance’. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left–right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821533

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

International Nuclear Information System (INIS)

Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

2017-01-01

Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

Low-priced, time-saving, reliable and stable LR-115 counting system

International Nuclear Information System (INIS)

Tchorz-Trzeciakiewicz, D.E.

2015-01-01

Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

International Nuclear Information System (INIS)

Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

1996-01-01

The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

LALR(1) : LL(1) = LR(0) : LL(0)

NARCIS (Netherlands)

Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

1992-01-01

It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

Science.gov (United States)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

Radon concentrations in some Egyptian dwellings using LR 115 detectors

International Nuclear Information System (INIS)

Hussein, A.S.

2007-01-01

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

Science.gov (United States)

A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

Radon concentrations in some Egyptian dwellings using LR 115 detectors

Energy Technology Data Exchange (ETDEWEB)

Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

Left-right asymmetry is formed in individual cells by intrinsic cell chirality.

Science.gov (United States)

Hatori, Ryo; Ando, Tadashi; Sasamura, Takeshi; Nakazawa, Naotaka; Nakamura, Mitsutoshi; Taniguchi, Kiichiro; Hozumi, Shunya; Kikuta, Junichi; Ishii, Masaru; Matsuno, Kenji

2014-08-01

Many animals show left-right (LR) asymmetric morphology. The mechanisms of LR asymmetric development are evolutionarily divergent, and they remain elusive in invertebrates. Various organs in Drosophila melanogaster show stereotypic LR asymmetry, including the embryonic gut. The Drosophila embryonic hindgut twists 90° left-handedly, thereby generating directional LR asymmetry. We recently revealed that the hindgut epithelial cell is chiral in shape and other properties; this is termed planar cell chirality (PCC). We previously showed by computer modeling that PCC is sufficient to induce the hindgut rotation. In addition, both the PCC and the direction of hindgut twisting are reversed in Myosin31DF (Myo31DF) mutants. Myo31DF encodes Drosophila MyosinID, an actin-based motor protein, whose molecular functions in LR asymmetric development are largely unknown. Here, to understand how PCC directs the asymmetric cell-shape, we analyzed PCC in genetic mosaics composed of cells homozygous for mutant Myo31DF, some of which also overexpressed wild-type Myo31DF. Wild-type cell-shape chirality only formed in the Myo31DF-overexpressing cells, suggesting that cell-shape chirality was established in each cell and reflects intrinsic PCC. A computer model recapitulating the development of this genetic mosaic suggested that mechanical interactions between cells are required for the cell-shape behavior seen in vivo. Our mosaic analysis also suggested that during hindgut rotation in vivo, wild-type Myo31DF suppresses the elongation of cell boundaries, supporting the idea that cell-shape chirality is an intrinsic property determined in each cell. However, the amount and distribution of F-actin and Myosin II, which are known to help generate the contraction force on cell boundaries, did not show differences between Myo31DF mutant cells and wild-type cells, suggesting that the static amount and distribution of these proteins are not involved in the suppression of cell-boundary elongation

Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

Science.gov (United States)

Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

2013-11-15

Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

NARCIS (Netherlands)

Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

2017-01-01

The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

The calibration of the solid state nuclear track detector LR 115 for radon measurements

CERN Document Server

Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

1999-01-01

An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

Mesenchymal Stem Cells Enhance Liver Regeneration via Improving Lipid Accumulation and Hippo Signaling

Directory of Open Access Journals (Sweden)

Yang Liu

2018-01-01

Full Text Available The liver has the potential to regenerate after injury. It is a challenge to improve liver regeneration (LR after liver resection in clinical practice. Bone morrow-derived mesenchymal stem cells (MSCs have shown to have a role in various liver diseases. To explore the effects of MSCs on LR, we established a model of 70% partial hepatectomy (PHx. Results revealed that infusion of MSCs could improve LR through enhancing cell proliferation and cell growth during the first 2 days after PHx, and MSCs could also restore liver synthesis function. Infusion of MSCs also improved liver lipid accumulation partly via mechanistic target of rapamycin (mTOR signaling and enhanced lipid β-oxidation support energy for LR. Rapamycin-induced inhibition of mTOR decreased liver lipid accumulation at 24 h after PHx, leading to impaired LR. And after infusion of MSCs, a proinflammatory environment formed in the liver, evidenced by increased expression of IL-6 and IL-1β, and thus the STAT3 and Hippo-YAP pathways were activated to improve cell proliferation. Our results demonstrated the function of MSCs on LR after PHx and provided new evidence for stem cell therapy of liver diseases.

Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann

1981-01-01

A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

Science.gov (United States)

Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

First successful ionization of Lr (Z = 103) by a surface-ionization technique

Energy Technology Data Exchange (ETDEWEB)

Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

2013-02-15

We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

Chiral Orientation of Skeletal Muscle Cells Requires Rigid Substrate

Directory of Open Access Journals (Sweden)

Ninghao Zhu

2017-06-01

Full Text Available Reconstitution of tissue morphology with inherent left–right (LR asymmetry is essential for tissue/organ functions. For skeletal muscle, the largest tissue in mammalian organisms, successful myogenesis requires the regulation of the LR asymmetry to form the appropriate muscle alignment. However, the key factor for reproducing the LR asymmetry of skeletal tissues in a controllable, engineering context remains largely unknown. Recent reports indicate that cell chirality may underlie the LR development in tissue morphogenesis. Here, we report that a rigid substrate is required for the chirality of skeletal muscle cells. By using alternating micropatterned cell-adherent and cell-repellent stripes on a rigid substrate, we found that C2C12 skeletal muscle myoblasts exhibited a unidirectional tilted orientation with respect to the stripe boundary. Importantly, such chiral orientation was reduced when soft substrates were used instead. In addition, we demonstrated the key role of actin stress fibers in the formation of the chiral orientation. This study reveals that a rigid substrate is required for the chiral pattern of myoblasts, paving the way for reconstructing damaged muscle tissue with inherent LR asymmetry in the future.

SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

Directory of Open Access Journals (Sweden)

Carol P. S. Lam

2015-01-01

Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

Institute of Scientific and Technical Information of China (English)

王文琴; 张永臣; 贾红玲

2013-01-01

目的：通过对太冲古代文献的整理，总结太冲的应用规律。方法：以《中华医典》（第四版）收录的中医古籍1000部为检索范围，对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理，并建立数据库。结果：太冲应用符合纳入标准的有752条，治疗病症共有689条，涉及87部古籍。太冲配伍的使用频次共有1433次，与太冲穴配伍的经穴为167个。结论：太冲单穴适应于临床各科，尤善于治疗中医内科病症，前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证；配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风；太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多，常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交；常用的刺灸法为灸法，针刺深度为针三分，针刺时间为十呼，灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

Green synthesis of nitrogen-doped carbon dots from lotus root for Hg(II) ions detection and cell imaging

Energy Technology Data Exchange (ETDEWEB)

Gu, Dan; Shang, Shaoming, E-mail: smshang@jiangnan.edu.cn; Yu, Qin; Shen, Jie

2016-12-30

Graphical abstract: Fluorescent nitrogen-doped carbon dots were synthesized by a facile, green, and fast microwave method, using lotus root as carbon source. These nitrogen-doped carbon dots can be used for Hg{sup 2+} detection and cell imaging. - Highlights: • A green, fast strategy for synthesizing carbon dots was established. • A simple, sensitive, selective and wide linear range sensing of Hg{sup 2+} was developed. • The sensor system was demonstrated to detect Hg{sup 2+} in environmental water sample. • The carbon dots could serve for multicolor fluorescence bioimaging. - Abstract: Herein, a facile, green, and fast method was developed in the synthesis of fluorescent nitrogen-doped carbon dots (CDs) with nitrogen content of 5.23%, using one-pot microwave treatment of lotus root (LR), without using any other surface passivation agents. The results show that these LR-CDs (with an average diameter of 9.41 nm) possess many outstanding features and have a high quantum yield of 19.0%. We further demonstrated applications of LR-CDs as probes for heavy metal ion detection. The LR-CDs exhibit captivating sensitivity and selectivity toward Hg{sup 2+} with a linear range from 0.1 to 60.0 μM and a detection limit of 18.7 nM. Eventually, the LR-CDs were applied for multicolor cell imaging, demonstrating their potential toward diverse applications.

Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

Science.gov (United States)

Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

2007-12-26

Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

International Nuclear Information System (INIS)

Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

2012-01-01

Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

Science.gov (United States)

Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

Directory of Open Access Journals (Sweden)

Jing Li

2018-01-01

Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

Chiral cell sliding drives left-right asymmetric organ twisting

Science.gov (United States)

Inaki, Mikiko; Hatori, Ryo; Nakazawa, Naotaka; Okumura, Takashi; Ishibashi, Tomoki; Kikuta, Junichi; Ishii, Masaru

2018-01-01

Polarized epithelial morphogenesis is an essential process in animal development. While this process is mostly attributed to directional cell intercalation, it can also be induced by other mechanisms. Using live-imaging analysis and a three-dimensional vertex model, we identified ‘cell sliding,’ a novel mechanism driving epithelial morphogenesis, in which cells directionally change their position relative to their subjacent (posterior) neighbors by sliding in one direction. In Drosophila embryonic hindgut, an initial left-right (LR) asymmetry of the cell shape (cell chirality in three dimensions), which occurs intrinsically before tissue deformation, is converted through LR asymmetric cell sliding into a directional axial twisting of the epithelial tube. In a Drosophila inversion mutant showing inverted cell chirality and hindgut rotation, cell sliding occurs in the opposite direction to that in wild-type. Unlike directional cell intercalation, cell sliding does not require junctional remodeling. Cell sliding may also be involved in other cases of LR-polarized epithelial morphogenesis. PMID:29891026

Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

Directory of Open Access Journals (Sweden)

Gaodao Liang

2011-01-01

Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

Bulk etch rate of LR-115 cellulose nitrate film

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

International Nuclear Information System (INIS)

Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

2001-01-01

An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

Science.gov (United States)

Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

2017-10-01

The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

2012-04-15

Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

Science.gov (United States)

Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

2018-06-01

The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

Expansion and differentiation of germline-derived pluripotent stem cells on biomaterials.

Science.gov (United States)

Hoss, Mareike; Šarić, Tomo; Denecke, Bernd; Peinkofer, Gabriel; Bovi, Manfred; Groll, Jürgen; Ko, Kinarm; Salber, Jochen; Halbach, Marcel; Schöler, Hans R; Zenke, Martin; Neuss, Sabine

2013-05-01

Stem cells with broad differentiation potential, such as the recently described germline-derived pluripotent stem cells (gPS cells), are an appealing source for tissue engineering strategies. Biomaterials can inhibit, support, or induce proliferation and differentiation of stem cells. Here we identified (1) polymers that maintain self-renewal and differentiation potential of gPS cells for feeder-free expansion and (2) polymers supporting the cardiomyogenic fate of gPS cells by analyzing a panel of polymers of an established biomaterial bank previously used to assess growth of diverse stem cell types. Identification of cytocompatible gPS cell/biomaterial combinations required analysis of several parameters, including morphology, viability, cytotoxicity, apoptosis, proliferation, and differentiation potential. Pluripotency of gPS cells was visualized by the endogenous Oct4-promoter-driven GFP and by Sox2 and Nanog immunofluorescence. Viability assay, proliferation assay, and flow cytometry showed that gPS cells efficiently adhere and are viable on synthetic polymers, such as Resomer(®) LR704 (poly(L-lactic-D,L-lactic acid), poly(tetrafluor ethylene) (PTFE), poly(vinylidene fluoride) (PVDF), and on gelatine-coated tissue culture polystyrene. Expansion experiments showed that Resomer LR704 is an alternative substrate for feeder-free gPS cell maintenance. Resomer LR704, PTFE, and PVDF were found to be suitable for gPS cell differentiation. Spontaneous beating in embryoid bodies cultured on Resomer LR704 occurred already on day 8 of differentiation, much earlier compared to the other surfaces. This indicates that Resomer LR704 supports spontaneous cardiomyogenic differentiation of gPS cells, which was also confirmed on molecular, protein and functional level.

Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

NARCIS (Netherlands)

Haraksim, Rudolf; Meuwly, Didier

2013-01-01

This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

WWER safety investigations on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2001-01-01

A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

Science.gov (United States)

Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

2015-02-01

The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

Cell Wall Structure of Coccoid Green Algae as an Important Trade-Off Between Biotic Interference Mechanisms and Multidimensional Cell Growth.

Science.gov (United States)

Dunker, Susanne; Wilhelm, Christian

2018-01-01

Coccoid green algae can be divided in two groups based on their cell wall structure. One group has a highly chemical resistant cell wall (HR-cell wall) containing algaenan. The other group is more susceptible to chemicals (LR-cell wall - Low resistant cell wall). Algaenan is considered as important molecule to explain cell wall resistance. Interestingly, cell wall types (LR- and HR-cell wall) are not in accordance with the taxonomic classes Chlorophyceae and Trebouxiophyceae, which makes it even more interesting to consider the ecological function. It was already shown that algaenan helps to protect against virus, bacterial and fungal attack, but in this study we show for the first time that green algae with different cell wall properties show different sensitivity against interference competition with the cyanobacterium Microcystis aeruginosa . Based on previous work with co-cultures of M. aeruginosa and two green algae ( Acutodesmus obliquus and Oocystis marssonii ) differing in their cell wall structure, it was shown that M. aeruginosa could impair only the growth of the green algae if they belong to the LR-cell wall type. In this study it was shown that the sensitivity to biotic interference mechanism shows a more general pattern within coccoid green algae species depending on cell wall structure.

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

Energy Technology Data Exchange (ETDEWEB)

Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

2017-02-15

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

International Nuclear Information System (INIS)

Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

2017-01-01

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Downregulation of the non-integrin laminin receptor reduces cellular viability by inducing apoptosis in lung and cervical cancer cells.

Directory of Open Access Journals (Sweden)

Kiashanee Moodley

Full Text Available The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR, is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and angiogenesis. This study investigated whether LRP/LR is implicated in the maintenance of cellular viability in lung and cervical cancer cell lines. Here we show a significant reduction in cellular viability in the aforementioned cell lines as a result of the siRNA-mediated downregulation of LRP. This reduction in cellular viability is due to increased apoptotic processes, reflected by the loss of nuclear integrity and the significant increase in the activity of caspase-3. These results indicate that LRP/LR is involved in the maintenance of cellular viability in tumorigenic lung and cervix uteri cells through the blockage of apoptosis. Knockdown of LRP/LR by siRNA might represent an alternative therapeutic strategy for the treatment of lung and cervical cancer.

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Role of eicosanoids and white blood cells in the beneficial effects of limited reperfusion after ischemia-reperfusion injury in skeletal muscle

International Nuclear Information System (INIS)

Anderson, R.J.; Cambria, R.A.; Dikdan, G.; Lysz, T.W.; Hobson, R.W. II

1990-01-01

Limiting the rate of reperfusion blood flow has been shown to be beneficial locally in models of ischemia-reperfusion injury. We investigated the effects of this on eicosanoids (thromboxane B2, 6-keto-PGF1 alpha, and leukotriene B4), white blood cell activation, and skeletal muscle injury as quantitated by triphenyltetrazolium chloride and technetium-99m pyrophosphate after ischemia-reperfusion injury in an isolated gracilis muscle model in 16 anesthetized dogs. One gracilis muscle in each dog was subjected to 6 hours of ischemia followed by 1 hour of limited reperfusion and then by a second hour of normal reperfusion. The other muscle was subjected to 6 hours of ischemia followed by 2 hours of normal reperfusion. Six dogs each were used as normal reperfusion controls (NR) and limited reperfusion controls (LR), with 5 dogs being treated with a thromboxane synthetase inhibitor (LR/TSI) and another five with a leukotriene inhibitor (LR/LI). LR in all three groups (LR, LR/TSI, and LR/LI) showed a benefit in skeletal muscle injury as measured by triphenyltetrazolim chloride and technetium-99m pyrophosphate when compared with NR. However, there was no significant difference between the groups with LR regarding eicosanoid levels and white blood cell activation when compared with NR. These results demonstrate that LR produces benefits by mechanisms other than those dependent upon thromboxane A2, prostacyclin, or white blood cell activation

The notochord breaks bilateral symmetry by controlling cell shapes in the zebrafish laterality organ.

Science.gov (United States)

Compagnon, Julien; Barone, Vanessa; Rajshekar, Srivarsha; Kottmeier, Rita; Pranjic-Ferscha, Kornelija; Behrndt, Martin; Heisenberg, Carl-Philipp

2014-12-22

Kupffer's vesicle (KV) is the zebrafish organ of laterality, patterning the embryo along its left-right (LR) axis. Regional differences in cell shape within the lumen-lining KV epithelium are essential for its LR patterning function. However, the processes by which KV cells acquire their characteristic shapes are largely unknown. Here, we show that the notochord induces regional differences in cell shape within KV by triggering extracellular matrix (ECM) accumulation adjacent to anterior-dorsal (AD) regions of KV. This localized ECM deposition restricts apical expansion of lumen-lining epithelial cells in AD regions of KV during lumen growth. Our study provides mechanistic insight into the processes by which KV translates global embryonic patterning into regional cell shape differences required for its LR symmetry-breaking function. Copyright © 2014 Elsevier Inc. All rights reserved.

Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

Science.gov (United States)

Siuly; Li, Yan; Paul Wen, Peng

2014-03-01

Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

CERN Document Server

Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

1999-01-01

Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

International Nuclear Information System (INIS)

Clement, G.; Delvecchio, D.J.; Sazawal, V.

1997-01-01

The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

Lactobacillus reuteri DSM 17938 changes the frequency of Foxp3+ regulatory T cells in the intestine and mesenteric lymph node in experimental necrotizing enterocolitis.

Directory of Open Access Journals (Sweden)

Yuying Liu

Full Text Available Necrotizing enterocolitis (NEC is an inflammatory disease of the intestine in premature infants. Lactobacillus reuteri DSM 17938 improves survival and reduces the incidence and severity of NEC in a rodent model. Foxp3(+ regulatory T cells (Tregs maintain intestinal homeostasis by controlling inflammation and inducing tolerance. To determine whether there are insufficient numbers of Tregs to control inflammation in NEC and to determine if LR17938 increases the frequency of Tregs, we studied selected groups of newborn Sprague-Dawley rats according to feeding plan: dam±LR17938, formula±LR17938, and NEC±LR17938. NEC was induced by gavage feeding with special formula and exposure to hypoxic conditions. Lymphocytes isolated from ileum, mesenteric lymph nodes (MLN, spleen and thymus were labeled for T cell surface markers (CD3, CD4, CD8 and intracellular Foxp3; and labeled cells were analyzed by flow cytometry. The percentage of CD3(+ T cells and Foxp3(+ Tregs in the ileum significantly decreased in pups with NEC, compared to normal controls. Feeding LR17938 to neonatal rats with NEC increased the % of Foxp3(+ T cells in the ileum while decreasing the percentage of cells in the MLN. Administration of LR17938 to dam-fed rats significantly increased Foxp3(+Tregs in the ileum as early as day of life (DOL1 but did not produce an increase in Tregs in formula-fed rats on DOL1. These results suggest that factors in breast milk may enhance the early immunomodulatory effects of LR17938. An anti-inflammatory effect of LR17938 in NEC was associated with the modulation of immune responses and induction and what appears to be migration of Foxp3(+ Tregs to the diseased gut. Probiotic-facilitated development of Tregs might play an important role in the prevention of NEC.

The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

Directory of Open Access Journals (Sweden)

Valentina Kubale

2016-07-01

Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

International Nuclear Information System (INIS)

Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-01-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

Energy Technology Data Exchange (ETDEWEB)

Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

2010-03-15

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

Science.gov (United States)

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

Impaired Expression of Focal Adhesion Kinase in Mesenchymal Stromal Cells from Low-Risk Myelodysplastic Syndrome Patients

Directory of Open Access Journals (Sweden)

Yuenv Wu

2017-08-01

Full Text Available The pathogenic role of mesenchymal stromal cells (MSCs in myelodysplastic syndromes (MDS development and progression has been investigated by numerous studies, yet, it remains controversial in some aspects (1, 2. In the present study, we found distinct features of MSCs from low-risk (LR-MDS stromal microenvironment as compared to those from healthy subjects. At the molecular level, focal adhesion kinase, a key tyrosine kinase in control of cell proliferation, survival, and adhesion process, was found profoundly suppressed in expression and activation in LR-MDS MSC. At a functional level, LR-MDS MSCs showed impaired growth and clonogenic capacity, which were independent of cellular senescence and apoptosis. The pro-adipogenic differentiation and attenuated osteogenic capacity along with reduced SDF-1 expression could be involved in creating an unfavorable microenvironment for hematopoiesis. In conclusion, our experiments support the theory that the stromal microenvironment is fundamentally altered in LR-MDS, and these preliminary data offer a new perspective on LR-MDS pathophysiology.

Absolute Transition Rates in {sup 188}lr

Energy Technology Data Exchange (ETDEWEB)

Malmskog, S G; Berg, V

1969-09-15

Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

DEFF Research Database (Denmark)

Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

2015-01-01

We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

Cellular and Nuclear Alignment Analysis for Determining Epithelial Cell Chirality

Science.gov (United States)

Raymond, Michael J.; Ray, Poulomi; Kaur, Gurleen; Singh, Ajay V.; Wan, Leo Q.

2015-01-01

Left-right (LR) asymmetry is a biologically conserved property in living organisms that can be observed in the asymmetrical arrangement of organs and tissues and in tissue morphogenesis, such as the directional looping of the gastrointestinal tract and heart. The expression of LR asymmetry in embryonic tissues can be appreciated in biased cell alignment. Previously an in vitro chirality assay was reported by patterning multiple cells on microscale defined geometries and quantified the cell phenotype–dependent LR asymmetry, or cell chirality. However, morphology and chirality of individual cells on micropatterned surfaces has not been well characterized. Here, a Python-based algorithm was developed to identify and quantify immunofluorescence stained individual epithelial cells on multicellular patterns. This approach not only produces results similar to the image intensity gradient-based method reported previously, but also can capture properties of single cells such as area and aspect ratio. We also found that cell nuclei exhibited biased alignment. Around 35% cells were misaligned and were typically smaller and less elongated. This new imaging analysis approach is an effective tool for measuring single cell chirality inside multicellular structures and can potentially help unveil biophysical mechanisms underlying cellular chiral bias both in vitro and in vivo. PMID:26294010

Direct determination of bulk etching rate for LR-115-II solid state ...

Indian Academy of Sciences (India)

The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

Age-related changes of healthy bone marrow cell signaling in response to growth factors provide insight into low risk MDS.

Science.gov (United States)

Kornblau, Steven M; Cohen, Aileen C; Soper, David; Huang, Ying-Wen; Cesano, Alessandra

2014-11-01

Single Cell Network Profiling (SCNP) is a multiparametric flow cytometry-based assay that quantifiably and simultaneously measures changes in intracellular signaling proteins in response to in vitro extracellular modulators at the single cell level. Myelodysplastic syndrome (MDS) is a heterogeneous clonal disorder of hematopoietic stem cells that occurs in elderly subjects and is characterized by dysplasia and ineffective hematopoiesis. The functional responsiveness of MDS bone marrow (BM) hematopoietic cells, including functionally distinct myeloid and erythroid precursor subsets, to hematopoietic growth factors (HGF) and the relationship of modulated signaling to disease characteristics is poorly understood. SCNP was used first to examine the effects of age on erythropoietin (EPO) and granulocyte colony stimulating factor (GCSF)-induced signaling in myeloid, nucleated red blood cells (nRBC), and CD34 expressing cell subsets in healthy BM (n = 15). SCNP was then used to map functional signaling profiles in low risk (LR) MDS (n = 7) for comparison to signaling in samples from healthy donors and to probe signaling associations within clinically defined subgroups. In healthy BM samples, signaling responses to HGF were quite homogeneous (i.e., tightly regulated) with age-dependent effects observed in response to EPO but not to GCSF. Despite the relatively small number of samples assayed in the study, LR MDS could be classified into distinct subgroups based on both cell subset frequency and signaling profiles. As a correlate of underlying genetic abnormalities, signal transduction analyses may provide a functional and potentially clinically relevant classification of MDS. Further evaluation in a larger cohort is warranted. © 2013 Clinical Cytometry Society.

Determination of thorium and uranium contents in soil samples ...

Indian Academy of Sciences (India)

using CR-39 and LR-115-II solid-state nuclear track detectors (SSNTDs). ... standard soil samples have been determined and compared with its known values. ... measure α-tracks activity [1], where SSNTDs have been used in geology [2–6] ...

In Vitro Evaluation of Swine-Derived Lactobacillus reuteri: Probiotic Properties and Effects on Intestinal Porcine Epithelial Cells Challenged with Enterotoxigenic Escherichia coli K88.

Science.gov (United States)

Wang, Zhilin; Wang, Li; Chen, Zhuang; Ma, Xianyong; Yang, Xuefen; Zhang, Jian; Jiang, Zongyong

2016-06-28

Probiotics are considered as the best effective alternatives to antibiotics. The aim of this study was to characterize the probiotic potential of lactobacilli for use in swine farming by using in vitro evaluation methods. A total of 106 lactic acid bacterial isolates, originating from porcine feces, were first screened for the capacity to survive stresses considered important for putative probiotic strains. Sixteen isolates showed notable acid and bile resistance, antibacterial activity, and adherence to intestinal porcine epithelial cells (IPEC-1). One isolate, LR1, identified as Lactobacillus reuteri, was selected for extensive study of its probiotic and functional properties in IPEC-1 cell models. L. reuteri LR1 exhibited good adhesion to IPEC-1 cells and could inhibit the adhesion of enterotoxigenic Escherichia coli (ETEC) to IPEC-1 cells. L. reuteri LR1 could also modulate transcript and protein expression of cytokines involved in inflammation in IPEC-1 cells; the Lactobacillus strain inhibited the ETEC-induced expression of proinflammatory transcripts (IL-6 and TNF-α) and protein (IL-6), and increased the level of anti-inflammatory cytokine (IL-10). Measurement of the permeation of FD-4 showed that L. reuteri LR1 could maintain barrier integrity in monolayer IPEC-1 cells exposed to ETEC. Immunolocalization experiments showed L. reuteri LR1 could also prevent ETEC-induced tight junction ZO-1 disruption. Together, these results indicate that L. reuteri LR1 exhibits desirable probiotic properties and could be a potential probiotic for use in swine production.

Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

Directory of Open Access Journals (Sweden)

Jaiok Roh

2011-01-01

Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

Directory of Open Access Journals (Sweden)

Carolina Saori Ishii Mauro

2016-12-01

Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

Science.gov (United States)

Woods, Carol M.

2008-01-01

Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

Science.gov (United States)

Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

2016-03-01

While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

Science.gov (United States)

Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

2016-01-01

The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

Influence of Sampling Practices on the Appearance of DNA Image Histograms of Prostate Cells in FNAB Samples

Directory of Open Access Journals (Sweden)

Abdelbaset Buhmeida

1999-01-01

Full Text Available Twenty‐one fine needle aspiration biopsies (FNAB of the prostate, diagnostically classified as definitely malignant, were studied. The Papanicolaou or H&E stained samples were destained and then stained for DNA with the Feulgen reaction. DNA cytometry was applied after different sampling rules. The histograms varied according to the sampling rule applied. Because free cells between cell groups were easier to measure than cells in the cell groups, two sampling rules were tested in all samples: (i cells in the cell groups were measured, and (ii free cells between cell groups were measured. Abnormal histograms were more common after the sampling rule based on free cells, suggesting that abnormal patterns are best revealed through the free cells in these samples. The conclusions were independent of the applied histogram interpretation method.

Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

International Nuclear Information System (INIS)

Azuma, Koichi; Tsurutani, Junji; Sakai, Kazuko; Kaneda, Hiroyasu; Fujisaka, Yasuhito; Takeda, Masayuki; Watatani, Masahiro; Arao, Tokuzo; Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu; Nishio, Kazuto; Nakagawa, Kazuhiko

2011-01-01

Highlights: → A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. → Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. → Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC 50 of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

Energy Technology Data Exchange (ETDEWEB)

Azuma, Koichi [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Tsurutani, Junji, E-mail: tsurutani_j@dotd.med.kindai.ac.jp [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Sakai, Kazuko; Kaneda, Hiroyasu [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Fujisaka, Yasuhito; Takeda, Masayuki [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Watatani, Masahiro [Department of Surgery, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Arao, Tokuzo [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nishio, Kazuto [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan)

2011-04-01

Highlights: {yields} A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. {yields} Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. {yields} Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC{sub 50} of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

Locoregional failures following thoracic irradiation in patients with limited-stage small cell lung carcinoma

International Nuclear Information System (INIS)

Giuliani, Meredith E.; Lindsay, Patricia E.; Sun, Alexander; Bezjak, Andrea; Le, Lisa W.; Brade, Anthony; Cho, John; Leighl, Natasha B.; Shepherd, Frances A.; Hope, Andrew J.

2012-01-01

Purpose: To determine the patterns of loco-regional (LR) and distant failure in patients with limited-stage small cell lung carcinoma (LS-SCLC) treated with curative intent. Methods: From 1997 to 2008, 253 LS-SCLC patients were treated with curative intent chemo-radiation at our institution. A retrospective review identified sites of failure. The cumulative LR failure (LRF) rate was calculated. Distant failure-free survival (FFS) and overall survival (OS) were calculated using the Kaplan–Meier method. Volumetric images of LR failures were delineated and registered with the original radiation treatment plans if available. Dosimetric parameters for the delineated failure volumes were calculated from the original treatment information. Results: The median follow-up was 19 months. The site of first failure was LR in 34, distant in 80 and simultaneous LR and distant in 31 patients. The cumulative LRF rate was 29% and 38% at 2 and 5 years. OS was 44% at 2 years. Seventy patients had electronically archived treatment plans of which there were 16 LR failures (7 local and 39 regional failure volumes). Of the local and regional failure volumes 29% and 31% were in-field, respectively. Conclusions: The predominant pattern of LR failure was marginal or out-of-field. LR failures may be preventable with improved radiotherapy target definition.

Distinct Roles of Th17 and Th1 Cells in Inflammatory Responses Associated with the Presentation of Paucibacillary Leprosy and Leprosy Reactions.

Science.gov (United States)

Santos, M B; de Oliveira, D T; Cazzaniga, R A; Varjão, C S; Dos Santos, P L; Santos, M L B; Correia, C B; Faria, D R; Simon, M do V; Silva, J S; Dutra, W O; Reed, S G; Duthie, M S; de Almeida, R P; de Jesus, A R

2017-07-01

It is well established that helper T cell responses influence resistance or susceptibility to Mycobacterium leprae infection, but the role of more recently described helper T cell subsets in determining severity is less clear. To investigate the involvement of Th17 cells in the pathogenesis of leprosy, we determined the immune profile with variant presentations of leprosy. Firstly, IL-17A, IFN-γ and IL-10 were evaluated in conjunction with CD4 + T cell staining by confocal microscopy of lesion biopsies from tuberculoid (TT) and lepromatous leprosy (LL) patients. Secondly, inflammatory cytokines were measured by multiplex assay of serum samples from Multibacillary (MB, n = 28) and Paucibacillary (PB, n = 23) patients and household contacts (HHC, n = 23). Patients with leprosy were also evaluated for leprosy reaction occurrence: LR+ (n = 8) and LR- (n = 20). Finally, peripheral blood mononuclear cells were analysed by flow cytometry used to determine the phenotype of cytokine-producing cells. Lesions from TT patients were found to have more CD4 + IL-17A + cells than those from LL patients. Higher concentrations of IL-17A and IL-1β were observed in serum from PB than MB patients. The highest serum IFN-γ concentrations were, however, detected in sera from MB patients that developed leprosy reactions (MB LR + ). Together, these results indicate that Th1 cells were associated with both the PB presentation and also with leprosy reactions. In contrast, Th17 cells were associated with an effective inflammatory response that is present in the PB forms but were not predictive of leprosy reactions in MB patients. © 2017 The Foundation for the Scandinavian Journal of Immunology.

Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

Science.gov (United States)

Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

2011-01-01

A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

CSIR Research Space (South Africa)

Oberholster, Paul J

2009-09-01

Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

International Nuclear Information System (INIS)

Huang, Eng-Yen; Chanchien, Chan-Chao; Lin, Hao; Wang, Chung-Chi; Wang, Chong-Jong; Huang, Chao-Cheng

2013-01-01

Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer

Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

Energy Technology Data Exchange (ETDEWEB)

Huang, Eng-Yen [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); School of Traditional Chinese Medicine, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Chanchien, Chan-Chao; Lin, Hao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Wang, Chung-Chi; Wang, Chong-Jong [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Huang, Chao-Cheng, E-mail: huangcc@cgmh.org.tw [Department of Pathology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)

2013-12-01

Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer.

Sampling strategies to capture single-cell heterogeneity

OpenAIRE

Satwik Rajaram; Louise E. Heinrich; John D. Gordan; Jayant Avva; Kathy M. Bonness; Agnieszka K. Witkiewicz; James S. Malter; Chloe E. Atreya; Robert S. Warren; Lani F. Wu; Steven J. Altschuler

2017-01-01

Advances in single-cell technologies have highlighted the prevalence and biological significance of cellular heterogeneity. A critical question is how to design experiments that faithfully capture the true range of heterogeneity from samples of cellular populations. Here, we develop a data-driven approach, illustrated in the context of image data, that estimates the sampling depth required for prospective investigations of single-cell heterogeneity from an existing collection of samples. ...

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

Science.gov (United States)

Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-03-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

Science.gov (United States)

1956-01-01

The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

Calibration of track detectors and measurement of radon exhalation rate from solid samples

International Nuclear Information System (INIS)

Singh, Ajay Kumar; Jojo, P.J.; Prasad, Rajendra; Khan, A.J.; Ramachandran, T.V.

1997-01-01

CR-39 and LR-115 type II track detectors to be used for radon exhalation measurements have been calibrated. The configurations fitted with detectors in Can technique in the open cup mode are cylindrical plastic cup (PC) and conical plastic cup (CPC). The experiment was performed in radon exposure chamber having monodisperse aerosols of 0.2 μm size, to find the relationship between track density and the radon concentration. The calibration factors for PC and CPC type dosimeters with LR-115 type II detector were found to be 0.056 and 0.083 tracks cm -2 d -1 (Bqm -3 ) -1 respectively, while with CR-39 detector the values were 0.149 and 0.150 tracks cm -2 d -1 (Bq m -3 ) -1 . Employing the Can technique, measurements of exhalation rates from solid samples used as construction materials, are undertaken. Radon exhalation rate is found to be minimum in cement samples while in fly ash it is not enhanced as compared to coal samples. (author)

A modified approach to estimating sample size for simple logistic regression with one continuous covariate.

Science.gov (United States)

Novikov, I; Fund, N; Freedman, L S

2010-01-15

Different methods for the calculation of sample size for simple logistic regression (LR) with one normally distributed continuous covariate give different results. Sometimes the difference can be large. Furthermore, some methods require the user to specify the prevalence of cases when the covariate equals its population mean, rather than the more natural population prevalence. We focus on two commonly used methods and show through simulations that the power for a given sample size may differ substantially from the nominal value for one method, especially when the covariate effect is large, while the other method performs poorly if the user provides the population prevalence instead of the required parameter. We propose a modification of the method of Hsieh et al. that requires specification of the population prevalence and that employs Schouten's sample size formula for a t-test with unequal variances and group sizes. This approach appears to increase the accuracy of the sample size estimates for LR with one continuous covariate.

Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

Energy Technology Data Exchange (ETDEWEB)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

2003-07-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

CSIR Research Space (South Africa)

Nchabeleng, T

2014-12-01

Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

Application of the LR-56 at DOE Facilities in the United States

International Nuclear Information System (INIS)

Smith, A.C.

1998-05-01

The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

Comparative study of cyanotoxins affecting cytoskeletal and chromatin structures in CHO-K1 cells.

Science.gov (United States)

Gácsi, Mariann; Antal, Otilia; Vasas, Gábor; Máthé, Csaba; Borbély, György; Saker, Martin L; Gyori, János; Farkas, Anna; Vehovszky, Agnes; Bánfalvi, Gáspár

2009-06-01

In this study we compared the effects of the two frequently occuring and most dangerous cyanobacterial toxins on the cellular organization of microfilaments, microtubules and on the chromatin structure in Chinese hamster ovary (CHO-K1) cells. These compounds are the widely known microcystin-LR (MC-LR) and cylindrospermopsin (CYN) classified as the highest-priority cyanotoxin. Toxic effects were tested in a concentration and time dependent manner. The hepatotoxic MC-LR did not cause significant cytotoxicity on CHO-K1 cells under 20 microM, but caused apoptotic changes at higher concentrations. Apoptotic shrinkage was associated with the shortening and loss of actin filaments and with a concentration dependent depolymerization of microtubules. No necrosis was observed over the concentration range (1-50 microM MC-LR) tested. Cylindrospermopsin did cause apoptosis at low concentrations (1-2 microM) and over short exposure periods (12h). Necrosis was observed at higher concentrations (5-10 microM) and following longer exposure periods (24 or 48h). Cyanotoxins also affected the chromatin structure. The condensation process was inhibited by MC-LR at a later stage and manifested as broken elongated prechromosomes. CYN inhibited chromatin condensation at the early fibrillary stage leading to blurred fluorescent images of apoptotic bodies and preventing the formation of metaphase chromosomes. Cylindrospermopsin exhibited a more pronounced toxic effect causing cytoskeletal and nuclear changes as well as apoptotic and necrotic alterations.

Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

Directory of Open Access Journals (Sweden)

Vanessa de Farias

2009-06-01

Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

Application of Long-Range Surface Plasmon Resonance for ABO Blood Typing

Directory of Open Access Journals (Sweden)

Wanida Tangkawsakul

2016-01-01

Full Text Available In this study, we demonstrate a long-range surface plasmon resonance (LR-SPR biosensor for the detection of whole cell by captured antigens A and B on the surface of red blood cells (RBCs as a model. The LR-SPR sensor chip consists of high-refractive index glass, a Cytop film layer, and a thin gold (Au film, which makes the evanescent field intensity and the penetration depth longer than conventional SPR. Therefore, the LR-SPR biosensor has improved capability for detecting large analytes, such as RBCs. The antibodies specific to blood group A and group B (Anti-A and Anti-B are covalently immobilized on a grafting self-assembled monolayer (SAM/Au surface on the biosensor. For blood typing, RBC samples can be detected by the LR-SPR biosensor through a change in the refractive index. We determined that the results of blood typing using the LR-SPR biosensor are consistent with the results obtained from the agglutination test. We obtained the lowest detection limits of 1.58 × 105 cells/ml for RBC-A and 3.83 × 105 cells/ml for RBC-B, indicating that the LR-SPR chip has a higher sensitivity than conventional SPR biosensors (3.3 × 108 cells/ml. The surface of the biosensor can be efficiently regenerated using 20 mM NaOH. In summary, as the LR-SPR technique is sensitive and has a simple experimental setup, it can easily be applied for ABO blood group typing.

A cell transportation solution that preserves live circulating tumor cells in patient blood samples

International Nuclear Information System (INIS)

Stefansson, Steingrimur; Adams, Daniel L.; Ershler, William B.; Le, Huyen; Ho, David H.

2016-01-01

Circulating tumor cells (CTCs) are typically collected into CellSave fixative tubes, which kills the cells, but preserves their morphology. Currently, the clinical utility of CTCs is mostly limited to their enumeration. More detailed investigation of CTC biology can be performed on live cells, but obtaining live CTCs is technically challenging, requiring blood collection into biocompatible solutions and rapid isolation which limits transportation options. To overcome the instability of CTCs, we formulated a sugar based cell transportation solution (SBTS) that stabilizes cell viability at ambient temperature. In this study we examined the long term viability of human cancer cell lines, primary cells and CTCs in human blood samples in the SBTS for transportation purposes. Four cell lines, 5 primary human cells and purified human PBMCs were tested to determine the viability of cells stored in the transportation solution at ambient temperature for up to 7 days. We then demonstrated viability of MCF-7 cells spiked into normal blood with SBTS and stored for up to 7 days. A pilot study was then run on blood samples from 3 patients with metastatic malignancies stored with or without SBTS for 6 days. CTCs were then purified by Ficoll separation/microfilter isolation and identified using CTC markers. Cell viability was assessed using trypan blue or CellTracker™ live cell stain. Our results suggest that primary/immortalized cell lines stored in SBTS remain ~90 % viable for > 72 h. Further, MCF-7 cells spiked into whole blood remain viable when stored with SBTS for up to 7 days. Finally, live CTCs were isolated from cancer patient blood samples kept in SBTS at ambient temperature for 6 days. No CTCs were isolated from blood samples stored without SBTS. In this proof of principle pilot study we show that viability of cell lines is preserved for days using SBTS. Further, this solution can be used to store patient derived blood samples for eventual isolation of viable CTCs

A cell transportation solution that preserves live circulating tumor cells in patient blood samples.

Science.gov (United States)

Stefansson, Steingrimur; Adams, Daniel L; Ershler, William B; Le, Huyen; Ho, David H

2016-05-06

Circulating tumor cells (CTCs) are typically collected into CellSave fixative tubes, which kills the cells, but preserves their morphology. Currently, the clinical utility of CTCs is mostly limited to their enumeration. More detailed investigation of CTC biology can be performed on live cells, but obtaining live CTCs is technically challenging, requiring blood collection into biocompatible solutions and rapid isolation which limits transportation options. To overcome the instability of CTCs, we formulated a sugar based cell transportation solution (SBTS) that stabilizes cell viability at ambient temperature. In this study we examined the long term viability of human cancer cell lines, primary cells and CTCs in human blood samples in the SBTS for transportation purposes. Four cell lines, 5 primary human cells and purified human PBMCs were tested to determine the viability of cells stored in the transportation solution at ambient temperature for up to 7 days. We then demonstrated viability of MCF-7 cells spiked into normal blood with SBTS and stored for up to 7 days. A pilot study was then run on blood samples from 3 patients with metastatic malignancies stored with or without SBTS for 6 days. CTCs were then purified by Ficoll separation/microfilter isolation and identified using CTC markers. Cell viability was assessed using trypan blue or CellTracker™ live cell stain. Our results suggest that primary/immortalized cell lines stored in SBTS remain ~90% viable for > 72 h. Further, MCF-7 cells spiked into whole blood remain viable when stored with SBTS for up to 7 days. Finally, live CTCs were isolated from cancer patient blood samples kept in SBTS at ambient temperature for 6 days. No CTCs were isolated from blood samples stored without SBTS. In this proof of principle pilot study we show that viability of cell lines is preserved for days using SBTS. Further, this solution can be used to store patient derived blood samples for eventual isolation of viable CTCs after

Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

Directory of Open Access Journals (Sweden)

Julin Yuan

2015-10-01

Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

Science.gov (United States)

Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

2013-04-01

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

Science.gov (United States)

Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

2005-12-01

Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

OpenAIRE

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

Interaction of E-cadherin and PTEN regulates morphogenesis and growth arrest in human mammary epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Fournier, Marcia V.; Fata, Jimmie E.; Martin, Katherine J.; Yaswen, Paul; Bissell, Mina J.

2009-06-03

PTEN is a dual function phosphatase with tumor suppressor function compromised in a wide spectrum of cancers. Because tissue polarity and architecture are crucial modulators of normal and malignant behavior, we postulated that PTEN may play a role in maintenance of tissue integrity. We used two non-malignant human mammary epithelial cell lines (HMECs) that form polarized, growth-arrested structures (acini) when cultured in 3-dimensional laminin-rich extracellular matrix gels (3D lrECM). As acini begin to form, PTEN accumulates in both the cytoplasm, and at cell-cell contacts where it colocalizes with E-cadherin/{beta}-catenin complex. Reduction of PTEN levels by shRNA in lrECM prevents formation of organized breast acini and disrupts growth arrest. Importantly, disruption of acinar polarity and cell-cell contact by E-cadherin function-blocking antibodies reduces endogenous PTEN protein levels and inhibits its accumulation at cell-cell contacts. Conversely, in SKBR3 breast cancer cells lacking endogenous E-cadherin expression, exogenous introduction of E-cadherin gene causes induction of PTEN expression and its accumulation at sites of cell interactions. These studies provide evidence that E-cadherin regulates both the PTEN protein levels and its recruitment to cell-cell junctions in 3D lrECM indicating a dynamic reciprocity between architectural integrity and the levels and localization of PTEN. This interaction thus appears to be a critical integrator of proliferative and morphogenetic signaling in breast epithelial cells.

Parameters of calibration of the measurement system of 222 Rn based in LR-115

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

2003-01-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

Directory of Open Access Journals (Sweden)

Hanna Mazur

2001-09-01

Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

Nodal Stage of Surgically Resected Non-Small Cell Lung Cancer and Its Effect on Recurrence Patterns and Overall Survival

Energy Technology Data Exchange (ETDEWEB)

Varlotto, John M., E-mail: john.varlotto@umassmemorial.org [Department of Radiation Oncology, University of Massachusetts Medical Center, Worcester, Massachusetts (United States); Yao, Aaron N. [Department of Healthcare Policy and Research, Virginia Commonwealth University, Richmond, Virginia (United States); DeCamp, Malcolm M. [Division of Thoracic Surgery, Department of Surgery, Northwestern Memorial Hospital, Chicago, Illinois (United States); Northwestern University School of Medicine, Chicago, Illinois (United States); Ramakrishna, Satvik [Northwestern University School of Medicine, Chicago, Illinois (United States); Recht, Abe [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States); Flickinger, John [Department of Radiation Oncology, Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania (United States); Andrei, Adin [Northwestern University, Chicago, Illinois (United States); Reed, Michael F. [Pennsylvania State University College of Medicine, Hershey, Pennsylvania (United States); Heart and Vascular Institute, Pennsylvania State University-Hershey, Hershey, Pennsylvania (United States); Toth, Jennifer W. [Pennsylvania State University College of Medicine, Hershey, Pennsylvania (United States); Division of Pulmonary, Allergy, and Critical Care Medicine, Department of Medicine, Pennsylvania State University-Hershey, Hershey, Pennsylvania (United States); Fizgerald, Thomas J. [Department of Radiation Oncology, University of Massachusetts Medical Center, Worcester, Massachusetts (United States); Higgins, Kristin [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Zheng, Xiao [Department of Healthcare Policy and Research, Virginia Commonwealth University, Richmond, Virginia (United States); Shelkey, Julie [Department of Anesthesiology, Columbia University, New York, New York (United States); and others

2015-03-15

Purpose: Current National Comprehensive Cancer Network guidelines recommend postoperative radiation therapy (PORT) for patients with resected non-small cell lung cancer (NSCLC) with N2 involvement. We investigated the relationship between nodal stage and local-regional recurrence (LR), distant recurrence (DR) and overall survival (OS) for patients having an R0 resection. Methods and Materials: A multi-institutional database of consecutive patients undergoing R0 resection for stage I-IIIA NSCLC from 1995 to 2008 was used. Patients receiving any radiation therapy before relapse were excluded. A total of 1241, 202, and 125 patients were identified with N0, N1, and N2 involvement, respectively; 161 patients received chemotherapy. Cumulative incidence rates were calculated for LR and DR as first sites of failure, and Kaplan-Meier estimates were made for OS. Competing risk analysis and proportional hazards models were used to examine LR, DR, and OS. Independent variables included age, sex, surgical procedure, extent of lymph node sampling, histology, lymphatic or vascular invasion, tumor size, tumor grade, chemotherapy, nodal stage, and visceral pleural invasion. Results: The median follow-up time was 28.7 months. Patients with N1 or N2 nodal stage had rates of LR similar to those of patients with N0 disease, but were at significantly increased risk for both DR (N1, hazard ratio [HR] = 1.84, 95% confidence interval [CI]: 1.30-2.59; P=.001; N2, HR = 2.32, 95% CI: 1.55-3.48; P<.001) and death (N1, HR = 1.46, 95% CI: 1.18-1.81; P<.001; N2, HR = 2.33, 95% CI: 1.78-3.04; P<.001). LR was associated with squamous histology, visceral pleural involvement, tumor size, age, wedge resection, and segmentectomy. The most frequent site of LR was the mediastinum. Conclusions: Our investigation demonstrated that nodal stage is directly associated with DR and OS but not with LR. Thus, even some patients with, N0-N1 disease are at relatively high risk of local recurrence. Prospective

Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

International Nuclear Information System (INIS)

Byun, Eui-Baek; Choi, Han-Gyu; Sung, Nak-Yun; Byun, Eui-Hong

2012-01-01

Highlights: ► Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. ► EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. ► EGCG-treated DCs inhibited MAPKs activation and NF-κB p65 translocation via 67LR. ► EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-α, interleukin [IL]-1β, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor κB (NF-κB) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

Energy Technology Data Exchange (ETDEWEB)

Byun, Eui-Baek [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Choi, Han-Gyu [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of); Sung, Nak-Yun [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Byun, Eui-Hong, E-mail: ehbyun80@gmail.com [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of)

2012-10-05

Highlights: Black-Right-Pointing-Pointer Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited MAPKs activation and NF-{kappa}B p65 translocation via 67LR. Black-Right-Pointing-Pointer EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-1{beta}, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor {kappa}B (NF-{kappa}B) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

Type B liquid package technical issues -- Experience with LR-56 safety analysis

International Nuclear Information System (INIS)

Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

1997-01-01

In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

Perturbation measurements in reactor LR-0 and their evaluation

International Nuclear Information System (INIS)

Rypar, W.; Faehrmann, K.H.

1988-07-01

To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

International Nuclear Information System (INIS)

Hadek, J.; Grundmann, U.

1989-09-01

Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

International Nuclear Information System (INIS)

Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

1987-01-01

The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

Comparison of four polymerase chain reaction assays for the detection of Brucella spp. in clinical samples from dogs

Directory of Open Access Journals (Sweden)

Eduardo J. Boeri

2018-02-01

Full Text Available Aim: This study aimed to compare the sensitivity (S, specificity (Sp, and positive likelihood ratios (LR+ of four polymerase chain reaction (PCR assays for the detection of Brucella spp. in dog's clinical samples. Materials and Methods: A total of 595 samples of whole blood, urine, and genital fluids were evaluated between October 2014 and November 2016. To compare PCR assays, the gold standard was defined using a combination of different serological and microbiological test. Bacterial isolation from urine and blood cultures was carried out. Serological methods such as rapid slide agglutination test, indirect enzyme-linked immunosorbent assay, agar gel immunodiffusion test, and buffered plate antigen test were performed. Four genes were evaluated: (i The gene coding for the BCSP31 protein, (ii the ribosomal gene coding for the 16S-23S intergenic spacer region, (iii the gene coding for porins omp2a/omp2b, and (iv the gene coding for the insertion sequence IS711. Results: The results obtained were as follows: (1 For the primers that amplify the gene coding for the BCSP31 protein: S: 45.64% (confidence interval [CI] 39.81-51.46, Sp: 95.62% (CI 93.13-98.12, and LR+: 10.43 (CI 6.04-18; (2 for the primers that amplify the ribosomal gene of the 16S-23S rDNA intergenic spacer region: S: 69.80% (CI 64.42-75.18, Sp: 95.62 % (CI 93.13-98.12, and LR+: 11.52 (CI 7.31-18.13; (3 for the primers that amplify the omp2a and omp2b genes: S: 39.26% (CI 33.55-44.97, Sp: 97.31% (CI 95.30-99.32, and LR+ 14.58 (CI 7.25-29.29; and (4 for the primers that amplify the insertion sequence IS711: S: 22.82% (CI 17.89 - 27.75, Sp: 99.66% (CI 98.84-100, and LR+ 67.77 (CI 9.47-484.89. Conclusion: We concluded that the gene coding for the 16S-23S rDNA intergenic spacer region was the one that best detected Brucella spp. in canine clinical samples.

Detection of tumor-associated cells in cryopreserved peripheral blood mononuclear cell samples for retrospective analysis.

Science.gov (United States)

Zhu, Peixuan; Stanton, Melissa L; Castle, Erik P; Joseph, Richard W; Adams, Daniel L; Li, Shuhong; Amstutz, Platte; Tang, Cha-Mei; Ho, Thai H

2016-07-02

Cryopreserved peripheral blood mononuclear cells (PBMCs) are commonly collected in biobanks. However, little data exist regarding the preservation of tumor-associated cells in cryopreserved collections. The objective of this study was to determine the feasibility of using the CellSieve™ microfiltration assay for the isolation of circulating tumor cells (CTCs) and circulating cancer-associated macrophage-like cells (CAMLs) from cryopreserved PBMC samples. Blood samples spiked with breast (MCF-7), prostate (PC-3), and renal (786-O) cancer cell lines were used to establish analytical accuracy, efficiency, and reproducibility after cryopreservation. The spiked samples were processed through Ficoll separation, and cryopreservation was followed by thawing and microfiltration. MCF-7 cells were successfully retrieved with recovery efficiencies of 90.5 % without cryopreservation and 87.8 and 89.0 %, respectively, on day 7 and day 66 following cryopreservation. The corresponding recovery efficiencies of PC-3 cells were 83.3 % without cryopreservation and 85.3 and 84.7 %, respectively, after cryopreservation. Recovery efficiencies of 786-O cells were 92.7 % without cryopreservation, and 82.7 and 81.3 %, respectively, after cryopreservation. The recovered cells retained the morphologic characteristics and immunohistochemical markers that had been observed before freezing. The protocols were further validated by quantitation of CAMLs in blood samples from two patients with renal cell carcinoma (RCC). The recovery rates of CTCs and CAMLs from cryopreserved samples were not statistically significant different (P > 0.05) from matched fresh samples. To our knowledge, this is the first report that CAMLs could be cryopreserved and analyzed after thawing with microfiltration technology. The application of microfiltration technology to cryopreserved samples will enable much greater retrospective study of cancer patients in relation to long-term outcomes.

Determination of alpha-dose rates and chronostratigraphical study of travertine samples

International Nuclear Information System (INIS)

Oufni, L.; University Moulay Ismail, Errachidia; Misdaq, M.A.; Boudad, L.; Kabiri, L.

2001-01-01

Uranium and thorium contents in different layers of stratigraphical sedimentary deposits have been evaluated by using LR-115 type II and CR-39 solid state nuclear track detectors (SSNTD). A method has been developed for determining the alpha-dose rates of the sedimentary travertine samples. Using the U/Th dating method, we succeeded in age dating carbonated level sampled in the sedimentary deposits. Correlation between the stratigraphy, alpha-dose rates and age has been investigated. (author)

The initiation of lateral roots in the primary roots of maize (Zea mays L.) implies a reactivation of cell proliferation in a group of founder pericycle cells.

Science.gov (United States)

Alarcón, M Victoria; Lloret, Pedro G; Martín-Partido, Gervasio; Salguero, Julio

2016-03-15

The initiation of lateral roots (LRs) has generally been viewed as a reactivation of proliferative activity in pericycle cells that are committed to initiate primordia. However, it is also possible that pericycle founder cells that initiate LRs never cease proliferative activity but rather are displaced to the most distal root zones while undertaking successive stages of LR initiation. In this study, we tested these two alternative hypotheses by examining the incorporation of 5-bromo-2'-deoxyuridine (BrdU) into the DNA of meristematic root cells of Zea mays. According to the values for the length of the cell cycle and values for cell displacement along the maize root, our results strongly suggest that pericycle cells that initiate LR primordia ceased proliferative activity upon exiting the meristematic zone. This finding is supported by the existence of a root zone between 4 and 20mm from the root cap junction, in which neither mitotic cells nor labelled nuclei were observed in phloem pericycle cells. Copyright © 2016 Elsevier GmbH. All rights reserved.

Role of polymorphic Fc receptor Fc gammaRIIa in cytokine release and adverse effects of murine IgG1 anti-CD3/T cell receptor antibody (WT31).

Science.gov (United States)

Tax, W J; Tamboer, W P; Jacobs, C W; Frenken, L A; Koene, R A

1997-01-15

Anti-CD3 monoclonal antibody (mAb) OKT3 is immunosuppressive, but causes severe adverse effects during the first administration ("first-dose reaction"). These adverse effects are presumably caused by cytokine release that results from T-cell activation. In vitro, T-cell activation by anti-CD3 mAb requires interaction with monocyte Fc receptors. The Fc receptor for murine IgG1, Fc gammaRIIa, is polymorphic. In some individuals, murine IgG1 anti-CD3 mAb causes T-cell proliferation and cytokine release in vitro (high responders [HR]), whereas in individuals with the low-responder (LR) phenotype it does not. We have now investigated the role of this Fc gammaRIIa polymorphism in the release of cytokines in vivo and the occurrence of adverse effects after the administration of WT31, a murine IgG1 anti-CD3/T cell receptor mAb. WT31 caused an increase of plasma tumor necrosis factor-alpha in all four HR patients and none of the five LR patients. In all HR patients except one, plasma gamma-interferon and interleukin 6 also increased, and a first-dose response was observed, whereas no cytokine release or adverse effects occurred in any of the LR patients. WT31 caused lymphopenia in all HR and none of the LR patients. FACS analysis demonstrated that in HR patients, after the initial disappearance of CD3+ cells from peripheral blood, modulation of CD3 occurred, whereas in LR patients a high degree of coating of the lymphocytes was observed. Surprisingly, WT31 also induced a marked granulocytopenia, as well as a decrease of thrombocytes, in three of the four HR patients (and in none of the LR patients). These data provide direct clinical evidence that Fc receptor interaction determines the release of cytokines and the occurrence of adverse effects after administration of anti-CD3/T cell receptor mAb. Furthermore, these data suggest that tumor necrosis factor-alpha by itself is not sufficient to induce the first-dose reaction.

Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

Science.gov (United States)

Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

International Nuclear Information System (INIS)

Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

2008-01-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

Energy Technology Data Exchange (ETDEWEB)

Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

2008-07-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

B-cell waste classification sampling plan

International Nuclear Information System (INIS)

HOBART, R.L.

1999-01-01

This report documents the methods used to collect samples and analyze data necessary to verify and/or determine the radionuclide content of the 324 Facility B-Cell decontamination and decommissioning waste stream

Tip chip : Subcellular sampling from single cancer cells

NARCIS (Netherlands)

Quist, Jos; Sarajlic, Edin; Lai, Stanley C.S.; Lemay, Serge G.

2016-01-01

To analyze the molecular content of single cells, cell lysis is typically required, yielding a snapshot of cell behavior only. To follow complex molecular profiles over time, subcellular sampling methods potentially can be used, but to date these methods involve laborious offline analysis. Here we

Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

International Nuclear Information System (INIS)

Aharmim, B.; Sabir, A.; Marah, H.

2002-01-01

A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

2016-08-31

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 ⁷LiF-BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

International Nuclear Information System (INIS)

Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

2016-01-01

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

Directory of Open Access Journals (Sweden)

Tingting Xu

2014-01-01

Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

Science.gov (United States)

Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

2018-04-25

A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

Tumor-related markers in histologically normal margins correlate with locally recurrent oral squamous cell carcinoma: a retrospective study.

Science.gov (United States)

Wang, Xinhong; Chen, Si; Chen, Xinming; Zhang, Cuicui; Liang, Xueyi

2016-02-01

Oral squamous cell carcinoma (OSCC) is characterized by a high rate of local recurrence (LR) even when the surgical margins are considered histopathologically 'normal'. The aim of our study was to determine the relationship between early tumor-related markers detected in histologically normal margins (HNM) and LR as well as disease-free survival in OSCC. The loss of heterozygosity (LOH) of markers on 9p21 (D9s1747, RPS6, D9s162) and 17p13 (TP53) and the immunostaining results of the corresponding mutant P53, P14, P15, and P16 proteins were assessed and correlated with LR and disease-free survival in 71 OSCC patients who had HNM. Fifteen of 71 patients with HNM developed LR. The presence of the following molecular markers in surgical margins was significantly correlated with the development of LR: LOH on chromosome 9p21 (D9s1747 + RPS6 + D9s162), any LOH, P16, and P53 (chi-square test, P tumor-related markers in histologically 'normal' resection margins may be a useful method for assessing LR in OSCC patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

International Nuclear Information System (INIS)

De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

2014-01-01

An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

Effects of sample treatments on genome recovery via single-cell genomics

Energy Technology Data Exchange (ETDEWEB)

Clingenpeel, Scott [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Schwientek, Patrick [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Hugenholtz, Philip [Univ. of Queensland, Brisbane (Australia); Woyke, Tanja [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States)

2014-06-13

It is known that single-cell genomics is a powerful tool for accessing genetic information from uncultivated microorganisms. Methods of handling samples before single-cell genomic amplification may affect the quality of the genomes obtained. Using three bacterial strains we demonstrate that, compared to cryopreservation, lower-quality single-cell genomes are recovered when the sample is preserved in ethanol or if the sample undergoes fluorescence in situ hybridization, while sample preservation in paraformaldehyde renders it completely unsuitable for sequencing.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr; Shihada, Basem

2015-01-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr

2015-07-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

A new method for determining the uranium and thorium distribution in volcanic rock samples using solid state nuclear track detectors

International Nuclear Information System (INIS)

Misdaq, M.A.; Bakhchi, A.; Ktata, A.; Koutit, A.; Lamine, J.; Ait nouh, F.; Oufni, L.

2000-01-01

A method based on using solid state nuclear track detectors (SSNTD) CR- 39 and LR-115 type II and calculating the probabilities for the alpha particles emitted by the uranium and thorium series to reach and be registered on these films was utilized for uranium and thorium contents determination in various geological samples. The distribution of uranium and thorium in different volcanic rocks has been investigated using the track fission method. In this work, the uranium and thorium contents have been determined in different volcanic rock samples by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTD). The mean critical angles of etching of the solid state nuclear track detectors utilized have been calculated. A petrographical study of the volcanic rock thin layers studied has been conducted. The uranium and thorium distribution inside different rock thin layers has been studied. The mechanism of inclusion of the uranium and thorium nuclei inside the volcanic rock samples studied has been investigated. (author)

Purifying, Separating, and Concentrating Cells From a Sample Low in Biomass

Science.gov (United States)

Benardini, James N.; LaDuc, Myron T.; Diamond, Rochelle

2012-01-01

Frequently there is an inability to process and analyze samples of low biomass due to limiting amounts of relevant biomaterial in the sample. Furthermore, molecular biological protocols geared towards increasing the density of recovered cells and biomolecules of interest, by their very nature, also concentrate unwanted inhibitory humic acids and other particulates that have an adversarial effect on downstream analysis. A novel and robust fluorescence-activated cell-sorting (FACS)-based technology has been developed for purifying (removing cells from sampling matrices), separating (based on size, density, morphology), and concentrating cells (spores, prokaryotic, eukaryotic) from a sample low in biomass. The technology capitalizes on fluorescent cell-sorting technologies to purify and concentrate bacterial cells from a low-biomass, high-volume sample. Over the past decade, cell-sorting detection systems have undergone enhancements and increased sensitivity, making bacterial cell sorting a feasible concept. Although there are many unknown limitations with regard to the applicability of this technology to environmental samples (smaller cells, few cells, mixed populations), dogmatic principles support the theoretical effectiveness of this technique upon thorough testing and proper optimization. Furthermore, the pilot study from which this report is based proved effective and demonstrated this technology capable of sorting and concentrating bacterial endospore and bacterial cells of varying size and morphology. Two commercial off-the-shelf bacterial counting kits were used to optimize a bacterial stain/dye FACS protocol. A LIVE/DEAD BacLight Viability and Counting Kit was used to distinguish between the live and dead cells. A Bacterial Counting Kit comprising SYTO BC (mixture of SYTO dyes) was employed as a broad-spectrum bacterial counting agent. Optimization using epifluorescence microscopy was performed with these two dye/stains. This refined protocol was further

Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

Science.gov (United States)

The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

Treatment and Prognosis of Isolated Local Relapse after Stereotactic Body Radiotherapy for Clinical Stage I Non-Small-Cell Lung Cancer: Importance of Salvage Surgery.

Science.gov (United States)

Hamaji, Masatsugu; Chen, Fengshi; Matsuo, Yukinori; Ueki, Nami; Hiraoka, Masahiro; Date, Hiroshi

2015-11-01

Many efforts have been made to detect local relapse (LR) in the follow-up after stereotactic body radiotherapy (SBRT) for non-small-cell lung cancer (NSCLC) although limited data are available on its treatment and prognosis. We aimed to characterize treatment options and clarify long-term outcomes of isolated LR after SBRT for patients with clinical stage I NSCLC. We reviewed our institutional database in search of patients with isolated LR after SBRT for clinical stage I NSCLC at our institution between 1999 and 2013. Patient characteristics were compared with Mann-Whitney U test, χ2 test, or Fisher's exact test as appropriate. Survival outcomes were estimated with Kaplan-Meier method. Potential prognostic factors were investigated using Cox proportional hazard model. Of 308 patients undergoing SBRT for clinical stage I NSCLC, 49 patients were identified to have isolated LR. Twelve patients underwent salvage surgery, none underwent radiotherapy, and eight patients received chemotherapy, whereas 29 patients received best supportive care. No patient characteristic except operability was significantly related with patient selection for LR treatments. Five-year overall survival (OS) rate of the whole cohort was 47.9% from SBRT and 25.7% from LR. Salvage surgery was associated with improved OS after LR (p = 0.014), and 5-year OS for patients undergoing salvage surgery was 79.5% from LR. It was confirmed that our patient selection for salvage surgery for isolated LR was associated with favorable survival outcomes. Operability based on multidisciplinary conferences, rather than measurable patient characteristics, is essential for appropriate patient selection for salvage surgery.

Accumulation of pro-cancer cytokines in the plasma fraction of stored packed red cells.

Science.gov (United States)

Benson, Douglas D; Beck, Adam W; Burdine, Marie S; Brekken, Rolf; Silliman, Christopher C; Barnett, Carlton C

2012-03-01

Perioperative blood transfusion has been linked to decreased survival in pancreatic cancer; however, the exact causal mechanism has not been elucidated. Allogeneic transfusions are known to expose patients to foreign cells and lipid mediators. We hypothesize that stored packed red cells (pRBCs) contain pro-cancer cytokines that augment tumor progression. We analyzed the plasma fraction of stored pRBCs for pro-cancer cytokines and evaluated the affect of both storage time and leukocyte reduction on these mediators. Chemiarray™ analysis for pro-cancer cytokines was performed on the acellular plasma fraction of stored leukocyte-reduced (LR) and non-leukocyte-reduced (NLR) pRBCs at day 1 (D.1-fresh) and day 42 (D.42-outdate) of storage. Elevated expression of monocyte chemotactic protein-1 (MCP-1), regulated on activation, normal T cell expressed and secreted (RANTES), angiogenin, tumor necrosis factor-alpha (TNF-α), epidermal growth factor (EGF), and platelet-derived growth factor (PDGF) was found. Specific enzyme-linked immunosorbent assay was performed for each of these factors in LR and NLR blood at D.1, day 28, and D.42. Data were analyzed by ANOVA. A p value ≤ 0.05 was considered significant; N ≥ 4 per group. Migration assays were performed using inhibitors of EGF (gefitinib) and PDGF (imatinib) on murine pancreatic adenocarcinoma cells (Pan02) exposed to D.1 and D.42 LR and NLR plasma. Proliferation assays were performed on Pan02 cells to test the inhibition of PDGF. MCP-1 levels increased with storage time in LR blood, 86.3 ± 6.3 pg/ml at D.1 vs. 121.2 ± 6.1 pg/ml at D.42 (p = 0.007), and NLR blood, 78.2 ± 7.3 pg/ml at D.1 vs. 647.8 ± 220.7 pg/ml at D.42 (p = 0.02). RANTES levels are lower in LR compared to NLR stored blood, 3.0 ± 1.9 vs. 15.8 ± 0.7 pg/ml at D.42 (p Pro-cancer cytokines that can augment tumor progression were identified in pRBCs. Some of these factors are present in fresh blood. The soluble factors identified herein may represent

Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

Science.gov (United States)

Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

2017-12-01

The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

Sample cell for in-field X-ray diffraction experiments

Directory of Open Access Journals (Sweden)

Viktor Höglin

2015-01-01

Full Text Available A sample cell making it possible to perform synchrotron radiation X-ray powder diffraction experiments in a magnetic field of 0.35 T has been constructed. The device is an add-on to an existing sample cell and contains a strong permanent magnet of NdFeB-type. Experiments have shown that the setup is working satisfactory making it possible to perform in-field measurements.

Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

International Nuclear Information System (INIS)

Vallejo Delgado, L.R.

1989-01-01

This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

Rye Bran Modified with Cell Wall-Degrading Enzymes Influences the Kinetics of Plant Lignans but Not of Enterolignans in Multicatheterized Pigs.

Science.gov (United States)

Bolvig, Anne K; Nørskov, Natalja P; van Vliet, Sophie; Foldager, Leslie; Curtasu, Mihai V; Hedemann, Mette S; Sørensen, Jens F; Lærke, Helle N; Bach Knudsen, Knud E

2017-12-01

Background: Whole-grain intake is associated with a lower risk of chronic Western-style diseases, possibly brought about by the high concentration of phytochemicals, among them plant lignans (PLs), in the grains. Objective: We studied whether treatment of rye bran with cell wall-degrading enzymes changed the solubility and kinetics of PLs in multicatheterized pigs. Methods: Ten female Duroc × Danish Landrace × Yorkshire pigs (60.3 ± 2.3 kg at surgery) fitted with permanent catheters were included in an incomplete crossover study. The pigs were fed 2 experimental diets for 1-7 d. The diets were rich in PLs and based on nontreated lignan-rich [LR; lignan concentration: 20.2 mg dry matter (DM)/kg] or enzymatically treated lignan-rich (ENZLR; lignan concentration: 27.8 mg DM/kg) rye bran. Plasma concentrations of PLs and enterolignans were quantified with the use of targeted LC-tandem mass spectrometry. Data were log transformed and analyzed with mixed-effects, 1-compartment, and asymptotic regression models. Results: The availability of PLs was 38% greater in ENZLR than in LR, and the soluble fraction of PLs was 49% in ENZLR compared with 35% in LR diets. PLs appeared in the circulation 30 min after intake of both the ENZLR and LR diets. Postprandially, consumption of ENZLR resulted in a 4-times-greater ( P concentration compared with LR. The area under the curve (AUC) measured 0-360 min after ENZLR intake was ∼2 times higher than after LR intake. A 1-compartment model could describe the postprandial increase in plasma concentration after ENZLR intake, whereas an asymptotic regression model described the plasma concentrations after LR intake. Despite increased available and soluble PLs, ENZLR did not increase plasma enterolignans. Conclusion: The modification of rye bran with cell wall-degrading enzymes resulted in significantly greater plasma concentrations of PLs and the 4-h AUC, particularly syringaresinol, in multicatheterized pigs. © 2017 American Society

Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

International Nuclear Information System (INIS)

Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

2007-01-01

Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

Integrated ligand-receptor bioinformatic and in vitro functional analysis identifies active TGFA/EGFR signaling loop in papillary thyroid carcinomas.

Directory of Open Access Journals (Sweden)

Debora Degl'Innocenti

Full Text Available BACKGROUND: Papillary thyroid carcinoma (PTCs, the most frequent thyroid cancer, is usually not life threatening, but may recur or progress to aggressive forms resistant to conventional therapies. A more detailed understanding of the signaling pathways activated in PTCs may help to identify novel therapeutic approaches against these tumors. The aim of this study is to identify signaling pathways activated in PTCs. METHODOLOGY/PRINCIPAL FINDINGS: We examined coordinated gene expression patterns of ligand/receptor (L/R pairs using the L/R database DRLP-rev1 and five publicly available thyroid cancer datasets of gene expression on a total of 41 paired PTC/normal thyroid tissues. We identified 26 (up and 13 (down L/R pairs coordinately and differentially expressed. The relevance of these L/R pairs was confirmed by performing the same analysis on REarranged during Transfection (RET/PTC1-infected thyrocytes with respect to normal thyrocytes. TGFA/EGFR emerged as one of the most tightly regulated L/R pair. Furthermore, PTC clinical samples analyzed by real-time RT-PCR expressed EGFR transcript levels similar to those of 5 normal thyroid tissues from patients with pathologies other than thyroid cancer, whereas significantly elevated levels of TGFA transcripts were only present in PTCs. Biochemical analysis of PTC cell lines demonstrated the presence of EGFR on the cell membrane and TGFA in conditioned media. Moreover, conditioned medium of the PTC cell line NIM-1 activated EGFR expressed on HeLa cells, culminating in both ERK and AKT phosphorylation. In NIM-1 cells harboring BRAF mutation, TGFA stimulated proliferation, contributing to PI3K/AKT activation independent of MEK/ERK signaling. CONCLUSIONS/SIGNIFICANCE: We compiled a reliable list of L/R pairs associated with PTC and validated the biological role of one of the emerged L/R pair, the TGFA/EGFR, in this cancer, in vitro. These data provide a better understanding of the factors involved in the

Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

Science.gov (United States)

Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

2017-06-01

The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

Suitability of small diagnostic peripheral-blood samples for cell-therapy studies.

Science.gov (United States)

Stephanou, Coralea; Papasavva, Panayiota; Zachariou, Myria; Patsali, Petros; Epitropou, Marilena; Ladas, Petros; Al-Abdulla, Ruba; Christou, Soteroulla; Antoniou, Michael N; Lederer, Carsten W; Kleanthous, Marina

2017-02-01

Primary hematopoietic stem and progenitor cells (HSPCs) are key components of cell-based therapies for blood disorders and are thus the authentic substrate for related research. We propose that ubiquitous small-volume diagnostic samples represent a readily available and as yet untapped resource of primary patient-derived cells for cell- and gene-therapy studies. In the present study we compare isolation and storage methods for HSPCs from normal and thalassemic small-volume blood samples, considering genotype, density-gradient versus lysis-based cell isolation and cryostorage media with different serum contents. Downstream analyses include viability, recovery, differentiation in semi-solid media and performance in liquid cultures and viral transductions. We demonstrate that HSPCs isolated either by ammonium-chloride potassium (ACK)-based lysis or by gradient isolation are suitable for functional analyses in clonogenic assays, high-level HSPC expansion and efficient lentiviral transduction. For cryostorage of cells, gradient isolation is superior to ACK lysis, and cryostorage in freezing media containing 50% fetal bovine serum demonstrated good results across all tested criteria. For assays on freshly isolated cells, ACK lysis performed similar to, and for thalassemic samples better than, gradient isolation, at a fraction of the cost and hands-on time. All isolation and storage methods show considerable variation within sample groups, but this is particularly acute for density gradient isolation of thalassemic samples. This study demonstrates the suitability of small-volume blood samples for storage and preclinical studies, opening up the research field of HSPC and gene therapy to any blood diagnostic laboratory with corresponding bioethics approval for experimental use of surplus material. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

International Nuclear Information System (INIS)

Somogyi, G.; Hunyadi, I.; Varga, Zs.

1978-01-01

Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

Evaluating hepatocellular carcinoma cell lines for tumour samples using within-sample relative expression orderings of genes.

Science.gov (United States)

Ao, Lu; Guo, You; Song, Xuekun; Guan, Qingzhou; Zheng, Weicheng; Zhang, Jiahui; Huang, Haiyan; Zou, Yi; Guo, Zheng; Wang, Xianlong

2017-11-01

Concerns are raised about the representativeness of cell lines for tumours due to the culture environment and misidentification. Liver is a major metastatic destination of many cancers, which might further confuse the origin of hepatocellular carcinoma cell lines. Therefore, it is of crucial importance to understand how well they can represent hepatocellular carcinoma. The HCC-specific gene pairs with highly stable relative expression orderings in more than 99% of hepatocellular carcinoma but with reversed relative expression orderings in at least 99% of one of the six types of cancer, colorectal carcinoma, breast carcinoma, non-small-cell lung cancer, gastric carcinoma, pancreatic carcinoma and ovarian carcinoma, were identified. With the simple majority rule, the HCC-specific relative expression orderings from comparisons with colorectal carcinoma and breast carcinoma could exactly discriminate primary hepatocellular carcinoma samples from both primary colorectal carcinoma and breast carcinoma samples. Especially, they correctly classified more than 90% of liver metastatic samples from colorectal carcinoma and breast carcinoma to their original tumours. Finally, using these HCC-specific relative expression orderings from comparisons with six cancer types, we identified eight of 24 hepatocellular carcinoma cell lines in the Cancer Cell Line Encyclopedia (Huh-7, Huh-1, HepG2, Hep3B, JHH-5, JHH-7, C3A and Alexander cells) that are highly representative of hepatocellular carcinoma. Evaluated with a REOs-based prognostic signature for hepatocellular carcinoma, all these eight cell lines showed the same metastatic properties of the high-risk metastatic hepatocellular carcinoma tissues. Caution should be taken for using hepatocellular carcinoma cell lines. Our results should be helpful to select proper hepatocellular carcinoma cell lines for biological experiments. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

NARCIS (Netherlands)

K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

2016-01-01

markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

Universal nucleic acids sample preparation method for cells, spores and their mixture

Science.gov (United States)

Bavykin, Sergei [Darien, IL

2011-01-18

The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

Investigations into the biodegradation of microcystin-LR in wastewaters

International Nuclear Information System (INIS)

Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

2010-01-01

Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

Development of measuring system with self-powered neutron detectors for the LR-0 reactor

International Nuclear Information System (INIS)

Erben, O.; Horinek, K.; Szasz, Z.

1989-01-01

A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

Directory of Open Access Journals (Sweden)

Košťál Michal

2016-01-01

Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

OpenAIRE

Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

2016-01-01

International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

International Nuclear Information System (INIS)

Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

1998-01-01

In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

Photometric measurements of red blood cell aggregation: light transmission versus light reflectance

NARCIS (Netherlands)

Baskurt, O.K.; Uyuklu, M.; Hardeman, M.R.; Meiselman, H.J.

2009-01-01

Red blood cell (RBC) aggregation is the reversible and regular clumping in the presence of certain macromolecules. This is a clinically important phenomenon, being significantly enhanced in the presence of acute phase reactants (e. g., fibrinogen). Both light reflection (LR) and light transmission

Photometric measurements of red blood cell aggregation: light transmission versus light reflectance

NARCIS (Netherlands)

Baskurt, Oguz K.; Uyuklu, Mehmet; Hardeman, Max R.; Meiselman, Herbert J.

2009-01-01

Red blood cell (RBC) aggregation is the reversible and regular clumping in the presence of certain macromolecules. This is a clinically important phenomenon, being significantly enhanced in the presence of acute phase reactants (e.g., fibrinogen). Both light reflection (LR) and light transmission

Data quality objectives for the B-Cell waste stream classification sampling

International Nuclear Information System (INIS)

Barnett, J.M.

1998-01-01

This document defines the data quality objectives, (DQOS) for sampling the B-Cell racks waste stream. The sampling effort is concentrated on determining a ratio of Cs-137 to Sr-90 and Cs-137 to transuranics (TRU). Figure 1.0 shows the logic path of sampling effort. The flow chart begins with sample and data acquisition and progresses toward (a) statistical confidence and waste classification boundaries, (b) management decisions based on the input parameters and technical methods available, and (c) grout container volume/weight limits and radiation limits. The end result will be accurately classifying the B-Cell rack waste stream

Humanized CD7 nanobody-based immunotoxins exhibit promising anti-T-cell acute lymphoblastic leukemia potential.

Science.gov (United States)

Yu, Yuan; Li, Jialu; Zhu, Xuejun; Tang, Xiaowen; Bao, Yangyi; Sun, Xiang; Huang, Yuhui; Tian, Fang; Liu, Xiaomei; Yang, Lin

2017-01-01

Nanobodies, named as VHHs (variable domain of heavy chain of HCAb [heavy-chain antibodies]), are derived from heavy-chain-only antibodies that circulate in sera of camelids. Their exceptional physicochemical properties, possibility of humanization, and unique antigen recognition properties make them excellent candidates for targeted delivery of biologically active components, including immunotoxins. In our previous efforts, we have successfully generated the monovalent and bivalent CD7 nanobody-based immunotoxins, which can effectively trigger the apoptosis of CD7-positive malignant cells. To pursue the possibility of translating those immunotoxins into clinics, we humanized the nanobody sequences (designated as dhuVHH6) as well as further truncated the Pseudomonas exotoxin A (PE)-derived PE38 toxin to produce a more protease-resistant form, which is named as PE-LR, by deleting majority of PE domain II. Three new types of immunotoxins, dhuVHH6-PE38, dVHH6-PE-LR, and dhuVHH6-PE-LR, were successfully constructed. These recombinant immunotoxins were expressed in Escherichia coli and showed that nanobody immunotoxins have the benefits of easy soluble expression in a prokaryotic expression system. Flow cytometry results revealed that all immunotoxins still maintained the ability to bind specifically to CD7-positive T lymphocyte strains without binding to CD7-negative control cells. Laser scanning confocal microscopy revealed that these proteins can be endocytosed into the cytoplasm after binding with CD7-positive cells and that this phenomenon was not observed in CD7-negative cells. WST-8 experiments showed that all immunotoxins retained the highly effective and specific growth inhibition activity in CD7-positive cell lines and primary T-cell acute lymphoblastic leukemia (T-ALL) cells. Further in vivo animal model experiments showed that humanized dhuVHH6-PE38 immunotoxin can tolerate higher doses and extend the survival of NOD-Prkdc em26 Il2rg em26 Nju (NCG) mice

On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

International Nuclear Information System (INIS)

Heydari-Fard, Malihe

2010-01-01

The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

ASSESSMENT OF ACUTE LUNG INJURY INDUCED BY PM 2.5 SAMPLES FROM TWO CITIES IN GERMANY WITH DIFFERING INCIDENCE OF ALLERGIES AND ASTHMA

Science.gov (United States)

ASSESSMENT OF ACUTE LUNG INJURY INDUCED BY PM 2.5 SAMPLES FROM TWO CITIES IN GERMANY WITH DIFFERING INCIDENCE OF ALLERGIES AND ASTHMA.LR Bishop, J Heinrich*, MK Selgrade & MI Gilmour. Experimental Toxicology Division, ORD/ NHEERL, U.S. EPA, RTP, NC. *GSF, Neuherberg,...

B-Cell waste classification sampling and analysis plan

International Nuclear Information System (INIS)

HOBART, R.L.

1999-01-01

This report documents the methods used to collect and analyze samples to obtain data necessary to verify and/or determine the radionuclide content of the 324 Facility B-Cell decontamination and decommissioning waste stream

Inhibiting Vimentin or beta 1-integrin Reverts Prostate Tumor Cells in IrECM and Reduces Tumor Growth

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xueping; Fournier, Marcia V.; Ware, Joy L.; Bissell, Mina J.; Zehner, Zendra E.

2009-07-27

Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphological changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional (3D) lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the parental prostate epithelial P69 cell line by selection in nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin or {alpha}6-, {beta}4- and {beta}1-integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via siRNA interference or {beta}1-integrin expression by the addition of the blocking antibody, AIIB2, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by subcutaneous injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in 3D lrECM gels. These studies suggest that the levels of vimentin and {beta}1-integrin play a key role in the homeostasis of the normal acini in prostate and that their dysregulation may lead to tumorigenesis.

1,3-Propanediol dehydrogenases in Lactobacillus reuteri: impact on central metabolism and 3-hydroxypropionaldehyde production.

Science.gov (United States)

Stevens, Marc J A; Vollenweider, Sabine; Meile, Leo; Lacroix, Christophe

2011-08-03

Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA) and further to 1,3-propanediol (1,3-PDO), the latter step catalysed by a propanediol dehydrogenase (PDH). The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts.During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.

Age-specific prevalence of HPV genotypes in cervical cytology samples with equivocal or low-grade lesions

Science.gov (United States)

Brismar-Wendel, S; Froberg, M; Hjerpe, A; Andersson, S; Johansson, B

2009-01-01

Background: To define the spectrum of human papillomavirus (HPV) types and establish an age limit for triage HPV testing in atypical squamous cells of undetermined significance (ASCUS) and low-grade squamous intraepithelial lesion (LSIL). Materials and methods: 343 liquid-based cytological samples from the population-based screening programme with minor abnormalities were subjected to HPV genotyping (Linear Array, Roche, Basel, Switzerland). Results: High-risk human papillomavirus (HR-HPV) was found in 71% of LSIL and 49% of ASCUS cases (Page-dependent in LSIL (P=0.01), with decreasing prevalence until the age of 50 years, followed by a slight increase. Human papillomavirus type 16 was the most common HR-HPV, found in 23% of HPV-positive women. Human papillomavirus type 18 was the sixth most common, found in 9.9% (Page-dependent quadratic trend was observed for multiple infections (P=0.01) with a trough at about 42 years. The most common HR-HPV types to show a coinfection with HPV16 (clade 9) were HPV39 (28%), 45 (38%), and 59 (46%), belonging to HPV18 clade 7. The frequency of low-risk (LR) vs probable HR and HR-HPV also followed an age-dependent quadratic trend. Conclusions: After the age of 25 years, HR-HPV prevalence is similar in LSIL and ASCUS cases, motivating a low age limit for triage HPV testing. Multiple infections and LR/HR-HPV dominance are age-dependent. Genotyping in longitudinal design is needed to elucidate the importance of multiple infections in cancer progression and in cross-protection from vaccination. PMID:19623178

Forensic Comparison of Soil Samples Using Nondestructive Elemental Analysis.

Science.gov (United States)

Uitdehaag, Stefan; Wiarda, Wim; Donders, Timme; Kuiper, Irene

2017-07-01

Soil can play an important role in forensic cases in linking suspects or objects to a crime scene by comparing samples from the crime scene with samples derived from items. This study uses an adapted ED-XRF analysis (sieving instead of grinding to prevent destruction of microfossils) to produce elemental composition data of 20 elements. Different data processing techniques and statistical distances were evaluated using data from 50 samples and the log-LR cost (C llr ). The best performing combination, Canberra distance, relative data, and square root values, is used to construct a discriminative model. Examples of the spatial resolution of the method in crime scenes are shown for three locations, and sampling strategy is discussed. Twelve test cases were analyzed, and results showed that the method is applicable. The study shows how the combination of an analysis technique, a database, and a discriminative model can be used to compare multiple soil samples quickly. © 2016 American Academy of Forensic Sciences.

Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

International Nuclear Information System (INIS)

Sawamura, Teruko; Yamazaki, Hatsuo

1988-01-01

This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

Energy Technology Data Exchange (ETDEWEB)

Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Liu, Yuan [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Biostatistics and Bioinformatics Shared Resource, Emory University, Atlanta, Georgia (United States); Okwan-Duodu, Derrick [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Flowers, Christopher R. [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Medical Oncology, Emory University, Atlanta, Georgia (United States); Khan, Mohammad K., E-mail: drkhurram2000@gmail.com [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States)

2015-05-01

Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy.

Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

International Nuclear Information System (INIS)

Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng; Liu, Yuan; Okwan-Duodu, Derrick; Flowers, Christopher R.; Khan, Mohammad K.

2015-01-01

Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy

Cyanotoxins at low doses induce apoptosis and inflammatory effects in murine brain cells: Potential implications for neurodegenerative diseases.

Science.gov (United States)

Takser, Larissa; Benachour, Nora; Husk, Barry; Cabana, Hubert; Gris, Denis

2016-01-01

Cyanotoxins have been shown to be highly toxic for mammalian cells, including brain cells. However, little is known about their effect on inflammatory pathways. This study investigated whether mammalian brain and immune cells can be a target of certain cyanotoxins, at doses approximating those in the guideline levels for drinking water, either alone or in mixtures. We examined the effects on cellular viability, apoptosis and inflammation signalling of several toxins on murine macrophage-like RAW264.7, microglial BV-2 and neuroblastoma N2a cell lines. We tested cylindrospermopsin (CYN), microcystin-LR (MC-LR), and anatoxin-a (ATX-a), individually as well as their mixture. In addition, we studied the neurotoxins β- N -methylamino-l-alanine (BMAA) and its isomer 2,4-diaminobutyric acid (DAB), as well as the mixture of both. Cellular viability was determined by the MTT assay. Apoptosis induction was assessed by measuring the activation of caspases 3/7. Cell death and inflammation are the hallmarks of neurodegenerative diseases. Thus, our final step was to quantify the expression of a major proinflammatory cytokine TNF-α by ELISA. Our results show that CYN, MC-LR and ATX-a, but not BMAA and DAB, at low doses, especially when present in a mixture at threefold less concentrations than individual compounds are 3-15 times more potent at inducing apoptosis and inflammation. Our results suggest that common cyanotoxins at low doses have a potential to induce inflammation and apoptosis in immune and brain cells. Further research of the neuroinflammatory effects of these compounds in vivo is needed to improve safety limit levels for cyanotoxins in drinking water and food.

Gel-aided sample preparation (GASP)--a simplified method for gel-assisted proteomic sample generation from protein extracts and intact cells.

Science.gov (United States)

Fischer, Roman; Kessler, Benedikt M

2015-04-01

We describe a "gel-assisted" proteomic sample preparation method for MS analysis. Solubilized protein extracts or intact cells are copolymerized with acrylamide, facilitating denaturation, reduction, quantitative cysteine alkylation, and matrix formation. Gel-aided sample preparation has been optimized to be highly flexible, scalable, and to allow reproducible sample generation from 50 cells to milligrams of protein extracts. This methodology is fast, sensitive, easy-to-use on a wide range of sample types, and accessible to nonspecialists. © 2014 The Authors. PROTEOMICS published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A sample cell to study hydrate formation with x-ray scattering

International Nuclear Information System (INIS)

Conrad, Heiko; Lehmkuehler, Felix; Sternemann, Christian; Feroughi, Omid; Tolan, Metin; Simonelli, Laura; Huotari, Simo

2009-01-01

We present a new sample cell for measuring nonresonant inelastic x-ray scattering spectra of a tetrahydrofuran (THF)-water liquid mixture and THF hydrate. The hydrate is formed inside the cell after nucleation seeds have been offered by a special magnetic stirring mechanism. Hydrate formation was verified by wide angle x-ray scattering and nonresonant x-ray Raman scattering spectra at the oxygen K-edge. A broad range of scattering angles can be studied with this cell which is necessary for momentum transfer dependent inelastic x-ray scattering. This cell is ideal to examine other liquid hydrate formers or other liquid samples, which have to be mixed in situ during the measurements.

Uranium, radium and radon exhalation study in some soil samples using track etch technique

International Nuclear Information System (INIS)

Harmanjit, Singh; Joga, Singh; Surinder, Singh; Bajwa, B.S.

2006-01-01

Full text of publication follows: Uranium, radium concentration and radon exhalation rates have been determined in the soil samples collected from some areas of Punjab using the L.R.-115 nuclear track detectors. Radium concentration in these samples has been found to be varying from 0.80 to 5.34 Bq Kg-1. The radon exhalation rate in these samples has been found to be varying from 0.99 to 6.60 mBq Kg -1 h -1 (32.82 to 218.49 mBqm -2 h -1 ). A good correlation has been observed between radon exhalation rate and radium concentration observed in the soil samples. The uranium concentration in all these samples is being carried out and the other correlations will also be established. (authors)

REMOTE IN-CELL SAMPLING IMPROVEMENTS PROGRAM AT THESAVANNAH RIVER SITE (SRS) DEFENSE WASTE PROCESSING FACILITY (DWPF)

International Nuclear Information System (INIS)

Marzolf, A

2007-01-01

Remote Systems Engineering (RSE) of the Savannah River National Lab (SRNL) in combination with the Defense Waste Processing Facility(DWPF) Engineering and Operations has evaluated the existing equipment and processes used in the facility sample cells for 'pulling' samples from the radioactive waste stream and performing equipment in-cell repairs/replacements. RSE has designed and tested equipment for improving remote in-cell sampling evolutions and reducing the time required for in-cell maintenance of existing equipment. The equipment within the present process tank sampling system has been in constant use since the facility start-up over 17 years ago. At present, the method for taking samples within the sample cells produces excessive maintenance and downtime due to frequent failures relative to the sampling station equipment and manipulator. Location and orientation of many sampling stations within the sample cells is not conducive to manipulator operation. The overextension of manipulators required to perform many in-cell operations is a major cause of manipulator failures. To improve sampling operations and reduce downtime due to equipment maintenance, a Portable Sampling Station (PSS), wireless in-cell cameras, and new commercially available sampling technology has been designed, developed and/or adapted and tested. The uniqueness of the design(s), the results of the scoping tests, and the benefits relative to in-cell operation and reduction of waste are presented

Cyanotoxins at low doses induce apoptosis and inflammatory effects in murine brain cells: Potential implications for neurodegenerative diseases

Directory of Open Access Journals (Sweden)

Larissa Takser

Full Text Available Cyanotoxins have been shown to be highly toxic for mammalian cells, including brain cells. However, little is known about their effect on inflammatory pathways. This study investigated whether mammalian brain and immune cells can be a target of certain cyanotoxins, at doses approximating those in the guideline levels for drinking water, either alone or in mixtures. We examined the effects on cellular viability, apoptosis and inflammation signalling of several toxins on murine macrophage-like RAW264.7, microglial BV-2 and neuroblastoma N2a cell lines. We tested cylindrospermopsin (CYN, microcystin-LR (MC-LR, and anatoxin-a (ATX-a, individually as well as their mixture. In addition, we studied the neurotoxins β-N-methylamino-l-alanine (BMAA and its isomer 2,4-diaminobutyric acid (DAB, as well as the mixture of both. Cellular viability was determined by the MTT assay. Apoptosis induction was assessed by measuring the activation of caspases 3/7. Cell death and inflammation are the hallmarks of neurodegenerative diseases. Thus, our final step was to quantify the expression of a major proinflammatory cytokine TNF-α by ELISA. Our results show that CYN, MC-LR and ATX-a, but not BMAA and DAB, at low doses, especially when present in a mixture at threefold less concentrations than individual compounds are 3–15 times more potent at inducing apoptosis and inflammation. Our results suggest that common cyanotoxins at low doses have a potential to induce inflammation and apoptosis in immune and brain cells. Further research of the neuroinflammatory effects of these compounds in vivo is needed to improve safety limit levels for cyanotoxins in drinking water and food. Keywords: Cyanotoxins, Low doses, Apoptosis, Inflammation, Brain cells, Neurodegenerative diseases

Single charged-particle damage to living cells: a new method based on track-etch detectors

International Nuclear Information System (INIS)

Durante, M.; Grossi, G.F.; Pugliese, M.; Manti, L.; Nappo, M.; Gialanella, G.

1994-01-01

Biological effects of ionizing radiation are usually expressed as a function of the absorbed dose. Low doses of high-LET radiation correspond to one or few particle traversals through the cell. In order to study the biological effectiveness of single charged particles, we have developed a new method based on solid state nuclear track detectors. Cells are seeded on mylar and a LR-115 film is stuck below the mylar base. After irradiation, the LR-115 film is etched and cells observed at a phase contrast microscope connected to a video camera and an image analyzer. In this way, it is possible to measure the number of traversals through the cell nucleus or cytoplasm. Coordinates of each cell on the microscope bench are saved. After incubation for about one week, cells are fixed and stained and the colonies observed at the microscope. The fate of each irradiated cell is therefore correlated to the number of traversals. We have tested this method with two different rodent embryo fibroblast cell lines, C3H 10T1/2 and V79, exposed to 3.2 MeV accelerated α-particles (LET =124 keV/μm). The studied endpoint was cell killing. Preliminary biological results suggest that few α-particle tracks in V79 hamster cells are sufficient to reduce surviving fraction. ((orig.))

Differences in replicon behavior between x-irradiation-sensitive L5178Y mouse lymphoma cells and A-T fibroblasts using DNA fiber autoradiography

International Nuclear Information System (INIS)

Ockey, C.H.

1983-01-01

Replicon behavior in radiosensitive Ataxia telangiectasia (A-T) fibroblasts and mouse lymphoma L5178Y (LS) cells was studied by DNA fiber autoradiography. LS cells, irradiated at 13 Gy, showed a similar reduction in rate of DNA chain growth and initiation of replicons as did resistant (LR) cells. A progressive increase in the intensity of [ 3 H]TdR labeling of many replicons was observed after irradition in the LS cells, but not in LR cells. This indicated a reduced or absent endogenous dTTP supply after irradiation in the LS cells, implicating a defect in nucleoside precursor production. Irradiated normal human and A-T cells did not show this effect. After 2 Gy, the frequency of initiation of replicons into synthesis was temporarily reduced in the normal human but not in the A-T cells. After 20 Gy, the rate of DNA chain growth was preferentially reduced in the normal human cells, but an increase was observed in the A-T cells. This increased rate could be explained in terms of a normal supply of complexes involved in chain elongation being distributed over a reduced number of initiated replicon clusters in the A-T cells

Risk factors for locoregional recurrence in patients with resected N1 non-small cell lung cancer: a retrospective study to identify patterns of failure and implications for adjuvant radiotherapy

International Nuclear Information System (INIS)

Fan, Chengcheng; Gao, Shugeng; Hui, Zhouguang; Liang, Jun; Lv, Jima; Wang, Xiaozhen; He, Jie; Wang, Luhua

2013-01-01

Meta-analysis of randomized trials has shown that postoperative radiotherapy (PORT) had a detrimental effect on overall survival (OS) in patients with resected N1 non–small cell lung cancer (NSCLC). Conversely, the locoregional recurrence (LR) rate is reported to be high without adjuvant PORT in these patients. We have evaluated the pattern of failure, actuarial risk and risk factors for LR in order to identify the subset of N1 NSCLC patients with the highest risk of LR. These patients could potentially benefit from PORT. We conducted a retrospective study on 199 patients with pathologically confirmed T1–3N1M0 NSCLC who underwent surgery. None of the patients had positive surgical margins or received preoperative therapy or PORT. The median follow-up was 53.8 months. Complete mediastinal lymph node (MLN) dissection and examination was defined as ≥3 dissected and examined MLN stations; incomplete MLN dissection or examination (IMD) was defined as <3 dissected or examined MLN stations. The primary end point of this study was freedom from LR (FFLR). Differences between patient groups were compared and risk factors for LR were identified by univariate and multivariate analyses. LR was identified in 41 (20.6%) patients, distant metastasis (DM) was identified in 79 (39.7%) patients and concurrent LR and DM was identified in 25 (12.6%) patients. The 3- and 5-year OS rates in patients with resected N1 NSCLC were 78.4% and 65.6%, respectively. The corresponding FFLR rates were 80.8% and 77.3%, respectively. Univariate analyses identified that nonsmokers, ≤23 dissected lymph nodes, visceral pleural invasion and lymph node ratio >10% were significantly associated with lower FFLR rates (P < 0.05). Multivariate analyses further confirmed positive lymph nodes at station 10 and IMD as risk factors for LR (P < 0.05). The 5-year LR rate was highest in patients with both these risk factors (48%). The incidence of LR in patients with surgically resected T1–3N1M0 NSCLC is

Large-scale prospective T cell function assays in shipped, unfrozen blood samples

DEFF Research Database (Denmark)

Hadley, David; Cheung, Roy K; Becker, Dorothy J

2014-01-01

, for measuring core T cell functions. The Trial to Reduce Insulin-dependent diabetes mellitus in the Genetically at Risk (TRIGR) type 1 diabetes prevention trial used consecutive measurements of T cell proliferative responses in prospectively collected fresh heparinized blood samples shipped by courier within...... cell immunocompetence. We have found that the vast majority of the samples were viable up to 3 days from the blood draw, yet meaningful responses were found in a proportion of those with longer travel times. Furthermore, the shipping time of uncooled samples significantly decreased both the viabilities...... North America. In this article, we report on the quality control implications of this simple and pragmatic shipping practice and the interpretation of positive- and negative-control analytes in our assay. We used polyclonal and postvaccination responses in 4,919 samples to analyze the development of T...

1,3-Propanediol dehydrogenases in Lactobacillus reuteri: impact on central metabolism and 3-hydroxypropionaldehyde production

Directory of Open Access Journals (Sweden)

Meile Leo

2011-08-01

Full Text Available Abstract Background Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA and further to 1,3-propanediol (1,3-PDO, the latter step catalysed by a propanediol dehydrogenase (PDH. The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. Results A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts. During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. Conclusion The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.

A new and standardized method to sample and analyse vitreous samples by the Cellient automated cell block system.

Science.gov (United States)

Van Ginderdeuren, Rita; Van Calster, Joachim; Stalmans, Peter; Van den Oord, Joost

2014-08-01

In this prospective study, a universal protocol for sampling and analysing vitreous material was investigated. Vitreous biopsies are difficult to handle because of the paucity of cells and the gelatinous structure of the vitreous. Histopathological analysis of the vitreous is useful in difficult uveitis cases to differentiate uveitis from lymphoma or infection and to define the type of cellular reaction. Hundred consecutive vitreous samples were analysed with the Cellient tissue processor (Hologic). This machine is a fully automated processor starting from a specified container with PreservCyt (fixative fluid) with cells to paraffin. Cytology was compared with fixatives Cytolyt (contains a mucolyticum) and PreservCyt. Routine histochemical and immunostainings were evaluated. In 92% of the cases, sufficient material was found for diagnosis. In 14%, a Cytolyt wash was necessary to prevent clotting of the tubes in the Cellient due to the viscosity of the sample. In 23%, the diagnosis was an acute inflammation (presence of granulocytes); in 33%, chronic active inflammation (presence of T lymphocytes); in 33%, low-grade inflammation (presence of CD68 cells, without T lymphocytes); and in 3%, a malignant process. A standardized protocol for sampling and handling vitreous biopsies, fixing in PreservCyt and processing by the Cellient gives a satisfactory result in morphology, number of cells and possibility of immuno-histochemical stainings. The diagnosis can be established or confirmed in more than 90% of cases. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

OpenAIRE

Jacobs, Loraine Cristina do Valle

2011-01-01

Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

A systematic assessment of goblet cell sampling of the bulbar conjunctiva by impression cytology.

Science.gov (United States)

Doughty, Michael J

2015-07-01

The purpose of this study was to assess the apparent goblet cell density (GCD) from conjunctival impression cytology (CIC) samples in relation to the number of conjunctival cells collected onto the filters. CIC specimens were collected from the superior-temporal bulbar conjunctiva of 16 pigmented rabbits onto Biopore (Millicell-CM) membranes, fixed with buffered glutaraldehyde and stained with Giemsa. Different numbers of microscope fields of view in each of the specimens were imaged by light microscopy using a 20× magnification objective lens (200× final magnification), and the goblet cells marked and counted. The GCD values/sq. mm were calculated. The same conjunctival region of 3 other rabbits was also prepared for transmission electron microscopy (TEM) by fixation, in situ, with the same buffered glutaraldehyde. Mean values for GCD estimates were found to vary from 399 to 1576 cells/sq. mm, depending on the image sampling and analysis strategy chosen, with the lowest inter-sample variance of around 10% being found if a maximum goblet cell count was taken on substantially multilayered regions of the CIC specimens. Counts of the number of goblet cells per 1000 visible conjunctival epithelial cells yielded a value of close to 90 (range 36-151), with modest inter-sample variability of around 30%. A three or ten 200× microscope field and random sampling strategy yielded mean GCD values between 542 and 670 cells/sq. mm, but with very high intra- and inter-sample variance of at least 60% and sometimes higher than 100%. TEM confirmed the multilayered organization of the conjunctiva and the deeper lying goblet cells. The general use of a goblet cell count as an objective marker for conjunctival normality or health is likely to be highly variable unless a more specific strategy is adopted. Beyond providing details of exactly the counting strategy used, it would be very useful to provide full details of the actual microscope field size used as well as information on

Drug: D08821 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available D08821 Drug Concentrated human red blood cells; Red cells concentrates -leukocytes... reduced (RCC-LR) (TN); Irradiated red cells concentrates -leukocytes reduced (Ir-RCC-LR) (TN) ... PubChem: 96025504 ...

Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

OpenAIRE

Máthé, Csaba; Mikóné Hamvas, Márta; Vasas, Gábor

2013-01-01

Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studi...

Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

Science.gov (United States)

Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

2017-01-01

In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

A pilot study on the usefulness of peripheral blood flow cytometry for the diagnosis of lower risk myelodysplastic syndromes: the "MDS thermometer".

Science.gov (United States)

Aires, Ana; Teixeira, Maria Dos Anjos; Lau, Catarina; Moreira, Cláudia; Spínola, Ana; Mota, Alexandra; Freitas, Inês; Coutinho, Jorge; Lima, Margarida

2018-01-01

Immunophenotypic analysis of the bone marrow (BM) cells has proven to be helpful in the diagnosis of Myelodysplastic Syndromes (MDS). However, the usefulness of flow cytometry (FCM) for the detection of myelodysplasia in the peripheral blood (PB) still needs to be investigated. The aim of this pilot study was to evaluate the value of FCM-based PB neutrophil and monocyte immunophenotyping for the diagnosis of lower risk MDS (LR-MDS). We evaluated by 8-color FCM the expression of multiple cell surface molecules (CD10, CD11b, CD11c, CD13, CD14, CD15, CD16, CD34, CD45, CD56, CD64 and HLA-DR) in PB neutrophils and monocytes from a series of 14 adult LR-MDS patients versus 14 normal individuals. Peripheral blood neutrophils from patients with LR-MDS frequently had low forward scatter (FSC) and side scatter (SSC) values and low levels of CD11b, CD11c, CD10, CD16, CD13 and CD45 expression, in that order, as compared to normal neutrophils. In addition, patients with LR-MDS commonly display a higher fraction of CD14 + CD56 + and a lower fraction of CD14 + CD16 + monocytes in the PB. Based on these results, we proposed an immunophenotyping score based on which PB samples from patients with LR-MDS could be distinguished from normal PB samples with a sensitivity 93% and a specificity of 100%. In addition, we used this score to construct the MDS Thermometer, a screening tool for detection and monitoring of MDS in the PB in clinical practice. Peripheral blood neutrophil and monocyte immunophenotyping provide useful information for the diagnosis of LR-MDS, as a complement to cytomorphology. If validated by subsequent studies in larger series of MDS patients and extended to non-MDS patients with cytopenias, our findings may improve the diagnostic assessment and avoid invasive procedures in selected groups of MDS patients.

Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

Science.gov (United States)

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

Hierarchical modeling for rare event detection and cell subset alignment across flow cytometry samples.

Directory of Open Access Journals (Sweden)

Andrew Cron

Full Text Available Flow cytometry is the prototypical assay for multi-parameter single cell analysis, and is essential in vaccine and biomarker research for the enumeration of antigen-specific lymphocytes that are often found in extremely low frequencies (0.1% or less. Standard analysis of flow cytometry data relies on visual identification of cell subsets by experts, a process that is subjective and often difficult to reproduce. An alternative and more objective approach is the use of statistical models to identify cell subsets of interest in an automated fashion. Two specific challenges for automated analysis are to detect extremely low frequency event subsets without biasing the estimate by pre-processing enrichment, and the ability to align cell subsets across multiple data samples for comparative analysis. In this manuscript, we develop hierarchical modeling extensions to the Dirichlet Process Gaussian Mixture Model (DPGMM approach we have previously described for cell subset identification, and show that the hierarchical DPGMM (HDPGMM naturally generates an aligned data model that captures both commonalities and variations across multiple samples. HDPGMM also increases the sensitivity to extremely low frequency events by sharing information across multiple samples analyzed simultaneously. We validate the accuracy and reproducibility of HDPGMM estimates of antigen-specific T cells on clinically relevant reference peripheral blood mononuclear cell (PBMC samples with known frequencies of antigen-specific T cells. These cell samples take advantage of retrovirally TCR-transduced T cells spiked into autologous PBMC samples to give a defined number of antigen-specific T cells detectable by HLA-peptide multimer binding. We provide open source software that can take advantage of both multiple processors and GPU-acceleration to perform the numerically-demanding computations. We show that hierarchical modeling is a useful probabilistic approach that can provide a

Multispectral Imaging Analysis of Circulating Tumor Cells in Negatively Enriched Peripheral Blood Samples.

Science.gov (United States)

Miller, Brandon; Lustberg, Maryam; Summers, Thomas A; Chalmers, Jeffrey J

2017-01-01

A variety of biomarkers are present on cells in peripheral blood of patients with a variety of disorders, including solid tumor malignancies. While rare, characterization of these cells for specific protein levels with the advanced technology proposed, will lead to future validation studies of blood samples as "liquid biopsies" for the evaluation of disease status and therapeutic response. While circulating tumor cells (CTCs) have been isolated in the blood samples of patients with solid tumors, the exact role of CTCs as clinically useful predictive markers is still debated. Current commercial technology has significant bias in that a positive selection technology is used that preassumes specific cell surface markers (such as EpCAM) are present on CTCs. However, CTCs with low EpCAM expression have been experimentally demonstrated to be more likely to be missed by this method. In contrast, this application uses a previously developed, technology that performs a purely negative enrichment methodology on peripheral blood, yielding highly enriched blood samples that contain CTCs as well as other, undefined cell types. The focus of this contribution is the use of multispectral imaging of epifluorescent, microscopic images of these enriched cells in order to help develop clinically relevant liquid biopsies from peripheral blood samples.

The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

International Nuclear Information System (INIS)

Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

2010-01-01

LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

Effects of mechanical stress and vitreous samples in retinal pigment epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Takahashi, Eri, E-mail: eritakahashi@fc.kuh.kumamoto-u.ac.jp; Fukushima, Ayako; Haga, Akira; Inomata, Yasuya; Ito, Yasuhiro; Fukushima, Mikiko; Tanihara, Hidenobu

2016-02-12

In rhegmatogenous retinal detachment (RRD), scattered RPE cells from the basement membrane into the vitreous cavity undergo an epithelial mesenchymal transition (EMT) and form the intraocular fibrous membrane in response to vitreous fluid. We investigated whether exposure to vitreous samples was associated with EMT-associated signals and mesenchymal characters. Human vitreous samples were collected from patients with RRD, epiretinal membrane (ERM), or macular hole (MH). We evaluated the effects of vitreous on ARPE-19 cells in suspension cultures using poly 2-hydroxyethyl methacrylate-coated dishes and three-dimensional (3D) Matrigel cultures. We found that exposure to vitreous samples did not induce morphological changes or accelerate wound closure in monolayers. Several samples showed increased phosphorylation of Smad2 and nuclear translocation of nuclear factor-κB. Mechanical stress triggered an elevation of phosphorylation levels in Smad2. In addition, exposure to vitreous fluid increased the phosphorylation of p38 mitogen-activated protein kinase in cell suspension cultures after mechanical stress. Moreover, ARPE-19 cells showed a stellate invasive phenotype in 3D Matrigel cultures with vitreous samples. In this study, we demonstrated that mechanical stress and vitreous were associated with EMT-associated signals and invasive phenotypes in 3D cultures but not in monolayers. These results have important implications for the role of vitreous humor in the induction of EMT and intraocular fibrosis.

Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

Science.gov (United States)

Feng, Rulin; Peterson, Kirk A

2017-08-28

New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

The Dopants and Doping Level Dependence of the Structure and Magnetic Properties of the Eu (BA_1-xLR_x)₂Cu₃O_7+δ

Energy Technology Data Exchange (ETDEWEB)

Lin, Yu [Iowa State Univ., Ames, IA (United States)

2002-12-31

Eu(Ba_1-xLR_x)₂Cu₃O_7+δ were systematically studied in order to understand how the valence of the rear earth elements, ionic sizes and magnetic moment affect the crystal structure and magnetic and electrical properties. Differential thermal analyses were carried out to check the phase purity, X-ray data were least-squares fitted to determine the lattice parameters, and DC-SQUID magnetometry was used to characterize the superconducting properties. These results showed that the crystallography is consistent with other EuLR123ss series, LR = La, Pr, Eu. The lattice parameters vary with the ionic radii of the rare earth ions. Unlike the uniform change in lattice parameter, the superconducting transition did not vary systematically with the ionic size of the dopants. Although the general trend was for T_c to decrease with decreasing ionic size of the dopant, for the same doping level, Pr was anomalous, depressing T_c faster. Although the exact mechanism is not clear, this result is consistent with the depression of T_c for Pr substitution for the rare earth in R123. The critical current J_c was determined using the Bean model from magnetization versus field measurements as a function of temperature and field. The effect of the dopants on J_c with the increasing of temperature or applied field was determined. For T < 77 K and small values of x, the value of J_c was increased over that of the x = 0 sample. In addition, the smaller the substituting atom, the higher the J_c becomes. For instance, at x = 0.025, Eu123 < EuLa.025 < EuPr.025 < EuNd.025 < EuEu.025. The enhancement of J_c disappears for x > 0.05 and T > 0.5T_c.

Simultaneous Microcystis Algicidal and Microcystin Degrading Capability by a Single Acinetobacter Bacterial Strain.

Science.gov (United States)

Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang

2016-11-01

Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10 3 to 1 × 10 7 cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.

Diagnostic value of circulating tumor cell detection in bladder and urothelial cancer: systematic review and meta-analysis

International Nuclear Information System (INIS)

Msaouel, Pavlos; Koutsilieris, Michael

2011-01-01

The diagnostic value and prognostic significance of circulating tumor cell (CTC) detection in patients with bladder cancer is controversial. We performed a meta-analysis to consolidate current evidence regarding the use of CTC detection assays to diagnose bladder and other urothelial cancers and the association of CTC positivity with advanced, remote disease. Studies that investigated the presence of CTCs in the peripheral blood of patients with bladder cancer and/or urothelial cancer were identified and reviewed. Sensitivities, specificities, and positive (LR+) and negative likelihood ratios (LR-) of CTC detection in individual studies were calculated and meta-analyzed by random effects model. Overall odds ratio of CTC positivity in patients with advanced disease versus those with organ-confined cancer was also calculated. Overall sensitivity of CTC detection assays was 35.1% (95%CI, 32.4-38%); specificity, LR+, and LR- was 89.4% (95%CI, 87.2-91.3%), 3.77 (95%CI, 1.95-7.30) and 0.72 (95%CI, 0.64-0.81). CTC-positive patients were significantly more likely to have advanced (stage III-IV) disease compared with CTC-negative patients (OR, 5.05; 95%CI, 2.49-10.26). CTC evaluation can confirm tumor diagnosis and identify patients with advanced bladder cancer. However, due to the low overall sensitivity, CTC detection assays should not be used as initial screening tests

EVALUATION OF ZEBU NELLORE CATTLE BLOOD SAMPLES USING THE CELL-DYN 3500 HEMATOLOGY ANALYZER

Directory of Open Access Journals (Sweden)

Alexandre Secorun Borges

2014-12-01

Full Text Available The Cell-dyn 3500 is a multiparameter flow cytometer, which may analyze samples from several species performing several simultaneous analyses. It is able to perform white blood cells, red blood cells and platelet counts, besides differential leukocyte counts, packed cell volume and hemoglobin determination. Cell-Dyn 3500 performs total leukocyte count both optically and by impedance. The equipment may choose one or other method, based on the reliability of the results. Erythrocyte and platelet counts are determined by impedance. Leukocyte differentiation is based on an optical principle, using separation in multiangular polarized light. The objective of this study was to compare the results of complete blood count of Zebu Nellore heifers from Celldyn 3500, with those obtained from a semi-automated cell counter (Celm CC 510 and the manual technique. Blood samples were collected from the jugular vein in 5 mL EDTA vacuum tubes from 58 Nellore heifers, at 24 months of age. Samples were processed in parallel in the three different techniques. Results were analyzed using paired t test, Pearson’s correlation and the Bland-Altmann method. There was a strong correlation for all parameters analyzed by Cell-Dyn 3500, manual method and semiautomated cell counter, except for basophils and monocytes counts. These results confirm that this analyzer is reliable for blood samples analysis of zebu cattle.

Extraction of nucleic acids from yeast cells and plant tissues using ethanol as medium for sample preservation and cell disruption.

Science.gov (United States)

Linke, Bettina; Schröder, Kersten; Arter, Juliane; Gasperazzo, Tatiana; Woehlecke, Holger; Ehwald, Rudolf

2010-09-01

Here we report that dehydrated ethanol is an excellent medium for both in situ preservation of nucleic acids and cell disruption of plant and yeast cells. Cell disruption was strongly facilitated by prior dehydration of the ethanol using dehydrated zeolite. Following removal of ethanol, nucleic acids were extracted from the homogenate pellet using denaturing buffers. The method provided DNA and RNA of high yield and integrity. Whereas cell wall disruption was essential for extraction of DNA and large RNA molecules, smaller molecules such as tRNAs could be selectively extracted from undisrupted, ethanol-treated yeast cells. Our results demonstrate the utility of absolute ethanol for sample fixation, cell membrane and cell wall disruption, as well as preservation of nucleic acids during sample storage.

Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

International Nuclear Information System (INIS)

Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

2014-01-01

This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

Science.gov (United States)

Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

2014-06-01

This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

Modulated Raman spectroscopy for enhanced identification of bladder tumor cells in urine samples.

Science.gov (United States)

Canetta, Elisabetta; Mazilu, Michael; De Luca, Anna Chiara; Carruthers, Antonia E; Dholakia, Kishan; Neilson, Sam; Sargeant, Harry; Briscoe, Tina; Herrington, C Simon; Riches, Andrew C

2011-03-01

Standard Raman spectroscopy (SRS) is a noninvasive technique that is used in the biomedical field to discriminate between normal and cancer cells. However, the presence of a strong fluorescence background detracts from the use of SRS in real-time clinical applications. Recently, we have reported a novel modulated Raman spectroscopy (MRS) technique to extract the Raman spectra from the background. In this paper, we present the first application of MRS to the identification of human urothelial cells (SV-HUC-1) and bladder cancer cells (MGH) in urine samples. These results are compared to those obtained by SRS. Classification using the principal component analysis clearly shows that MRS allows discrimination between Raman spectra of SV-HUC-1 and MGH cells with high sensitivity (98%) and specificity (95%). MRS is also used to distinguish between SV-HUC-1 and MGH cells after exposure to urine for up to 6 h. We observe a marked change in the MRS of SV-HUC-1 and MGH cells with time in urine, indicating that the conditions of sample collection will be important for the application of this methodology to clinical urine samples.

Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut.

Science.gov (United States)

Essner, Jeffrey J; Amack, Jeffrey D; Nyholm, Molly K; Harris, Erin B; Yost, H Joseph

2005-03-01

Monocilia have been proposed to establish the left-right (LR) body axis in vertebrate embryos by creating a directional fluid flow that triggers asymmetric gene expression. In zebrafish, dorsal forerunner cells (DFCs) express a conserved ciliary dynein gene (left-right dynein-related1, lrdr1) and form a ciliated epithelium inside a fluid-filled organ called Kupffer's vesicle (KV). Here, videomicroscopy demonstrates that cilia inside KV are motile and create a directional fluid flow just prior to the onset of asymmetric gene expression in lateral cells. Laser ablation of DFCs and surgical disruption of KV provide direct evidence that ciliated KV cells are required during early somitogenesis for subsequent LR patterning in the brain, heart and gut. Antisense morpholinos against lrdr1 disrupt KV fluid flow and perturb LR development. Furthermore, lrdr1 morpholinos targeted to DFC/KV cells demonstrate that Lrdr1 functions in these ciliated cells to control LR patterning. This provides the first direct evidence, in any vertebrate, that impairing cilia function in derivatives of the dorsal organizer, and not in other cells that express ciliogenic genes, alters LR development. Finally, genetic analysis reveals novel roles for the T-box transcription factor no tail and the Nodal signaling pathway as upstream regulators of lrdr1 expression and KV morphogenesis. We propose that KV is a transient embryonic 'organ of asymmetry' that directs LR development by establishing a directional fluid flow. These results suggest that cilia are an essential component of a conserved mechanism that controls the transition from bilateral symmetry to LR asymmetry in vertebrates.

Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E

2008-06-12

Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

Immunomagnetic separation combined with colony immunoblotting for selective enrichment and detection of piliated Lactobacillus rhamnosus strains.

Science.gov (United States)

Yang, Z Q; Wei, Y F; Rao, S Q; Gao, L; Yin, Y Q; Xue, F; Fang, W M; Gu, R X; Jiao, X A

2016-11-01

Piliated Lactobacillus rhamnosus (pLR) strains have attracted much attention owing to their excellent mucus adhering capacity and immunomodulatory effects. Here, we aimed to develop a rapid, sensitive method for isolating pLR strains in complex ecosystems using immunomagnetic separation (IMS) with colony immunoblotting (CIB). Magnetic nanobeads (diameter: 180 nm) conjugated with anti-pLR SpaA pilin antibodies (anti-SpaA) were prepared and used to preconcentrate pLR strains in samples, followed by confirmation with anti-SpaA-based CIB analysis. Under optimized experimental conditions, IMS-CIB selectively recovered pLR strains from 10 7  CFU ml -1 of faecal microbiota samples spiked with 2·9 × 10 1 to 2·4 × 10 6  CFU ml -1 of pLR strains. No positive colonies were detected in samples without addition of pLR strains. The detection limit of IMS-CIB was 29 CFU pLR ml -1 of faecal microbiota, which is much lower than that of CIB without IMS preconcentration (2·0 × 10 4  CFU ml -1 ). IMS-CIB allowed selective preconcentration of pLR strains in highly heterogeneous bacterial suspensions and direct detection of pLR colonies, which remained readily available for subsequent isolation. Our findings established an effective method for selective enrichment and detection of pLR strains. © 2016 The Society for Applied Microbiology.

Genetic control of eosinophilia in mice: gene(s) expressed in bone marrow-derived cells control high responsiveness

International Nuclear Information System (INIS)

Vadas, M.A.

1982-01-01

A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy

Estimating negative likelihood ratio confidence when test sensitivity is 100%: A bootstrapping approach.

Science.gov (United States)

Marill, Keith A; Chang, Yuchiao; Wong, Kim F; Friedman, Ari B

2017-08-01

Objectives Assessing high-sensitivity tests for mortal illness is crucial in emergency and critical care medicine. Estimating the 95% confidence interval (CI) of the likelihood ratio (LR) can be challenging when sample sensitivity is 100%. We aimed to develop, compare, and automate a bootstrapping method to estimate the negative LR CI when sample sensitivity is 100%. Methods The lowest population sensitivity that is most likely to yield sample sensitivity 100% is located using the binomial distribution. Random binomial samples generated using this population sensitivity are then used in the LR bootstrap. A free R program, "bootLR," automates the process. Extensive simulations were performed to determine how often the LR bootstrap and comparator method 95% CIs cover the true population negative LR value. Finally, the 95% CI was compared for theoretical sample sizes and sensitivities approaching and including 100% using: (1) a technique of individual extremes, (2) SAS software based on the technique of Gart and Nam, (3) the Score CI (as implemented in the StatXact, SAS, and R PropCI package), and (4) the bootstrapping technique. Results The bootstrapping approach demonstrates appropriate coverage of the nominal 95% CI over a spectrum of populations and sample sizes. Considering a study of sample size 200 with 100 patients with disease, and specificity 60%, the lowest population sensitivity with median sample sensitivity 100% is 99.31%. When all 100 patients with disease test positive, the negative LR 95% CIs are: individual extremes technique (0,0.073), StatXact (0,0.064), SAS Score method (0,0.057), R PropCI (0,0.062), and bootstrap (0,0.048). Similar trends were observed for other sample sizes. Conclusions When study samples demonstrate 100% sensitivity, available methods may yield inappropriately wide negative LR CIs. An alternative bootstrapping approach and accompanying free open-source R package were developed to yield realistic estimates easily. This

Design and evaluation of a new Peltier-cooled laser ablation cell with on-sample temperature control.

Science.gov (United States)

Konz, Ioana; Fernández, Beatriz; Fernández, M Luisa; Pereiro, Rosario; Sanz-Medel, Alfredo

2014-01-27

A new custom-built Peltier-cooled laser ablation cell is described. The proposed cryogenic cell combines a small internal volume (20 cm(3)) with a unique and reliable on-sample temperature control. The use of a flexible temperature sensor, directly located on the sample surface, ensures a rigorous sample temperature control throughout the entire analysis time and allows instant response to any possible fluctuation. In this way sample integrity and, therefore, reproducibility can be guaranteed during the ablation. The refrigeration of the proposed cryogenic cell combines an internal refrigeration system, controlled by a sensitive thermocouple, with an external refrigeration system. Cooling of the sample is directly carried out by 8 small (1 cm×1 cm) Peltier elements placed in a circular arrangement in the base of the cell. These Peltier elements are located below a copper plate where the sample is placed. Due to the small size of the cooling electronics and their circular allocation it was possible to maintain a peephole under the sample for illumination allowing a much better visualization of the sample, a factor especially important when working with structurally complex tissue sections. The analytical performance of the cryogenic cell was studied using a glass reference material (SRM NIST 612) at room temperature and at -20°C. The proposed cell design shows a reasonable signal washout (signal decay within less than 10 s to background level), high sensitivity and good signal stability (in the range 6.6-11.7%). Furthermore, high precision (0.4-2.6%) and accuracy (0.3-3.9%) in the isotope ratio measurements were also observed operating the cell both at room temperature and at -20°C. Finally, experimental results obtained for the cell application to qualitative elemental imaging of structurally complex tissue samples (e.g. eye sections from a native frozen porcine eye and fresh flower leaves) demonstrate that working in cryogenic conditions is critical in such

Utility of Cytospin and Cell block Technology in Evaluation of Body Fluids and Urine Samples: A Comparative Study.

Science.gov (United States)

Qamar, Irmeen; Rehman, Suhailur; Mehdi, Ghazala; Maheshwari, Veena; Ansari, Hena A; Chauhan, Sunanda

2018-01-01

Cytologic examination of body fluids commonly involves the use of direct or sediment smears, cytocentrifuge preparations, membrane filter preparations, or cell block sections. Cytospin and cell block techniques are extremely useful in improving cell yield of thin serous effusions and urine samples, and ensure high diagnostic efficacy. We studied cytospin preparations and cell block sections prepared from 180 samples of body fluids and urine samples to compare the relative efficiency of cell retrieval, preservation of cell morphology, ease of application of special stains, and diagnostic efficacy. Samples were collected and processed to prepare cytospin smears and cell block sections. We observed that overall, cell yield and preservation of individual cell morphology were better in cytospin preparations as compared to cell blocks, while preservation of architectural pattern was better in cell block sections. The number of suspicious cases also decreased on cell block sections, with increased detection of malignancy. It was difficult to prepare cell blocks from urine samples due to low cellularity. Cytospin technology is a quick, efficient, and cost-effective method of increasing cell yield in hypocellular samples, with better preservation of cell morphology. Cell blocks are better prepared from high cellularity fluids; however, tissue architecture is better studied, with improved rate of diagnosis and decrease in ambiguous results. Numerous sections can be prepared from a small amount of material. Special stains and immunochemical stains can be easily applied to cell blocks. It also provides a source of archival material.

Raman spectral signatures of cervical exfoliated cells from liquid-based cytology samples

Science.gov (United States)

Kearney, Padraig; Traynor, Damien; Bonnier, Franck; Lyng, Fiona M.; O'Leary, John J.; Martin, Cara M.

2017-10-01

It is widely accepted that cervical screening has significantly reduced the incidence of cervical cancer worldwide. The primary screening test for cervical cancer is the Papanicolaou (Pap) test, which has extremely variable specificity and sensitivity. There is an unmet clinical need for methods to aid clinicians in the early detection of cervical precancer. Raman spectroscopy is a label-free objective method that can provide a biochemical fingerprint of a given sample. Compared with studies on infrared spectroscopy, relatively few Raman spectroscopy studies have been carried out to date on cervical cytology. The aim of this study was to define the Raman spectral signatures of cervical exfoliated cells present in liquid-based cytology Pap test specimens and to compare the signature of high-grade dysplastic cells to each of the normal cell types. Raman spectra were recorded from single exfoliated cells and subjected to multivariate statistical analysis. The study demonstrated that Raman spectroscopy can identify biochemical signatures associated with the most common cell types seen in liquid-based cytology samples; superficial, intermediate, and parabasal cells. In addition, biochemical changes associated with high-grade dysplasia could be identified suggesting that Raman spectroscopy could be used to aid current cervical screening tests.

Validation of High-Risk Computed Tomography Features for Detection of Local Recurrence After Stereotactic Body Radiation Therapy for Early-Stage Non-Small Cell Lung Cancer

Energy Technology Data Exchange (ETDEWEB)

Peulen, Heike [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Mantel, Frederick [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Department of Radiation Oncology, University Hospital Zurich, Zurich (Switzerland); Guckenberger, Matthias [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Belderbos, José [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Werner-Wasik, Maria [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Hope, Andrew; Giuliani, Meredith [Department of Radiation Oncology University of Toronto and Princess Margaret Cancer Center, Toronto, Ontario (Canada); Grills, Inga [Department of Radiation Oncology Beaumont Hospital, Royal Oak, Michigan (United States); Sonke, Jan-Jakob, E-mail: j.sonke@nki.nl [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands)

2016-09-01

Purpose: Fibrotic changes after stereotactic body radiation therapy (SBRT) for stage I non-small cell lung cancer (NSCLC) are difficult to distinguish from local recurrences (LR), hampering proper patient selection for salvage therapy. This study validates previously reported high-risk computed tomography (CT) features (HRFs) for detection of LR in an independent patient cohort. Methods and Materials: From a multicenter database, 13 patients with biopsy-proven LR were matched 1:2 to 26 non-LR control patients based on dose, planning target volume (PTV), follow-up time, and lung lobe. Tested HRFs were enlarging opacity, sequential enlarging opacity, enlarging opacity after 12 months, bulging margin, linear margin disappearance, loss of air bronchogram, and craniocaudal growth. Additionally, 2 new features were analyzed: the occurrence of new unilateral pleural effusion, and growth based on relative volume, assessed by manual delineation. Results: All HRFs were significantly associated with LR except for loss of air bronchogram. The best performing HRFs were bulging margin, linear margin disappearance, and craniocaudal growth. Receiver operating characteristic analysis of the number of HRFs to detect LR had an area under the curve (AUC) of 0.97 (95% confidence interval [CI] 0.9-1.0), which was identical to the performance described in the original report. The best compromise (closest to 100% sensitivity and specificity) was found at ≥4 HRFs, with a sensitivity of 92% and a specificity of 85%. A model consisting of only 2 HRFs, bulging margin and craniocaudal growth, resulted in a sensitivity of 85% and a specificity of 100%, with an AUC of 0.96 (95% CI 0.9-1.0) (HRFs ≥2). Pleural effusion and relative growth did not significantly improve the model. Conclusion: We successfully validated CT-based HRFs for detection of LR after SBRT for early-stage NSCLC. As an alternative to number of HRFs, we propose a simplified model with the combination of the 2 best HRFs

Lactobacillus rhamnosus L34 and Lactobacillus casei L39 suppress Clostridium difficile-induced IL-8 production by colonic epithelial cells

Science.gov (United States)

2014-01-01

Background Clostridium difficile is the main cause of hospital-acquired diarrhea and colitis known as C. difficile-associated disease (CDAD).With increased severity and failure of treatment in CDAD, new approaches for prevention and treatment, such as the use of probiotics, are needed. Since the pathogenesis of CDAD involves an inflammatory response with a massive influx of neutrophils recruited by interleukin (IL)-8, this study aimed to investigate the probiotic effects of Lactobacillus spp. on the suppression of IL-8 production in response to C. difficile infection. Results We screened Lactobacillus conditioned media from 34 infant fecal isolates for the ability to suppress C. difficile-induced IL-8 production from HT-29 cells. Factors produced by two vancomycin-resistant lactobacilli, L. rhamnosus L34 (LR-L34) and L.casei L39 (LC-L39), suppressed the secretion and transcription of IL-8 without inhibiting C. difficile viability or toxin production. Conditioned media from LR-L34 suppressed the activation of phospho-NF-κB with no effect on phospho-c-Jun. However, LC-L39 conditioned media suppressed the activation of both phospho-NF-κB and phospho-c-Jun. Conditioned media from LR-L34 and LC-L39 also decreased the production of C. difficile-induced GM-CSF in HT-29 cells. Immunomodulatory factors present in the conditioned media of both LR-L34 and LC-L39 are heat-stable up to 100°C and > 100 kDa in size. Conclusions Our results suggest that L. rhamnosus L34 and L. casei L39 each produce factors capable of modulating inflammation stimulated by C. difficile. These vancomycin-resistant Lactobacillus strains are potential probiotics for treating or preventing CDAD. PMID:24989059

Lactobacillus rhamnosus L34 and Lactobacillus casei L39 suppress Clostridium difficile-induced IL-8 production by colonic epithelial cells.

Science.gov (United States)

Boonma, Prapaporn; Spinler, Jennifer K; Venable, Susan F; Versalovic, James; Tumwasorn, Somying

2014-07-02

Clostridium difficile is the main cause of hospital-acquired diarrhea and colitis known as C. difficile-associated disease (CDAD).With increased severity and failure of treatment in CDAD, new approaches for prevention and treatment, such as the use of probiotics, are needed. Since the pathogenesis of CDAD involves an inflammatory response with a massive influx of neutrophils recruited by interleukin (IL)-8, this study aimed to investigate the probiotic effects of Lactobacillus spp. on the suppression of IL-8 production in response to C. difficile infection. We screened Lactobacillus conditioned media from 34 infant fecal isolates for the ability to suppress C. difficile-induced IL-8 production from HT-29 cells. Factors produced by two vancomycin-resistant lactobacilli, L. rhamnosus L34 (LR-L34) and L.casei L39 (LC-L39), suppressed the secretion and transcription of IL-8 without inhibiting C. difficile viability or toxin production. Conditioned media from LR-L34 suppressed the activation of phospho-NF-κB with no effect on phospho-c-Jun. However, LC-L39 conditioned media suppressed the activation of both phospho-NF-κB and phospho-c-Jun. Conditioned media from LR-L34 and LC-L39 also decreased the production of C. difficile-induced GM-CSF in HT-29 cells. Immunomodulatory factors present in the conditioned media of both LR-L34 and LC-L39 are heat-stable up to 100°C and > 100 kDa in size. Our results suggest that L. rhamnosus L34 and L. casei L39 each produce factors capable of modulating inflammation stimulated by C. difficile. These vancomycin-resistant Lactobacillus strains are potential probiotics for treating or preventing CDAD.

Reagentless mechanical cell lysis by nanoscale barbs in microchannels for sample preparation.

Science.gov (United States)

Di Carlo, Dino; Jeong, Ki-Hun; Lee, Luke P

2003-11-01

A highly effective, reagentless, mechanical cell lysis device integrated in microfluidic channels is reported. Sample preparation, specifically cell lysis, is a critical element in 'lab-on-chip' applications. However, traditional methods of cell lysis require purification steps or complicated fabrication steps that a simple mechanical method of lysis may avoid. A simple and effective mechanical cell lysis system is designed, microfabricated, and characterized to quantify the efficiency of cell lysis and biomolecule accessibility. The device functionality is based on a microfluidic filter region with nanostructured barbs created using a modified deep reactive ion etching process. Mechanical lysis is characterized by using a membrane impermeable dye. Three main mechanisms of micro-mechanical lysis are described. Quantitative measurements of accessible protein as compared to a chemically lysed sample are acquired with optical absorption measurements at 280 and 414 nm. At a flow rate of 300 microL min(-1) within the filter region total protein and hemoglobin accessibilities of 4.8% and 7.5% are observed respectively as compared to 1.9% and 3.2% for a filter without nanostructured barbs.

Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

International Nuclear Information System (INIS)

Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

2016-01-01

Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

Study of radon exhalation and emanation rates from fly ash samples

International Nuclear Information System (INIS)

Raj Kumari; Jain, Ravinder; Kant, Krishan; Gupta, Nitin; Garg, Maneesha; Yadav, Mani Kant

2013-01-01

Fly ash, a by-product of burnt coal is technologically important material being used for manufacturing of bricks, sheets, cement, land filling etc. The increased interest in measuring radon exhalation and emanation rates in fly ash samples is due to its health hazards and environmental pollution and the same have been measured to assess the radiological impact of radon emanated from fly ash disposal sites. Samples of fly ash from different thermal power stations in northern India and National Council for Cement and Building Materials (NCB) were collected and analysed for the measurements. For the measurement, alpha sensitive LR-115 type II plastic track detectors were used. Gamma spectrometry and can technique was used for the measurements. The experimental data show that fly ash samples emanate radon in significant amount and this consequently, may result in increased radon levels in dwellings built by using fly ash bricks and excessive radiation exposure to workers residing in the surroundings of fly ash dumping sites. (author)

Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

Directory of Open Access Journals (Sweden)

Košál Michal

2017-01-01

Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

Directory of Open Access Journals (Sweden)

Nemoda Zsofia

2011-12-01

Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

International Nuclear Information System (INIS)

Cerrada, Lucia; San Martin, Jesus

2011-01-01

In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

Accounting for randomness in measurement and sampling in studying cancer cell population dynamics.

Science.gov (United States)

Ghavami, Siavash; Wolkenhauer, Olaf; Lahouti, Farshad; Ullah, Mukhtar; Linnebacher, Michael

2014-10-01

Knowing the expected temporal evolution of the proportion of different cell types in sample tissues gives an indication about the progression of the disease and its possible response to drugs. Such systems have been modelled using Markov processes. We here consider an experimentally realistic scenario in which transition probabilities are estimated from noisy cell population size measurements. Using aggregated data of FACS measurements, we develop MMSE and ML estimators and formulate two problems to find the minimum number of required samples and measurements to guarantee the accuracy of predicted population sizes. Our numerical results show that the convergence mechanism of transition probabilities and steady states differ widely from the real values if one uses the standard deterministic approach for noisy measurements. This provides support for our argument that for the analysis of FACS data one should consider the observed state as a random variable. The second problem we address is about the consequences of estimating the probability of a cell being in a particular state from measurements of small population of cells. We show how the uncertainty arising from small sample sizes can be captured by a distribution for the state probability.

Automated cell counts on CSF samples: A multicenter performance evaluation of the GloCyte system.

Science.gov (United States)

Hod, E A; Brugnara, C; Pilichowska, M; Sandhaus, L M; Luu, H S; Forest, S K; Netterwald, J C; Reynafarje, G M; Kratz, A

2018-02-01

Automated cell counters have replaced manual enumeration of cells in blood and most body fluids. However, due to the unreliability of automated methods at very low cell counts, most laboratories continue to perform labor-intensive manual counts on many or all cerebrospinal fluid (CSF) samples. This multicenter clinical trial investigated if the GloCyte System (Advanced Instruments, Norwood, MA), a recently FDA-approved automated cell counter, which concentrates and enumerates red blood cells (RBCs) and total nucleated cells (TNCs), is sufficiently accurate and precise at very low cell counts to replace all manual CSF counts. The GloCyte System concentrates CSF and stains RBCs with fluorochrome-labeled antibodies and TNCs with nucleic acid dyes. RBCs and TNCs are then counted by digital image analysis. Residual adult and pediatric CSF samples obtained for clinical analysis at five different medical centers were used for the study. Cell counts were performed by the manual hemocytometer method and with the GloCyte System following the same protocol at all sites. The limits of the blank, detection, and quantitation, as well as precision and accuracy of the GloCyte, were determined. The GloCyte detected as few as 1 TNC/μL and 1 RBC/μL, and reliably counted as low as 3 TNCs/μL and 2 RBCs/μL. The total coefficient of variation was less than 20%. Comparison with cell counts obtained with a hemocytometer showed good correlation (>97%) between the GloCyte and the hemocytometer, including at very low cell counts. The GloCyte instrument is a precise, accurate, and stable system to obtain red cell and nucleated cell counts in CSF samples. It allows for the automated enumeration of even very low cell numbers, which is crucial for CSF analysis. These results suggest that GloCyte is an acceptable alternative to the manual method for all CSF samples, including those with normal cell counts. © 2017 John Wiley & Sons Ltd.

System Identification of a Non-Uniformly Sampled Multi-Rate System in Aluminium Electrolysis Cells

Directory of Open Access Journals (Sweden)

Håkon Viumdal

2014-07-01

Full Text Available Standard system identification algorithms are usually designed to generate mathematical models with equidistant sampling instants, that are equal for both input variables and output variables. Unfortunately, real industrial data sets are often disrupted by missing samples, variations of sampling rates in the different variables (also known as multi-rate systems, and intermittent measurements. In industries with varying events based maintenance or manual operational measures, intermittent measurements are performed leading to uneven sampling rates. Such is the case with aluminium smelters, where in addition the materials fed into the cell create even more irregularity in sampling. Both measurements and feeding are mostly manually controlled. A simplified simulation of the metal level in an aluminium electrolysis cell is performed based on mass balance considerations. System identification methods based on Prediction Error Methods (PEM such as Ordinary Least Squares (OLS, and the sub-space method combined Deterministic and Stochastic system identification and Realization (DSR, and its variants are applied to the model of a single electrolysis cell as found in the aluminium smelters. Aliasing phenomena due to large sampling intervals can be crucial in avoiding unsuitable models, but with knowledge about the system dynamics, it is easier to optimize the sampling performance, and hence achieve successful models. The results based on the simulation studies of molten aluminium height in the cells using the various algorithms give results which tally well with the synthetic data sets used. System identification on a smaller data set from a real plant is also implemented in this work. Finally, some concrete suggestions are made for using these models in the smelters.

Experiences from Refurbishment of Metallography Hot Cells and Application of a New Preparation Concept for Materialography Samples

International Nuclear Information System (INIS)

Oberlander, B. C.; Espeland, M.; Solum, N. O.

2001-01-01

After more than 30 years of operation the lead shielded metallography hot cells needed a basic renewal and modernisation not least of the specimen preparation equipment. Preparation in hot cells of radioactive samples for metallography and ceramography is challenging and time consuming. It demands a special design and quality of all in-cell equipment and skill and patience from the operator. Essentials in the preparation process are: simplicity and reliability of the machines, and a good quality, reproducibility and efficiency in performance. Desirable is process automation, flexibility and an alara amounto of radioactive waste produced per sample prepared. State of the art preparation equipment for materialography seems to meet most of the demands, however, it cannot be used in hot cells without modifications. Therefore. IFE and Struers in Copenhagen modified a standard model of a Strues precision cutting machine and a microprocessor controlled grinding and polishing machine for Hot Cell application. Hot cell utilisation of the microcomputer controlled grinding and polishing machine and the existing automatic dosing equipment made the task of preparing radioactive samples more attractive. The new grinding and polishing system for hot cells provides good sample preparation quality and reproductibility at reduced preparation time and reduced amount of contaminated waste produced per sample prepared. the sample materials examined were irradiated cladding materials and fuels

A comprehensive immunoassay for the detection of microcystins in waters based on polyclonal antibodies

International Nuclear Information System (INIS)

Sheng Jianwu; He Miao; Shi Hanchang; Qian Yi

2006-01-01

Microcystins (MCs) are a group of closely related toxic cyclic heptapeptides produced by common cyanobacteria (blue-green algae), and microcystin-leucine-arginine (MC-LR) is among the most frequent and most toxic microcystin congeners. In this study, a free amino group was introduced to MC-LR at its seventh amino acid residue with 2-mercaptoethylamine, and the product aminoethyl-MC-LR was coupled to bovine serum albumin (BSA) and horseradish peroxidise (HRP) by glutaraldehyde to be complete antigen (MC-LR-BSA) and labelled hapten (MC-LR-HRP), respectively. Polyclonal antibodies against MC-LR were generated by immunization with MC-LR-BSA. A direct competitive enzyme-linked immunosorbent assay (dc-ELISA) was established to detect the MCs in waters, which showed a good cross-reactivity with MC-LR, MC-RR, MC-YR, MC-LF, MC-LW and nodularin, and have a detection limit for MC-LR 0.12 μg L -1 , the 50% inhibition concentration (IC 50 ) for MC-LR was 0.63 ± 0.06 μg L -1 and the quantitative detection range was from 0.17 to 2.32 μg L -1 , the analysis result of water samples showed good recovery and reliability. So the comprehensive and reliable dc-ELISA will well potentially suit for sensitive analysis for total MCs in drinking as well as resource water samples

Lateral root formation and the multiple roles of auxin.

Science.gov (United States)

Du, Yujuan; Scheres, Ben

2018-01-04

Root systems can display variable architectures that contribute to survival strategies of plants. The model plant Arabidopsis thaliana possesses a tap root system, in which the primary root and lateral roots (LRs) are major architectural determinants. The phytohormone auxin fulfils multiple roles throughout LR development. In this review, we summarize recent advances in our understanding of four aspects of LR formation: (i) LR positioning, which determines the spatial distribution of lateral root primordia (LRP) and LRs along primary roots; (ii) LR initiation, encompassing the activation of nuclear migration in specified lateral root founder cells (LRFCs) up to the first asymmetric cell division; (iii) LR outgrowth, the 'primordium-intrinsic' patterning of de novo organ tissues and a meristem; and (iv) LR emergence, an interaction between LRP and overlaying tissues to allow passage through cell layers. We discuss how auxin signaling, embedded in a changing developmental context, plays important roles in all four phases. In addition, we discuss how rapid progress in gene network identification and analysis, modeling, and four-dimensional imaging techniques have led to an increasingly detailed understanding of the dynamic regulatory networks that control LR development. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Genomic Sequencing of Single Microbial Cells from Environmental Samples

Energy Technology Data Exchange (ETDEWEB)

Ishoey, Thomas; Woyke, Tanja; Stepanauskas, Ramunas; Novotny, Mark; Lasken, Roger S.

2008-02-01

Recently developed techniques allow genomic DNA sequencing from single microbial cells [Lasken RS: Single-cell genomic sequencing using multiple displacement amplification, Curr Opin Microbiol 2007, 10:510-516]. Here, we focus on research strategies for putting these methods into practice in the laboratory setting. An immediate consequence of single-cell sequencing is that it provides an alternative to culturing organisms as a prerequisite for genomic sequencing. The microgram amounts of DNA required as template are amplified from a single bacterium by a method called multiple displacement amplification (MDA) avoiding the need to grow cells. The ability to sequence DNA from individual cells will likely have an immense impact on microbiology considering the vast numbers of novel organisms, which have been inaccessible unless culture-independent methods could be used. However, special approaches have been necessary to work with amplified DNA. MDA may not recover the entire genome from the single copy present in most bacteria. Also, some sequence rearrangements can occur during the DNA amplification reaction. Over the past two years many research groups have begun to use MDA, and some practical approaches to single-cell sequencing have been developed. We review the consensus that is emerging on optimum methods, reliability of amplified template, and the proper interpretation of 'composite' genomes which result from the necessity of combining data from several single-cell MDA reactions in order to complete the assembly. Preferred laboratory methods are considered on the basis of experience at several large sequencing centers where >70% of genomes are now often recovered from single cells. Methods are reviewed for preparation of bacterial fractions from environmental samples, single-cell isolation, DNA amplification by MDA, and DNA sequencing.

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

International Nuclear Information System (INIS)

Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

2005-01-01

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

Humanized CD7 nanobody-based immunotoxins exhibit promising anti-T-cell acute lymphoblastic leukemia potential

Directory of Open Access Journals (Sweden)

Yu Y

2017-03-01

Full Text Available Yuan Yu,1–3 Jialu Li,1–3 Xuejun Zhu,4 Xiaowen Tang,2,5 Yangyi Bao,6 Xiang Sun,6 Yuhui Huang,1,2 Fang Tian,4 Xiaomei Liu,1,2 Lin Yang1–3 1The Cyrus Tang Hematology Center, 2Collaborative Innovation Center of Hematology, Soochow University, 3Suzhou Cancer Immunotherapy and Diagnosis Engineering Center, Suzhou, 4Central Laboratory, Department of Hematology, The Affiliated Hospital of Nanjing University of Chinese Medicine, Jiangsu Province Hospital of Traditional Chinese Medicine, Nanjing, 5Department of Hematology, The First Affiliated Hospital of Soochow University, Suzhou, 6Department of Hematology-Oncology, The First People’s Hospital of Hefei, Hefei, People’s Republic of China Background: Nanobodies, named as VHHs (variable domain of heavy chain of HCAb [heavy-chain antibodies], are derived from heavy-chain-only antibodies that circulate in sera of camelids. Their exceptional physicochemical properties, possibility of humanization, and unique antigen recognition properties make them excellent candidates for targeted delivery of biologically active components, including immunotoxins. In our previous efforts, we have successfully generated the monovalent and bivalent CD7 nanobody-based immunotoxins, which can effectively trigger the apoptosis of CD7-positive malignant cells. To pursue the possibility of translating those immunotoxins into clinics, we humanized the nanobody sequences (designated as dhuVHH6 as well as further truncated the Pseudomonas exotoxin A (PE-derived PE38 toxin to produce a more protease-resistant form, which is named as PE-LR, by deleting majority of PE domain II. Methods and results: Three new types of immunotoxins, dhuVHH6-PE38, dVHH6-PE-LR, and dhuVHH6-PE-LR, were successfully constructed. These recombinant immunotoxins were expressed in Escherichia coli and showed that nanobody immunotoxins have the benefits of easy soluble expression in a prokaryotic expression system. Flow cytometry results revealed that

Novel diffusion cell for in vitro transdermal permeation, compatible with automated dynamic sampling

NARCIS (Netherlands)

Bosman, I.J; Lawant, A.L; Avegaart, S.R.; Ensing, K; de Zeeuw, R.A

The development of a new diffusion cell for in vitro transdermal permeation is described. The so-called Kelder cells were used in combination with the ASPEC system (Automatic Sample Preparation with Extraction Columns), which is designed for the automation of solid-phase extractions (SPE). Instead

SNC Meteorites, Organic Matter and a New Look at Viking

Science.gov (United States)

Warmflash, David M.; Clemett, Simon J.; McKay, David S.

2001-01-01

Recently, evidence has begun to grow supporting the possibility that the Viking GC-MS would not have detected certain carboxylate salts that could have been present as metastable oxidation products of high molecular weight organic species. Additionally, despite the instrument's high sensitivity, the possibility had remained that very low levels of organic matter, below the instrument's detection limit, could have been present. In fact, a recent study indicates that the degradation products of several million microorganisms per gram of soil on Mars would not have been detected by the Viking GC-MS. Since the strength of the GC-MS findings was considered enough to dismiss the biology packet, particularly the LR results, any subsequent evidence suggesting that organic molecules may in fact be present on the Martian surface necessitates a re-evaluation of the Viking LR data. In addition to an advanced mass spectrometer to look for isotopic signatures of biogenic processes, future lander missions will include the ability to detect methane produced by methanogenic bacteria, as well as techniques based on biotechnology. Meanwhile, the identification of Mars samples already present on Earth in the form of the SNC meteorites has provided us with the ability to study samples of the Martian upper crust a decade or more in advance of any planned sample return missions. While contamination issues are of serious concern, the presence of indigenous organic matter in the form of polycyclic aromatic hydrocarbons has been detected in the Martian meteorites ALH84001 and Nakhla, while there is circumstantial evidence for carbonaceous material in Chassigny. The radiochronological ages of these meteorites are 4.5 Ga, 1.3 Ga, and 165 Ma respectively representing a span of time in Earth history from the earliest single-celled organisms to the present day. Given this perspective on organic material, a biological interpretation to the Viking LR results can no longer be ruled out. In the LR

Sample to answer visualization pipeline for low-cost point-of-care blood cell counting

Science.gov (United States)

Smith, Suzanne; Naidoo, Thegaran; Davies, Emlyn; Fourie, Louis; Nxumalo, Zandile; Swart, Hein; Marais, Philip; Land, Kevin; Roux, Pieter

2015-03-01

We present a visualization pipeline from sample to answer for point-of-care blood cell counting applications. Effective and low-cost point-of-care medical diagnostic tests provide developing countries and rural communities with accessible healthcare solutions [1], and can be particularly beneficial for blood cell count tests, which are often the starting point in the process of diagnosing a patient [2]. The initial focus of this work is on total white and red blood cell counts, using a microfluidic cartridge [3] for sample processing. Analysis of the processed samples has been implemented by means of two main optical visualization systems developed in-house: 1) a fluidic operation analysis system using high speed video data to determine volumes, mixing efficiency and flow rates, and 2) a microscopy analysis system to investigate homogeneity and concentration of blood cells. Fluidic parameters were derived from the optical flow [4] as well as color-based segmentation of the different fluids using a hue-saturation-value (HSV) color space. Cell count estimates were obtained using automated microscopy analysis and were compared to a widely accepted manual method for cell counting using a hemocytometer [5]. The results using the first iteration microfluidic device [3] showed that the most simple - and thus low-cost - approach for microfluidic component implementation was not adequate as compared to techniques based on manual cell counting principles. An improved microfluidic design has been developed to incorporate enhanced mixing and metering components, which together with this work provides the foundation on which to successfully implement automated, rapid and low-cost blood cell counting tests.

Irradiating cell samples in an x-ray radiation cabinet-the effect of tube filtration

International Nuclear Information System (INIS)

Parkin, Adrian; Wright, Ian; Yates, Stuart; Goldstone, Karen E; Russell, Paul; Starr, Christy

2004-01-01

The cell irradiation cabinet described is used for creating DNA damage in cell samples in order to study tumourigenesis. The medical research laboratory involved was using the manufacturer's quoted dose rate (32.2 mGy s -1 ) to determine the required exposure time to impart a dose of 10 Gy. The x-ray output was investigated when the exposure failed to produce cell cycle arrest. The x-ray tube was fitted with only a 0.76 mm beryllium filter, and the spectrum therefore contained a high proportion of low energy photons which were being removed by the polystyrene sample flask as demonstrated by dose measurements in air and through the sample flask. Incorporation of a 0.5 mm aluminium filter removed most of these low energy photons but greatly reduced the dose rate to 3.8 mGy s -1 . The manufacturer's quoted dose rates from a lightly filtered tube are misleading: the contribution of the very low energy component of the spectrum to the dose is not relevant since it will be removed by a sample flask. (note)

Simultaneous isolation of mRNA and native protein from minute samples of cells

DEFF Research Database (Denmark)

Petersen, Tonny Studsgaard; Andersen, Claus Yding

2014-01-01

Precious biological samples often lack a sufficient number of cells for multiple procedures, such as extraction of mRNA while maintaining protein in a non-denatured state suitable for subsequent characterization. Here we present a new method for the simultaneous purification of mRNA and native...... in their native state for traditional protein assays. We validated the procedure using neonatal rat ovaries and small numbers of human granulosa cells, demonstrating the extraction of mRNA suitable for gene expression analysis with simultaneous isolation of native proteins suitable for downstream characterization...... proteins from samples containing small numbers of cells. Our approach utilizes oligodeoxythymidylate [oligo(dT)25]-coated paramagnetic beads in an optimized reaction buffer to isolate mRNA comparable in quantity and quality to mRNA isolated with existing methods, while maintaining the proteins...

Breast Cancer Cells in Three-dimensional Culture Display an Enhanced Radioresponse after Coordinate Targeting of Integrin ?5?1 and Fibronectin

Energy Technology Data Exchange (ETDEWEB)

Nam, Jin-Min; Onodera, Yasuhito; Bissell, Mina J; Park, Catherine C

2010-04-07

Tactics to selectively enhance cancer radioresponse are of great interest. Cancer cells actively elaborate and remodel their extracellular matrix (ECM) to aid in survival and progression. Previous work has shown that {beta}1-integrin inhibitory antibodies can enhance the growth-inhibitory and apoptotic responses of human breast cancer cell lines to ionizing radiation, either when cells are cultured in three-dimensional laminin-rich ECM (3D lrECM) or grown as xenografts in mice. Here, we show that a specific {alpha} heterodimer of {beta}1-integrin preferentially mediates a prosurvival signal in human breast cancer cells that can be specifically targeted for therapy. 3D lrECM culture conditions were used to compare {alpha}-integrin heterodimer expression in malignant and nonmalignant cell lines. Under these conditions, we found that expression of {alpha}5{beta}1-integrin was upregulated in malignant cells compared with nonmalignant breast cells. Similarly, we found that normal and oncofetal splice variants of fibronectin, the primary ECM ligand of {alpha}5{beta}1-integrin, were also strikingly upregulated in malignant cell lines compared with nonmalignant acini. Cell treatment with a peptide that disrupts the interactions of {alpha}5{beta}1-integrin with fibronectin promoted apoptosis in malignant cells and further heightened the apoptotic effects of radiation. In support of these results, an analysis of gene expression array data from breast cancer patients revealed an association of high levels of {alpha}5-integrin expression with decreased survival. Our findings offer preclinical validation of fibronectin and {alpha}5{beta}1-integrin as targets for breast cancer therapy.

EXPANSINA17 up-regulated by LBD18/ASL20 promotes lateral root formation during the auxin response.

Science.gov (United States)

Lee, Han Woo; Kim, Jungmook

2013-10-01

Expansins are non-hydrolytic cell wall-loosening proteins involved in a variety of plant developmental processes during which cell wall modification occurs. Cell wall remodeling proteins including expansins have been suggested to be involved in cell separation to facilitate the emergence of lateral roots (LRs) through the overlaying tissues of the primary root. LBD18/ASL20 activates EXPANSINA14 (EXPA14) expression by directly binding to the EXPA14 promoter to enhance LR emergence in Arabidopsis thaliana. Here we show that EXPA17 is another target gene regulated by LBD18 to promote LR formation in Arabidopsis. We showed that nuclear translocation of the LBD18:GR fusion protein expressed under the Cauliflower mosaic virus (CaMV) 35S promoter or under the LBD18 promoter by dexamethasone treatment results in an increase in EXPA17 transcript levels. β-Glucuronidase (GUS) expression under the EXPA17 promoter, which is detected only in the roots of the wild type, was reduced in the LR primordium and overlaying tissues in an lbd18 mutant background. The number of emerged LRs of the EXPA17 RNAi (RNA interference) Arabidopsis lines was significantly lower than that of the wild type. Overexpression of EXPA17 in Arabidopsis increased the density of emerged LRs in the presence of auxin compared with the wild type. LR induction experiments with a gravitropic stimulus showed that LR emergence is delayed in the EXPA17 RNAi plants compared with the wild type. In addition, EXPA4 expression was also detected in overlaying tissues of the LR primordium and was inducible by LBD18. Taken together, these results support the notion that LBD18 up-regulates a subset of EXP genes to enhance cell separation to promote LR emergence in Arabidopsis.

Expression of T helper cell-associated inflammatory mediator mRNAs in cells of bronchoalveolar lavage fluid samples and oxygen concentration in arterial blood samples from healthy horses exposed to hyperbaric oxygen.

Science.gov (United States)

Looijen, Maty G P; New, Dallas J; Fischer, Carrie D; Dardari, Rkia; Irwin, Karyn M; Berezowski, Christopher J; Bond, Stephanie L; Léguillette, Renaud

2016-10-01

OBJECTIVE To evaluate the mRNA expression of T helper (Th)1, Th2, and Th17 cell-associated inflammatory mediators in cells of bronchoalveolar lavage fluid samples collected from healthy horses exposed to hyperbaric oxygen (HBO) and to monitor blood oxygen concentration during and following HBO therapy. ANIMALS 8 healthy horses. PROCEDURES In a randomized controlled crossover design study, each horse was exposed (beginning day 1) to 100% oxygen at a maximum of 3 atmospheres absolute (304 kPa) daily for 10 days or ambient air at atmospheric pressure in the HBO chamber for an equivalent amount of time (control). Bronchoalveolar lavage fluid samples were collected on days 0 and 10. After validation of candidate reference genes, relative mRNA expressions of various innate inflammatory, Th1 cell-derived, Th2 cell-derived (including eotaxin-2), Th17 cell-derived, and regulatory cytokines were measured by quantitative PCR assays. For 3 horses, arterial blood samples were collected for blood gas analysis during a separate HBO session. RESULTS The optimal combination of reference genes was glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine ribosyltransferase, and ribosomal protein L32. Compared with day 0 findings, expression of eotaxin-2 mRNA was significantly lower (0.12-fold reduction) and the percentage of neutrophils in bronchoalveolar lavage fluid samples was significantly lower on day 10 when horses received HBO therapy. Values of Pao2 rapidly increased (> 800 mm Hg) but immediately decreased to pretreatment values when HBO sessions ended. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that HBO therapy does not increase mRNA expression of inflammatory cytokines, but reduces eotaxin-2 mRNA transcription. The Pao2 increase was transient with no cumulative effects of HBO.

Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

Science.gov (United States)

Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

2017-09-01

Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

Directory of Open Access Journals (Sweden)

Jeong Byung-Hoon

2011-08-01

Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

The contribution of cell blocks in the diagnosis of mediastinal masses and hilar adenopathy samples from echobronchoscopy.

Science.gov (United States)

Lourido-Cebreiro, Tamara; Leiro-Fernández, Virginia; Tardio-Baiges, Antoni; Botana-Rial, Maribel; Núñez-Delgado, Manuel; Álvarez-Martín, M Jesús; Fernández-Villar, Alberto

2014-07-01

Cell block material from puncture can be obtained with endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) in many cases. The aim of this study was to analyse the value of additional information from cell blocks obtained with EBUS-TBNA samples from mediastinal and hilar lymph nodes and masses. Review of pathology reports with a specific diagnosis obtained from EBUS-TBNA samples of mediastinal or hilar lesions, prospectively obtained over a two-year period. The generation of cell blocks from cytology needle samples, the contribution to morphological diagnosis, and the possible use of samples for immunohistochemistry were analysed. One hundred and twenty-nine samples corresponding to 110 patients were reviewed. The diagnosis was lung cancer in 81% of cases, extrapulmonary carcinoma in 10%, sarcoidosis in 4%, lymphoma in 2.7%, and tuberculosis in 0.9%. Cell blocks could be obtained in 72% of cases. Immunohistochemistry studies on the cell blocks were significantly easier to perform than on conventional smears (52.6% vs. 14%, P<.0001). In 4cases, the cell block provided an exclusive morphological diagnosis (3sarcoidosis and one metastasis from prostatic carcinoma) and in 3carcinomas, subtype and origin could be identified. Exclusive diagnoses from the cell block were significantly more frequent in benign disease than in malignant disease (25% vs 0.9%, P=.002). Cell blocks were obtained from 72% of EBUS-TBNA diagnostic procedures. The main contributions of cell blocks to pathology examinations were the possibility of carrying out immunohistochemical staining for the better classification of neoplasms, especially extrapulmonary metastatic tumours, and the improved diagnosis of benign lesions. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

77 FR 3191 - Rules of Practice

Science.gov (United States)

2012-01-23

... would encompass all types of documentary material sought by the Commission, the revisions would better... staff's authority to inspect, copy, or sample documentary material--including electronic media--to... Case Management and Discovery); N.D. Ohio LR 30.1(b); D. Or. LR 30-5; D. Wyo. LR 30 (Depositions Upon...

SEM/TIMS analysis trials on hotswipe samples taken from a shielded cell at Harwell

International Nuclear Information System (INIS)

Tushingham, J.; Vatter, I.; Cooke, R.

1998-09-01

The IAEA require advanced techniques and procedures for the detection of traces of actinides to be applied to their environmental sampling programme for nuclear safeguards as a means to detect undeclared activities. 'Swipe' samples taken from within nuclear facilities by IAEA inspectors require analysis to determine their actinide content and composition by bulk and particle measurements. The use of analytical equipment capable of analysing individual particles, particularly of actinides, is essential to optimise the IAEA's aim to monitor Member State's nuclear activities more proficiently. A trial has been undertaken at the Harwell Laboratory of AEA Technology to establish the efficacy of scanning electron microscopy (SEM) and thermal ionisation mass spectrometry (TIMS) for the particle and bulk characterisation, respectively, of actinides on samples taken from within a shielded cell. These measurements were supported by γ-spectrometry and α-spectrometry. 'Hotswipe' samples taken from within a shielded cell with a well-known recent history have been prepared for particle and bulk analysis. SEM has been used to characterise individual particles from the swipe samples and the results have been related to known cell activities. Samples were prepared for SEM using a simple procedure to minimise the potential for sample contamination. The method proved to be capable of identifying 1 μm particles that contained U, Pu, Pa and Np. The measurement of U/Pu ratios was limited to particles that contained >2% Pu in U by weight. TIMS, together with alpha spectrometry, has been used to determine the bulk actinide composition of the samples whilst gamma spectrometry has been used to determine the fission product composition. Further work to improve the potential of SEM, and also secondary ionisation mass spectrometry (SIMS), for the measurement of hotswipe samples has been proposed. (author)

[Susceptibility of induced sickle in samples of heterozygous hemoglobin S patients (sickle cell trait) suffering diabetes mellitus type 2].

Science.gov (United States)

Díaz-Piedra, Pablo; Cervantes-Villagrana, Alberto Rafael; Ramos-Jiménez, Raúl; Presno-Bernal, José Miguel; Cervantes-Villagrana, Rodolfo Daniel

2015-01-01

Hemoglobin S is an abnormal protein that induces morphological changes in erythrocyte in low-oxygen conditions. In Mexico, it is reported that up to 13.7% of the population with mutation in one allele are considered asymptomatic (sickle cell trait). The sickle cell trait and diabetes mellitus are conditions that occur together in more than one million patients worldwide. Both diseases possibly produce microvascular changes in retinopathy and acute chest syndrome. The aim of this study was to evaluate the induction of sickle cells in samples of diabetic patients with sickle cell trait to identify altered red cell parameters. We obtained samples of diabetic patients to determine hemoglobin A1c and S; furthermore, red blood cell biometrics data were analyzed. We found that older men with diabetes were susceptible to generate sickle cells and this correlated with reduced red blood cell count and an increase in media cell volume. In samples of women diabetes, there were no differences. We conclude that samples from patients with sickle cell trait and diabetes can cause sickle cells with high frequency in men, with lower red blood cells count and increased mean corpuscular volume as susceptibility parameters.

Screening disrupted molecular functions and pathways associated with clear cell renal cell carcinoma using Gibbs sampling.

Science.gov (United States)

Nan, Ning; Chen, Qi; Wang, Yu; Zhai, Xu; Yang, Chuan-Ce; Cao, Bin; Chong, Tie

2017-10-01

To explore the disturbed molecular functions and pathways in clear cell renal cell carcinoma (ccRCC) using Gibbs sampling. Gene expression data of ccRCC samples and adjacent non-tumor renal tissues were recruited from public available database. Then, molecular functions of expression changed genes in ccRCC were classed to Gene Ontology (GO) project, and these molecular functions were converted into Markov chains. Markov chain Monte Carlo (MCMC) algorithm was implemented to perform posterior inference and identify probability distributions of molecular functions in Gibbs sampling. Differentially expressed molecular functions were selected under posterior value more than 0.95, and genes with the appeared times in differentially expressed molecular functions ≥5 were defined as pivotal genes. Functional analysis was employed to explore the pathways of pivotal genes and their strongly co-regulated genes. In this work, we obtained 396 molecular functions, and 13 of them were differentially expressed. Oxidoreductase activity showed the highest posterior value. Gene composition analysis identified 79 pivotal genes, and survival analysis indicated that these pivotal genes could be used as a strong independent predictor of poor prognosis in patients with ccRCC. Pathway analysis identified one pivotal pathway - oxidative phosphorylation. We identified the differentially expressed molecular functions and pivotal pathway in ccRCC using Gibbs sampling. The results could be considered as potential signatures for early detection and therapy of ccRCC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

Directory of Open Access Journals (Sweden)

Augusto Etchegaray

2010-01-01

Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

RANdom SAmple Consensus (RANSAC) algorithm for material-informatics: application to photovoltaic solar cells.

Science.gov (United States)

Kaspi, Omer; Yosipof, Abraham; Senderowitz, Hanoch

2017-06-06

An important aspect of chemoinformatics and material-informatics is the usage of machine learning algorithms to build Quantitative Structure Activity Relationship (QSAR) models. The RANdom SAmple Consensus (RANSAC) algorithm is a predictive modeling tool widely used in the image processing field for cleaning datasets from noise. RANSAC could be used as a "one stop shop" algorithm for developing and validating QSAR models, performing outlier removal, descriptors selection, model development and predictions for test set samples using applicability domain. For "future" predictions (i.e., for samples not included in the original test set) RANSAC provides a statistical estimate for the probability of obtaining reliable predictions, i.e., predictions within a pre-defined number of standard deviations from the true values. In this work we describe the first application of RNASAC in material informatics, focusing on the analysis of solar cells. We demonstrate that for three datasets representing different metal oxide (MO) based solar cell libraries RANSAC-derived models select descriptors previously shown to correlate with key photovoltaic properties and lead to good predictive statistics for these properties. These models were subsequently used to predict the properties of virtual solar cells libraries highlighting interesting dependencies of PV properties on MO compositions.

Large-scale prospective T cell function assays in shipped, unfrozen blood samples: experiences from the multicenter TRIGR trial.

Science.gov (United States)

Hadley, David; Cheung, Roy K; Becker, Dorothy J; Girgis, Rose; Palmer, Jerry P; Cuthbertson, David; Krischer, Jeffrey P; Dosch, Hans-Michael

2014-02-01

Broad consensus assigns T lymphocytes fundamental roles in inflammatory, infectious, and autoimmune diseases. However, clinical investigations have lacked fully characterized and validated procedures, equivalent to those of widely practiced biochemical tests with established clinical roles, for measuring core T cell functions. The Trial to Reduce Insulin-dependent diabetes mellitus in the Genetically at Risk (TRIGR) type 1 diabetes prevention trial used consecutive measurements of T cell proliferative responses in prospectively collected fresh heparinized blood samples shipped by courier within North America. In this article, we report on the quality control implications of this simple and pragmatic shipping practice and the interpretation of positive- and negative-control analytes in our assay. We used polyclonal and postvaccination responses in 4,919 samples to analyze the development of T cell immunocompetence. We have found that the vast majority of the samples were viable up to 3 days from the blood draw, yet meaningful responses were found in a proportion of those with longer travel times. Furthermore, the shipping time of uncooled samples significantly decreased both the viabilities of the samples and the unstimulated cell counts in the viable samples. Also, subject age was significantly associated with the number of unstimulated cells and T cell proliferation to positive activators. Finally, we observed a pattern of statistically significant increases in T cell responses to tetanus toxin around the timing of infant vaccinations. This assay platform and shipping protocol satisfy the criteria for robust and reproducible long-term measurements of human T cell function, comparable to those of established blood biochemical tests. We present a stable technology for prospective disease-relevant T cell analysis in immunological diseases, vaccination medicine, and measurement of herd immunity.

Occurrence of Toxic Cyanobacterial Blooms in Rio de la Plata Estuary, Argentina: Field Study and Data Analysis

Science.gov (United States)

Giannuzzi, L.; Carvajal, G.; Corradini, M. G.; Araujo Andrade, C.; Echenique, R.; Andrinolo, D.

2012-01-01

Water samples were collected during 3 years (2004–2007) at three sampling sites in the Rio de la Plata estuary. Thirteen biological, physical, and chemical parameters were determined on the water samples. The presence of microcystin-LR in the reservoir samples, and also in domestic water samples, was confirmed and quantified. Microcystin-LR concentration ranged between 0.02 and 8.6 μg.L−1. Principal components analysis was used to identify the factors promoting cyanobacteria growth. The proliferation of cyanobacteria was accompanied by the presence of high total and fecal coliforms bacteria (>1500 MNP/100 mL), temperature ≥25°C, and total phosphorus content ≥1.24 mg·L−1. The observed fluctuating patterns of Microcystis aeruginosa, total coliforms, and Microcystin-LR were also described by probabilistic models based on the log-normal and extreme value distributions. The sampling sites were compared in terms of the distribution parameters and the probability of observing high concentrations for Microcystis aeruginosa, total coliforms, and microcystin-LR concentration. PMID:22523486

Efficacy and mechanism of action of Proellex, an antiprogestin in aromatase overexpressing and Letrozole resistant T47D breast cancer cells.

Science.gov (United States)

Gupta, Akash; Mehta, Rajeshwari; Alimirah, Fatouma; Peng, Xinjian; Murillo, Genoveva; Wiehle, Ronald; Mehta, Rajendra G

2013-01-01

Aromatase inhibitors (AI) are considered as a first line therapy for ER+PR+ breast cancers. However, many patients acquire resistance to AI. In this study, we determined the response of antiprogestin CDB-4124 (Proellex) on the aromatase overexpressing and Letrozole resistant cell lines and also studies its mechanism of action in inhibition of breast cancer cell proliferation. For these studies we generated aromatase overexpressing T47D (T47Darom) and respective control (T47Dcon) breast cancer cell lines by stable transfection with plasmid containing CYP19A1 gene, or empty vector respectively. Letrozole resistant cell line (T47DaromLR) was generated by incubating T47Darom for 75 weeks in the presence of 10 μM Letrozole. Cell proliferation was determined by MTT or crystal violet assays. Gene expressions were quantified by QRT-PCR whereas proteins were identified by western blot analyses, flow cytometry and immunofluorescence staining. Aromatase activity was determined by estradiol ELISA. The effects of Proellex on the anchorage independent growth were measured by soft agar colony formation. Statistical differences between the various groups were determined by Student's 't' test or ANOVA followed by Bonferroni's post hoc test. Results showed that T47Darom and T47DaromLR cell lines had significantly higher aromatase expression (mRNA; 80-90 fold and protein) and as a result exhibited increased aromatization of testosterone to estradiol as compared to T47Dcon. Both these cell lines showed enhanced growth in the presence of Testosterone (50-60%). In T47DaromLR cells increased PR-B and EGFR expression as compared to T47Dcon cells was observed. Proellex and other known aromatase inhibitors (Letrozole, Anastrozole, and Exemestane) inhibited testosterone induced cell proliferation and anchorage independent growth of T47Darom cells. Cell growth inhibition was significantly greater when cells were treated with Proellex alone or in combination with other AIs as compared to AIs

Determination of blood cell subtype concentrations from frozen whole blood samples using TruCount beads.

Science.gov (United States)

Langenskiöld, Cecilia; Mellgren, Karin; Abrahamsson, Jonas; Bemark, Mats

2016-06-24

In many studies it would be advantageous if blood samples could be collected and analyzed using flow cytometry at a later stage. Ideally, sample collection should involve little hands-on time, allow for long-term storage, and minimally influence the samples. Here we establish a flow cytometry antibody panel that can be used to determine granulocytes, monocytes, and lymphocyte subset concentrations in fresh and frozen whole blood using TruCount technology. The panel can be used on fresh whole-blood samples as well as whole-blood samples that have been frozen after mixing with 10% DMSO. Concentrations in frozen and fresh sample is highly correlated both when frozen within 4 h and the day after collection (r ≥ 0.98), and the estimated concentration in frozen samples was between 91 and 94% of that in fresh samples for all cell types. Using this method whole-blood samples can be frozen using a simple preparation method, and stored long-term before accurate determination of cell concentration. This allows for standardized analysis of the samples at a reference laboratory in multi-center studies. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Paracrine effects of oocyte secreted factors and stem cell factor on porcine granulosa and theca cells in vitro

Directory of Open Access Journals (Sweden)

Webb Bob

2003-08-01

Full Text Available Abstract Oocyte control of granulosa and theca cell function may be mediated by several growth factors via a local feedback loop(s between these cell types. This study examined both the role of oocyte-secreted factors on granulosa and thecal cells, cultured independently and in co-culture, and the effect of stem cell factor (SCF; a granulosa cell derived peptide that appears to have multiple roles in follicle development. Granulosa and theca cells were isolated from 2–6 mm healthy follicles of mature porcine ovaries and cultured under serum-free conditions, supplemented with: 100 ng/ml LR3 IGF-1, 10 ng/ml insulin, 100 ng/ml testosterone, 0–10 ng/ml SCF, 1 ng/ml FSH (granulosa, 0.01 ng/ml LH (theca or 1 ng/ml FSH and 0.01 ng/ml LH (co-culture and with/without oocyte conditioned medium (OCM or 5 oocytes. Cells were cultured in 96 well plates for 144 h, after which viable cell numbers were determined. Medium was replaced every 48 h and spent medium analysed for steroids. Oocyte secreted factors were shown to stimulate both granulosa cell proliferation (P

Measurement of radon exhalation rate in various building materials and soil samples

Science.gov (United States)

Bala, Pankaj; Kumar, Vinod; Mehra, Rohit

2017-03-01

Indoor radon is considered as one of the potential dangerous radioactive elements. Common building materials and soil are the major source of this radon gas in the indoor environment. In the present study, the measurement of radon exhalation rate in the soil and building material samples of Una and Hamirpur districts of Himachal Pradesh has been done with solid state alpha track detectors, LR-115 type-II plastic track detectors. The radon exhalation rate for the soil samples varies from 39.1 to 91.2 mBq kg-1 h-1 with a mean value 59.7 mBq kg-1 h-1. Also the radium concentration of the studied area is found and it varies from 30.6 to 51.9 Bq kg-1 with a mean value 41.6 Bq kg-1. The exhalation rate for the building material samples varies from 40.72 (sandstone) to 81.40 mBq kg-1 h-1 (granite) with a mean value of 59.94 mBq kg-1 h-1.

Radon exhalation rates from slate stone samples in Aravali Range in Haryana

International Nuclear Information System (INIS)

Upadhyay, S.B.; Kant, K.; Chakarvarti, S.K.

2012-01-01

The slate stone tiles are very popular in covering the walls of the rooms. Radon is released into ambient air from slate stones due to ubiquitous uranium and radium in them, thus increasing the airborne radon concentration. The radioactivity in slates stones is related to radioactivity in the rocks from which the slate stone tiles are formed. In the present investigation, the radon emanated from slate stone samples collected from different slate mines in Aravali range of hills in the Haryana state of Northern India has been estimated. For the measurement of radon concentration emanated from these samples, alpha-sensitive LR-115 type II plastic track detectors have been used. The alpha particles emitted from the radon form tracks in these detectors. After chemical etching the track density of registered tracks is used to calculate radon concentration and exhalation rates of radon using required formulae. The measurements indicate normal to some higher levels of radon concentration emanated from the slat stone samples collected from Aravali range of hills in north India. The results will be discussed in full paper. (author)

Prevalence study of HPV mixed infections in Italian HIV positive women

Directory of Open Access Journals (Sweden)

Anna Rosa Garbuglia

2010-06-01

Full Text Available Introduction: HIV positive women, show a higher frequency of multiple HPV infections than HIV negative.The immune response seems to be genotype-specific, but evidence on different genotypes distribution and involvement of coinfections in the development of invasive cervix cancer (ICC remains limited. The aim of our study was to assess the prevalence of multiple infections in a group of Italian HIV positive women, the distribution of High risk (HR strains and Low Risk (LR strains in multiple and single infections, and their correlation with immune status and cervical lesions. Methods: 553 women were considered in the study. HPV search was performed with MY09-MY11 primers. HPV positive samples were typed with the Clinical Genomic array (HPV test (Genomica, Spain. Results: 244 samples were HPV positive (44.1%.129/244 (52.9% had a single infection and 103/244 (42.2% multiple infections.Among the 412 performed typing, 223 (54.1% were HR strains, while 189 (45.9% were LR strains.The HPV61 (40 times was more frequent among the LR strains.Among HR strains, the most frequently observed was the HPV16 (30 times. In 92% of multiple infections, at least one HR strain was found. 36% of LR strains was presented in single infections compared to 27% of HR strains (p = 0.06. The clades A3 (n = 124, 65.3% multiple infections and A10 (n = 37, 56.8% multiple infections were the most represented in LR;A9 (n = 95, 67.4% multiple infections and A6 (n = 57, 70.2% clades were the most representative among HR strains. Differences in age between women with single infection and those with multiple infection were not observed (p = 0.33 .Women with the best immune status (CD4 cell count of >500 cell/ mm3 showed a higher prevalence of single infection. HPV was positive in 75% of ASCUS/LSIL lesion and 77.3% of H-SIL. Conclusions: HPV-16 is the most frequent in both single and multiple infections as reported in a recent study about HIV negative women. Follow-up studies are

Artificial neural network model of survival in patients treated with irradiation with and without concurrent chemotherapy for advanced carcinoma of the head and neck

International Nuclear Information System (INIS)

Bryce, Thomas J.; Dewhirst, Mark W.; Floyd, Carey E.; Hars, Vera; Brizel, David M.

1998-01-01

Purpose: This study was performed to investigate the feasibility of predicting survival in squamous cell carcinoma of the head and neck (SCCHN) with an artificial neural network (ANN), and to compare ANN performance with conventional models. Methods and Materials: Data were analyzed from a Phase III trial in which patients with locally advanced SCCHN received hyperfractionated irradiation with or without concurrent cisplatin and 5-fluorouracil. Of the 116 randomized patients, 95 who had 2-year follow-up and all required data were evaluated. ANN and logistic regression (LR) models were constructed to predict 2-year total survival using round-robin cross-validation. A modified staging model was also examined. Results: The best LR model used tumor size, nodal stage, and race to predict survival. The best ANN used nodal stage, tumor size, stage, and resectability, and hemoglobin. Treatment type did not predict 2-year survival and was not included in either model. Using the respective best feature sets, the area under the receiver operating characteristic curve (A z ) for the ANN was 0.78 ± 0.05, showing more accurate overall performance than LR (A z = 0.67 ± 0.05, p = 0.07). At 70% sensitivity, the ANN was 72% specific, while LR was 54% specific (p = 0.08). At 70% specificity, the ANN was 72% sensitive, while LR was 54% sensitive (p = 0.07). When both models used the five predictive variables best for an ANN, A z for LR decreased [A z = 0.61 ± 0.06, p z = 0.60 ± 0.07, p = 0.02 (ANN)]. Conclusions: An ANN modeled 2-year survival in this data set more accurately than LR or staging models and employed predictive variables that could not be used by LR. Further work is planned to confirm these results on larger patient samples, examining longer follow-up to incorporate treatment type into the model

Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

International Nuclear Information System (INIS)

Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

2015-01-01

Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

Oxygen partial pressure modulates 67-kDa laminin receptor expression, leading to altered activity of the green tea polyphenol, EGCG.

Science.gov (United States)

Tsukamoto, Shuntaro; Yamashita, Shuya; Kim, Yoon Hee; Kumazoe, Motofumi; Huang, Yuhui; Yamada, Koji; Tachibana, Hirofumi

2012-09-21

(-)-Epigallocatechin-3-O-gallate (EGCG) exhibits anti-tumor activity mediated via the 67-kDa laminin receptor (67LR). In this study, we found that 67LR protein levels are reduced by exposure to low O(2) levels (5%), without affecting the expression of HIF-1α. We also found that EGCG-induced anti-cancer activity is abrogated under low O(2) levels (5%) in various cancer cells. Notably, treatment with the proteasome inhibitor, prevented down-regulation of 67LR and restored sensitivity to EGCG under 5% O(2). In summary, 67LR expression is highly sensitive to O(2) partial pressure, and the activity of EGCG can be regulated in cancer cells by O(2) partial pressure. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

International Nuclear Information System (INIS)

Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

2016-01-01

Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

The Antiproliferative Activity of Sclerotia of Lignosus rhinocerus (Tiger Milk Mushroom

Directory of Open Access Journals (Sweden)

M. L. Lee

2012-01-01

Full Text Available Lignosus rhinocerus, the tiger milk mushroom, is one of the most important medicinal mushrooms used by the indigenous people of Southeast Asia and China. It has been used to treat breast cancer. A cold water extract (LR-CW prepared from the sclerotia of L. rhinocerus cultivar was found to exhibit antiproliferative activity against human breast carcinoma (MCF-7 and human lung carcinoma (A549, with IC50 of 96.7 μg/mL and 466.7 μg/mL, respectively. In comparison, LR-CW did not show significant cytotoxicity against the two corresponding human normal cells, 184B5 (human breast cell and NL 20 (human lung cell. DNA fragmentation studies suggested that the cytotoxic action of LR-CW against cancer cells is mediated by apoptosis. Sephadex G-50 gel filtration fractionation of LR-CW yielded a high-molecular-weight and a low-molecular-weight fraction. The high-molecular-weight fraction contains mainly carbohydrate (68.7% and small amount of protein (3.6%, whereas the low-molecular-weight fraction contains 31% carbohydrate and was devoid of protein. Only the high-molecular-weight fraction exhibited antiproliferative activity against cancer cells, with IC50 of 70.0 μg/mL and 76.7 μg/mL, respectively. Thus, the cytotoxic action of the LR-CW is due to the high-molecular-weight fraction, either the proteins or protein-carbohydrate complex.

Sample cell for powder x-ray diffraction at up to 500 bars and 200 deg. C

International Nuclear Information System (INIS)

Jupe, Andrew C.; Wilkinson, Angus P.

2006-01-01

A low cost sample cell for powder diffraction at high pressure and temperature that employs either sapphire or steel pressure tubes is described. The cell can be assembled rapidly, facilitating the study of chemically reacting systems, and it provides good control of both pressure and temperature in a regimen where diamond anvil cells and multianvil apparatus cannot be used. The design provides a relatively large sample volume making it suitable for the study of quite large grain size materials, such as hydrating cement slurries. However, relatively high energy x rays are needed to penetrate the pressure tube

A fresh frozen plasma to red blood cell transfusion ratio of 1:1 mitigates lung injury in a rat model of damage control resuscitation for hemorrhagic shock.

Science.gov (United States)

Zhao, Jingxiang; Pan, Guocheng; Wang, Bo; Zhang, Yuhua; You, Guoxing; Wang, Ying; Gao, Dawei; Zhou, Hong; Zhao, Lian

2015-06-01

We aimed to evaluate the effects of resuscitation with different ratios of fresh frozen plasma (FFP) to red blood cells (RBCs) on pulmonary inflammatory injury and to illuminate the beneficial effects of FFP on lung protection compared with lactated ringers (LR) using a rat model of hemorrhagic shock. Rats underwent pressure-controlled hemorrhage for 60 minutes and were then transfused with LR for initial resuscitation. Thereafter, the rats were transfused with varying ratios of FFP:RBC (1:4, 1:2, 1:1, and 2:1) or LR:RBC (1:1) to hold their mean arterial pressure (MAP) at 100 ± 3 mm Hg for 30 minutes. After 4 hours of observation, lung tissue was harvested to determine the wet/dry weight, myeloperoxidase levels, tumor necrosis factor α levels, macrophage inflammatory protein 2 (MIP-2) levels, inducible nitric oxide synthase activity, and the nuclear factor κB p65 DNA-binding activity. With an increase in the FFP:RBC ratio, the volume of required RBC to maintain the target MAP decreased. The MAP value in each group was not significantly different during the whole experiment period. The values of the wet/dry weights and MIP-2 were significantly lower in the FFP:RBC = 1:1 group than the other groups (P ratio of FFP to RBC results in decreased lung inflammation. Compared with LR, FFP could further mitigate lung inflammatory injury. Copyright © 2015. Published by Elsevier Inc.

The outcome of dimethylglyoxime testing in a sample of cell phones in Denmark

DEFF Research Database (Denmark)

Thyssen, Jacob Pontoppidan; Johansen, Jeanne D; Zachariae, Claus

2008-01-01

BACKGROUND: Nickel dermatitis may be caused by frequent and prolonged use of cell phones. Because little is known about the frequency of nickel release from cell phones, it is difficult to estimate the risk of nickel sensitization and dermatitis among their users. OBJECTIVE: Inspired by a recent...... case of nickel dermatitis from prolonged cell phone use, the frequency of dimethylglyoxime (DMG)-positive cell phones on the Danish market was investigated. METHODS: Five major cell phone companies were contacted. Two were visited, and the DMG test was performed on a sample of their products. RESULTS...... phones from the Danish market. Prolonged use of cell phones may in some cases fulfil the criteria for items included in the European Union Nickel Directive. We believe that this new cause of nickel dermatitis should be carefully followed and that regulatory steps may be necessary....

The outcome of dimethylglyoxime testing in a sample of cell phones in Denmark

DEFF Research Database (Denmark)

Thyssen, J.P.; Johansen, J.D.; Zachariae, C.

2008-01-01

Background: Nickel dermatitis may be caused by frequent and prolonged use of cell phones. Because little is known about the frequency of nickel release from cell phones, it is difficult to estimate the risk of nickel sensitization and dermatitis among their users. Objective: Inspired by a recent...... case of nickel dermatitis from prolonged cell phone use, the frequency of dimethylglyoxime (DMG)-positive cell phones on the Danish market was investigated. Methods: Five major cell phone companies were contacted. Two were visited, and the DMG test was performed on a sample of their products. Results...... phones from the Danish market. Prolonged use of cell phones may in some cases fulfil the criteria for items included in the European Union Nickel Directive. We believe that this new cause of nickel dermatitis should be carefully followed and that regulatory steps may be necessary Udgivelsesdato: 2008...

Identification of immune cell infiltration in hematoxylin-eosin stained breast cancer samples: texture-based classification of tissue morphologies

Science.gov (United States)

Turkki, Riku; Linder, Nina; Kovanen, Panu E.; Pellinen, Teijo; Lundin, Johan

2016-03-01

The characteristics of immune cells in the tumor microenvironment of breast cancer capture clinically important information. Despite the heterogeneity of tumor-infiltrating immune cells, it has been shown that the degree of infiltration assessed by visual evaluation of hematoxylin-eosin (H and E) stained samples has prognostic and possibly predictive value. However, quantification of the infiltration in H and E-stained tissue samples is currently dependent on visual scoring by an expert. Computer vision enables automated characterization of the components of the tumor microenvironment, and texture-based methods have successfully been used to discriminate between different tissue morphologies and cell phenotypes. In this study, we evaluate whether local binary pattern texture features with superpixel segmentation and classification with support vector machine can be utilized to identify immune cell infiltration in H and E-stained breast cancer samples. Guided with the pan-leukocyte CD45 marker, we annotated training and test sets from 20 primary breast cancer samples. In the training set of arbitrary sized image regions (n=1,116) a 3-fold cross-validation resulted in 98% accuracy and an area under the receiver-operating characteristic curve (AUC) of 0.98 to discriminate between immune cell -rich and - poor areas. In the test set (n=204), we achieved an accuracy of 96% and AUC of 0.99 to label cropped tissue regions correctly into immune cell -rich and -poor categories. The obtained results demonstrate strong discrimination between immune cell -rich and -poor tissue morphologies. The proposed method can provide a quantitative measurement of the degree of immune cell infiltration and applied to digitally scanned H and E-stained breast cancer samples for diagnostic purposes.

Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

International Nuclear Information System (INIS)

Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

1991-01-01

The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

Characteristics of HIV target CD4 T cells collected using different sampling methods from the genital tract of HIV seronegative women.

Science.gov (United States)

Iyer, Smita S; Sabula, Michael J; Mehta, C Christina; Haddad, Lisa B; Brown, Nakita L; Amara, Rama R; Ofotokun, Igho; Sheth, Anandi N

2017-01-01

Understanding the immune profile of CD4 T cells, the primary targets for HIV, in the female genital tract (FGT) is critical for evaluating and developing effective biomedical HIV prevention strategies in women. However, longitudinal investigation of HIV susceptibility markers expressed by FGT CD4 T cells has been hindered by low cellular yield and risk of sampling-associated trauma. We investigated three minimally invasive FGT sampling methods to characterize and compare CD4 T cell yield and phenotype with the goal of establishing feasible sampling strategies for immune profiling of mucosal CD4 T cells. FGT samples were collected bimonthly from 12 healthy HIV negative women of reproductive age in the following order: 1) Cervicovaginal lavage (CVL), 2) two sequential endocervical flocked swabs (FS), and 3) two sequential endocervical cytobrushes (CB1, CB2). Cells were isolated and phentoyped via flow cytometry. CD4 T cell recovery was highest from each individual CB compared to either CVL or FS (p sampling method, expressed CCR5 relative to peripheral blood (p samples. Using three different mucosal sampling methods collected longitudinally we demonstrate that CD4 T cells within the FGT express CCR5 and α4β7 and are highly activated, attributes which could act in concert to facilitate HIV acquisition. FS and CB sampling methods can allow for investigation of strategies to reduce HIV target cells in the FGT and could inform the design and interpretation microbicide and vaccine studies in women.

Local recurrence after surgery for non-small cell lung cancer: a recursive partitioning analysis of multi-institutional data.

Science.gov (United States)

Kelsey, Chris R; Higgins, Kristin A; Peterson, Bercedis L; Chino, Junzo P; Marks, Lawrence B; D'Amico, Thomas A; Varlotto, John M

2013-10-01

To define subgroups at high risk of local recurrence (LR) after surgery for non-small cell lung cancer using a recursive partitioning analysis (RPA). This Institutional Review Board-approved study included patients who underwent upfront surgery for I-IIIA non-small cell lung cancer at Duke Cancer Institute (primary set) or at other participating institutions (validation set). The 2 data sets were analyzed separately and identically. Disease recurrence at the surgical margin, ipsilateral hilum, and/or mediastinum was considered an LR. Recursive partitioning was used to build regression trees for the prediction of local recurrence-free survival (LRFS) from standard clinical and pathological factors. LRFS distributions were estimated with the Kaplan-Meier method. The 1411 patients in the primary set had a 5-year LRFS rate of 77% (95% confidence interval [CI], 0.74-0.81), and the 889 patients in the validation set had a 5-year LRFS rate of 76% (95% CI, 0.72-0.80). The RPA of the primary data set identified 3 terminal nodes based on stage and histology. These nodes and their 5-year LRFS rates were as follows: (1) stage I/adenocarcinoma, 87% (95% CI, 0.83-0.90); (2) stage I/squamous or large cell, 72% (95% CI, 0.65-0.79); and (3) stage II-IIIA, 62% (95% CI, 0.55-0.69). The validation RPA identified 3 terminal nodes based on lymphovascular invasion (LVI) and stage: (1) no LVI/stage IA, 82% (95% CI, 0.76-0.88); (2) no LVI/stage IB-IIIA, 73% (95% CI, 0.69-0.80); and (3) LVI, 58% (95% CI, 0.47-0.69). The risk of LR was similar in the primary and validation patient data sets. There was discordance between the 2 data sets regarding the clinical factors that best segregate patients into risk groups. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

Persistent Low-Risk and High-Risk Human Papillomavirus Infections of the Uterine Cervix in HIV-Negative and HIV-Positive Women

Directory of Open Access Journals (Sweden)

Sally N. Adebamowo

2017-07-01

Full Text Available BackgroundThe prevalence, persistence, and multiplicity of human papillomavirus (HPV infection appears different comparing HIV-positive to HIV-negative women. In this study, we examined prevalent, persistent, and multiple low- and high-risk cervical HPV infections in HIV-negative and HIV-positive women.MethodsWe studied 1,020 women involved in a study of HPV infection using SPF25/LiPA10. Two study visits were scheduled, at enrollment and 6 months afterward. At each study visit, research nurses used a cervical brush to collect samples of exfoliated cervical cells from the cervical os, from all the study participants. Exact logistic regression models were used to estimate associations between HIV and HPV infections.ResultsThe mean (SD age of the study participants was 38 (8 years, 56% were HIV-negative and 44% were HIV-positive. Among HIV-negative women at baseline, single low-risk HPV (lrHPV infections occurred in 12%; multiple lrHPV in 2%; single high-risk human papillomavirus (hrHPV infections in 9%, and multiple hrHPV infections in 2%. Single lrHPV infections were persistent in 6%, but there was no persistent multiple lrHPV infections. Single hrHPV infections were persistent in 4% while multiple hrHPV infections were persistent in 0.3%. Among HIV-positive women at baseline, single lrHPV infections occurred in 19%, multiple lrHPV in 6%, single hrHPV infections in 17%, and multiple hrHPV infections occurred in 12%. Single lrHPV infections were persistent in 9%, multiple lrHPV infections in 0.6%, single hrHPV infections in 13%, while multiple hrHPV were persistent in 3%. Prevalent, persistent, and multiple infections were more common in HIV-positive women, compared to HIV-negative women. In multivariate models adjusted for age, marital status, socioeconomic status, age at sexual initiation, and douching, the odds ratios comparing HIV-positive to HIV-negative women, were 2.09 (95% CI 1.47–2.97, p < 0.001 for prevalent lrHPV, 1.26 (95% CI

Effect of Lithospermi Radix on Contact Dermatitis Induced by Dinitrofluorobenzene in Mice

Directory of Open Access Journals (Sweden)

Kim Han-Na

2012-06-01

Full Text Available Objectives: The root of Lithospermum erythrorhizon Sieb. et Zucc. (Lithospermi Radix, LR is a kind of heat clearing and blood cooling medicinal herbs. It can clear away heat and cool the blood, reduce toxins and disperse maculae. LR has long been used as efficacious therapy for inflammation, burns, frostbite and skin diseases such as eczema and psoriasis. Methods: In the present study, we investigate anti-allergic and anti-inflammatory effects of LR by using the 1-fluoro-2, 4- dinitrofluorobenzene (DNFB-induced contact dermatitis mouse model. Results: Topical application of 10 mg/mL of LR effectively inhibited skin lesions induced by repeated paintings with DNFB. Topical application of LR also inhibited hyperplasia, edema, spongiosis and infiltrations of mononuclear cells. In addition, production levels of total immunoglobulin and IgG1 in serum were decreased by using LR in vivo. Conclusions: These data suggest that LR acts as an antiinflammatory agent, improving skin lesions in CD mice.

Sequence typing of adenovirus from samples from hematological stem cell transplant recipients.

Science.gov (United States)

Al Qurashi, Yasir Mohammed A; Guiver, Malcolm; Cooper, Robert J

2011-11-01

Adenovirus infections are usually mild or even asymptomatic, but infections with the virus are being recognized increasingly as a major cause of mortality and morbidity in the immunocompromised, particularly hematological stem cell transplant patients where infections can be life threatening and mortality may reach 60%. Typing by sequencing the HVR7 region of the hexon was established and validated using 60 isolates of different serotypes from the six of the seven species which had been typed previously by serum neutralization. Analysis of nucleotide sequences was used to type 227 samples from 41 hematological stem cell transplant recipients. Types from six species were detected but species C types were detected in 51.4% and species A in 34.3% of patients. Seven patients were infected with different adenovirus types sequentially and a further six patients had evidence of simultaneous multiple infections. Many of the sequences had several differences from the prototype strains which will allow tracing of outbreaks and provide evidence for cross-infection in a hospital setting. In this study, the phylogenetic analysis of adenovirus sequences from hematological stem cell transplant patients' samples showed evidence of two possible cross-infection incidents involving three and five patients, respectively. Copyright © 2011 Wiley-Liss, Inc.

Cell Lysis and Detoxification of Cyanotoxins Using a Novel Combination of Microbubble Generation and Plasma Microreactor Technology for Ozonation

Directory of Open Access Journals (Sweden)

Jagroop Pandhal

2018-04-01

Full Text Available There has been a steady rise in the incidences of algal blooms globally, and worryingly, there is increasing evidence that changes in the global climate are leading to a shift toward cyanobacterial blooms. Many cyanobacterial genera are harmful, producing several potent toxins, including microcystins, for which there are over 90 described analogues. There are a wide range of negative effects associated with these toxins including gastroenteritis, cytotoxicity, hepatotoxicity and neurotoxicity. Although a variety of oxidation based treatment methods have been described, ozonation and advanced oxidation are acknowledged as most effective as they readily oxidise microcystins to non-toxic degradation products. However, most ozonation technologies have challenges for scale up including high costs and sub-optimum efficiencies, hence, a low cost and scalable ozonation technology is needed. Here we designed a low temperature plasma dielectric barrier discharge (DBD reactor with an incorporated fluidic oscillator for microbubble delivery of ozone. Both technologies have the potential to drastically reduce the costs of ozonation at scale. Mass spectrometry analysis revealed very rapid (<2 min destruction of two pure microcystins (MC-LR and MC-RR, together with removal of by-products even at low flow rate 1 L min−1 where bubble size was 0.56–0.6 mm and the ozone concentration within the liquid was 20 ppm. Toxicity levels were calculated through protein phosphatase inhibition assays and indicated loss of toxicity as well as confirming the by-products were also non-toxic. Finally, treatment of whole Microcystis aeruginosa cells showed that even at these very low ozone levels, cells can be killed and toxins (MC-LR and Desmethyl MC-LR removed. Little change was observed in the first 20 min of treatment followed by rapid increase in extracellular toxins, indicating cell lysis, with most significant release at the higher 3 L min−1 flow rate compared to 1 L

Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

International Nuclear Information System (INIS)

Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

2016-01-01

Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

A novel approach to non-biased systematic random sampling: a stereologic estimate of Purkinje cells in the human cerebellum.

Science.gov (United States)

Agashiwala, Rajiv M; Louis, Elan D; Hof, Patrick R; Perl, Daniel P

2008-10-21

Non-biased systematic sampling using the principles of stereology provides accurate quantitative estimates of objects within neuroanatomic structures. However, the basic principles of stereology are not optimally suited for counting objects that selectively exist within a limited but complex and convoluted portion of the sample, such as occurs when counting cerebellar Purkinje cells. In an effort to quantify Purkinje cells in association with certain neurodegenerative disorders, we developed a new method for stereologic sampling of the cerebellar cortex, involving calculating the volume of the cerebellar tissues, identifying and isolating the Purkinje cell layer and using this information to extrapolate non-biased systematic sampling data to estimate the total number of Purkinje cells in the tissues. Using this approach, we counted Purkinje cells in the right cerebella of four human male control specimens, aged 41, 67, 70 and 84 years, and estimated the total Purkinje cell number for the four entire cerebella to be 27.03, 19.74, 20.44 and 22.03 million cells, respectively. The precision of the method is seen when comparing the density of the cells within the tissue: 266,274, 173,166, 167,603 and 183,575 cells/cm3, respectively. Prior literature documents Purkinje cell counts ranging from 14.8 to 30.5 million cells. These data demonstrate the accuracy of our approach. Our novel approach, which offers an improvement over previous methodologies, is of value for quantitative work of this nature. This approach could be applied to morphometric studies of other similarly complex tissues as well.

Radon induced radiological impact of coal, fly ash and cement samples

International Nuclear Information System (INIS)

Kant, K.; Chauhan, R.P.; Sharma, G.S.; Chakravarti, S.K.

2001-01-01

Coal and its by-product fly ash are technologically important materials being used for power generation and in the manufacture of bricks, sheets, cement, land-filling, etc., respectively. Increased interest in measuring radon concentration in coal, fly ash and cement is due to its health hazards and environmental pollution. As the presence of radon in the environment (indoor and outdoor), soil, ground water, oil and gas deposits contributes the largest fraction of the natural radiation dose to populations, tracking its concentration is thus of paramount importance for radiological protection. Samples of coal and fly ash were collected from different thermal power stations in northern India and cement samples from National Council for Cement and Building Materials, Ballabgarh (Haryana), India and were analysed for radon concentration. For the measurement, alpha sensitive LR-115 type II plastic track detectors were used. Based upon the available data, the annual effective dose and the lifetime fatality risk factors have been calculated. The radon concentration from coal samples varied from 433 ± 28 Bqm -3 to 2086 ± 28 Bqm -3 . The radon concentration from fly ash samples varied from 748 ± 28 Bqm -3 to 1417 ± 111 Bqm -3 and from 158 Bqm -3 to 1810 Bqm -3 in cement samples, with an average of 624 ± 169 Bqm -3 . (author)

15.SFPS "Ieņēmumi no līgumiem ar klientiem"un 16.SFPS "Noma" prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu

OpenAIRE

Dābola, Iveta

2016-01-01

Maģistra darba temats 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu. Maģistra darba mērķis - balstoties uz 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” standartu prasību izpēti un analīzi, novērtēt Latvijas likumdošanas atbilstību minēto standartu prasībām un sniegt priekšlikumus konkrētu jautājumu risināšanai Latvijas kontekstā. Maģistra darbā izpētīti LR normatīvie regulējumi un sta...

Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

International Nuclear Information System (INIS)

Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

2007-01-01

Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

International Nuclear Information System (INIS)

Agba, Dabo Salif Ignace

2011-02-01

Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

High diagnostic accuracy of the Sysmex XT-2000iV delta total nucleated cells on effusions for feline infectious peritonitis.

Science.gov (United States)

Giordano, Alessia; Stranieri, Angelica; Rossi, Gabriele; Paltrinieri, Saverio

2015-06-01

The ΔWBC (the ratio between DIFF and BASO counts of the Sysmex XT-2000iV), hereafter defined as ΔTNC (total nucleated cells), is high in effusions due to feline infectious peritonitis (FIP), as cells are entrapped in fibrin clots formed in the BASO reagent. Similar clots form in the Rivalta's test, a method with high diagnostic accuracy for FIP. The objective of this study was to determine the diagnostic accuracy for FIP and the optimal cutoff of ΔTNC. After a retrospective search of our database, DIFF and BASO counts, and the ΔTNC from cats with and without FIP were compared to each other. Sensitivity, specificity, and positive and negative likelihood ratios (LR+, LR-) were calculated. A ROC curve was designed to determine the cutoff for best sensitivity and specificity. Effusions from 20 FIP and 31 non-FIP cats were analyzed. The ΔTNC was higher (P  2.5 had 100% specificity. The ΔTNC has a high diagnostic accuracy for FIP-related effusions by providing an estimate of precipitable proteins, as the Rivalta's test, in addition to the cell count. As fibrin clots result in false lower BASO counts, the ΔTNC is preferable to the WBC count generated by the BASO channel alone in suspected FIP effusions. © 2015 American Society for Veterinary Clinical Pathology.

Low cost label-free live cell imaging for biological samples

Science.gov (United States)

Seniya, C.; Towers, C. E.; Towers, D. P.

2017-02-01

This paper reports the progress to develop a practical phase measuring microscope offering new capabilities in terms of phase measurement accuracy and quantification of cell:cell interactions over the longer term. A novel, low cost phase interference microscope for imaging live cells (label-free) is described. The method combines the Zernike phase contrast approach with a dual mirror design to enable phase modulation between the scattered and un-scattered optical fields. Two designs are proposed and demonstrated, one of which retains the common path nature of Zernike's original microscopy concept. In both setups the phase shift is simple to control via a piezoelectric driven mirror in the back focal plane of the imaging system. The approach is significantly cheaper to implement than those based on spatial light modulators (SLM) at approximately 20% of the cost. A quantitative assessment of the performance of a set of phase shifting algorithms is also presented, specifically with regard to broad bandwidth illumination in phase contrast microscopy. The simulation results show that the phase measurement accuracy is strongly dependent on the algorithm selected and the optical path difference in the sample.

IFNG-mediated immune responses enhance autophagy against Mycobacterium tuberculosis antigens in patients with active tuberculosis

Science.gov (United States)

Rovetta, Ana I; Peña, Delfina; Hernández Del Pino, Rodrigo E; Recalde, Gabriela M; Pellegrini, Joaquín; Bigi, Fabiana; Musella, Rosa M; Palmero, Domingo J; Gutierrez, Marisa; Colombo, María I; García, Verónica E

2015-01-01

Protective immunity against Mycobacterium tuberculosis (Mtb) requires IFNG. Besides, IFNG-mediated induction of autophagy suppresses survival of virulent Mtb in macrophage cell lines. We investigated the contribution of autophagy to the defense against Mtb antigen (Mtb-Ag) in cells from tuberculosis patients and healthy donors (HD). Patients were classified as high responders (HR) if their T cells produced significant IFNG against Mtb-Ag; and low responders (LR) when patients showed weak or no T cell responses to Mtb-Ag. The highest autophagy levels were detected in HD cells whereas the lowest quantities were observed in LR patients. Interestingly, upon Mtb-Ag stimulation, we detected a positive correlation between IFNG and MAP1LC3B-II/LC3-II levels. Actually, blockage of Mtb-Ag-induced IFNG markedly reduced autophagy in HR patients whereas addition of limited amounts of IFNG significantly increased autophagy in LR patients. Therefore, autophagy collaborates with human immune responses against Mtb in close association with specific IFNG secreted against the pathogen. PMID:25426782

Gold nanomaterials for the selective capturing and SERS diagnosis of toxins in aqueous and biological fluids

DEFF Research Database (Denmark)

Hassanain, Waleed A.; Izake, Emad L.; Schmidt, Michael Stenbæk

2017-01-01

the extractor nanoparticles within 5min by manipulating the pH environment of the nanoparticles. The regenerated extractor nanoparticles maintained their capture efficiency and, therefore, were re-used to capture of MC-LR from successive samples. The released purified toxin was screened within 10min on gold......A highly sensitive nanosensing method for the combined selective capture and SERS detection of Microcystin-LR (MC-LR) in blood plasma has been developed. The new method utilizes gold coated magnetic nanoparticles that are functionalized with anti MC-LR antibody Fab' fragments for the selective...... capture of MC-LR from aqueous media and blood plasma. Using an oriented immobilization approach, the Fab' fragments are covalently attached to gold surface to form a monolayer with high capture efficiency towards the toxin. After the selective capture, the purified MC-LR molecules were released from...

Postoperative radiotherapy in stage III non-small cell lung cancer: Is a reassessment necessary in modern times?

OpenAIRE

Billiet, Charlotte

2017-01-01

Background: The role of postoperative radiation therapy (PORT) in patients with completely resected non-small cell lung cancer (NSCLC) with pathologically involved mediastinal lymph nodes (N2) remains unclear. Despite a reduction of local recurrence (LR), its effect on overall survival (OS) remains unproven. Therefore we conducted a review of the current literature. Methods: To investigate the benefit and safety of modern PORT, we identified published phase III trials for PORT. We inves...

Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

Science.gov (United States)

Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

2013-11-01

While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

An improved enzyme-linked immunosorbent assay for whole-cell determination of methanogens in samples from anaerobic reactors

DEFF Research Database (Denmark)

Sørensen, A.H.; Ahring, B.K.

1997-01-01

An enzyme-linked immunosorbent assay was developed for the detection of whole cells of methanogens in samples from anaerobic continuously stirred tank digesters treating slurries of solid waste. The assay was found to allow for quantitative analysis of the most important groups of methanogens......-quality microtiter plates and the addition of dilute hydrochloric acid to the samples. In an experiment on different digester samples, the test demonstrated a unique pattern of different methanogenic strains present in each sample. The limited preparatory work required for the assay and the simple assay design make...... in samples from anaerobic digesters in a reproducible manner. Polyclonal antisera against eight strains of methanogens were employed in the test, The specificities of the antisera were increased by adsorption with cross-reacting cells. The reproducibility of the assay depended on the use of high...

Neutron sample cell suitable for the diffraction of aligned biomaterials and capable of exerting up to 370 MPa of hydrostatic pressure

International Nuclear Information System (INIS)

Watson, M.J.; Nieh, M.-P.; Harroun, T.A.; Katsaras, J.

2003-01-01

We describe a temperature controlled sample cell suitable for the study of biomimetic materials (e.g., lipid bilayers) using neutron diffraction, and capable of exerting hydrostatic pressures of up to 370 MPa. The advantage of this sample cell, compared to previous high-pressure cells of its type, is that it allows for the use of samples aligned on a solid support which, compared to 'powder' or so-called liposomal preparations, requires only small amounts of sample and allows for the clear differentiation between in-plane and out-of-plane structure

Salvage stereotactic body radiotherapy for locally recurrent non-small cell lung cancer after sublobar resection and I125 vicryl mesh brachytherapy

Directory of Open Access Journals (Sweden)

Beant Singh Gill

2015-05-01

Full Text Available Purpose: Locally-recurrent non-small cell lung cancer (LR-NSCLC remains challenging treat, particularly in patients having received prior radiotherapy. Heterogeneous populations and varied treatment intent in existing literature result in significant limitations in evaluating efficacy of lung re-irradiation. In order to better establish the impact of re-irradiation in patients with LR-NSCLC following high-dose radiotherapy, we report outcomes for patients treated with prior sublobar resection and brachytherapy that subsequently underwent stereotactic body radiotherapy (SBRT.Methods: A retrospective review of patients initially treated with sublobar resection and I125 vicryl mesh brachytherapy, who later developed LR-NSCLC along the suture line, was performed. Patients received salvage SBRT with curative intent. Dose and fractionation was based on tumor location and size, with a median prescription dose of 48 Gy in 4 fractions (range 20-60 Gy in 1-4 fractions.Results: Thirteen consecutive patients were identified with median follow-up of 2.1 years (range 0.7-5.6 years. Two in-field local failures occurred at 7.5 and 11.1 months, resulting in 2-year local control of 83.9% (95% CI 63.5-100.0%. Two-year disease-free survival and overall survival estimates were 38.5% (95% CI 0.0-65.0% and 65.8% (95% CI, 38.2-93.4%. Four patients (31% remained disease-free at last follow-up. All but one patient who experienced disease recurrence developed isolated or synchronous distant metastases. Only one patient (7.7% developed grade ≥3 toxicity, consisting of grade 3 esophageal stricture following a centrally located recurrence previously treated with radiofrequency ablation.Conclusion: Despite high local radiation doses delivered to lung parenchyma previously with I125 brachytherapy, re-irradiation with SBRT for LR-NSCLC results in excellent local control with limited morbidity, allowing for potential disease cure in a subset of patients.

Removal of MCs by Bi2O2CO3: adsorption and the potential of photocatalytic degradation.

Science.gov (United States)

Wang, Yujiao; Cao, Yanqiu; Li, Hongmei; Gong, Aijun; Han, Jintao; Qian, Zhen; Chao, Wenran

2018-04-01

Microcystins (MCs) is a kind of hepatotoxin, which is the secondary metabolite of cyanobacteria. Bi 2 O 2 CO 3 (BOC) is a kind of cheap and nontoxic semiconductor material. BOC was synthetized by solvothermal method and then microcystin-LR (MC-LR) and microcystin-RR (MC-RR) were removed by BOC, through adsorption and photocatalytic degradation. When the dosage of BOC is 6 g/L, the MC-LR and MC-RR in the natural water sample can be completely adsorbed in 30 min and then after 12 h irradiation, MC-LR and MC-RR were photocatalytically degraded by BOC.

Evaluation of different continuous cell lines in the isolation of mumps virus by the shell vial method from clinical samples

Science.gov (United States)

Reina, J; Ballesteros, F; Mari, M; Munar, M

2001-01-01

Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211

Controls to validate plasma samples for cell free DNA quantification

DEFF Research Database (Denmark)

Pallisgaard, Niels; Spindler, Karen-Lise Garm; Andersen, Rikke Fredslund

2015-01-01

, are diverging due to methodological differences with lack of standardisation and definition of sensitivity. The new biological information has not yet come into routine use. The present study presents external standardisation by spiking with non-human DNA fragments to control for loss of DNA during sample...... preparation and measurement. It also suggests a method to control for admixture of DNA from normal lymphocytes by utilizing the unique immunoglobulin gene rearrangement in the B-cells. The results show that this approach improves the quality of the analysis and lowers the risk of falsely increased values...

Nonequilibrium Gyrokinetic Fluctuation Theory and Sampling Noise in Gyrokinetic Particle-in-cell Simulations

International Nuclear Information System (INIS)

Krommes, John A.

2007-01-01

The present state of the theory of fluctuations in gyrokinetic (GK) plasmas and especially its application to sampling noise in GK particle-in-cell (PIC) simulations is reviewed. Topics addressed include the Δf method, the fluctuation-dissipation theorem for both classical and GK many-body plasmas, the Klimontovich formalism, sampling noise in PIC simulations, statistical closure for partial differential equations, the theoretical foundations of spectral balance in the presence of arbitrary noise sources, and the derivation of Kadomtsev-type equations from the general formalism

Nonequilibrium Gyrokinetic Fluctuation Theory and Sampling Noise in Gyrokinetic Particle-in-cell Simulations

Energy Technology Data Exchange (ETDEWEB)

John A. Krommes

2007-10-09

The present state of the theory of fluctuations in gyrokinetic GK plasmas and especially its application to sampling noise in GK particle-in-cell PIC simulations is reviewed. Topics addressed include the Δf method, the fluctuation-dissipation theorem for both classical and GK many-body plasmas, the Klimontovich formalism, sampling noise in PIC simulations, statistical closure for partial differential equations, the theoretical foundations of spectral balance in the presence of arbitrary noise sources, and the derivation of Kadomtsev-type equations from the general formalism.

[Planned neck dissection in the treatment of locally advanced head and neck squamous cell carcinoma].

Science.gov (United States)

Jiang, L; Lou, J L; Wang, K J; Fang, M Y; Fu, Z F

2018-02-07

Objective: To investigate the value of planned neck dissection combined with induction chemotherapy and concurrent chemoradiotherapy in regional control and the outcome of locally advanced head and neck squamous cell carcinoma. Methods: A prospective randomized controlled study totally enrolled sixty-four patients of head and neck squamous cell carcinomas(include oropharynx, hypopharynx, and larynx) in stages Ⅳa-Ⅳb with lymph node metastase was were N2-N3. All patients firstly received 2-3 cycles of induction chemotherapy(ICT), then divided into two groups randomly, according to the efficacy of ICT. Group A(the study group) received planned neck dissection(PND) and concurrent chemoradiotherapy(CCRT). Group B(the control group) received concurrent chemoradiotherapy(CCRT). The differences in clinicopathologic features, local recurrence(LR), regional recurrence(RR), disease-free survival(DFS), and overall survival(OS) between the two groups were estimated. SPSS 19.0 software was used to analyze the data. Results: Group A enrolled twenty-one patients, and group B enrolled forty-three patients.The follow-up of all patients were 4-55 months, median follow-up time was 22 months. In study group, two-year OS and DFS were 80.9% and 68.3%, respectively. In control group, two-year OS and DFS were 90.7% and 67.1%, respectively. There was no significant difference in gender( P =0.215), age( P =0.828), primary tumor site( P =0.927), LR( P =0.126), DFS( P =0.710), and OS( P =0.402) between the two groups, while the RR(χ(2)=5.640, P squamous cell carcinoma.

Measurement of diffuse and specular reflections through single cell layers

CSIR Research Space (South Africa)

Karsten, AE

2006-07-01

Full Text Available ) • On average 50 000 new cases/year • LR at least • Male: 1 in 6 • Female: 1 in 7 Slide 4 © CSIR 2006 www.csir.co.za Background • Diabetes • High prevalence in SA • Not a notifiable disease • Indian: Av. 17% (11% - 30%) • Black...: 8% • White: 6% • Type II diabetes on the increase • Limp amputation • Research aimed at PDT and accelerated wound healing Slide 5 © CSIR 2006 www.csir.co.za Experimental work at UJ WS1Cell line Induce wound: sterile...

A whole-cell bioreporter assay for quantitative genotoxicity evaluation of environmental samples.

Science.gov (United States)

Jiang, Bo; Li, Guanghe; Xing, Yi; Zhang, Dayi; Jia, Jianli; Cui, Zhisong; Luan, Xiao; Tang, Hui

2017-10-01

Whole-cell bioreporters have emerged as promising tools for genotoxicity evaluation, due to their rapidity, cost-effectiveness, sensitivity and selectivity. In this study, a method for detecting genotoxicity in environmental samples was developed using the bioluminescent whole-cell bioreporter Escherichia coli recA::luxCDABE. To further test its performance in a real world scenario, the E. coli bioreporter was applied in two cases: i) soil samples collected from chromium(VI) contaminated sites; ii) crude oil contaminated seawater collected after the Jiaozhou Bay oil spill which occurred in 2013. The chromium(VI) contaminated soils were pretreated by water extraction, and directly exposed to the bioreporter in two phases: aqueous soil extraction (water phase) and soil supernatant (solid phase). The results indicated that both extractable and soil particle fixed chromium(VI) were bioavailable to the bioreporter, and the solid-phase contact bioreporter assay provided a more precise evaluation of soil genotoxicity. For crude oil contaminated seawater, the response of the bioreporter clearly illustrated the spatial and time change in genotoxicity surrounding the spill site, suggesting that the crude oil degradation process decreased the genotoxic risk to ecosystem. In addition, the performance of the bioreporter was simulated by a modified cross-regulation gene expression model, which quantitatively described the DNA damage response of the E. coli bioreporter. Accordingly, the bioluminescent response of the bioreporter was calculated as the mitomycin C equivalent, enabling quantitative comparison of genotoxicities between different environmental samples. This bioreporter assay provides a rapid and sensitive screening tool for direct genotoxicity assessment of environmental samples. Copyright © 2017. Published by Elsevier Ltd.

A novel method for sample preparation of fresh lung cancer tissue for proteomics analysis by tumor cell enrichment and removal of blood contaminants

Directory of Open Access Journals (Sweden)

Orre Lotta

2010-02-01

Full Text Available Abstract Background In-depth proteomics analyses of tumors are frequently biased by the presence of blood components and stromal contamination, which leads to large experimental variation and decreases the proteome coverage. We have established a reproducible method to prepare freshly collected lung tumors for proteomics analysis, aiming at tumor cell enrichment and reduction of plasma protein contamination. We obtained enriched tumor-cell suspensions (ETS from six lung cancer cases (two adenocarcinomas, two squamous-cell carcinomas, two large-cell carcinomas and from two normal lung samples. The cell content of resulting ETS was evaluated with immunocytological stainings and compared with the histologic pattern of the original specimens. By means of a quantitative mass spectrometry-based method we evaluated the reproducibility of the sample preparation protocol and we assessed the proteome coverage by comparing lysates from ETS samples with the direct lysate of corresponding fresh-frozen samples. Results Cytological analyses on cytospin specimens showed that the percentage of tumoral cells in the ETS samples ranged from 20% to 70%. In the normal lung samples the percentage of epithelial cells was less then 10%. The reproducibility of the sample preparation protocol was very good, with coefficient of variation at the peptide level and at the protein level of 13% and 7%, respectively. Proteomics analysis led to the identification of a significantly higher number of proteins in the ETS samples than in the FF samples (244 vs 109, respectively. Albumin and hemoglobin were among the top 5 most abundant proteins identified in the FF samples, showing a high contamination with blood and plasma proteins, whereas ubiquitin and the mitochondrial ATP synthase 5A1 where among the top 5 most abundant proteins in the ETS samples. Conclusion The method is feasible and reproducible. We could obtain a fair enrichment of cells but the major benefit of the method

Application of gelatin zymography for evaluating low levels of contaminating neutrophils in red blood cell samples.

Science.gov (United States)

Achilli, Cesare; Ciana, Annarita; Balduini, Cesare; Risso, Angela; Minetti, Giampaolo

2011-02-15

Supposedly "homogeneous" red blood cell (RBC) samples are commonly obtained by "washing" whole blood free of plasma, platelets, and white cells with physiological solutions, a procedure that does not result, however, in sufficient removal of polymorphonuclear neutrophils (PMNs), leading to possible artifactual results. Pure RBC samples can be obtained only by leukodepletion procedures. Proposed here is a version of gelatin zymography adapted to detect matrix metalloproteinase 9 (MMP-9), selectively expressed by PMNs, in heterogeneous mixtures of RBCs and PMNs that can reveal contamination at levels as low as 1 PMN/10⁶ RBCs. Copyright © 2010 Elsevier Inc. All rights reserved.

Measurement of radon activity, exhalation rate and radiation dose in fly ash and coal samples from NTPC, Badarpur, Delhi, India

International Nuclear Information System (INIS)

Gupta, Mamta; Verma, K.D.; Mahur, A.K.; Prasad, R.; Sonkawade, R.G.

2013-01-01

In the present study radon activities and exhalation rates from fly ash and coal samples from NTPC (National Thermal Power Corporation) situated at Badarpur, Delhi, India, have been measured. 'Sealed Can Technique' using LR-115 type II track detectors was employed. In fly ash samples, radon activity has been found to vary from 400.0 ± 34.7 to 483.9 ± 38.1Bqm -3 with an average value of 447.1 ± 36.6 Bqm -3 and in coal samples, radon activity has been found to vary from 504.0 ± 39.0 to 932.1 ± 52.9 Bqm -3 with an average value of 687.2 ± 45.2 Bqm -3 . Radon exhalation rate from coal is found to be higher than radon exhalation rate from its ash products, whereas the opposite is expected. Indoor inhalation exposure (radon) effective dose has also been estimated. (author)

Consistent left-right asymmetry cannot be established by late organizers in Xenopus unless the late organizer is a conjoined twin.

Science.gov (United States)

Vandenberg, Laura N; Levin, Michael

2010-04-01

How embryos consistently orient asymmetries of the left-right (LR) axis is an intriguing question, as no macroscopic environmental cues reliably distinguish left from right. Especially unclear are the events coordinating LR patterning with the establishment of the dorsoventral (DV) axes and midline determination in early embryos. In frog embryos, consistent physiological and molecular asymmetries manifest by the second cell cleavage; however, models based on extracellular fluid flow at the node predict correct de novo asymmetry orientation during neurulation. We addressed these issues in Xenopus embryos by manipulating the timing and location of dorsal organizer induction: the primary dorsal organizer was ablated by UV irradiation, and a new organizer was induced at various locations, either early, by mechanical rotation, or late, by injection of lithium chloride (at 32 cells) or of the transcription factor XSiamois (which functions after mid-blastula transition). These embryos were then analyzed for the position of three asymmetric organs. Whereas organizers rescued before cleavage properly oriented the LR axis 90% of the time, organizers induced in any position at any time after the 32-cell stage exhibited randomized laterality. Late organizers were unable to correctly orient the LR axis even when placed back in their endogenous location. Strikingly, conjoined twins produced by late induction of ectopic organizers did have normal asymmetry. These data reveal that although correct LR orientation must occur no later than early cleavage stages in singleton embryos, a novel instructive influence from an early organizer can impose normal asymmetry upon late organizers in the same cell field.

Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

Directory of Open Access Journals (Sweden)

Maya Safira Dewi

2011-05-01

Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

Renal cell carcinoma

Science.gov (United States)

... kidney Patient Instructions Kidney removal - discharge Images Kidney anatomy Kidney tumor - CT scan Kidney metastases, CT scan Kidney - blood and urine flow References Campbell SC, Lane BR. Malignant renal tumors. In: Wein AJ, Kavoussi LR, Partin AW, ...

Isolation of endothelial colony-forming cells from blood samples collected from the jugular and cephalic veins of healthy adult horses.

Science.gov (United States)

Sharpe, Ashley N; Seeto, Wen J; Winter, Randolph L; Zhong, Qiao; Lipke, Elizabeth A; Wooldridge, Anne A

2016-10-01

OBJECTIVE To evaluate optimal isolation of endothelial colony-forming cells (ECFCs) from peripheral blood of horses. SAMPLE Jugular and cephalic venous blood samples from 17 adult horses. PROCEDURES Each blood sample was divided; isolation was performed with whole blood adherence (WBA) and density gradient centrifugation (DGC). Isolated cells were characterized by uptake of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate-labeled acetylated low-density lipoprotein (DiI-Ac-LDL), vascular tubule formation, and expression of endothelial (CD34, CD105, vascular endothelial growth factor receptor-2, and von Willebrand factor) and hematopoietic (CD14) cell markers by use of indirect immunofluorescence assay (IFA) and flow cytometry. RESULTS Colonies with cobblestone morphology were isolated from 15 of 17 horses. Blood collected from the cephalic vein yielded colonies significantly more often (14/17 horses) than did blood collected from the jugular vein (8/17 horses). Of 14 cephalic blood samples with colonies, 13 were obtained with DGC and 8 with WBA. Of 8 jugular blood samples with colonies, 8 were obtained with DGC and 4 with WBA. Colony frequency (colonies per milliliter of blood) was significantly higher for cephalic blood samples and samples isolated with DGC. Cells formed vascular tubules, had uptake of DiI-Ac-LDL, and expressed endothelial markers by use of IFA and flow cytometry, which confirmed their identity as ECFCs. CONCLUSIONS AND CLINICAL RELEVANCE Maximum yield of ECFCs was obtained for blood samples collected from both the jugular and cephalic veins and use of DGC to isolate cells. Consistent yield of ECFCs from peripheral blood of horses will enable studies to evaluate diagnostic and therapeutic uses.

WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

International Nuclear Information System (INIS)

Josek, R.; Hudec, F.; Rypar, V.

2006-01-01

One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

Short communication: Influence of the sampling device on somatic cell count variation in cow milk samples (by official recording)

International Nuclear Information System (INIS)

Fouz, R.; Vilar, M.J.; Yus, E.; Sanjuán, M.L.; Diéguez, F.J.

2016-01-01

The objective of this study was to investigate the variability in cow´s milk somatic cell counts (SCC) depending on the type of milk meter used by dairy farms for official milk recording. The study was performed in 2011 and 2012 in the major cattle area of Spain. In total, 137,846 lactations of Holstein-Friesian cows were analysed at 1,912 farms. A generalised least squares regression model was used for data analysis. The model showed that the milk meter had a substantial effect on the SCC for individual milk samples obtained for official milk recording. The results suggested an overestimation of the SCC in milk samples from farms that had electronic devices in comparison with farms that used portable devices and underestimation when volumetric meters are used. A weak positive correlation was observed between the SCC and the percentage of fat in individual milk samples. The results underline the importance of considering this variable when using SCC data from milk recording in the dairy herd improvement program or in quality milk programs. (Author)

Short communication: Influence of the sampling device on somatic cell count variation in cow milk samples (by official recording)

Energy Technology Data Exchange (ETDEWEB)

Fouz, R.; Vilar, M.J.; Yus, E.; Sanjuán, M.L.; Diéguez, F.J.

2016-11-01

The objective of this study was to investigate the variability in cow´s milk somatic cell counts (SCC) depending on the type of milk meter used by dairy farms for official milk recording. The study was performed in 2011 and 2012 in the major cattle area of Spain. In total, 137,846 lactations of Holstein-Friesian cows were analysed at 1,912 farms. A generalised least squares regression model was used for data analysis. The model showed that the milk meter had a substantial effect on the SCC for individual milk samples obtained for official milk recording. The results suggested an overestimation of the SCC in milk samples from farms that had electronic devices in comparison with farms that used portable devices and underestimation when volumetric meters are used. A weak positive correlation was observed between the SCC and the percentage of fat in individual milk samples. The results underline the importance of considering this variable when using SCC data from milk recording in the dairy herd improvement program or in quality milk programs. (Author)

Sample processing, protocol, and statistical analysis of the time-of-flight secondary ion mass spectrometry (ToF-SIMS) of protein, cell, and tissue samples.

Science.gov (United States)

Barreto, Goncalo; Soininen, Antti; Sillat, Tarvo; Konttinen, Yrjö T; Kaivosoja, Emilia

2014-01-01

Time-of-flight secondary ion mass spectrometry (ToF-SIMS) is increasingly being used in analysis of biological samples. For example, it has been applied to distinguish healthy and osteoarthritic human cartilage. This chapter discusses ToF-SIMS principle and instrumentation including the three modes of analysis in ToF-SIMS. ToF-SIMS sets certain requirements for the samples to be analyzed; for example, the samples have to be vacuum compatible. Accordingly, sample processing steps for different biological samples, i.e., proteins, cells, frozen and paraffin-embedded tissues and extracellular matrix for the ToF-SIMS are presented. Multivariate analysis of the ToF-SIMS data and the necessary data preprocessing steps (peak selection, data normalization, mean-centering, and scaling and transformation) are discussed in this chapter.

Assessment of real-time PCR method for detection of EGFR mutation using both supernatant and cell pellet of malignant pleural effusion samples from non-small-cell lung cancer patients.

Science.gov (United States)

Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A

2017-10-26

EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.

Complete Sensitivity/Uncertainty Analysis of LR-0 Reactor Experiments with MSRE FLiBe Salt and Perform Comparison with Molten Salt Cooled and Molten Salt Fueled Reactor Models

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mueller, Don [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2016-12-01

In September 2016, reactor physics measurements were conducted at Research Centre Rez (RC Rez) using the FLiBe (2 ⁷LiF + BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) in the LR-0 low power nuclear reactor. These experiments were intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems using FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL), in collaboration with RC Rez, performed sensitivity/uncertainty (S/U) analyses of these experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objectives of these analyses were (1) to identify potential sources of bias in fluoride salt-cooled and salt-fueled reactor simulations resulting from cross section uncertainties, and (2) to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a final report on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. In the future, these S/U analyses could be used to inform the design of additional FLiBe-based experiments using the salt from MSRE. The key finding of this work is that, for both solid and liquid fueled fluoride salt reactors, radiative capture in ⁷Li is the most significant contributor to potential bias in neutronics calculations within the FLiBe salt.

Investigation of CPD and HMDS Sample Preparation Techniques for Cervical Cells in Developing Computer-Aided Screening System Based on FE-SEM/EDX

Science.gov (United States)

Ng, Siew Cheok; Abu Osman, Noor Azuan

2014-01-01

This paper investigated the effects of critical-point drying (CPD) and hexamethyldisilazane (HMDS) sample preparation techniques for cervical cells on field emission scanning electron microscopy and energy dispersive X-ray (FE-SEM/EDX). We investigated the visualization of cervical cell image and elemental distribution on the cervical cell for two techniques of sample preparation. Using FE-SEM/EDX, the cervical cell images are captured and the cell element compositions are extracted for both sample preparation techniques. Cervical cell image quality, elemental composition, and processing time are considered for comparison of performances. Qualitatively, FE-SEM image based on HMDS preparation technique has better image quality than CPD technique in terms of degree of spread cell on the specimen and morphologic signs of cell deteriorations (i.e., existence of plate and pellet drying artifacts and membrane blebs). Quantitatively, with mapping and line scanning EDX analysis, carbon and oxygen element compositions in HMDS technique were higher than the CPD technique in terms of weight percentages. The HMDS technique has shorter processing time than the CPD technique. The results indicate that FE-SEM imaging, elemental composition, and processing time for sample preparation with the HMDS technique were better than CPD technique for cervical cell preparation technique for developing computer-aided screening system. PMID:25610902

Treatability studies on different refinery wastewater samples using high-throughput microbial electrolysis cells (MECs)

KAUST Repository

Ren, Lijiao; Siegert, Michael; Ivanov, Ivan; Pisciotta, John M.; Logan, Bruce E.

2013-01-01

High-throughput microbial electrolysis cells (MECs) were used to perform treatability studies on many different refinery wastewater samples all having appreciably different characteristics, which resulted in large differences in current generation. A de-oiled refinery wastewater sample from one site (DOW1) produced the best results, with 2.1±0.2A/m2 (maximum current density), 79% chemical oxygen demand removal, and 82% headspace biological oxygen demand removal. These results were similar to those obtained using domestic wastewater. Two other de-oiled refinery wastewater samples also showed good performance, with a de-oiled oily sewer sample producing less current. A stabilization lagoon sample and a stripped sour wastewater sample failed to produce appreciable current. Electricity production, organics removal, and startup time were improved when the anode was first acclimated to domestic wastewater. These results show mini-MECs are an effective method for evaluating treatability of different wastewaters. © 2013 Elsevier Ltd.

Treatability studies on different refinery wastewater samples using high-throughput microbial electrolysis cells (MECs)

KAUST Repository

Ren, Lijiao

2013-05-01

High-throughput microbial electrolysis cells (MECs) were used to perform treatability studies on many different refinery wastewater samples all having appreciably different characteristics, which resulted in large differences in current generation. A de-oiled refinery wastewater sample from one site (DOW1) produced the best results, with 2.1±0.2A/m2 (maximum current density), 79% chemical oxygen demand removal, and 82% headspace biological oxygen demand removal. These results were similar to those obtained using domestic wastewater. Two other de-oiled refinery wastewater samples also showed good performance, with a de-oiled oily sewer sample producing less current. A stabilization lagoon sample and a stripped sour wastewater sample failed to produce appreciable current. Electricity production, organics removal, and startup time were improved when the anode was first acclimated to domestic wastewater. These results show mini-MECs are an effective method for evaluating treatability of different wastewaters. © 2013 Elsevier Ltd.

Detection of Merkel Cell Polyomavirus DNA in Serum Samples of Healthy Blood Donors

Science.gov (United States)

Mazzoni, Elisa; Rotondo, John C.; Marracino, Luisa; Selvatici, Rita; Bononi, Ilaria; Torreggiani, Elena; Touzé, Antoine; Martini, Fernanda; Tognon, Mauro G.

2017-01-01

Merkel cell polyomavirus (MCPyV) has been detected in 80% of Merkel cell carcinomas (MCC). In the host, the MCPyV reservoir remains elusive. MCPyV DNA sequences were revealed in blood donor buffy coats. In this study, MCPyV DNA sequences were investigated in the sera (n = 190) of healthy blood donors. Two MCPyV DNA sequences, coding for the viral oncoprotein large T antigen (LT), were investigated using polymerase chain reaction (PCR) methods and DNA sequencing. Circulating MCPyV sequences were detected in sera with a prevalence of 2.6% (5/190), at low-DNA viral load, which is in the range of 1–4 and 1–5 copies/μl by real-time PCR and droplet digital PCR, respectively. DNA sequencing carried out in the five MCPyV-positive samples indicated that the two MCPyV LT sequences which were analyzed belong to the MKL-1 strain. Circulating MCPyV LT sequences are present in blood donor sera. MCPyV-positive samples from blood donors could represent a potential vehicle for MCPyV infection in receivers, whereas an increase in viral load may occur with multiple blood transfusions. In certain patient conditions, such as immune-depression/suppression, additional disease or old age, transfusion of MCPyV-positive samples could be an additional risk factor for MCC onset. PMID:29238698

IgG4-positive cell infiltration in various cardiovascular disorders - results from histopathological analysis of surgical samples.

Science.gov (United States)

Hourai, Ryoto; Kasashima, Satomi; Sohmiya, Koichi; Yamauchi, Yohei; Ozawa, Hideki; Hirose, Yoshinobu; Ogino, Yasuhiro; Katsumata, Takahiro; Daimon, Masahiro; Fujita, Shu-Ichi; Hoshiga, Masaaki; Ishizaka, Nobukazu

2017-02-03

The diagnosis of Immunoglobulin G4 (IgG4)-related disease (IgG4-RD), in general, depends on serum IgG4 concentrations and histopathological findings; therefore, diagnosis of IgG4-RD in cardiovascular organs/tissues is often difficult owing to the risk of tissue sampling. Prevalence of IgG4-positive lymphoplasmacytic infiltration in 103 consecutive cardiovascular surgical samples from 98 patients with various cardiovascular diseases was analyzed immunohistochemically. The diagnoses of the enrolled patients included aortic aneurysm (abdominal, n = 8; thoracic, n = 9); aortic dissection (n = 20); aortic stenosis (n = 24), aortic regurgitation (n = 10), and mitral stenosis/regurgitation (n = 17). In total, 10 (9.7%) of the 103 specimens showed IgG4-positive cell infiltration with various intensities; five of these were aortic valve specimens from aortic stenosis, and IgG4-positive cell infiltration was present at >10 /HPF in three of them. In one aortic wall sample from an abdominal aortic aneurysm, various histopathological features of IgG4-RD, such as IgG4-positive cell infiltration, obliterating phlebitis, and storiform fibrosis, were observed. IgG4-positive cell infiltration was observed in 9.7% of the surgical cardiovascular specimens, mainly in the aortic valve from aortic stenosis and in the aortic wall from aortic aneurysm. Whether IgG4-positive cell infiltration has pathophysiological importance in the development or progression of cardiovascular diseases should be investigated in future studies.

Characterization of Medicago populations under cold acclimation by ...

African Journals Online (AJOL)

SAM

2014-07-02

Jul 2, 2014 ... their metabolism and basic cell functioning biophysical constraints imposed by the transition to ... Plant material, growth conditions and cold stress treatment. The study was carried on four annuals ... and the root (LR) were measured at the end of each treatment on both the treated and control lots. LR and ...

Measurement of radon exhalation rates in some soil samples collected near the international monument Taj Mahal, Agra

International Nuclear Information System (INIS)

Sharma, Jyoti; Kumar, Rupesh; Indolia, R.S.; Swarup, R.; Mahur, A.K.; Singh, Hargyan; Sonkawade, R.G.

2011-01-01

Human beings are exposed to ionizing radiation from natural sources due to the occurrence of natural radioactive elements in solids, rocks, sand, soil etc. used as building construction materials and to the internal exposure from radioactive elements through good, water and air. Radon exhalation rate is of prime importance for the estimation of radiation risk from various materials. In the present study soil samples collected near the Tajmahal Agra. Sealed Can Technique was adopted for radon exhalation measurements. All the soil samples collected were grinded, dried and sieved through a 100 mesh sieve. Equal amount of each sieved (100μm grain size) sample (100 gm) was placed at the base of the Cans of 7.5 cm height and 7.0 cm diameter similar to those used in the calibration experiment (Singh et al., 1997). LR-115 type II plastic track detector (2 cm x 2 cm) was fixed on the top inside of the cylindrical Can. Radon exhalation rate varies from 529 mBqm -2 h -1 to 1254 mBqm -2 h -1 . The results will be presented. (author)

Measurement of radioactive nuclides present in soil samples of district Ganderbal of Kashmir Province for radiation safety purposes

Directory of Open Access Journals (Sweden)

Feroz A. Mir

2015-04-01

Full Text Available Assessment of radioactive elements in the residential area is very important from different points of view especially for human health. The aim of present survey was focused on determining the current radon exhalation rate and radium concentration in soil samples collected from some areas of the Ganderbal district, Jammu and Kashmir, India. “Can technique” has been employed for the measurement of radon exhalation rate and radium concentration in soil samples collected from under study areas. The Uranium concentration in these soil samples where estimated by using the fission track registration technique (using LR-115 plastic track detectors.The uranium concentration was found to varies between 2.03 and 3.52 ppm. The radon exhalation rate in these samples has been found to vary from 5.05 to 21.89 m Bq kg−1 h−1. Radium concentration in soil samples varies from 6.43 to 18.89 Bq kg−1. The calculated values of Uranium concentration in these soil/rock samples are quite lower than the risk level. Radon and radium values found in these samples are also lower than that of optimum value. Hence these areas can be considered as risk free zones from human health point of view.

Optical characterization of epidermal cells and their relationship to DNA recovery from touch samples [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Cristina E. Stanciu

2015-11-01

Full Text Available The goal of this study was to investigate the relative contributions of different cellular and genetic components to biological samples created by touch or contact with a surface – one of the most challenging forms of forensic evidence. Touch samples were generated by having individuals hold an object for five minutes and analyzed for quantity of intact epidermal cells, extracellular DNA, and DNA from pelleted cell material after elution from the collection swab. Comparisons were made between samples where individuals had washed their hands immediately prior to handling and those where hand washing was not controlled. The vast majority (84-100% of DNA detected in these touch samples was extracellular and was uncorrelated to the number of epidermal cells detected. Although little to no extracellular or cell pellet-associated DNA was detected when individuals washed their hands prior to substrate handling, we found that a significant number of epidermal cells (between ~5x103 and ~1x105 could still be recovered from these samples, suggesting that other types of biological information may be present even when no amplifiable nuclear DNA is present. These results help to elucidate the biological context for touch samples and characterize factors that may contribute to patterns of transfer and persistence of genetic material in forensic evidence.

A sealable ultrathin window sample cell for the study of liquids by means of soft X-ray spectroscopy

Science.gov (United States)

Grötzsch, D.; Streeck, C.; Nietzold, C.; Malzer, W.; Mantouvalou, I.; Nutsch, A.; Dietrich, P.; Unger, W.; Beckhoff, B.; Kanngießer, B.

2017-12-01

A new sample cell concept for the analysis of liquids or solid-liquid interfaces using soft X-ray spectroscopy is presented, which enables the complete sealing of the cell as well as the transport into vacuum via, for example, a load-lock system. The cell uses pressure monitoring and active as well as passive pressure regulation systems, thereby facilitating the full control over the pressure during filling, sealing, evacuation, and measurement. The cell design and sample preparation as well as the crucial sealing procedure are explained in detail. As a first proof-of-principle experiment, successful nitrogen K-edge fluorescence yield near-edge X-ray absorption fine structure experiments of a biomolecular solution are presented. For this purpose, it is shown that the careful evaluation of all involved parameters, such as window type or photon flux, is desirable for optimizing the experimental result.

In Vitro Efficient Expansion of Tumor Cells Deriving from Different Types of Human Tumor Samples

Directory of Open Access Journals (Sweden)

Ilaria Turin

2014-03-01

Full Text Available Obtaining human tumor cell lines from fresh tumors is essential to advance our understanding of antitumor immune surveillance mechanisms and to develop new ex vivo strategies to generate an efficient anti-tumor response. The present study delineates a simple and rapid method for efficiently establishing primary cultures starting from tumor samples of different types, while maintaining the immuno-histochemical characteristics of the original tumor. We compared two different strategies to disaggregate tumor specimens. After short or long term in vitro expansion, cells analyzed for the presence of malignant cells demonstrated their neoplastic origin. Considering that tumor cells may be isolated in a closed system with high efficiency, we propose this methodology for the ex vivo expansion of tumor cells to be used to evaluate suitable new drugs or to generate tumor-specific cytotoxic T lymphocytes or vaccines.

Determination of a Differential Item Functioning Procedure Using the Hierarchical Generalized Linear Model

Directory of Open Access Journals (Sweden)

Tülin Acar

2012-01-01

Full Text Available The aim of this research is to compare the result of the differential item functioning (DIF determining with hierarchical generalized linear model (HGLM technique and the results of the DIF determining with logistic regression (LR and item response theory–likelihood ratio (IRT-LR techniques on the test items. For this reason, first in this research, it is determined whether the students encounter DIF with HGLM, LR, and IRT-LR techniques according to socioeconomic status (SES, in the Turkish, Social Sciences, and Science subtest items of the Secondary School Institutions Examination. When inspecting the correlations among the techniques in terms of determining the items having DIF, it was discovered that there was significant correlation between the results of IRT-LR and LR techniques in all subtests; merely in Science subtest, the results of the correlation between HGLM and IRT-LR techniques were found significant. DIF applications can be made on test items with other DIF analysis techniques that were not taken to the scope of this research. The analysis results, which were determined by using the DIF techniques in different sample sizes, can be compared.

Diversity of cyanobacteria and the presence of cyanotoxins in the epilimnion of Lake Yerevan (Armenia).

Science.gov (United States)

Minasyan, Arevik; Christophoridis, Christophoros; Wilson, Alan E; Zervou, Sevasti-Kiriaki; Kaloudis, Triantafyllos; Hiskia, Anastasia

2018-04-26

This paper presents the first report of cyanobacteria and cyanotoxins from the South Caucasus region, in particular from Lake Yerevan (Armenia). Microcystis, Dolichospermum and Planktothrix were the key genera identified during the growing season. A trend of a remarkable increase in cyanobacterial densities was observed from 2012 to 2013 exhibiting bloom formation in June (by Nostoc linckia) with the highest values in June and August 2013, reaching up to 695.9*10 3  cells mL -1 . Seasonal dependence of cyanobacterial density on temperature, and temperature as a driver for cyanobacterial cells growth and development were suggested. Biogenic nutrients were identified as co-drivers determining species richness and dominance, as well as the distribution of phytoplankton in different parts of the reservoir. Cyanotoxin concentrations in the filtered biomass were reported during July 2012 for both stations of the reservoir (left and right bank). Microcystin-RR (MC-RR) was the most abundant and the most frequently observed cyanotoxin. Lower MC-LR concentrations were identified in all samples from both stations, with the highest values observed at the right bank in July 2012. [D-Asp 3 ]MC-RR, MC-YR, MC-HtyR, [D-Asp 3 ]MC-LR, MC-HilR, MC-WR, MC-LY and MC-LW were also identified in trace levels. Anatoxin-a (ANA) was reported in the samples from both stations during August 2012. Cylindrospermopsin (CYN) was present in trace concentrations in samples from both stations during July and in the sample from the left bank during September. Copyright © 2018 Elsevier Ltd. All rights reserved.

An Analysis of Source Tilting and Sub-cell Opacity Sampling for IMC

Energy Technology Data Exchange (ETDEWEB)

Wollaeger, Ryan T. [Los Alamos National Laboratory; Urbatsch, Todd J. [Los Alamos National Laboratory; Wollaber, Allan B. [Los Alamos National Laboratory; Densmore, Jeffery D. [Los Alamos National Laboratory

2012-08-02

Implicit Monte Carlo (IMC) is a stochastic method for solving the radiative transfer equations for multiphysics application with the material in local thermodynamic equilibrium. The IMC method employs a fictitious scattering term that is computed from an implicit discretization of the material temperature equation. Unfortunately, the original histogram representation of the temperature and opacity with respect to the spatial domain leads to nonphysically fast propagation of radiation waves through optically thick material. In the past, heuristic source tilting schemes have been used to mitigate the numerical teleportation error of the radiation particles in IMC that cause this overly rapid radiation wave propagation. While improving the material temperature profile throughout the time duration, these tilting schemes alone do not generally alleviate the teleportation error to suitable levels. Another means of potentially reducing teleportation error in IMC is implementing continuous sub-cell opacities based on sub-cell temperature profiles. We present here an analysis of source tilting and continuous sub-cell opacity sampling applied to various discretizations of the temperature equation. Through this analysis, we demonstrate that applying both heuristics does not necessarily yield more accurate results if the discretization of the material equation is inconsistent with the Monte Carlo sub-cell transport.