WorldWideScience

Sample records for lr sample cell

  1. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  2. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  4. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    Directory of Open Access Journals (Sweden)

    R. Greco

    2013-09-01

    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  5. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  6. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  7. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Directory of Open Access Journals (Sweden)

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  8. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  9. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  10. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  11. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  12. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  14. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Science.gov (United States)

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  15. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Science.gov (United States)

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

    2012-10-01

    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  16. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  17. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Science.gov (United States)

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

    2018-07-01

    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  18. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Science.gov (United States)

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

    2013-05-01

    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  19. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

    2014-04-18

    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  20. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    OpenAIRE

    Máthé, Csaba; Mikóné Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studi...

  1. Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

    Science.gov (United States)

    Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

    2017-03-01

    The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

  2. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  3. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  4. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  5. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  6. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  7. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  8. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  9. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  10. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  11. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  12. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  13. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  14. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  15. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  16. Protection of dystrophic muscle cells with polyphenols from green tea correlates with improved glutathione balance and increased expression of 67LR, a receptor for (-)-epigallocatechin gallate

    OpenAIRE

    Dorchies OM Wagner S Buetler TM Ruegg UT

    2009-01-01

    Duchenne muscular dystrophy (DMD) is a fatal muscle wasting disease caused by the absence of the protein dystrophin. Because oxidative stress contributes to the pathogenesis of DMD we investigated if a green tea polyphenol blend (GTP) and its major polyphenol ( ) epigallocatechin gallate (EGCg) could protect muscle cell primary cultures from oxidative damage induced by hydrogen peroxide (H(2)O(2)) in the widely used mdx mouse model. On line fluorimetric measurements using an H(2)O(2) sensitiv...

  17. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  18. B-cell waste classification sampling plan

    International Nuclear Information System (INIS)

    HOBART, R.L.

    1999-01-01

    This report documents the methods used to collect samples and analyze data necessary to verify and/or determine the radionuclide content of the 324 Facility B-Cell decontamination and decommissioning waste stream

  19. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  20. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  1. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  2. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  3. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  4. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  5. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  6. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  7. alpha-particle radioactivity from LR 115 by two methods of analysis

    CERN Document Server

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  8. WWER safety investigations on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  9. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  10. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  11. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  12. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  13. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  14. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  15. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  16. Absolute Transition Rates in {sup 188}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  17. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  18. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  19. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  20. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  1. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  2. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Tip chip : Subcellular sampling from single cancer cells

    NARCIS (Netherlands)

    Quist, Jos; Sarajlic, Edin; Lai, Stanley C.S.; Lemay, Serge G.

    2016-01-01

    To analyze the molecular content of single cells, cell lysis is typically required, yielding a snapshot of cell behavior only. To follow complex molecular profiles over time, subcellular sampling methods potentially can be used, but to date these methods involve laborious offline analysis. Here we

  4. Sampling strategies to capture single-cell heterogeneity

    OpenAIRE

    Satwik Rajaram; Louise E. Heinrich; John D. Gordan; Jayant Avva; Kathy M. Bonness; Agnieszka K. Witkiewicz; James S. Malter; Chloe E. Atreya; Robert S. Warren; Lani F. Wu; Steven J. Altschuler

    2017-01-01

    Advances in single-cell technologies have highlighted the prevalence and biological significance of cellular heterogeneity. A critical question is how to design experiments that faithfully capture the true range of heterogeneity from samples of cellular populations. Here, we develop a data-driven approach, illustrated in the context of image data, that estimates the sampling depth required for prospective investigations of single-cell heterogeneity from an existing collection of samples. ...

  5. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  6. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  7. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. B-Cell waste classification sampling and analysis plan

    International Nuclear Information System (INIS)

    HOBART, R.L.

    1999-01-01

    This report documents the methods used to collect and analyze samples to obtain data necessary to verify and/or determine the radionuclide content of the 324 Facility B-Cell decontamination and decommissioning waste stream

  9. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  10. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  11. Influence of Sampling Practices on the Appearance of DNA Image Histograms of Prostate Cells in FNAB Samples

    Directory of Open Access Journals (Sweden)

    Abdelbaset Buhmeida

    1999-01-01

    Full Text Available Twenty‐one fine needle aspiration biopsies (FNAB of the prostate, diagnostically classified as definitely malignant, were studied. The Papanicolaou or H&E stained samples were destained and then stained for DNA with the Feulgen reaction. DNA cytometry was applied after different sampling rules. The histograms varied according to the sampling rule applied. Because free cells between cell groups were easier to measure than cells in the cell groups, two sampling rules were tested in all samples: (i cells in the cell groups were measured, and (ii free cells between cell groups were measured. Abnormal histograms were more common after the sampling rule based on free cells, suggesting that abnormal patterns are best revealed through the free cells in these samples. The conclusions were independent of the applied histogram interpretation method.

  12. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  13. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  14. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  15. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  16. Bulk etch rate of LR-115 cellulose nitrate film

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  17. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    International Nuclear Information System (INIS)

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  18. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  19. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  20. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    International Nuclear Information System (INIS)

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  1. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  2. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Genomic Sequencing of Single Microbial Cells from Environmental Samples

    Energy Technology Data Exchange (ETDEWEB)

    Ishoey, Thomas; Woyke, Tanja; Stepanauskas, Ramunas; Novotny, Mark; Lasken, Roger S.

    2008-02-01

    Recently developed techniques allow genomic DNA sequencing from single microbial cells [Lasken RS: Single-cell genomic sequencing using multiple displacement amplification, Curr Opin Microbiol 2007, 10:510-516]. Here, we focus on research strategies for putting these methods into practice in the laboratory setting. An immediate consequence of single-cell sequencing is that it provides an alternative to culturing organisms as a prerequisite for genomic sequencing. The microgram amounts of DNA required as template are amplified from a single bacterium by a method called multiple displacement amplification (MDA) avoiding the need to grow cells. The ability to sequence DNA from individual cells will likely have an immense impact on microbiology considering the vast numbers of novel organisms, which have been inaccessible unless culture-independent methods could be used. However, special approaches have been necessary to work with amplified DNA. MDA may not recover the entire genome from the single copy present in most bacteria. Also, some sequence rearrangements can occur during the DNA amplification reaction. Over the past two years many research groups have begun to use MDA, and some practical approaches to single-cell sequencing have been developed. We review the consensus that is emerging on optimum methods, reliability of amplified template, and the proper interpretation of 'composite' genomes which result from the necessity of combining data from several single-cell MDA reactions in order to complete the assembly. Preferred laboratory methods are considered on the basis of experience at several large sequencing centers where >70% of genomes are now often recovered from single cells. Methods are reviewed for preparation of bacterial fractions from environmental samples, single-cell isolation, DNA amplification by MDA, and DNA sequencing.

  4. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  6. LR1: a candidate RNA virus of Leishmania.

    OpenAIRE

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  7. Detection of tumor-associated cells in cryopreserved peripheral blood mononuclear cell samples for retrospective analysis.

    Science.gov (United States)

    Zhu, Peixuan; Stanton, Melissa L; Castle, Erik P; Joseph, Richard W; Adams, Daniel L; Li, Shuhong; Amstutz, Platte; Tang, Cha-Mei; Ho, Thai H

    2016-07-02

    Cryopreserved peripheral blood mononuclear cells (PBMCs) are commonly collected in biobanks. However, little data exist regarding the preservation of tumor-associated cells in cryopreserved collections. The objective of this study was to determine the feasibility of using the CellSieve™ microfiltration assay for the isolation of circulating tumor cells (CTCs) and circulating cancer-associated macrophage-like cells (CAMLs) from cryopreserved PBMC samples. Blood samples spiked with breast (MCF-7), prostate (PC-3), and renal (786-O) cancer cell lines were used to establish analytical accuracy, efficiency, and reproducibility after cryopreservation. The spiked samples were processed through Ficoll separation, and cryopreservation was followed by thawing and microfiltration. MCF-7 cells were successfully retrieved with recovery efficiencies of 90.5 % without cryopreservation and 87.8 and 89.0 %, respectively, on day 7 and day 66 following cryopreservation. The corresponding recovery efficiencies of PC-3 cells were 83.3 % without cryopreservation and 85.3 and 84.7 %, respectively, after cryopreservation. Recovery efficiencies of 786-O cells were 92.7 % without cryopreservation, and 82.7 and 81.3 %, respectively, after cryopreservation. The recovered cells retained the morphologic characteristics and immunohistochemical markers that had been observed before freezing. The protocols were further validated by quantitation of CAMLs in blood samples from two patients with renal cell carcinoma (RCC). The recovery rates of CTCs and CAMLs from cryopreserved samples were not statistically significant different (P > 0.05) from matched fresh samples. To our knowledge, this is the first report that CAMLs could be cryopreserved and analyzed after thawing with microfiltration technology. The application of microfiltration technology to cryopreserved samples will enable much greater retrospective study of cancer patients in relation to long-term outcomes.

  8. A cell transportation solution that preserves live circulating tumor cells in patient blood samples.

    Science.gov (United States)

    Stefansson, Steingrimur; Adams, Daniel L; Ershler, William B; Le, Huyen; Ho, David H

    2016-05-06

    Circulating tumor cells (CTCs) are typically collected into CellSave fixative tubes, which kills the cells, but preserves their morphology. Currently, the clinical utility of CTCs is mostly limited to their enumeration. More detailed investigation of CTC biology can be performed on live cells, but obtaining live CTCs is technically challenging, requiring blood collection into biocompatible solutions and rapid isolation which limits transportation options. To overcome the instability of CTCs, we formulated a sugar based cell transportation solution (SBTS) that stabilizes cell viability at ambient temperature. In this study we examined the long term viability of human cancer cell lines, primary cells and CTCs in human blood samples in the SBTS for transportation purposes. Four cell lines, 5 primary human cells and purified human PBMCs were tested to determine the viability of cells stored in the transportation solution at ambient temperature for up to 7 days. We then demonstrated viability of MCF-7 cells spiked into normal blood with SBTS and stored for up to 7 days. A pilot study was then run on blood samples from 3 patients with metastatic malignancies stored with or without SBTS for 6 days. CTCs were then purified by Ficoll separation/microfilter isolation and identified using CTC markers. Cell viability was assessed using trypan blue or CellTracker™ live cell stain. Our results suggest that primary/immortalized cell lines stored in SBTS remain ~90% viable for > 72 h. Further, MCF-7 cells spiked into whole blood remain viable when stored with SBTS for up to 7 days. Finally, live CTCs were isolated from cancer patient blood samples kept in SBTS at ambient temperature for 6 days. No CTCs were isolated from blood samples stored without SBTS. In this proof of principle pilot study we show that viability of cell lines is preserved for days using SBTS. Further, this solution can be used to store patient derived blood samples for eventual isolation of viable CTCs after

  9. A cell transportation solution that preserves live circulating tumor cells in patient blood samples

    International Nuclear Information System (INIS)

    Stefansson, Steingrimur; Adams, Daniel L.; Ershler, William B.; Le, Huyen; Ho, David H.

    2016-01-01

    Circulating tumor cells (CTCs) are typically collected into CellSave fixative tubes, which kills the cells, but preserves their morphology. Currently, the clinical utility of CTCs is mostly limited to their enumeration. More detailed investigation of CTC biology can be performed on live cells, but obtaining live CTCs is technically challenging, requiring blood collection into biocompatible solutions and rapid isolation which limits transportation options. To overcome the instability of CTCs, we formulated a sugar based cell transportation solution (SBTS) that stabilizes cell viability at ambient temperature. In this study we examined the long term viability of human cancer cell lines, primary cells and CTCs in human blood samples in the SBTS for transportation purposes. Four cell lines, 5 primary human cells and purified human PBMCs were tested to determine the viability of cells stored in the transportation solution at ambient temperature for up to 7 days. We then demonstrated viability of MCF-7 cells spiked into normal blood with SBTS and stored for up to 7 days. A pilot study was then run on blood samples from 3 patients with metastatic malignancies stored with or without SBTS for 6 days. CTCs were then purified by Ficoll separation/microfilter isolation and identified using CTC markers. Cell viability was assessed using trypan blue or CellTracker™ live cell stain. Our results suggest that primary/immortalized cell lines stored in SBTS remain ~90 % viable for > 72 h. Further, MCF-7 cells spiked into whole blood remain viable when stored with SBTS for up to 7 days. Finally, live CTCs were isolated from cancer patient blood samples kept in SBTS at ambient temperature for 6 days. No CTCs were isolated from blood samples stored without SBTS. In this proof of principle pilot study we show that viability of cell lines is preserved for days using SBTS. Further, this solution can be used to store patient derived blood samples for eventual isolation of viable CTCs

  10. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  11. Controls to validate plasma samples for cell free DNA quantification

    DEFF Research Database (Denmark)

    Pallisgaard, Niels; Spindler, Karen-Lise Garm; Andersen, Rikke Fredslund

    2015-01-01

    , are diverging due to methodological differences with lack of standardisation and definition of sensitivity. The new biological information has not yet come into routine use. The present study presents external standardisation by spiking with non-human DNA fragments to control for loss of DNA during sample...... preparation and measurement. It also suggests a method to control for admixture of DNA from normal lymphocytes by utilizing the unique immunoglobulin gene rearrangement in the B-cells. The results show that this approach improves the quality of the analysis and lowers the risk of falsely increased values...

  12. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  13. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  14. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  15. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  16. Perturbation measurements in reactor LR-0 and their evaluation

    International Nuclear Information System (INIS)

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  17. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  18. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  20. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

    2018-03-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  1. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  3. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  4. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  5. Sampling

    CERN Document Server

    Thompson, Steven K

    2012-01-01

    Praise for the Second Edition "This book has never had a competitor. It is the only book that takes a broad approach to sampling . . . any good personal statistics library should include a copy of this book." —Technometrics "Well-written . . . an excellent book on an important subject. Highly recommended." —Choice "An ideal reference for scientific researchers and other professionals who use sampling." —Zentralblatt Math Features new developments in the field combined with all aspects of obtaining, interpreting, and using sample data Sampling provides an up-to-date treat

  6. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  7. Reliable single cell array CGH for clinical samples.

    Directory of Open Access Journals (Sweden)

    Zbigniew T Czyż

    Full Text Available BACKGROUND: Disseminated cancer cells (DCCs and circulating tumor cells (CTCs are extremely rare, but comprise the precursors cells of distant metastases or therapy resistant cells. The detailed molecular analysis of these cells may help to identify key events of cancer cell dissemination, metastatic colony formation and systemic therapy escape. METHODOLOGY/PRINCIPAL FINDINGS: Using the Ampli1™ whole genome amplification (WGA technology and high-resolution oligonucleotide aCGH microarrays we optimized conditions for the analysis of structural copy number changes. The protocol presented here enables reliable detection of numerical genomic alterations as small as 0.1 Mb in a single cell. Analysis of single cells from well-characterized cell lines and single normal cells confirmed the stringent quantitative nature of the amplification and hybridization protocol. Importantly, fixation and staining procedures used to detect DCCs showed no significant impact on the outcome of the analysis, proving the clinical usability of our method. In a proof-of-principle study we tracked the chromosomal changes of single DCCs over a full course of high-dose chemotherapy treatment by isolating and analyzing DCCs of an individual breast cancer patient at four different time points. CONCLUSIONS/SIGNIFICANCE: The protocol enables detailed genome analysis of DCCs and thereby assessment of the clonal evolution during the natural course of the disease and under selection pressures. The results from an exemplary patient provide evidence that DCCs surviving selective therapeutic conditions may be recruited from a pool of genomically less advanced cells, which display a stable subset of specific genomic alterations.

  8. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Directory of Open Access Journals (Sweden)

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  9. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    Science.gov (United States)

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

    2002-01-01

    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  10. Screening disrupted molecular functions and pathways associated with clear cell renal cell carcinoma using Gibbs sampling.

    Science.gov (United States)

    Nan, Ning; Chen, Qi; Wang, Yu; Zhai, Xu; Yang, Chuan-Ce; Cao, Bin; Chong, Tie

    2017-10-01

    To explore the disturbed molecular functions and pathways in clear cell renal cell carcinoma (ccRCC) using Gibbs sampling. Gene expression data of ccRCC samples and adjacent non-tumor renal tissues were recruited from public available database. Then, molecular functions of expression changed genes in ccRCC were classed to Gene Ontology (GO) project, and these molecular functions were converted into Markov chains. Markov chain Monte Carlo (MCMC) algorithm was implemented to perform posterior inference and identify probability distributions of molecular functions in Gibbs sampling. Differentially expressed molecular functions were selected under posterior value more than 0.95, and genes with the appeared times in differentially expressed molecular functions ≥5 were defined as pivotal genes. Functional analysis was employed to explore the pathways of pivotal genes and their strongly co-regulated genes. In this work, we obtained 396 molecular functions, and 13 of them were differentially expressed. Oxidoreductase activity showed the highest posterior value. Gene composition analysis identified 79 pivotal genes, and survival analysis indicated that these pivotal genes could be used as a strong independent predictor of poor prognosis in patients with ccRCC. Pathway analysis identified one pivotal pathway - oxidative phosphorylation. We identified the differentially expressed molecular functions and pivotal pathway in ccRCC using Gibbs sampling. The results could be considered as potential signatures for early detection and therapy of ccRCC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  12. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  13. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  14. Evaluating hepatocellular carcinoma cell lines for tumour samples using within-sample relative expression orderings of genes.

    Science.gov (United States)

    Ao, Lu; Guo, You; Song, Xuekun; Guan, Qingzhou; Zheng, Weicheng; Zhang, Jiahui; Huang, Haiyan; Zou, Yi; Guo, Zheng; Wang, Xianlong

    2017-11-01

    Concerns are raised about the representativeness of cell lines for tumours due to the culture environment and misidentification. Liver is a major metastatic destination of many cancers, which might further confuse the origin of hepatocellular carcinoma cell lines. Therefore, it is of crucial importance to understand how well they can represent hepatocellular carcinoma. The HCC-specific gene pairs with highly stable relative expression orderings in more than 99% of hepatocellular carcinoma but with reversed relative expression orderings in at least 99% of one of the six types of cancer, colorectal carcinoma, breast carcinoma, non-small-cell lung cancer, gastric carcinoma, pancreatic carcinoma and ovarian carcinoma, were identified. With the simple majority rule, the HCC-specific relative expression orderings from comparisons with colorectal carcinoma and breast carcinoma could exactly discriminate primary hepatocellular carcinoma samples from both primary colorectal carcinoma and breast carcinoma samples. Especially, they correctly classified more than 90% of liver metastatic samples from colorectal carcinoma and breast carcinoma to their original tumours. Finally, using these HCC-specific relative expression orderings from comparisons with six cancer types, we identified eight of 24 hepatocellular carcinoma cell lines in the Cancer Cell Line Encyclopedia (Huh-7, Huh-1, HepG2, Hep3B, JHH-5, JHH-7, C3A and Alexander cells) that are highly representative of hepatocellular carcinoma. Evaluated with a REOs-based prognostic signature for hepatocellular carcinoma, all these eight cell lines showed the same metastatic properties of the high-risk metastatic hepatocellular carcinoma tissues. Caution should be taken for using hepatocellular carcinoma cell lines. Our results should be helpful to select proper hepatocellular carcinoma cell lines for biological experiments. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. A new and standardized method to sample and analyse vitreous samples by the Cellient automated cell block system.

    Science.gov (United States)

    Van Ginderdeuren, Rita; Van Calster, Joachim; Stalmans, Peter; Van den Oord, Joost

    2014-08-01

    In this prospective study, a universal protocol for sampling and analysing vitreous material was investigated. Vitreous biopsies are difficult to handle because of the paucity of cells and the gelatinous structure of the vitreous. Histopathological analysis of the vitreous is useful in difficult uveitis cases to differentiate uveitis from lymphoma or infection and to define the type of cellular reaction. Hundred consecutive vitreous samples were analysed with the Cellient tissue processor (Hologic). This machine is a fully automated processor starting from a specified container with PreservCyt (fixative fluid) with cells to paraffin. Cytology was compared with fixatives Cytolyt (contains a mucolyticum) and PreservCyt. Routine histochemical and immunostainings were evaluated. In 92% of the cases, sufficient material was found for diagnosis. In 14%, a Cytolyt wash was necessary to prevent clotting of the tubes in the Cellient due to the viscosity of the sample. In 23%, the diagnosis was an acute inflammation (presence of granulocytes); in 33%, chronic active inflammation (presence of T lymphocytes); in 33%, low-grade inflammation (presence of CD68 cells, without T lymphocytes); and in 3%, a malignant process. A standardized protocol for sampling and handling vitreous biopsies, fixing in PreservCyt and processing by the Cellient gives a satisfactory result in morphology, number of cells and possibility of immuno-histochemical stainings. The diagnosis can be established or confirmed in more than 90% of cases. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  16. Green synthesis of nitrogen-doped carbon dots from lotus root for Hg(II) ions detection and cell imaging

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Dan; Shang, Shaoming, E-mail: smshang@jiangnan.edu.cn; Yu, Qin; Shen, Jie

    2016-12-30

    Graphical abstract: Fluorescent nitrogen-doped carbon dots were synthesized by a facile, green, and fast microwave method, using lotus root as carbon source. These nitrogen-doped carbon dots can be used for Hg{sup 2+} detection and cell imaging. - Highlights: • A green, fast strategy for synthesizing carbon dots was established. • A simple, sensitive, selective and wide linear range sensing of Hg{sup 2+} was developed. • The sensor system was demonstrated to detect Hg{sup 2+} in environmental water sample. • The carbon dots could serve for multicolor fluorescence bioimaging. - Abstract: Herein, a facile, green, and fast method was developed in the synthesis of fluorescent nitrogen-doped carbon dots (CDs) with nitrogen content of 5.23%, using one-pot microwave treatment of lotus root (LR), without using any other surface passivation agents. The results show that these LR-CDs (with an average diameter of 9.41 nm) possess many outstanding features and have a high quantum yield of 19.0%. We further demonstrated applications of LR-CDs as probes for heavy metal ion detection. The LR-CDs exhibit captivating sensitivity and selectivity toward Hg{sup 2+} with a linear range from 0.1 to 60.0 μM and a detection limit of 18.7 nM. Eventually, the LR-CDs were applied for multicolor cell imaging, demonstrating their potential toward diverse applications.

  17. Sample preparation by cell guiding using negative dielectrophoresis

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Pedersen, Christian Møller; Bang, Dang Duong

    2007-01-01

    and a decreased efficiency with increased flowrate is observed. In addition, the DEP behaviour of the yeast cells at different medium conductivities and applied frequencies is investigated. The chip is easily fabricated in a two-step process: Standard UV lithography techniques are used for electrode fabrication...

  18. Quantitation of ranaviruses in cell culture and tissue samples

    DEFF Research Database (Denmark)

    Holopainen, Riikka; Honkanen, Jarno; Jensen, Britt Bang

    2011-01-01

    ; European sheatfish virus, ESV; Frog virus 3, FV3; Bohle iridovirus, BIV; Doctor fish virus, DFV; Guppy virus 6, GV6; Pike-perch iridovirus, PPIV; Rana esculenta virus Italy 282/I02, REV282/I02 and Short-finned eel ranavirus, SERV) were detected with the qPCR assay. In addition, two fish cell lines...

  19. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  20. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  1. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  2. Universal nucleic acids sample preparation method for cells, spores and their mixture

    Science.gov (United States)

    Bavykin, Sergei [Darien, IL

    2011-01-18

    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

  3. Effects of sample treatments on genome recovery via single-cell genomics

    Energy Technology Data Exchange (ETDEWEB)

    Clingenpeel, Scott [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Schwientek, Patrick [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Hugenholtz, Philip [Univ. of Queensland, Brisbane (Australia); Woyke, Tanja [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States)

    2014-06-13

    It is known that single-cell genomics is a powerful tool for accessing genetic information from uncultivated microorganisms. Methods of handling samples before single-cell genomic amplification may affect the quality of the genomes obtained. Using three bacterial strains we demonstrate that, compared to cryopreservation, lower-quality single-cell genomes are recovered when the sample is preserved in ethanol or if the sample undergoes fluorescence in situ hybridization, while sample preservation in paraformaldehyde renders it completely unsuitable for sequencing.

  4. Transmission electron microscope cells for use with liquid samples

    Science.gov (United States)

    Khalid, Waqas; Alivisatos, Paul A.; Zettl, Alexander K.

    2016-08-09

    This disclosure provides systems, methods, and devices related to transmission electron microscopy cells for use with liquids. In one aspect a device includes a substrate, a first graphene layer, and a second graphene layer. The substrate has a first surface and a second surface. The first surface defines a first channel, a second channel, and an outlet channel. The first channel and the second channel are joined to the outlet channel. The outlet channel defines a viewport region forming a though hole in the substrate. The first graphene layer overlays the first surface of the substrate, including an interior area of the first channel, the second channel, and the outlet channel. The second graphene layer overlays the first surface of the substrate, including open regions defined by the first channel, the second channel, and the outlet channel.

  5. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  6. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  7. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  8. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  9. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  10. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. Extraction of nucleic acids from yeast cells and plant tissues using ethanol as medium for sample preservation and cell disruption.

    Science.gov (United States)

    Linke, Bettina; Schröder, Kersten; Arter, Juliane; Gasperazzo, Tatiana; Woehlecke, Holger; Ehwald, Rudolf

    2010-09-01

    Here we report that dehydrated ethanol is an excellent medium for both in situ preservation of nucleic acids and cell disruption of plant and yeast cells. Cell disruption was strongly facilitated by prior dehydration of the ethanol using dehydrated zeolite. Following removal of ethanol, nucleic acids were extracted from the homogenate pellet using denaturing buffers. The method provided DNA and RNA of high yield and integrity. Whereas cell wall disruption was essential for extraction of DNA and large RNA molecules, smaller molecules such as tRNAs could be selectively extracted from undisrupted, ethanol-treated yeast cells. Our results demonstrate the utility of absolute ethanol for sample fixation, cell membrane and cell wall disruption, as well as preservation of nucleic acids during sample storage.

  12. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  13. Hierarchical modeling for rare event detection and cell subset alignment across flow cytometry samples.

    Directory of Open Access Journals (Sweden)

    Andrew Cron

    Full Text Available Flow cytometry is the prototypical assay for multi-parameter single cell analysis, and is essential in vaccine and biomarker research for the enumeration of antigen-specific lymphocytes that are often found in extremely low frequencies (0.1% or less. Standard analysis of flow cytometry data relies on visual identification of cell subsets by experts, a process that is subjective and often difficult to reproduce. An alternative and more objective approach is the use of statistical models to identify cell subsets of interest in an automated fashion. Two specific challenges for automated analysis are to detect extremely low frequency event subsets without biasing the estimate by pre-processing enrichment, and the ability to align cell subsets across multiple data samples for comparative analysis. In this manuscript, we develop hierarchical modeling extensions to the Dirichlet Process Gaussian Mixture Model (DPGMM approach we have previously described for cell subset identification, and show that the hierarchical DPGMM (HDPGMM naturally generates an aligned data model that captures both commonalities and variations across multiple samples. HDPGMM also increases the sensitivity to extremely low frequency events by sharing information across multiple samples analyzed simultaneously. We validate the accuracy and reproducibility of HDPGMM estimates of antigen-specific T cells on clinically relevant reference peripheral blood mononuclear cell (PBMC samples with known frequencies of antigen-specific T cells. These cell samples take advantage of retrovirally TCR-transduced T cells spiked into autologous PBMC samples to give a defined number of antigen-specific T cells detectable by HLA-peptide multimer binding. We provide open source software that can take advantage of both multiple processors and GPU-acceleration to perform the numerically-demanding computations. We show that hierarchical modeling is a useful probabilistic approach that can provide a

  14. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  15. Data quality objectives for the B-Cell waste stream classification sampling

    International Nuclear Information System (INIS)

    Barnett, J.M.

    1998-01-01

    This document defines the data quality objectives, (DQOS) for sampling the B-Cell racks waste stream. The sampling effort is concentrated on determining a ratio of Cs-137 to Sr-90 and Cs-137 to transuranics (TRU). Figure 1.0 shows the logic path of sampling effort. The flow chart begins with sample and data acquisition and progresses toward (a) statistical confidence and waste classification boundaries, (b) management decisions based on the input parameters and technical methods available, and (c) grout container volume/weight limits and radiation limits. The end result will be accurately classifying the B-Cell rack waste stream

  16. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    user

    2011-01-17

    Jan 17, 2011 ... The water quality of the shallow hand dug wells and reservoir water were almost similar. .... formation of Sibasa basalt in the area (SRR, 2001). The cyanobacteria usually ... 3D). The nitrate level in sampling site 2 exceeded 6 mg/l. DWAF guideline .... The 1 µg/l is the safe limit suggested by the Word. Health ...

  17. Action potential conduction between a ventricular cell model and an isolated ventricular cell

    NARCIS (Netherlands)

    Wilders, R.; Kumar, R.; Joyner, R. W.; Jongsma, H. J.; Verheijck, E. E.; Golod, D.; van Ginneken, A. C.; Goolsby, W. N.

    1996-01-01

    We used the Luo and Rudy (LR) mathematical model of the guinea pig ventricular cell coupled to experimentally recorded guinea pig ventricular cells to investigate the effects of geometrical asymmetry on action potential propagation. The overall correspondence of the LR cell model with the recorded

  18. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  19. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    CERN Document Server

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  20. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Science.gov (United States)

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  1. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  2. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  3. Sample cell for in-field X-ray diffraction experiments

    Directory of Open Access Journals (Sweden)

    Viktor Höglin

    2015-01-01

    Full Text Available A sample cell making it possible to perform synchrotron radiation X-ray powder diffraction experiments in a magnetic field of 0.35 T has been constructed. The device is an add-on to an existing sample cell and contains a strong permanent magnet of NdFeB-type. Experiments have shown that the setup is working satisfactory making it possible to perform in-field measurements.

  4. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  5. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    NARCIS (Netherlands)

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  6. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  7. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  8. EVALUATION OF ZEBU NELLORE CATTLE BLOOD SAMPLES USING THE CELL-DYN 3500 HEMATOLOGY ANALYZER

    Directory of Open Access Journals (Sweden)

    Alexandre Secorun Borges

    2014-12-01

    Full Text Available The Cell-dyn 3500 is a multiparameter flow cytometer, which may analyze samples from several species performing several simultaneous analyses. It is able to perform white blood cells, red blood cells and platelet counts, besides differential leukocyte counts, packed cell volume and hemoglobin determination. Cell-Dyn 3500 performs total leukocyte count both optically and by impedance. The equipment may choose one or other method, based on the reliability of the results. Erythrocyte and platelet counts are determined by impedance. Leukocyte differentiation is based on an optical principle, using separation in multiangular polarized light. The objective of this study was to compare the results of complete blood count of Zebu Nellore heifers from Celldyn 3500, with those obtained from a semi-automated cell counter (Celm CC 510 and the manual technique. Blood samples were collected from the jugular vein in 5 mL EDTA vacuum tubes from 58 Nellore heifers, at 24 months of age. Samples were processed in parallel in the three different techniques. Results were analyzed using paired t test, Pearson’s correlation and the Bland-Altmann method. There was a strong correlation for all parameters analyzed by Cell-Dyn 3500, manual method and semiautomated cell counter, except for basophils and monocytes counts. These results confirm that this analyzer is reliable for blood samples analysis of zebu cattle.

  9. Novel diffusion cell for in vitro transdermal permeation, compatible with automated dynamic sampling

    NARCIS (Netherlands)

    Bosman, I.J; Lawant, A.L; Avegaart, S.R.; Ensing, K; de Zeeuw, R.A

    The development of a new diffusion cell for in vitro transdermal permeation is described. The so-called Kelder cells were used in combination with the ASPEC system (Automatic Sample Preparation with Extraction Columns), which is designed for the automation of solid-phase extractions (SPE). Instead

  10. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Short communication: Influence of the sampling device on somatic cell count variation in cow milk samples (by official recording)

    International Nuclear Information System (INIS)

    Fouz, R.; Vilar, M.J.; Yus, E.; Sanjuán, M.L.; Diéguez, F.J.

    2016-01-01

    The objective of this study was to investigate the variability in cow´s milk somatic cell counts (SCC) depending on the type of milk meter used by dairy farms for official milk recording. The study was performed in 2011 and 2012 in the major cattle area of Spain. In total, 137,846 lactations of Holstein-Friesian cows were analysed at 1,912 farms. A generalised least squares regression model was used for data analysis. The model showed that the milk meter had a substantial effect on the SCC for individual milk samples obtained for official milk recording. The results suggested an overestimation of the SCC in milk samples from farms that had electronic devices in comparison with farms that used portable devices and underestimation when volumetric meters are used. A weak positive correlation was observed between the SCC and the percentage of fat in individual milk samples. The results underline the importance of considering this variable when using SCC data from milk recording in the dairy herd improvement program or in quality milk programs. (Author)

  12. Short communication: Influence of the sampling device on somatic cell count variation in cow milk samples (by official recording)

    Energy Technology Data Exchange (ETDEWEB)

    Fouz, R.; Vilar, M.J.; Yus, E.; Sanjuán, M.L.; Diéguez, F.J.

    2016-11-01

    The objective of this study was to investigate the variability in cow´s milk somatic cell counts (SCC) depending on the type of milk meter used by dairy farms for official milk recording. The study was performed in 2011 and 2012 in the major cattle area of Spain. In total, 137,846 lactations of Holstein-Friesian cows were analysed at 1,912 farms. A generalised least squares regression model was used for data analysis. The model showed that the milk meter had a substantial effect on the SCC for individual milk samples obtained for official milk recording. The results suggested an overestimation of the SCC in milk samples from farms that had electronic devices in comparison with farms that used portable devices and underestimation when volumetric meters are used. A weak positive correlation was observed between the SCC and the percentage of fat in individual milk samples. The results underline the importance of considering this variable when using SCC data from milk recording in the dairy herd improvement program or in quality milk programs. (Author)

  13. Large-scale prospective T cell function assays in shipped, unfrozen blood samples

    DEFF Research Database (Denmark)

    Hadley, David; Cheung, Roy K; Becker, Dorothy J

    2014-01-01

    , for measuring core T cell functions. The Trial to Reduce Insulin-dependent diabetes mellitus in the Genetically at Risk (TRIGR) type 1 diabetes prevention trial used consecutive measurements of T cell proliferative responses in prospectively collected fresh heparinized blood samples shipped by courier within...... cell immunocompetence. We have found that the vast majority of the samples were viable up to 3 days from the blood draw, yet meaningful responses were found in a proportion of those with longer travel times. Furthermore, the shipping time of uncooled samples significantly decreased both the viabilities...... North America. In this article, we report on the quality control implications of this simple and pragmatic shipping practice and the interpretation of positive- and negative-control analytes in our assay. We used polyclonal and postvaccination responses in 4,919 samples to analyze the development of T...

  14. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  15. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  16. Determination of blood cell subtype concentrations from frozen whole blood samples using TruCount beads.

    Science.gov (United States)

    Langenskiöld, Cecilia; Mellgren, Karin; Abrahamsson, Jonas; Bemark, Mats

    2016-06-24

    In many studies it would be advantageous if blood samples could be collected and analyzed using flow cytometry at a later stage. Ideally, sample collection should involve little hands-on time, allow for long-term storage, and minimally influence the samples. Here we establish a flow cytometry antibody panel that can be used to determine granulocytes, monocytes, and lymphocyte subset concentrations in fresh and frozen whole blood using TruCount technology. The panel can be used on fresh whole-blood samples as well as whole-blood samples that have been frozen after mixing with 10% DMSO. Concentrations in frozen and fresh sample is highly correlated both when frozen within 4 h and the day after collection (r ≥ 0.98), and the estimated concentration in frozen samples was between 91 and 94% of that in fresh samples for all cell types. Using this method whole-blood samples can be frozen using a simple preparation method, and stored long-term before accurate determination of cell concentration. This allows for standardized analysis of the samples at a reference laboratory in multi-center studies. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  17. A systematic assessment of goblet cell sampling of the bulbar conjunctiva by impression cytology.

    Science.gov (United States)

    Doughty, Michael J

    2015-07-01

    The purpose of this study was to assess the apparent goblet cell density (GCD) from conjunctival impression cytology (CIC) samples in relation to the number of conjunctival cells collected onto the filters. CIC specimens were collected from the superior-temporal bulbar conjunctiva of 16 pigmented rabbits onto Biopore (Millicell-CM) membranes, fixed with buffered glutaraldehyde and stained with Giemsa. Different numbers of microscope fields of view in each of the specimens were imaged by light microscopy using a 20× magnification objective lens (200× final magnification), and the goblet cells marked and counted. The GCD values/sq. mm were calculated. The same conjunctival region of 3 other rabbits was also prepared for transmission electron microscopy (TEM) by fixation, in situ, with the same buffered glutaraldehyde. Mean values for GCD estimates were found to vary from 399 to 1576 cells/sq. mm, depending on the image sampling and analysis strategy chosen, with the lowest inter-sample variance of around 10% being found if a maximum goblet cell count was taken on substantially multilayered regions of the CIC specimens. Counts of the number of goblet cells per 1000 visible conjunctival epithelial cells yielded a value of close to 90 (range 36-151), with modest inter-sample variability of around 30%. A three or ten 200× microscope field and random sampling strategy yielded mean GCD values between 542 and 670 cells/sq. mm, but with very high intra- and inter-sample variance of at least 60% and sometimes higher than 100%. TEM confirmed the multilayered organization of the conjunctiva and the deeper lying goblet cells. The general use of a goblet cell count as an objective marker for conjunctival normality or health is likely to be highly variable unless a more specific strategy is adopted. Beyond providing details of exactly the counting strategy used, it would be very useful to provide full details of the actual microscope field size used as well as information on

  18. Multispectral Imaging Analysis of Circulating Tumor Cells in Negatively Enriched Peripheral Blood Samples.

    Science.gov (United States)

    Miller, Brandon; Lustberg, Maryam; Summers, Thomas A; Chalmers, Jeffrey J

    2017-01-01

    A variety of biomarkers are present on cells in peripheral blood of patients with a variety of disorders, including solid tumor malignancies. While rare, characterization of these cells for specific protein levels with the advanced technology proposed, will lead to future validation studies of blood samples as "liquid biopsies" for the evaluation of disease status and therapeutic response. While circulating tumor cells (CTCs) have been isolated in the blood samples of patients with solid tumors, the exact role of CTCs as clinically useful predictive markers is still debated. Current commercial technology has significant bias in that a positive selection technology is used that preassumes specific cell surface markers (such as EpCAM) are present on CTCs. However, CTCs with low EpCAM expression have been experimentally demonstrated to be more likely to be missed by this method. In contrast, this application uses a previously developed, technology that performs a purely negative enrichment methodology on peripheral blood, yielding highly enriched blood samples that contain CTCs as well as other, undefined cell types. The focus of this contribution is the use of multispectral imaging of epifluorescent, microscopic images of these enriched cells in order to help develop clinically relevant liquid biopsies from peripheral blood samples.

  19. Suitability of small diagnostic peripheral-blood samples for cell-therapy studies.

    Science.gov (United States)

    Stephanou, Coralea; Papasavva, Panayiota; Zachariou, Myria; Patsali, Petros; Epitropou, Marilena; Ladas, Petros; Al-Abdulla, Ruba; Christou, Soteroulla; Antoniou, Michael N; Lederer, Carsten W; Kleanthous, Marina

    2017-02-01

    Primary hematopoietic stem and progenitor cells (HSPCs) are key components of cell-based therapies for blood disorders and are thus the authentic substrate for related research. We propose that ubiquitous small-volume diagnostic samples represent a readily available and as yet untapped resource of primary patient-derived cells for cell- and gene-therapy studies. In the present study we compare isolation and storage methods for HSPCs from normal and thalassemic small-volume blood samples, considering genotype, density-gradient versus lysis-based cell isolation and cryostorage media with different serum contents. Downstream analyses include viability, recovery, differentiation in semi-solid media and performance in liquid cultures and viral transductions. We demonstrate that HSPCs isolated either by ammonium-chloride potassium (ACK)-based lysis or by gradient isolation are suitable for functional analyses in clonogenic assays, high-level HSPC expansion and efficient lentiviral transduction. For cryostorage of cells, gradient isolation is superior to ACK lysis, and cryostorage in freezing media containing 50% fetal bovine serum demonstrated good results across all tested criteria. For assays on freshly isolated cells, ACK lysis performed similar to, and for thalassemic samples better than, gradient isolation, at a fraction of the cost and hands-on time. All isolation and storage methods show considerable variation within sample groups, but this is particularly acute for density gradient isolation of thalassemic samples. This study demonstrates the suitability of small-volume blood samples for storage and preclinical studies, opening up the research field of HSPC and gene therapy to any blood diagnostic laboratory with corresponding bioethics approval for experimental use of surplus material. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  20. Purifying, Separating, and Concentrating Cells From a Sample Low in Biomass

    Science.gov (United States)

    Benardini, James N.; LaDuc, Myron T.; Diamond, Rochelle

    2012-01-01

    Frequently there is an inability to process and analyze samples of low biomass due to limiting amounts of relevant biomaterial in the sample. Furthermore, molecular biological protocols geared towards increasing the density of recovered cells and biomolecules of interest, by their very nature, also concentrate unwanted inhibitory humic acids and other particulates that have an adversarial effect on downstream analysis. A novel and robust fluorescence-activated cell-sorting (FACS)-based technology has been developed for purifying (removing cells from sampling matrices), separating (based on size, density, morphology), and concentrating cells (spores, prokaryotic, eukaryotic) from a sample low in biomass. The technology capitalizes on fluorescent cell-sorting technologies to purify and concentrate bacterial cells from a low-biomass, high-volume sample. Over the past decade, cell-sorting detection systems have undergone enhancements and increased sensitivity, making bacterial cell sorting a feasible concept. Although there are many unknown limitations with regard to the applicability of this technology to environmental samples (smaller cells, few cells, mixed populations), dogmatic principles support the theoretical effectiveness of this technique upon thorough testing and proper optimization. Furthermore, the pilot study from which this report is based proved effective and demonstrated this technology capable of sorting and concentrating bacterial endospore and bacterial cells of varying size and morphology. Two commercial off-the-shelf bacterial counting kits were used to optimize a bacterial stain/dye FACS protocol. A LIVE/DEAD BacLight Viability and Counting Kit was used to distinguish between the live and dead cells. A Bacterial Counting Kit comprising SYTO BC (mixture of SYTO dyes) was employed as a broad-spectrum bacterial counting agent. Optimization using epifluorescence microscopy was performed with these two dye/stains. This refined protocol was further

  1. The outcome of dimethylglyoxime testing in a sample of cell phones in Denmark

    DEFF Research Database (Denmark)

    Thyssen, Jacob Pontoppidan; Johansen, Jeanne D; Zachariae, Claus

    2008-01-01

    BACKGROUND: Nickel dermatitis may be caused by frequent and prolonged use of cell phones. Because little is known about the frequency of nickel release from cell phones, it is difficult to estimate the risk of nickel sensitization and dermatitis among their users. OBJECTIVE: Inspired by a recent...... case of nickel dermatitis from prolonged cell phone use, the frequency of dimethylglyoxime (DMG)-positive cell phones on the Danish market was investigated. METHODS: Five major cell phone companies were contacted. Two were visited, and the DMG test was performed on a sample of their products. RESULTS...... phones from the Danish market. Prolonged use of cell phones may in some cases fulfil the criteria for items included in the European Union Nickel Directive. We believe that this new cause of nickel dermatitis should be carefully followed and that regulatory steps may be necessary....

  2. The outcome of dimethylglyoxime testing in a sample of cell phones in Denmark

    DEFF Research Database (Denmark)

    Thyssen, J.P.; Johansen, J.D.; Zachariae, C.

    2008-01-01

    Background: Nickel dermatitis may be caused by frequent and prolonged use of cell phones. Because little is known about the frequency of nickel release from cell phones, it is difficult to estimate the risk of nickel sensitization and dermatitis among their users. Objective: Inspired by a recent...... case of nickel dermatitis from prolonged cell phone use, the frequency of dimethylglyoxime (DMG)-positive cell phones on the Danish market was investigated. Methods: Five major cell phone companies were contacted. Two were visited, and the DMG test was performed on a sample of their products. Results...... phones from the Danish market. Prolonged use of cell phones may in some cases fulfil the criteria for items included in the European Union Nickel Directive. We believe that this new cause of nickel dermatitis should be carefully followed and that regulatory steps may be necessary Udgivelsesdato: 2008...

  3. Automated cell counts on CSF samples: A multicenter performance evaluation of the GloCyte system.

    Science.gov (United States)

    Hod, E A; Brugnara, C; Pilichowska, M; Sandhaus, L M; Luu, H S; Forest, S K; Netterwald, J C; Reynafarje, G M; Kratz, A

    2018-02-01

    Automated cell counters have replaced manual enumeration of cells in blood and most body fluids. However, due to the unreliability of automated methods at very low cell counts, most laboratories continue to perform labor-intensive manual counts on many or all cerebrospinal fluid (CSF) samples. This multicenter clinical trial investigated if the GloCyte System (Advanced Instruments, Norwood, MA), a recently FDA-approved automated cell counter, which concentrates and enumerates red blood cells (RBCs) and total nucleated cells (TNCs), is sufficiently accurate and precise at very low cell counts to replace all manual CSF counts. The GloCyte System concentrates CSF and stains RBCs with fluorochrome-labeled antibodies and TNCs with nucleic acid dyes. RBCs and TNCs are then counted by digital image analysis. Residual adult and pediatric CSF samples obtained for clinical analysis at five different medical centers were used for the study. Cell counts were performed by the manual hemocytometer method and with the GloCyte System following the same protocol at all sites. The limits of the blank, detection, and quantitation, as well as precision and accuracy of the GloCyte, were determined. The GloCyte detected as few as 1 TNC/μL and 1 RBC/μL, and reliably counted as low as 3 TNCs/μL and 2 RBCs/μL. The total coefficient of variation was less than 20%. Comparison with cell counts obtained with a hemocytometer showed good correlation (>97%) between the GloCyte and the hemocytometer, including at very low cell counts. The GloCyte instrument is a precise, accurate, and stable system to obtain red cell and nucleated cell counts in CSF samples. It allows for the automated enumeration of even very low cell numbers, which is crucial for CSF analysis. These results suggest that GloCyte is an acceptable alternative to the manual method for all CSF samples, including those with normal cell counts. © 2017 John Wiley & Sons Ltd.

  4. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  5. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  6. A sample cell to study hydrate formation with x-ray scattering

    International Nuclear Information System (INIS)

    Conrad, Heiko; Lehmkuehler, Felix; Sternemann, Christian; Feroughi, Omid; Tolan, Metin; Simonelli, Laura; Huotari, Simo

    2009-01-01

    We present a new sample cell for measuring nonresonant inelastic x-ray scattering spectra of a tetrahydrofuran (THF)-water liquid mixture and THF hydrate. The hydrate is formed inside the cell after nucleation seeds have been offered by a special magnetic stirring mechanism. Hydrate formation was verified by wide angle x-ray scattering and nonresonant x-ray Raman scattering spectra at the oxygen K-edge. A broad range of scattering angles can be studied with this cell which is necessary for momentum transfer dependent inelastic x-ray scattering. This cell is ideal to examine other liquid hydrate formers or other liquid samples, which have to be mixed in situ during the measurements.

  7. Direct determination of bulk etching rate for LR-115-II solid state ...

    Indian Academy of Sciences (India)

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  8. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Directory of Open Access Journals (Sweden)

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  9. Treatability studies on different refinery wastewater samples using high-throughput microbial electrolysis cells (MECs)

    KAUST Repository

    Ren, Lijiao; Siegert, Michael; Ivanov, Ivan; Pisciotta, John M.; Logan, Bruce E.

    2013-01-01

    High-throughput microbial electrolysis cells (MECs) were used to perform treatability studies on many different refinery wastewater samples all having appreciably different characteristics, which resulted in large differences in current generation. A de-oiled refinery wastewater sample from one site (DOW1) produced the best results, with 2.1±0.2A/m2 (maximum current density), 79% chemical oxygen demand removal, and 82% headspace biological oxygen demand removal. These results were similar to those obtained using domestic wastewater. Two other de-oiled refinery wastewater samples also showed good performance, with a de-oiled oily sewer sample producing less current. A stabilization lagoon sample and a stripped sour wastewater sample failed to produce appreciable current. Electricity production, organics removal, and startup time were improved when the anode was first acclimated to domestic wastewater. These results show mini-MECs are an effective method for evaluating treatability of different wastewaters. © 2013 Elsevier Ltd.

  10. Treatability studies on different refinery wastewater samples using high-throughput microbial electrolysis cells (MECs)

    KAUST Repository

    Ren, Lijiao

    2013-05-01

    High-throughput microbial electrolysis cells (MECs) were used to perform treatability studies on many different refinery wastewater samples all having appreciably different characteristics, which resulted in large differences in current generation. A de-oiled refinery wastewater sample from one site (DOW1) produced the best results, with 2.1±0.2A/m2 (maximum current density), 79% chemical oxygen demand removal, and 82% headspace biological oxygen demand removal. These results were similar to those obtained using domestic wastewater. Two other de-oiled refinery wastewater samples also showed good performance, with a de-oiled oily sewer sample producing less current. A stabilization lagoon sample and a stripped sour wastewater sample failed to produce appreciable current. Electricity production, organics removal, and startup time were improved when the anode was first acclimated to domestic wastewater. These results show mini-MECs are an effective method for evaluating treatability of different wastewaters. © 2013 Elsevier Ltd.

  11. Application of gelatin zymography for evaluating low levels of contaminating neutrophils in red blood cell samples.

    Science.gov (United States)

    Achilli, Cesare; Ciana, Annarita; Balduini, Cesare; Risso, Angela; Minetti, Giampaolo

    2011-02-15

    Supposedly "homogeneous" red blood cell (RBC) samples are commonly obtained by "washing" whole blood free of plasma, platelets, and white cells with physiological solutions, a procedure that does not result, however, in sufficient removal of polymorphonuclear neutrophils (PMNs), leading to possible artifactual results. Pure RBC samples can be obtained only by leukodepletion procedures. Proposed here is a version of gelatin zymography adapted to detect matrix metalloproteinase 9 (MMP-9), selectively expressed by PMNs, in heterogeneous mixtures of RBCs and PMNs that can reveal contamination at levels as low as 1 PMN/10⁶ RBCs. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. Effects of mechanical stress and vitreous samples in retinal pigment epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Eri, E-mail: eritakahashi@fc.kuh.kumamoto-u.ac.jp; Fukushima, Ayako; Haga, Akira; Inomata, Yasuya; Ito, Yasuhiro; Fukushima, Mikiko; Tanihara, Hidenobu

    2016-02-12

    In rhegmatogenous retinal detachment (RRD), scattered RPE cells from the basement membrane into the vitreous cavity undergo an epithelial mesenchymal transition (EMT) and form the intraocular fibrous membrane in response to vitreous fluid. We investigated whether exposure to vitreous samples was associated with EMT-associated signals and mesenchymal characters. Human vitreous samples were collected from patients with RRD, epiretinal membrane (ERM), or macular hole (MH). We evaluated the effects of vitreous on ARPE-19 cells in suspension cultures using poly 2-hydroxyethyl methacrylate-coated dishes and three-dimensional (3D) Matrigel cultures. We found that exposure to vitreous samples did not induce morphological changes or accelerate wound closure in monolayers. Several samples showed increased phosphorylation of Smad2 and nuclear translocation of nuclear factor-κB. Mechanical stress triggered an elevation of phosphorylation levels in Smad2. In addition, exposure to vitreous fluid increased the phosphorylation of p38 mitogen-activated protein kinase in cell suspension cultures after mechanical stress. Moreover, ARPE-19 cells showed a stellate invasive phenotype in 3D Matrigel cultures with vitreous samples. In this study, we demonstrated that mechanical stress and vitreous were associated with EMT-associated signals and invasive phenotypes in 3D cultures but not in monolayers. These results have important implications for the role of vitreous humor in the induction of EMT and intraocular fibrosis.

  13. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  14. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  15. Modulated Raman spectroscopy for enhanced identification of bladder tumor cells in urine samples.

    Science.gov (United States)

    Canetta, Elisabetta; Mazilu, Michael; De Luca, Anna Chiara; Carruthers, Antonia E; Dholakia, Kishan; Neilson, Sam; Sargeant, Harry; Briscoe, Tina; Herrington, C Simon; Riches, Andrew C

    2011-03-01

    Standard Raman spectroscopy (SRS) is a noninvasive technique that is used in the biomedical field to discriminate between normal and cancer cells. However, the presence of a strong fluorescence background detracts from the use of SRS in real-time clinical applications. Recently, we have reported a novel modulated Raman spectroscopy (MRS) technique to extract the Raman spectra from the background. In this paper, we present the first application of MRS to the identification of human urothelial cells (SV-HUC-1) and bladder cancer cells (MGH) in urine samples. These results are compared to those obtained by SRS. Classification using the principal component analysis clearly shows that MRS allows discrimination between Raman spectra of SV-HUC-1 and MGH cells with high sensitivity (98%) and specificity (95%). MRS is also used to distinguish between SV-HUC-1 and MGH cells after exposure to urine for up to 6 h. We observe a marked change in the MRS of SV-HUC-1 and MGH cells with time in urine, indicating that the conditions of sample collection will be important for the application of this methodology to clinical urine samples.

  16. Utility of Cytospin and Cell block Technology in Evaluation of Body Fluids and Urine Samples: A Comparative Study.

    Science.gov (United States)

    Qamar, Irmeen; Rehman, Suhailur; Mehdi, Ghazala; Maheshwari, Veena; Ansari, Hena A; Chauhan, Sunanda

    2018-01-01

    Cytologic examination of body fluids commonly involves the use of direct or sediment smears, cytocentrifuge preparations, membrane filter preparations, or cell block sections. Cytospin and cell block techniques are extremely useful in improving cell yield of thin serous effusions and urine samples, and ensure high diagnostic efficacy. We studied cytospin preparations and cell block sections prepared from 180 samples of body fluids and urine samples to compare the relative efficiency of cell retrieval, preservation of cell morphology, ease of application of special stains, and diagnostic efficacy. Samples were collected and processed to prepare cytospin smears and cell block sections. We observed that overall, cell yield and preservation of individual cell morphology were better in cytospin preparations as compared to cell blocks, while preservation of architectural pattern was better in cell block sections. The number of suspicious cases also decreased on cell block sections, with increased detection of malignancy. It was difficult to prepare cell blocks from urine samples due to low cellularity. Cytospin technology is a quick, efficient, and cost-effective method of increasing cell yield in hypocellular samples, with better preservation of cell morphology. Cell blocks are better prepared from high cellularity fluids; however, tissue architecture is better studied, with improved rate of diagnosis and decrease in ambiguous results. Numerous sections can be prepared from a small amount of material. Special stains and immunochemical stains can be easily applied to cell blocks. It also provides a source of archival material.

  17. In Vitro Efficient Expansion of Tumor Cells Deriving from Different Types of Human Tumor Samples

    Directory of Open Access Journals (Sweden)

    Ilaria Turin

    2014-03-01

    Full Text Available Obtaining human tumor cell lines from fresh tumors is essential to advance our understanding of antitumor immune surveillance mechanisms and to develop new ex vivo strategies to generate an efficient anti-tumor response. The present study delineates a simple and rapid method for efficiently establishing primary cultures starting from tumor samples of different types, while maintaining the immuno-histochemical characteristics of the original tumor. We compared two different strategies to disaggregate tumor specimens. After short or long term in vitro expansion, cells analyzed for the presence of malignant cells demonstrated their neoplastic origin. Considering that tumor cells may be isolated in a closed system with high efficiency, we propose this methodology for the ex vivo expansion of tumor cells to be used to evaluate suitable new drugs or to generate tumor-specific cytotoxic T lymphocytes or vaccines.

  18. SEM/TIMS analysis trials on hotswipe samples taken from a shielded cell at Harwell

    International Nuclear Information System (INIS)

    Tushingham, J.; Vatter, I.; Cooke, R.

    1998-09-01

    The IAEA require advanced techniques and procedures for the detection of traces of actinides to be applied to their environmental sampling programme for nuclear safeguards as a means to detect undeclared activities. 'Swipe' samples taken from within nuclear facilities by IAEA inspectors require analysis to determine their actinide content and composition by bulk and particle measurements. The use of analytical equipment capable of analysing individual particles, particularly of actinides, is essential to optimise the IAEA's aim to monitor Member State's nuclear activities more proficiently. A trial has been undertaken at the Harwell Laboratory of AEA Technology to establish the efficacy of scanning electron microscopy (SEM) and thermal ionisation mass spectrometry (TIMS) for the particle and bulk characterisation, respectively, of actinides on samples taken from within a shielded cell. These measurements were supported by γ-spectrometry and α-spectrometry. 'Hotswipe' samples taken from within a shielded cell with a well-known recent history have been prepared for particle and bulk analysis. SEM has been used to characterise individual particles from the swipe samples and the results have been related to known cell activities. Samples were prepared for SEM using a simple procedure to minimise the potential for sample contamination. The method proved to be capable of identifying 1 μm particles that contained U, Pu, Pa and Np. The measurement of U/Pu ratios was limited to particles that contained >2% Pu in U by weight. TIMS, together with alpha spectrometry, has been used to determine the bulk actinide composition of the samples whilst gamma spectrometry has been used to determine the fission product composition. Further work to improve the potential of SEM, and also secondary ionisation mass spectrometry (SIMS), for the measurement of hotswipe samples has been proposed. (author)

  19. Measurement of dihydroxyacetone-phosphate acyltransferase (DHAPAT) in chorionic villous samples, blood cells and cultured cells

    NARCIS (Netherlands)

    Wanders, R. J.; Ofman, R.; Romeijn, G. J.; Schutgens, R. B.; Mooijer, P. A.; Dekker, C.; van den Bosch, H.

    1995-01-01

    Dihydroxyacetone-phosphate acyltransferase (DHAPAT) is a peroxisomal enzyme catalysing the first step in ether-phospholipid biosynthesis. DHAPAT is deficient in cells from patients suffering from a variety of peroxisomal disorders. Accurate measurement of the activity of this enzyme is of great

  20. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    International Nuclear Information System (INIS)

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  1. System Identification of a Non-Uniformly Sampled Multi-Rate System in Aluminium Electrolysis Cells

    Directory of Open Access Journals (Sweden)

    Håkon Viumdal

    2014-07-01

    Full Text Available Standard system identification algorithms are usually designed to generate mathematical models with equidistant sampling instants, that are equal for both input variables and output variables. Unfortunately, real industrial data sets are often disrupted by missing samples, variations of sampling rates in the different variables (also known as multi-rate systems, and intermittent measurements. In industries with varying events based maintenance or manual operational measures, intermittent measurements are performed leading to uneven sampling rates. Such is the case with aluminium smelters, where in addition the materials fed into the cell create even more irregularity in sampling. Both measurements and feeding are mostly manually controlled. A simplified simulation of the metal level in an aluminium electrolysis cell is performed based on mass balance considerations. System identification methods based on Prediction Error Methods (PEM such as Ordinary Least Squares (OLS, and the sub-space method combined Deterministic and Stochastic system identification and Realization (DSR, and its variants are applied to the model of a single electrolysis cell as found in the aluminium smelters. Aliasing phenomena due to large sampling intervals can be crucial in avoiding unsuitable models, but with knowledge about the system dynamics, it is easier to optimize the sampling performance, and hence achieve successful models. The results based on the simulation studies of molten aluminium height in the cells using the various algorithms give results which tally well with the synthetic data sets used. System identification on a smaller data set from a real plant is also implemented in this work. Finally, some concrete suggestions are made for using these models in the smelters.

  2. Sample to answer visualization pipeline for low-cost point-of-care blood cell counting

    Science.gov (United States)

    Smith, Suzanne; Naidoo, Thegaran; Davies, Emlyn; Fourie, Louis; Nxumalo, Zandile; Swart, Hein; Marais, Philip; Land, Kevin; Roux, Pieter

    2015-03-01

    We present a visualization pipeline from sample to answer for point-of-care blood cell counting applications. Effective and low-cost point-of-care medical diagnostic tests provide developing countries and rural communities with accessible healthcare solutions [1], and can be particularly beneficial for blood cell count tests, which are often the starting point in the process of diagnosing a patient [2]. The initial focus of this work is on total white and red blood cell counts, using a microfluidic cartridge [3] for sample processing. Analysis of the processed samples has been implemented by means of two main optical visualization systems developed in-house: 1) a fluidic operation analysis system using high speed video data to determine volumes, mixing efficiency and flow rates, and 2) a microscopy analysis system to investigate homogeneity and concentration of blood cells. Fluidic parameters were derived from the optical flow [4] as well as color-based segmentation of the different fluids using a hue-saturation-value (HSV) color space. Cell count estimates were obtained using automated microscopy analysis and were compared to a widely accepted manual method for cell counting using a hemocytometer [5]. The results using the first iteration microfluidic device [3] showed that the most simple - and thus low-cost - approach for microfluidic component implementation was not adequate as compared to techniques based on manual cell counting principles. An improved microfluidic design has been developed to incorporate enhanced mixing and metering components, which together with this work provides the foundation on which to successfully implement automated, rapid and low-cost blood cell counting tests.

  3. Gel-aided sample preparation (GASP)--a simplified method for gel-assisted proteomic sample generation from protein extracts and intact cells.

    Science.gov (United States)

    Fischer, Roman; Kessler, Benedikt M

    2015-04-01

    We describe a "gel-assisted" proteomic sample preparation method for MS analysis. Solubilized protein extracts or intact cells are copolymerized with acrylamide, facilitating denaturation, reduction, quantitative cysteine alkylation, and matrix formation. Gel-aided sample preparation has been optimized to be highly flexible, scalable, and to allow reproducible sample generation from 50 cells to milligrams of protein extracts. This methodology is fast, sensitive, easy-to-use on a wide range of sample types, and accessible to nonspecialists. © 2014 The Authors. PROTEOMICS published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    Science.gov (United States)

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  5. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  6. REMOTE IN-CELL SAMPLING IMPROVEMENTS PROGRAM AT THESAVANNAH RIVER SITE (SRS) DEFENSE WASTE PROCESSING FACILITY (DWPF)

    International Nuclear Information System (INIS)

    Marzolf, A

    2007-01-01

    Remote Systems Engineering (RSE) of the Savannah River National Lab (SRNL) in combination with the Defense Waste Processing Facility(DWPF) Engineering and Operations has evaluated the existing equipment and processes used in the facility sample cells for 'pulling' samples from the radioactive waste stream and performing equipment in-cell repairs/replacements. RSE has designed and tested equipment for improving remote in-cell sampling evolutions and reducing the time required for in-cell maintenance of existing equipment. The equipment within the present process tank sampling system has been in constant use since the facility start-up over 17 years ago. At present, the method for taking samples within the sample cells produces excessive maintenance and downtime due to frequent failures relative to the sampling station equipment and manipulator. Location and orientation of many sampling stations within the sample cells is not conducive to manipulator operation. The overextension of manipulators required to perform many in-cell operations is a major cause of manipulator failures. To improve sampling operations and reduce downtime due to equipment maintenance, a Portable Sampling Station (PSS), wireless in-cell cameras, and new commercially available sampling technology has been designed, developed and/or adapted and tested. The uniqueness of the design(s), the results of the scoping tests, and the benefits relative to in-cell operation and reduction of waste are presented

  7. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  8. Simultaneous isolation of mRNA and native protein from minute samples of cells

    DEFF Research Database (Denmark)

    Petersen, Tonny Studsgaard; Andersen, Claus Yding

    2014-01-01

    Precious biological samples often lack a sufficient number of cells for multiple procedures, such as extraction of mRNA while maintaining protein in a non-denatured state suitable for subsequent characterization. Here we present a new method for the simultaneous purification of mRNA and native...... in their native state for traditional protein assays. We validated the procedure using neonatal rat ovaries and small numbers of human granulosa cells, demonstrating the extraction of mRNA suitable for gene expression analysis with simultaneous isolation of native proteins suitable for downstream characterization...... proteins from samples containing small numbers of cells. Our approach utilizes oligodeoxythymidylate [oligo(dT)25]-coated paramagnetic beads in an optimized reaction buffer to isolate mRNA comparable in quantity and quality to mRNA isolated with existing methods, while maintaining the proteins...

  9. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Raman spectral signatures of cervical exfoliated cells from liquid-based cytology samples

    Science.gov (United States)

    Kearney, Padraig; Traynor, Damien; Bonnier, Franck; Lyng, Fiona M.; O'Leary, John J.; Martin, Cara M.

    2017-10-01

    It is widely accepted that cervical screening has significantly reduced the incidence of cervical cancer worldwide. The primary screening test for cervical cancer is the Papanicolaou (Pap) test, which has extremely variable specificity and sensitivity. There is an unmet clinical need for methods to aid clinicians in the early detection of cervical precancer. Raman spectroscopy is a label-free objective method that can provide a biochemical fingerprint of a given sample. Compared with studies on infrared spectroscopy, relatively few Raman spectroscopy studies have been carried out to date on cervical cytology. The aim of this study was to define the Raman spectral signatures of cervical exfoliated cells present in liquid-based cytology Pap test specimens and to compare the signature of high-grade dysplastic cells to each of the normal cell types. Raman spectra were recorded from single exfoliated cells and subjected to multivariate statistical analysis. The study demonstrated that Raman spectroscopy can identify biochemical signatures associated with the most common cell types seen in liquid-based cytology samples; superficial, intermediate, and parabasal cells. In addition, biochemical changes associated with high-grade dysplasia could be identified suggesting that Raman spectroscopy could be used to aid current cervical screening tests.

  11. Accounting for randomness in measurement and sampling in studying cancer cell population dynamics.

    Science.gov (United States)

    Ghavami, Siavash; Wolkenhauer, Olaf; Lahouti, Farshad; Ullah, Mukhtar; Linnebacher, Michael

    2014-10-01

    Knowing the expected temporal evolution of the proportion of different cell types in sample tissues gives an indication about the progression of the disease and its possible response to drugs. Such systems have been modelled using Markov processes. We here consider an experimentally realistic scenario in which transition probabilities are estimated from noisy cell population size measurements. Using aggregated data of FACS measurements, we develop MMSE and ML estimators and formulate two problems to find the minimum number of required samples and measurements to guarantee the accuracy of predicted population sizes. Our numerical results show that the convergence mechanism of transition probabilities and steady states differ widely from the real values if one uses the standard deterministic approach for noisy measurements. This provides support for our argument that for the analysis of FACS data one should consider the observed state as a random variable. The second problem we address is about the consequences of estimating the probability of a cell being in a particular state from measurements of small population of cells. We show how the uncertainty arising from small sample sizes can be captured by a distribution for the state probability.

  12. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  13. Irradiating cell samples in an x-ray radiation cabinet-the effect of tube filtration

    International Nuclear Information System (INIS)

    Parkin, Adrian; Wright, Ian; Yates, Stuart; Goldstone, Karen E; Russell, Paul; Starr, Christy

    2004-01-01

    The cell irradiation cabinet described is used for creating DNA damage in cell samples in order to study tumourigenesis. The medical research laboratory involved was using the manufacturer's quoted dose rate (32.2 mGy s -1 ) to determine the required exposure time to impart a dose of 10 Gy. The x-ray output was investigated when the exposure failed to produce cell cycle arrest. The x-ray tube was fitted with only a 0.76 mm beryllium filter, and the spectrum therefore contained a high proportion of low energy photons which were being removed by the polystyrene sample flask as demonstrated by dose measurements in air and through the sample flask. Incorporation of a 0.5 mm aluminium filter removed most of these low energy photons but greatly reduced the dose rate to 3.8 mGy s -1 . The manufacturer's quoted dose rates from a lightly filtered tube are misleading: the contribution of the very low energy component of the spectrum to the dose is not relevant since it will be removed by a sample flask. (note)

  14. Reagentless mechanical cell lysis by nanoscale barbs in microchannels for sample preparation.

    Science.gov (United States)

    Di Carlo, Dino; Jeong, Ki-Hun; Lee, Luke P

    2003-11-01

    A highly effective, reagentless, mechanical cell lysis device integrated in microfluidic channels is reported. Sample preparation, specifically cell lysis, is a critical element in 'lab-on-chip' applications. However, traditional methods of cell lysis require purification steps or complicated fabrication steps that a simple mechanical method of lysis may avoid. A simple and effective mechanical cell lysis system is designed, microfabricated, and characterized to quantify the efficiency of cell lysis and biomolecule accessibility. The device functionality is based on a microfluidic filter region with nanostructured barbs created using a modified deep reactive ion etching process. Mechanical lysis is characterized by using a membrane impermeable dye. Three main mechanisms of micro-mechanical lysis are described. Quantitative measurements of accessible protein as compared to a chemically lysed sample are acquired with optical absorption measurements at 280 and 414 nm. At a flow rate of 300 microL min(-1) within the filter region total protein and hemoglobin accessibilities of 4.8% and 7.5% are observed respectively as compared to 1.9% and 3.2% for a filter without nanostructured barbs.

  15. Nonequilibrium Gyrokinetic Fluctuation Theory and Sampling Noise in Gyrokinetic Particle-in-cell Simulations

    International Nuclear Information System (INIS)

    Krommes, John A.

    2007-01-01

    The present state of the theory of fluctuations in gyrokinetic (GK) plasmas and especially its application to sampling noise in GK particle-in-cell (PIC) simulations is reviewed. Topics addressed include the Δf method, the fluctuation-dissipation theorem for both classical and GK many-body plasmas, the Klimontovich formalism, sampling noise in PIC simulations, statistical closure for partial differential equations, the theoretical foundations of spectral balance in the presence of arbitrary noise sources, and the derivation of Kadomtsev-type equations from the general formalism

  16. Nonequilibrium Gyrokinetic Fluctuation Theory and Sampling Noise in Gyrokinetic Particle-in-cell Simulations

    Energy Technology Data Exchange (ETDEWEB)

    John A. Krommes

    2007-10-09

    The present state of the theory of fluctuations in gyrokinetic GK plasmas and especially its application to sampling noise in GK particle-in-cell PIC simulations is reviewed. Topics addressed include the Δf method, the fluctuation-dissipation theorem for both classical and GK many-body plasmas, the Klimontovich formalism, sampling noise in PIC simulations, statistical closure for partial differential equations, the theoretical foundations of spectral balance in the presence of arbitrary noise sources, and the derivation of Kadomtsev-type equations from the general formalism.

  17. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    International Nuclear Information System (INIS)

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  18. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  19. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    International Nuclear Information System (INIS)

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  20. Application of the LR-56 at DOE Facilities in the United States

    International Nuclear Information System (INIS)

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  1. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    International Nuclear Information System (INIS)

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  2. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Science.gov (United States)

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  3. Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

    International Nuclear Information System (INIS)

    Huang, Eng-Yen; Chanchien, Chan-Chao; Lin, Hao; Wang, Chung-Chi; Wang, Chong-Jong; Huang, Chao-Cheng

    2013-01-01

    Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer

  4. Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Eng-Yen [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); School of Traditional Chinese Medicine, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Chanchien, Chan-Chao; Lin, Hao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Wang, Chung-Chi; Wang, Chong-Jong [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Huang, Chao-Cheng, E-mail: huangcc@cgmh.org.tw [Department of Pathology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)

    2013-12-01

    Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer.

  5. RANdom SAmple Consensus (RANSAC) algorithm for material-informatics: application to photovoltaic solar cells.

    Science.gov (United States)

    Kaspi, Omer; Yosipof, Abraham; Senderowitz, Hanoch

    2017-06-06

    An important aspect of chemoinformatics and material-informatics is the usage of machine learning algorithms to build Quantitative Structure Activity Relationship (QSAR) models. The RANdom SAmple Consensus (RANSAC) algorithm is a predictive modeling tool widely used in the image processing field for cleaning datasets from noise. RANSAC could be used as a "one stop shop" algorithm for developing and validating QSAR models, performing outlier removal, descriptors selection, model development and predictions for test set samples using applicability domain. For "future" predictions (i.e., for samples not included in the original test set) RANSAC provides a statistical estimate for the probability of obtaining reliable predictions, i.e., predictions within a pre-defined number of standard deviations from the true values. In this work we describe the first application of RNASAC in material informatics, focusing on the analysis of solar cells. We demonstrate that for three datasets representing different metal oxide (MO) based solar cell libraries RANSAC-derived models select descriptors previously shown to correlate with key photovoltaic properties and lead to good predictive statistics for these properties. These models were subsequently used to predict the properties of virtual solar cells libraries highlighting interesting dependencies of PV properties on MO compositions.

  6. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  7. Sequence typing of adenovirus from samples from hematological stem cell transplant recipients.

    Science.gov (United States)

    Al Qurashi, Yasir Mohammed A; Guiver, Malcolm; Cooper, Robert J

    2011-11-01

    Adenovirus infections are usually mild or even asymptomatic, but infections with the virus are being recognized increasingly as a major cause of mortality and morbidity in the immunocompromised, particularly hematological stem cell transplant patients where infections can be life threatening and mortality may reach 60%. Typing by sequencing the HVR7 region of the hexon was established and validated using 60 isolates of different serotypes from the six of the seven species which had been typed previously by serum neutralization. Analysis of nucleotide sequences was used to type 227 samples from 41 hematological stem cell transplant recipients. Types from six species were detected but species C types were detected in 51.4% and species A in 34.3% of patients. Seven patients were infected with different adenovirus types sequentially and a further six patients had evidence of simultaneous multiple infections. Many of the sequences had several differences from the prototype strains which will allow tracing of outbreaks and provide evidence for cross-infection in a hospital setting. In this study, the phylogenetic analysis of adenovirus sequences from hematological stem cell transplant patients' samples showed evidence of two possible cross-infection incidents involving three and five patients, respectively. Copyright © 2011 Wiley-Liss, Inc.

  8. Detection of Merkel Cell Polyomavirus DNA in Serum Samples of Healthy Blood Donors

    Science.gov (United States)

    Mazzoni, Elisa; Rotondo, John C.; Marracino, Luisa; Selvatici, Rita; Bononi, Ilaria; Torreggiani, Elena; Touzé, Antoine; Martini, Fernanda; Tognon, Mauro G.

    2017-01-01

    Merkel cell polyomavirus (MCPyV) has been detected in 80% of Merkel cell carcinomas (MCC). In the host, the MCPyV reservoir remains elusive. MCPyV DNA sequences were revealed in blood donor buffy coats. In this study, MCPyV DNA sequences were investigated in the sera (n = 190) of healthy blood donors. Two MCPyV DNA sequences, coding for the viral oncoprotein large T antigen (LT), were investigated using polymerase chain reaction (PCR) methods and DNA sequencing. Circulating MCPyV sequences were detected in sera with a prevalence of 2.6% (5/190), at low-DNA viral load, which is in the range of 1–4 and 1–5 copies/μl by real-time PCR and droplet digital PCR, respectively. DNA sequencing carried out in the five MCPyV-positive samples indicated that the two MCPyV LT sequences which were analyzed belong to the MKL-1 strain. Circulating MCPyV LT sequences are present in blood donor sera. MCPyV-positive samples from blood donors could represent a potential vehicle for MCPyV infection in receivers, whereas an increase in viral load may occur with multiple blood transfusions. In certain patient conditions, such as immune-depression/suppression, additional disease or old age, transfusion of MCPyV-positive samples could be an additional risk factor for MCC onset. PMID:29238698

  9. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  11. [Susceptibility of induced sickle in samples of heterozygous hemoglobin S patients (sickle cell trait) suffering diabetes mellitus type 2].

    Science.gov (United States)

    Díaz-Piedra, Pablo; Cervantes-Villagrana, Alberto Rafael; Ramos-Jiménez, Raúl; Presno-Bernal, José Miguel; Cervantes-Villagrana, Rodolfo Daniel

    2015-01-01

    Hemoglobin S is an abnormal protein that induces morphological changes in erythrocyte in low-oxygen conditions. In Mexico, it is reported that up to 13.7% of the population with mutation in one allele are considered asymptomatic (sickle cell trait). The sickle cell trait and diabetes mellitus are conditions that occur together in more than one million patients worldwide. Both diseases possibly produce microvascular changes in retinopathy and acute chest syndrome. The aim of this study was to evaluate the induction of sickle cells in samples of diabetic patients with sickle cell trait to identify altered red cell parameters. We obtained samples of diabetic patients to determine hemoglobin A1c and S; furthermore, red blood cell biometrics data were analyzed. We found that older men with diabetes were susceptible to generate sickle cells and this correlated with reduced red blood cell count and an increase in media cell volume. In samples of women diabetes, there were no differences. We conclude that samples from patients with sickle cell trait and diabetes can cause sickle cells with high frequency in men, with lower red blood cells count and increased mean corpuscular volume as susceptibility parameters.

  12. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    International Nuclear Information System (INIS)

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  13. An Analysis of Source Tilting and Sub-cell Opacity Sampling for IMC

    Energy Technology Data Exchange (ETDEWEB)

    Wollaeger, Ryan T. [Los Alamos National Laboratory; Urbatsch, Todd J. [Los Alamos National Laboratory; Wollaber, Allan B. [Los Alamos National Laboratory; Densmore, Jeffery D. [Los Alamos National Laboratory

    2012-08-02

    Implicit Monte Carlo (IMC) is a stochastic method for solving the radiative transfer equations for multiphysics application with the material in local thermodynamic equilibrium. The IMC method employs a fictitious scattering term that is computed from an implicit discretization of the material temperature equation. Unfortunately, the original histogram representation of the temperature and opacity with respect to the spatial domain leads to nonphysically fast propagation of radiation waves through optically thick material. In the past, heuristic source tilting schemes have been used to mitigate the numerical teleportation error of the radiation particles in IMC that cause this overly rapid radiation wave propagation. While improving the material temperature profile throughout the time duration, these tilting schemes alone do not generally alleviate the teleportation error to suitable levels. Another means of potentially reducing teleportation error in IMC is implementing continuous sub-cell opacities based on sub-cell temperature profiles. We present here an analysis of source tilting and continuous sub-cell opacity sampling applied to various discretizations of the temperature equation. Through this analysis, we demonstrate that applying both heuristics does not necessarily yield more accurate results if the discretization of the material equation is inconsistent with the Monte Carlo sub-cell transport.

  14. Molecular Characterization of Viruses from Clinical Respiratory Samples Producing Unidentified Cytopathic Effects in Cell Culture

    Directory of Open Access Journals (Sweden)

    Guy Boivin

    2009-07-01

    Full Text Available The sequence-independent single primer amplification (SISPA method was performed to identify a virus in 17 clinical respiratory samples producing uncharacterized cytopathic effects in LLC-MK2 cells. Sequence analysis of 600-1600 bp amplicons allowed the identification of six viruses (one influenza C, two parechovirus-3 and three cardioviruses. Genomic sequences of the cardioviruses showed similarities with those of the recently-described Saffold virus strain although significant variation was present in the viral surface EF and CD loops. These results demonstrate the usefulness of SISPA for identifying emerging viruses and also known viruses not easily identified by standard virological methods.

  15. A whole-cell bioreporter assay for quantitative genotoxicity evaluation of environmental samples.

    Science.gov (United States)

    Jiang, Bo; Li, Guanghe; Xing, Yi; Zhang, Dayi; Jia, Jianli; Cui, Zhisong; Luan, Xiao; Tang, Hui

    2017-10-01

    Whole-cell bioreporters have emerged as promising tools for genotoxicity evaluation, due to their rapidity, cost-effectiveness, sensitivity and selectivity. In this study, a method for detecting genotoxicity in environmental samples was developed using the bioluminescent whole-cell bioreporter Escherichia coli recA::luxCDABE. To further test its performance in a real world scenario, the E. coli bioreporter was applied in two cases: i) soil samples collected from chromium(VI) contaminated sites; ii) crude oil contaminated seawater collected after the Jiaozhou Bay oil spill which occurred in 2013. The chromium(VI) contaminated soils were pretreated by water extraction, and directly exposed to the bioreporter in two phases: aqueous soil extraction (water phase) and soil supernatant (solid phase). The results indicated that both extractable and soil particle fixed chromium(VI) were bioavailable to the bioreporter, and the solid-phase contact bioreporter assay provided a more precise evaluation of soil genotoxicity. For crude oil contaminated seawater, the response of the bioreporter clearly illustrated the spatial and time change in genotoxicity surrounding the spill site, suggesting that the crude oil degradation process decreased the genotoxic risk to ecosystem. In addition, the performance of the bioreporter was simulated by a modified cross-regulation gene expression model, which quantitatively described the DNA damage response of the E. coli bioreporter. Accordingly, the bioluminescent response of the bioreporter was calculated as the mitomycin C equivalent, enabling quantitative comparison of genotoxicities between different environmental samples. This bioreporter assay provides a rapid and sensitive screening tool for direct genotoxicity assessment of environmental samples. Copyright © 2017. Published by Elsevier Ltd.

  16. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

    Directory of Open Access Journals (Sweden)

    Valentina Kubale

    2016-07-01

    Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

  17. Sample processing, protocol, and statistical analysis of the time-of-flight secondary ion mass spectrometry (ToF-SIMS) of protein, cell, and tissue samples.

    Science.gov (United States)

    Barreto, Goncalo; Soininen, Antti; Sillat, Tarvo; Konttinen, Yrjö T; Kaivosoja, Emilia

    2014-01-01

    Time-of-flight secondary ion mass spectrometry (ToF-SIMS) is increasingly being used in analysis of biological samples. For example, it has been applied to distinguish healthy and osteoarthritic human cartilage. This chapter discusses ToF-SIMS principle and instrumentation including the three modes of analysis in ToF-SIMS. ToF-SIMS sets certain requirements for the samples to be analyzed; for example, the samples have to be vacuum compatible. Accordingly, sample processing steps for different biological samples, i.e., proteins, cells, frozen and paraffin-embedded tissues and extracellular matrix for the ToF-SIMS are presented. Multivariate analysis of the ToF-SIMS data and the necessary data preprocessing steps (peak selection, data normalization, mean-centering, and scaling and transformation) are discussed in this chapter.

  18. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  19. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  20. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    International Nuclear Information System (INIS)

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  1. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    International Nuclear Information System (INIS)

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  2. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    International Nuclear Information System (INIS)

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  3. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  4. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    International Nuclear Information System (INIS)

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  5. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    International Nuclear Information System (INIS)

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  6. Immunosuppressive mediators of oral squamous cell carcinoma in tumour samples and saliva.

    Science.gov (United States)

    Gonçalves, Andréia Souza; Arantes, Diego Antonio Costa; Bernardes, Vanessa Fátima; Jaeger, Filipe; Silva, Janine Mayra; Silva, Tarcília Aparecida; Aguiar, Maria Cássia Ferreira; Batista, Aline Carvalho

    2015-01-01

    The goal of this study was to compare the salivary concentrations of IL-10, TGF-β1 and soluble HLA-G (sHLA-G) in patients with oral squamous cell carcinoma (OSCC) to those in healthy individuals (control group), and to correlate the expression of these mediators in saliva with that in the tumour microenvironment. Neoplastic tissue and saliva samples from patients with OSCC (n=22) were analysed by immunohistochemistry and enzyme-linked immunosorbent assay (ELISA) respectively. We detected high expression of IL-10 and HLA-G in the tumour microenvironment when compared to healthy oral mucosa samples. Determination of IL-10 salivary concentration enabled us to distinguish patients with OSCC from healthy individuals (P=0.038), which showed correlation with tissue expression of this cytokine. HLA-G salivary release was similar in both groups (P=0.17) and no correlation with tumour expression was observed. TGF-β1 expression was low or absent in tumours, and salivary concentration was similar between groups. Our results suggest that of the three markers analysed, IL-10 is a potential salivary biomarker. Furthermore, the elevated expression of HLA-G and IL-10 in tumour sites could favour the escape of tumour cells from immune defense mechanisms. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  7. Gene methylation parallelisms between peripheral blood cells and oral mucosa samples in relation to overweight.

    Science.gov (United States)

    San-Cristobal, Rodrigo; Navas-Carretero, Santiago; Milagro, Fermín I; Riezu-Boj, J Ignacio; Guruceaga, Elizabeth; Celis-Morales, Carlos; Livingstone, Katherine M; Brennan, Lorraine; Lovegrove, Julie A; Daniel, Hannelore; Saris, Wim H; Traczyk, Iwonna; Manios, Yannis; Gibney, Eileen R; Gibney, Michael J; Mathers, John C; Martinez, J Alfredo

    2016-08-01

    Epigenetics has an important role in the regulation of metabolic adaptation to environmental modifications. In this sense, the determination of epigenetic changes in non-invasive samples during the development of metabolic diseases could play an important role in the procedures in primary healthcare practice. To help translate the knowledge of epigenetics to public health practice, the present study aims to explore the parallelism of methylation levels between white blood cells and buccal samples in relation to obesity and associated disorders. Blood and buccal swap samples were collected from a subsample of the Spanish cohort of the Food4Me study. Infinium HumanMethylation450 DNA Analysis was carried out for the determination of methylation levels. Standard deviation for β values method and concordance correlation analysis were used to select those CpG which showed best parallelism between samples. A total of 277 CpGs met the criteria and were selected for an enrichment analysis and a correlation analysis with anthropometrical and clinical parameters. From those selected CpGs, four presented high associations with BMI (cg01055691 in GAP43; r = -0.92 and rho = -0.84 for blood; r = -0.89 and rho = -0.83 for buccal sample), HOMA-IR (cg00095677 in ATP2A3; r = 0.82 and rho = -0.84 for blood; r = -0.8 and rho = -0.83 for buccal sample) and leptin (cg14464133 in ADARB2; r = -0.9182 and rho = -0.94 for blood; r = -0.893 and rho = -0.79 for buccal sample). These findings demonstrate the potential application of non-invasive buccal samples in the identification of surrogate epigenetic biomarkers and identify methylation sites in GAP43, ATP2A3 and ADARB2 genes as potential targets in relation to overweight management and insulin sensibility.

  8. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    International Nuclear Information System (INIS)

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  9. Measurements of accurate x-ray scattering data of protein solutions using small stationary sample cells

    Science.gov (United States)

    Hong, Xinguo; Hao, Quan

    2009-01-01

    In this paper, we report a method of precise in situ x-ray scattering measurements on protein solutions using small stationary sample cells. Although reduction in the radiation damage induced by intense synchrotron radiation sources is indispensable for the correct interpretation of scattering data, there is still a lack of effective methods to overcome radiation-induced aggregation and extract scattering profiles free from chemical or structural damage. It is found that radiation-induced aggregation mainly begins on the surface of the sample cell and grows along the beam path; the diameter of the damaged region is comparable to the x-ray beam size. Radiation-induced aggregation can be effectively avoided by using a two-dimensional scan (2D mode), with an interval as small as 1.5 times the beam size, at low temperature (e.g., 4 °C). A radiation sensitive protein, bovine hemoglobin, was used to test the method. A standard deviation of less than 5% in the small angle region was observed from a series of nine spectra recorded in 2D mode, in contrast to the intensity variation seen using the conventional stationary technique, which can exceed 100%. Wide-angle x-ray scattering data were collected at a standard macromolecular diffraction station using the same data collection protocol and showed a good signal/noise ratio (better than the reported data on the same protein using a flow cell). The results indicate that this method is an effective approach for obtaining precise measurements of protein solution scattering.

  10. Measurements of accurate x-ray scattering data of protein solutions using small stationary sample cells

    International Nuclear Information System (INIS)

    Hong Xinguo; Hao Quan

    2009-01-01

    In this paper, we report a method of precise in situ x-ray scattering measurements on protein solutions using small stationary sample cells. Although reduction in the radiation damage induced by intense synchrotron radiation sources is indispensable for the correct interpretation of scattering data, there is still a lack of effective methods to overcome radiation-induced aggregation and extract scattering profiles free from chemical or structural damage. It is found that radiation-induced aggregation mainly begins on the surface of the sample cell and grows along the beam path; the diameter of the damaged region is comparable to the x-ray beam size. Radiation-induced aggregation can be effectively avoided by using a two-dimensional scan (2D mode), with an interval as small as 1.5 times the beam size, at low temperature (e.g., 4 deg. C). A radiation sensitive protein, bovine hemoglobin, was used to test the method. A standard deviation of less than 5% in the small angle region was observed from a series of nine spectra recorded in 2D mode, in contrast to the intensity variation seen using the conventional stationary technique, which can exceed 100%. Wide-angle x-ray scattering data were collected at a standard macromolecular diffraction station using the same data collection protocol and showed a good signal/noise ratio (better than the reported data on the same protein using a flow cell). The results indicate that this method is an effective approach for obtaining precise measurements of protein solution scattering.

  11. Maternal obesity alters immune cell frequencies and responses in umbilical cord blood samples.

    Science.gov (United States)

    Wilson, Randall M; Marshall, Nicole E; Jeske, Daniel R; Purnell, Jonathan Q; Thornburg, Kent; Messaoudi, Ilhem

    2015-06-01

    Maternal obesity is one of the several key factors thought to modulate neonatal immune system development. Data from murine studies demonstrate worse outcomes in models of infection, autoimmunity, and allergic sensitization in offspring of obese dams. In humans, children born to obese mothers are at increased risk for asthma. These findings suggest a dysregulation of immune function in the children of obese mothers; however, the underlying mechanisms remain poorly understood. The aim of this study was to examine the relationship between maternal body weight and the human neonatal immune system. Umbilical cord blood samples were collected from infants born to lean, overweight, and obese mothers. Frequency and function of major innate and adaptive immune cell populations were quantified using flow cytometry and multiplex analysis of circulating factors. Compared to babies born to lean mothers, babies of obese mothers had fewer eosinophils and CD4 T helper cells, reduced monocyte and dendritic cell responses to Toll-like receptor ligands, and increased plasma levels of IFN-α2 and IL-6 in cord blood. These results support the hypothesis that maternal obesity influences programming of the neonatal immune system, providing a potential link to increased incidence of chronic inflammatory diseases such as asthma and cardiovascular disease in the offspring. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Low cost label-free live cell imaging for biological samples

    Science.gov (United States)

    Seniya, C.; Towers, C. E.; Towers, D. P.

    2017-02-01

    This paper reports the progress to develop a practical phase measuring microscope offering new capabilities in terms of phase measurement accuracy and quantification of cell:cell interactions over the longer term. A novel, low cost phase interference microscope for imaging live cells (label-free) is described. The method combines the Zernike phase contrast approach with a dual mirror design to enable phase modulation between the scattered and un-scattered optical fields. Two designs are proposed and demonstrated, one of which retains the common path nature of Zernike's original microscopy concept. In both setups the phase shift is simple to control via a piezoelectric driven mirror in the back focal plane of the imaging system. The approach is significantly cheaper to implement than those based on spatial light modulators (SLM) at approximately 20% of the cost. A quantitative assessment of the performance of a set of phase shifting algorithms is also presented, specifically with regard to broad bandwidth illumination in phase contrast microscopy. The simulation results show that the phase measurement accuracy is strongly dependent on the algorithm selected and the optical path difference in the sample.

  13. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  14. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Vanessa de Farias

    2009-06-01

    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  15. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  16. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  17. Experiences from Refurbishment of Metallography Hot Cells and Application of a New Preparation Concept for Materialography Samples

    International Nuclear Information System (INIS)

    Oberlander, B. C.; Espeland, M.; Solum, N. O.

    2001-01-01

    After more than 30 years of operation the lead shielded metallography hot cells needed a basic renewal and modernisation not least of the specimen preparation equipment. Preparation in hot cells of radioactive samples for metallography and ceramography is challenging and time consuming. It demands a special design and quality of all in-cell equipment and skill and patience from the operator. Essentials in the preparation process are: simplicity and reliability of the machines, and a good quality, reproducibility and efficiency in performance. Desirable is process automation, flexibility and an alara amounto of radioactive waste produced per sample prepared. State of the art preparation equipment for materialography seems to meet most of the demands, however, it cannot be used in hot cells without modifications. Therefore. IFE and Struers in Copenhagen modified a standard model of a Strues precision cutting machine and a microprocessor controlled grinding and polishing machine for Hot Cell application. Hot cell utilisation of the microcomputer controlled grinding and polishing machine and the existing automatic dosing equipment made the task of preparing radioactive samples more attractive. The new grinding and polishing system for hot cells provides good sample preparation quality and reproductibility at reduced preparation time and reduced amount of contaminated waste produced per sample prepared. the sample materials examined were irradiated cladding materials and fuels

  18. Detecting estrogenic activity in water samples withestrogen-sensitive yeast cells using spectrophotometry and fluorescencemicroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wozei, E.; Holman, H-Y.N.; Hermanowicz, S.W.; Borglin S.

    2006-03-15

    Environmental estrogens are environmental contaminants that can mimic the biological activities of the female hormone estrogen in the endocrine system, i.e. they act as endocrine disrupters. Several substances are reported to have estrogen-like activity or estrogenic activity. These include steroid hormones, synthetic estrogens (xenoestrogens), environmental pollutants and phytoestrogens (plant estrogens). Using the chromogenic substrate ortho-nitrophenyl-{beta}-D-galactopyranoside (ONPG) we show that an estrogen-sensitive yeast strain RMY/ER-ERE, with human estrogen receptor (hER{alpha}) gene and the lacZ gene which encodes the enzyme {beta}-galactosidase, is able to detect estrogenic activity in water samples over a wide range of spiked concentrations of the hormonal estrogen 17{beta}-estradiol (E2). Ortho-nitrophenol (ONP), the yellow product of this assay can be detected using spectrophotometry but requires cell lysis to release the enzyme and allow product formation. We improved this aspect in a fluorogenic assay by using fluorescein di-{beta}-D-galactopyranoside (FDG) as a substrate. The product was visualized using fluorescence microscopy without the need to kill, fix or lyse the cells. We show that in live yeast cells, the uptake of E2 and the subsequent production of {beta}-galactosidase enzyme occur quite rapidly, with maximum enzyme-catalyzed fluorescent product formation evident after about 30 minutes of exposure to E2. The fluorogenic assay was applied to a selection of estrogenic compounds and the Synchrotron-based Fourier transform infrared (SR-FTIR) spectra of the cells obtained to better understand the yeast whole cell response to the compounds. The fluorogenic assay is most sensitive to E2, but the SR-FTIR spectra suggest that the cells respond to all the estrogenic compounds tested even when no fluorescent response was detected. These findings are promising and may shorten the duration of environmental water screening and monitoring regimes using

  19. Somatic Cells in Bulk Samples and Purchase Prices of Cow Milk

    Directory of Open Access Journals (Sweden)

    Jindřich Kvapilík

    2017-01-01

    Full Text Available There were calculated the somatic cell count (SCC 209 (36 – 468 103ml–1, the total count of microorganisms (TCM 25 103ml–1 (from 5 to 377, fat 3.84 % (from 3.23 to 4.46 and protein content 3.39 % (from 3.04 to 3.75 and milk freezing point (MFP –0.525 °C (from –0.534 to –0.395 of the 522 monthly bulk milk samples from 11 experimental stables during the period from 2012 to 2015. Residues of inhibitory substances were not detected in any sample. Milk sale reached 7,999 liters (l with fluctuating between 6,150 and 10,532 l per cow. This can be deduced from the regression coefficients that due to increase in the SCC by 100 103ml–1 the TCM increased by 2.9 to 4.2 103ml–1, the fat content decreased by 0.09 to 0.13 % and protein about 0.01 to 0.05 %. Influence of SCC, TCM and the fat and protein content calculated from monthly samples for individual stables can be estimated at –0.12 CZC, fluctuations between the stables at +0.46 to –0.84 CZC per l of milk. The increase in milk price by 0.17 CZC in the range of –0.92 to +0.92 CZC per l of milk corresponds to averages of indicators calculated from 522 samples.

  20. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  1. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  2. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  3. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    DEFF Research Database (Denmark)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  4. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  5. Nodal Stage of Surgically Resected Non-Small Cell Lung Cancer and Its Effect on Recurrence Patterns and Overall Survival

    Energy Technology Data Exchange (ETDEWEB)

    Varlotto, John M., E-mail: john.varlotto@umassmemorial.org [Department of Radiation Oncology, University of Massachusetts Medical Center, Worcester, Massachusetts (United States); Yao, Aaron N. [Department of Healthcare Policy and Research, Virginia Commonwealth University, Richmond, Virginia (United States); DeCamp, Malcolm M. [Division of Thoracic Surgery, Department of Surgery, Northwestern Memorial Hospital, Chicago, Illinois (United States); Northwestern University School of Medicine, Chicago, Illinois (United States); Ramakrishna, Satvik [Northwestern University School of Medicine, Chicago, Illinois (United States); Recht, Abe [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States); Flickinger, John [Department of Radiation Oncology, Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania (United States); Andrei, Adin [Northwestern University, Chicago, Illinois (United States); Reed, Michael F. [Pennsylvania State University College of Medicine, Hershey, Pennsylvania (United States); Heart and Vascular Institute, Pennsylvania State University-Hershey, Hershey, Pennsylvania (United States); Toth, Jennifer W. [Pennsylvania State University College of Medicine, Hershey, Pennsylvania (United States); Division of Pulmonary, Allergy, and Critical Care Medicine, Department of Medicine, Pennsylvania State University-Hershey, Hershey, Pennsylvania (United States); Fizgerald, Thomas J. [Department of Radiation Oncology, University of Massachusetts Medical Center, Worcester, Massachusetts (United States); Higgins, Kristin [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Zheng, Xiao [Department of Healthcare Policy and Research, Virginia Commonwealth University, Richmond, Virginia (United States); Shelkey, Julie [Department of Anesthesiology, Columbia University, New York, New York (United States); and others

    2015-03-15

    Purpose: Current National Comprehensive Cancer Network guidelines recommend postoperative radiation therapy (PORT) for patients with resected non-small cell lung cancer (NSCLC) with N2 involvement. We investigated the relationship between nodal stage and local-regional recurrence (LR), distant recurrence (DR) and overall survival (OS) for patients having an R0 resection. Methods and Materials: A multi-institutional database of consecutive patients undergoing R0 resection for stage I-IIIA NSCLC from 1995 to 2008 was used. Patients receiving any radiation therapy before relapse were excluded. A total of 1241, 202, and 125 patients were identified with N0, N1, and N2 involvement, respectively; 161 patients received chemotherapy. Cumulative incidence rates were calculated for LR and DR as first sites of failure, and Kaplan-Meier estimates were made for OS. Competing risk analysis and proportional hazards models were used to examine LR, DR, and OS. Independent variables included age, sex, surgical procedure, extent of lymph node sampling, histology, lymphatic or vascular invasion, tumor size, tumor grade, chemotherapy, nodal stage, and visceral pleural invasion. Results: The median follow-up time was 28.7 months. Patients with N1 or N2 nodal stage had rates of LR similar to those of patients with N0 disease, but were at significantly increased risk for both DR (N1, hazard ratio [HR] = 1.84, 95% confidence interval [CI]: 1.30-2.59; P=.001; N2, HR = 2.32, 95% CI: 1.55-3.48; P<.001) and death (N1, HR = 1.46, 95% CI: 1.18-1.81; P<.001; N2, HR = 2.33, 95% CI: 1.78-3.04; P<.001). LR was associated with squamous histology, visceral pleural involvement, tumor size, age, wedge resection, and segmentectomy. The most frequent site of LR was the mediastinum. Conclusions: Our investigation demonstrated that nodal stage is directly associated with DR and OS but not with LR. Thus, even some patients with, N0-N1 disease are at relatively high risk of local recurrence. Prospective

  6. Cell shape regulates global histone acetylation in human mammaryepithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Le Beyec, Johanne; Xu, Ren; Lee, Sun-Young; Nelson, Celeste M.; Rizki, Aylin; Alcaraz, Jordi; Bissell, Mina J.

    2007-02-28

    Extracellular matrix (ECM) regulates cell morphology and gene expression in vivo; these relationships are maintained in three-dimensional (3D) cultures of mammary epithelial cells. In the presence of laminin-rich ECM (lrECM), mammary epithelial cells round up and undergo global histone deacetylation, a process critical for their functional differentiation. However, it remains unclear whether lrECM-dependent cell rounding and global histone deacetylation are indeed part of a common physical-biochemical pathway. Using 3D cultures as well as nonadhesive and micropatterned substrata, here we showed that the cell 'rounding' caused by lrECM was sufficient to induce deacetylation of histones H3 and H4 in the absence of biochemical cues. Microarray and confocal analysis demonstrated that this deacetylation in 3D culture is associated with a global increase in chromatin condensation and a reduction in gene expression. Whereas cells cultured on plastic substrata formed prominent stress fibers, cells grown in 3D lrECM or on micropatterns lacked these structures. Disruption of the actin cytoskeleton with cytochalasin D phenocopied the lrECM-induced cell rounding and histone deacetylation. These results reveal a novel link between ECM-controlled cell shape and chromatin structure, and suggest that this link is mediated by changes in the actin cytoskeleton.

  7. A new protoparvovirus in human fecal samples and cutaneous T cell lymphomas (mycosis fungoides).

    Science.gov (United States)

    Phan, Tung G; Dreno, Brigitte; da Costa, Antonio Charlys; Li, Linlin; Orlandi, Patricia; Deng, Xutao; Kapusinszky, Beatrix; Siqueira, Juliana; Knol, Anne-Chantal; Halary, Franck; Dantal, Jacques; Alexander, Kathleen A; Pesavento, Patricia A; Delwart, Eric

    2016-09-01

    We genetically characterized seven nearly complete genomes in the protoparvovirus genus from the feces of children with diarrhea. The viruses, provisionally named cutaviruses (CutaV), varied by 1-6% nucleotides and shared ~76% and ~82% amino acid identity with the NS1 and VP1 of human bufaviruses, their closest relatives. Using PCR, cutavirus DNA was found in 1.6% (4/245) and 1% (1/100) of diarrhea samples from Brazil and Botswana respectively. In silico analysis of pre-existing metagenomics datasets then revealed closely related parvovirus genomes in skin biopsies from patients with epidermotropic cutaneous T-cell lymphoma (CTCL or mycosis fungoides). PCR of skin biopsies yielded cutavirus DNA in 4/17 CTCL, 0/10 skin carcinoma, and 0/21 normal or noncancerous skin biopsies. In situ hybridization of CTCL skin biopsies detected viral genome within rare individual cells in regions of neoplastic infiltrations. The influence of cutavirus infection on human enteric functions and possible oncolytic role in CTCL progression remain to be determined. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Correlates of professional burnout in a sample of employees of cell and tissue banks in Poland.

    Science.gov (United States)

    Kamiński, Artur; Rozenek, Hanna; Banasiewicz, Jolanta; Wójtowicz, Stanisław; Błoński, Artur; Owczarek, Krzysztof

    2018-02-03

    Job Demands-Resources model proposes that the development of burnout follows excessive job demands and lack of job resources. Job demands are predictive of feeling of exhaustion, and lack of job resources-disengagement from work. This pilot study investigated professional burnout and its correlates in employees of Polish cell and tissue banks, many of whom were involved in procurement and processing of tissues from deceased donors, as it was hypothesized that job burnout in this population might influence the effectiveness of cell and tissue transplantation network in our country. This study utilized the Polish version of the Oldenburg Burnout Inventory (OLBI), which measures the two dimensions of burnout (exhaustion and disengagement), and the Psychosocial Working Conditions Questionnaire (PWC), a Polish instrument used for monitoring psychosocial stress at work. The study sample consisted of 31 participants. Their average time of working in a cell and tissue bank was 13.20 years. Majority of the PWC scales and subscales scores fell in the Average range, and the OLBI results for the Disengagement and the Exhaustion scales were in the Average range. A number of correlations between the Exhaustion or Disengagement and the PWC scales and subscales were detected, majority of which fell in the Moderate range. In spite of the limited number of participants, the results of this pilot study are consistent with the burnout literature reports. Among the detected correlates of professional burnout, it is job-related support which seems to be the most important factor which may influence the efficacy of transplantation network in Poland.

  9. Sampling versus systematic full lymphatic dissection in surgical treatment of non-small cell lung cancer.

    Science.gov (United States)

    Koulaxouzidis, Georgios; Karagkiouzis, Grigorios; Konstantinou, Marios; Gkiozos, Ioannis; Syrigos, Konstantinos

    2013-04-22

    The extent of mediastinal lymph node assessment during surgery for non-small cell cancer remains controversial. Different techniques are used, ranging from simple visual inspection of the unopened mediastinum to an extended bilateral lymph node dissection. Furthermore, different terms are used to define these techniques. Sampling is the removal of one or more lymph nodes under the guidance of pre-operative findings. Systematic (full) nodal dissection is the removal of all mediastinal tissue containing the lymph nodes systematically within anatomical landmarks. A Medline search was conducted to identify articles in the English language that addressed the role of mediastinal lymph node resection in the treatment of non-small cell lung cancer. Opinions as to the reasons for favoring full lymphatic dissection include complete resection, improved nodal staging and better local control due to resection of undetected micrometastasis. Arguments against routine full lymphatic dissection are increased morbidity, increase in operative time, and lack of evidence of improved survival. For complete resection of non-small cell lung cancer, many authors recommend a systematic nodal dissection as the standard approach during surgery, and suggest that this provides both adequate nodal staging and guarantees complete resection. Whether extending the lymph node dissection influences survival or recurrence rate is still not known. There are valid arguments in favor in terms not only of an improved local control but also of an improved long-term survival. However, the impact of lymph node dissection on long-term survival should be further assessed by large-scale multicenter randomized trials.

  10. Large-scale prospective T cell function assays in shipped, unfrozen blood samples: experiences from the multicenter TRIGR trial.

    Science.gov (United States)

    Hadley, David; Cheung, Roy K; Becker, Dorothy J; Girgis, Rose; Palmer, Jerry P; Cuthbertson, David; Krischer, Jeffrey P; Dosch, Hans-Michael

    2014-02-01

    Broad consensus assigns T lymphocytes fundamental roles in inflammatory, infectious, and autoimmune diseases. However, clinical investigations have lacked fully characterized and validated procedures, equivalent to those of widely practiced biochemical tests with established clinical roles, for measuring core T cell functions. The Trial to Reduce Insulin-dependent diabetes mellitus in the Genetically at Risk (TRIGR) type 1 diabetes prevention trial used consecutive measurements of T cell proliferative responses in prospectively collected fresh heparinized blood samples shipped by courier within North America. In this article, we report on the quality control implications of this simple and pragmatic shipping practice and the interpretation of positive- and negative-control analytes in our assay. We used polyclonal and postvaccination responses in 4,919 samples to analyze the development of T cell immunocompetence. We have found that the vast majority of the samples were viable up to 3 days from the blood draw, yet meaningful responses were found in a proportion of those with longer travel times. Furthermore, the shipping time of uncooled samples significantly decreased both the viabilities of the samples and the unstimulated cell counts in the viable samples. Also, subject age was significantly associated with the number of unstimulated cells and T cell proliferation to positive activators. Finally, we observed a pattern of statistically significant increases in T cell responses to tetanus toxin around the timing of infant vaccinations. This assay platform and shipping protocol satisfy the criteria for robust and reproducible long-term measurements of human T cell function, comparable to those of established blood biochemical tests. We present a stable technology for prospective disease-relevant T cell analysis in immunological diseases, vaccination medicine, and measurement of herd immunity.

  11. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Science.gov (United States)

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  12. Evaluation of different continuous cell lines in the isolation of mumps virus by the shell vial method from clinical samples

    Science.gov (United States)

    Reina, J; Ballesteros, F; Mari, M; Munar, M

    2001-01-01

    Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211

  13. Sample cell for powder x-ray diffraction at up to 500 bars and 200 deg. C

    International Nuclear Information System (INIS)

    Jupe, Andrew C.; Wilkinson, Angus P.

    2006-01-01

    A low cost sample cell for powder diffraction at high pressure and temperature that employs either sapphire or steel pressure tubes is described. The cell can be assembled rapidly, facilitating the study of chemically reacting systems, and it provides good control of both pressure and temperature in a regimen where diamond anvil cells and multianvil apparatus cannot be used. The design provides a relatively large sample volume making it suitable for the study of quite large grain size materials, such as hydrating cement slurries. However, relatively high energy x rays are needed to penetrate the pressure tube

  14. A novel approach to non-biased systematic random sampling: a stereologic estimate of Purkinje cells in the human cerebellum.

    Science.gov (United States)

    Agashiwala, Rajiv M; Louis, Elan D; Hof, Patrick R; Perl, Daniel P

    2008-10-21

    Non-biased systematic sampling using the principles of stereology provides accurate quantitative estimates of objects within neuroanatomic structures. However, the basic principles of stereology are not optimally suited for counting objects that selectively exist within a limited but complex and convoluted portion of the sample, such as occurs when counting cerebellar Purkinje cells. In an effort to quantify Purkinje cells in association with certain neurodegenerative disorders, we developed a new method for stereologic sampling of the cerebellar cortex, involving calculating the volume of the cerebellar tissues, identifying and isolating the Purkinje cell layer and using this information to extrapolate non-biased systematic sampling data to estimate the total number of Purkinje cells in the tissues. Using this approach, we counted Purkinje cells in the right cerebella of four human male control specimens, aged 41, 67, 70 and 84 years, and estimated the total Purkinje cell number for the four entire cerebella to be 27.03, 19.74, 20.44 and 22.03 million cells, respectively. The precision of the method is seen when comparing the density of the cells within the tissue: 266,274, 173,166, 167,603 and 183,575 cells/cm3, respectively. Prior literature documents Purkinje cell counts ranging from 14.8 to 30.5 million cells. These data demonstrate the accuracy of our approach. Our novel approach, which offers an improvement over previous methodologies, is of value for quantitative work of this nature. This approach could be applied to morphometric studies of other similarly complex tissues as well.

  15. Deciphering the Correlation between Breast Tumor Samples and Cell Lines by Integrating Copy Number Changes and Gene Expression Profiles

    Directory of Open Access Journals (Sweden)

    Yi Sun

    2015-01-01

    Full Text Available Breast cancer is one of the most common cancers with high incident rate and high mortality rate worldwide. Although different breast cancer cell lines were widely used in laboratory investigations, accumulated evidences have indicated that genomic differences exist between cancer cell lines and tissue samples in the past decades. The abundant molecular profiles of cancer cell lines and tumor samples deposited in the Cancer Cell Line Encyclopedia and The Cancer Genome Atlas now allow a systematical comparison of the breast cancer cell lines with breast tumors. We depicted the genomic characteristics of breast primary tumors based on the copy number variation and gene expression profiles and the breast cancer cell lines were compared to different subgroups of breast tumors. We identified that some of the breast cancer cell lines show high correlation with the tumor group that agrees with previous knowledge, while a big part of them do not, including the most used MCF7, MDA-MB-231, and T-47D. We presented a computational framework to identify cell lines that mostly resemble a certain tumor group for the breast tumor study. Our investigation presents a useful guide to bridge the gap between cell lines and tumors and helps to select the most suitable cell line models for personalized cancer studies.

  16. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    International Nuclear Information System (INIS)

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  17. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  18. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  19. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Directory of Open Access Journals (Sweden)

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  20. The contribution of cell blocks in the diagnosis of mediastinal masses and hilar adenopathy samples from echobronchoscopy.

    Science.gov (United States)

    Lourido-Cebreiro, Tamara; Leiro-Fernández, Virginia; Tardio-Baiges, Antoni; Botana-Rial, Maribel; Núñez-Delgado, Manuel; Álvarez-Martín, M Jesús; Fernández-Villar, Alberto

    2014-07-01

    Cell block material from puncture can be obtained with endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) in many cases. The aim of this study was to analyse the value of additional information from cell blocks obtained with EBUS-TBNA samples from mediastinal and hilar lymph nodes and masses. Review of pathology reports with a specific diagnosis obtained from EBUS-TBNA samples of mediastinal or hilar lesions, prospectively obtained over a two-year period. The generation of cell blocks from cytology needle samples, the contribution to morphological diagnosis, and the possible use of samples for immunohistochemistry were analysed. One hundred and twenty-nine samples corresponding to 110 patients were reviewed. The diagnosis was lung cancer in 81% of cases, extrapulmonary carcinoma in 10%, sarcoidosis in 4%, lymphoma in 2.7%, and tuberculosis in 0.9%. Cell blocks could be obtained in 72% of cases. Immunohistochemistry studies on the cell blocks were significantly easier to perform than on conventional smears (52.6% vs. 14%, P<.0001). In 4cases, the cell block provided an exclusive morphological diagnosis (3sarcoidosis and one metastasis from prostatic carcinoma) and in 3carcinomas, subtype and origin could be identified. Exclusive diagnoses from the cell block were significantly more frequent in benign disease than in malignant disease (25% vs 0.9%, P=.002). Cell blocks were obtained from 72% of EBUS-TBNA diagnostic procedures. The main contributions of cell blocks to pathology examinations were the possibility of carrying out immunohistochemical staining for the better classification of neoplasms, especially extrapulmonary metastatic tumours, and the improved diagnosis of benign lesions. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

  1. Relationship between haemoglobin concentration and packed cell volume in cattle blood samples

    Directory of Open Access Journals (Sweden)

    Paa-Kobina Turkson

    2015-02-01

    Full Text Available A convention that has been adopted in medicine is to estimate haemoglobin (HB concentration as a third of packed cell volume (PCV or vice versa. The present research set out to determine whether a proportional relationship exists between PCV and Hb concentration in cattle blood samples, and to assess the validity of the convention of estimating Hb concentration as a third of PCV. A total of 440 cattle in Ghana from four breeds (Ndama, 110; West African Short Horn, 110; Zebu, 110 and Sanga, 110 were bled for haematological analysis, specifically packed cell volume, using the microhaematocrit technique and haemoglobin concentration using the cyanmethaemoglobin method. Means, standard deviations, standard errors of mean and 95% confidence intervals were calculated. Trendline analyses generated linear regression equations from scatterplots. For all the cattle, a significant and consistent relationship (r = 0.74 was found between Hb concentration and PCV (%. This was expressed as Hb concentration (g/dL = 0.28 PCV + 3.11. When the Hb concentration was estimated by calculating it as a third of PCV, the relationship was expressed in linear regression as Hb concentration (g/dL = 0.83 calculated Hb + 3.11. The difference in the means of determined (12.2 g/dL and calculated (10.9 g/dL Hb concentrations for all cattle was significant (p < 0.001, whereas the difference in the means of determined Hb and corrected calculated Hb was not significant. In conclusion, a simplified relationship of Hb (g/dL = (0.3 PCV + 3 may provide a better estimate of Hb concentration from the PCV of cattle.

  2. Ultrasound Characterization of Microbead and Cell Suspensions by Speed of Sound Measurements of Neutrally Buoyant Samples

    DEFF Research Database (Denmark)

    Cushing, Kevin W.; Garofalo, Fabio; Magnusson, Cecilia

    2017-01-01

    . The density of the microparticles is determined by using a neutrally buoyant selection process that involves centrifuging of microparticles suspended in different density solutions, CsCl for microbeads and Percoll for cells. The speed of sound at 3 MHz in the neutrally buoyant suspensions is measured...... and fixed cells, such as red blood cells, white blood cells, DU-145 prostate cancer cells, MCF-7 breast cancer cells, and LU-HNSCC-25 head and-neck squamous carcinoma cells in phosphate buffered saline. The results show agreement with published data obtained by other methods....

  3. An improved enzyme-linked immunosorbent assay for whole-cell determination of methanogens in samples from anaerobic reactors

    DEFF Research Database (Denmark)

    Sørensen, A.H.; Ahring, B.K.

    1997-01-01

    An enzyme-linked immunosorbent assay was developed for the detection of whole cells of methanogens in samples from anaerobic continuously stirred tank digesters treating slurries of solid waste. The assay was found to allow for quantitative analysis of the most important groups of methanogens......-quality microtiter plates and the addition of dilute hydrochloric acid to the samples. In an experiment on different digester samples, the test demonstrated a unique pattern of different methanogenic strains present in each sample. The limited preparatory work required for the assay and the simple assay design make...... in samples from anaerobic digesters in a reproducible manner. Polyclonal antisera against eight strains of methanogens were employed in the test, The specificities of the antisera were increased by adsorption with cross-reacting cells. The reproducibility of the assay depended on the use of high...

  4. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  5. Design and evaluation of a new Peltier-cooled laser ablation cell with on-sample temperature control.

    Science.gov (United States)

    Konz, Ioana; Fernández, Beatriz; Fernández, M Luisa; Pereiro, Rosario; Sanz-Medel, Alfredo

    2014-01-27

    A new custom-built Peltier-cooled laser ablation cell is described. The proposed cryogenic cell combines a small internal volume (20 cm(3)) with a unique and reliable on-sample temperature control. The use of a flexible temperature sensor, directly located on the sample surface, ensures a rigorous sample temperature control throughout the entire analysis time and allows instant response to any possible fluctuation. In this way sample integrity and, therefore, reproducibility can be guaranteed during the ablation. The refrigeration of the proposed cryogenic cell combines an internal refrigeration system, controlled by a sensitive thermocouple, with an external refrigeration system. Cooling of the sample is directly carried out by 8 small (1 cm×1 cm) Peltier elements placed in a circular arrangement in the base of the cell. These Peltier elements are located below a copper plate where the sample is placed. Due to the small size of the cooling electronics and their circular allocation it was possible to maintain a peephole under the sample for illumination allowing a much better visualization of the sample, a factor especially important when working with structurally complex tissue sections. The analytical performance of the cryogenic cell was studied using a glass reference material (SRM NIST 612) at room temperature and at -20°C. The proposed cell design shows a reasonable signal washout (signal decay within less than 10 s to background level), high sensitivity and good signal stability (in the range 6.6-11.7%). Furthermore, high precision (0.4-2.6%) and accuracy (0.3-3.9%) in the isotope ratio measurements were also observed operating the cell both at room temperature and at -20°C. Finally, experimental results obtained for the cell application to qualitative elemental imaging of structurally complex tissue samples (e.g. eye sections from a native frozen porcine eye and fresh flower leaves) demonstrate that working in cryogenic conditions is critical in such

  6. Identification of immune cell infiltration in hematoxylin-eosin stained breast cancer samples: texture-based classification of tissue morphologies

    Science.gov (United States)

    Turkki, Riku; Linder, Nina; Kovanen, Panu E.; Pellinen, Teijo; Lundin, Johan

    2016-03-01

    The characteristics of immune cells in the tumor microenvironment of breast cancer capture clinically important information. Despite the heterogeneity of tumor-infiltrating immune cells, it has been shown that the degree of infiltration assessed by visual evaluation of hematoxylin-eosin (H and E) stained samples has prognostic and possibly predictive value. However, quantification of the infiltration in H and E-stained tissue samples is currently dependent on visual scoring by an expert. Computer vision enables automated characterization of the components of the tumor microenvironment, and texture-based methods have successfully been used to discriminate between different tissue morphologies and cell phenotypes. In this study, we evaluate whether local binary pattern texture features with superpixel segmentation and classification with support vector machine can be utilized to identify immune cell infiltration in H and E-stained breast cancer samples. Guided with the pan-leukocyte CD45 marker, we annotated training and test sets from 20 primary breast cancer samples. In the training set of arbitrary sized image regions (n=1,116) a 3-fold cross-validation resulted in 98% accuracy and an area under the receiver-operating characteristic curve (AUC) of 0.98 to discriminate between immune cell -rich and - poor areas. In the test set (n=204), we achieved an accuracy of 96% and AUC of 0.99 to label cropped tissue regions correctly into immune cell -rich and -poor categories. The obtained results demonstrate strong discrimination between immune cell -rich and -poor tissue morphologies. The proposed method can provide a quantitative measurement of the degree of immune cell infiltration and applied to digitally scanned H and E-stained breast cancer samples for diagnostic purposes.

  7. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  8. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  10. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    OpenAIRE

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  11. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  12. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  13. A sealable ultrathin window sample cell for the study of liquids by means of soft X-ray spectroscopy

    Science.gov (United States)

    Grötzsch, D.; Streeck, C.; Nietzold, C.; Malzer, W.; Mantouvalou, I.; Nutsch, A.; Dietrich, P.; Unger, W.; Beckhoff, B.; Kanngießer, B.

    2017-12-01

    A new sample cell concept for the analysis of liquids or solid-liquid interfaces using soft X-ray spectroscopy is presented, which enables the complete sealing of the cell as well as the transport into vacuum via, for example, a load-lock system. The cell uses pressure monitoring and active as well as passive pressure regulation systems, thereby facilitating the full control over the pressure during filling, sealing, evacuation, and measurement. The cell design and sample preparation as well as the crucial sealing procedure are explained in detail. As a first proof-of-principle experiment, successful nitrogen K-edge fluorescence yield near-edge X-ray absorption fine structure experiments of a biomolecular solution are presented. For this purpose, it is shown that the careful evaluation of all involved parameters, such as window type or photon flux, is desirable for optimizing the experimental result.

  14. Attitude of A Sample of Iranian Researchers toward The Future of Stem Cell Research.

    Science.gov (United States)

    Lotfipanah, Mahdi; Azadeh, Fereydoon; Totonchi, Mehdi; Omani-Samani, Reza

    2018-10-01

    Stem cells that have unlimited proliferation potential as well as differentiation potency are considered to be a promising future treatment method for incurable diseases. The aim of the present study is to evaluate the future trend of stem cell researches from researchers' viewpoints. This was a cross-sectional descriptive study on researchers involved in stem cell research at Royan Institute. We designed a questionnaire using a qualitative study based on expert opinion and a literature review. Content validity was performed using three rounds of the Delphi method with experts. Face validity was undertaken by a Persian literature expert and a graphics designer. The questionnaire was distributed among 150 researchers involved in stem cell studies in Royan Institute biology laboratories. We collected 138 completed questionnaires. The mean age of participants was 31.13 ± 5.8 years; most (60.9%) were females. Participants (76.1%) considered the budget to be the most important issue in stem cell research, 79.7% needed financial support from the government, and 77.5% felt that charities could contribute substantially to stem cell research. A total of 90.6% of participants stated that stem cells should lead to commercial usage which could support future researches (86.2%). The aim of stem cell research was stipulated as increasing health status of the society according to 92.8% of the participants. At present, among cell types, importance was attached to cord blood and adult stem cells. Researchers emphasized the importance of mesenchymal stem cells (MSCs) rather than hematopoietic stem cells (HSCs, 57.73%). The prime priorities were given to cancer so that stem cell research could be directed to sphere stem cell research whereas the least preference was given to skin research. Regenerative medicine is considered the future of stem cell research with emphasis on application of these cells, especially in cancer treatment. Copyright© by Royan Institute. All rights

  15. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Directory of Open Access Journals (Sweden)

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  16. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  17. Cell chirality: its origin and roles in left-right asymmetric development.

    Science.gov (United States)

    Inaki, Mikiko; Liu, Jingyang; Matsuno, Kenji

    2016-12-19

    An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by 'cortical inheritance'. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left-right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Authors.

  18. Cell chirality: its origin and roles in left–right asymmetric development

    Science.gov (United States)

    Inaki, Mikiko; Liu, Jingyang

    2016-01-01

    An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by ‘cortical inheritance’. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left–right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821533

  19. Evaluation of Chromosomal Disorders in Tissue and Blood Samples in Patients with Oral Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    A. Parvaneroo

    2004-12-01

    Full Text Available Statement of Problem: Many studies have indicated that genetic disturbances are common findings in patients with Oral Squamous Cell Carcinoma (OSCC. Identification of these changes can be helpful in diagnostic procedures of these tumors.Purpose: The aim of this study was to appraise the chromosomal disorders in blood and tissue patients with OSCC.Methods and Materials: In this descriptive study, the study group consisted of all OSCC patients who were referred to the Faculty of Dentistry, Tehran University of Medical Sciences, Maxillofacial Surgery Clinic of Shariati Hospital, and Amir Aalam Hospital fromSeptember 2000 to November 2002. In order to study chromosomal disorders in the peripheral blood lymphocytes, 5 mL of blood was obtained from each patient In patients with the large lesion, a piece of involved tissue were obtained and cultured for 24 hours.This led to 29 blood samples and 16 tissue specimens and any relation between OSCC and age, sex, smoking and alcohol use were evaluated.Results: In this study, OSCC was more common in males than in females (3 to 5. 31% of our patients were smokers, and one had a history of alcoholic consumption. There was an increase in incidence of OSCC with age. In this study, all patients had numerical(aneuploidy, polyploidy and structural chromosomal disorders (double minute, fragment,breakage and dicentric. There was significant difference between blood and tissue chromosomal disorders (aneuploidy, polyploidy,breakage in OSCC patients.Conclusion: It can be concluded that chromosomes in patients with OSCC might show some genetic aberration and evaluation of involved tissue might be better way for determining this disorders.

  20. Role of eicosanoids and white blood cells in the beneficial effects of limited reperfusion after ischemia-reperfusion injury in skeletal muscle

    International Nuclear Information System (INIS)

    Anderson, R.J.; Cambria, R.A.; Dikdan, G.; Lysz, T.W.; Hobson, R.W. II

    1990-01-01

    Limiting the rate of reperfusion blood flow has been shown to be beneficial locally in models of ischemia-reperfusion injury. We investigated the effects of this on eicosanoids (thromboxane B2, 6-keto-PGF1 alpha, and leukotriene B4), white blood cell activation, and skeletal muscle injury as quantitated by triphenyltetrazolium chloride and technetium-99m pyrophosphate after ischemia-reperfusion injury in an isolated gracilis muscle model in 16 anesthetized dogs. One gracilis muscle in each dog was subjected to 6 hours of ischemia followed by 1 hour of limited reperfusion and then by a second hour of normal reperfusion. The other muscle was subjected to 6 hours of ischemia followed by 2 hours of normal reperfusion. Six dogs each were used as normal reperfusion controls (NR) and limited reperfusion controls (LR), with 5 dogs being treated with a thromboxane synthetase inhibitor (LR/TSI) and another five with a leukotriene inhibitor (LR/LI). LR in all three groups (LR, LR/TSI, and LR/LI) showed a benefit in skeletal muscle injury as measured by triphenyltetrazolim chloride and technetium-99m pyrophosphate when compared with NR. However, there was no significant difference between the groups with LR regarding eicosanoid levels and white blood cell activation when compared with NR. These results demonstrate that LR produces benefits by mechanisms other than those dependent upon thromboxane A2, prostacyclin, or white blood cell activation

  1. A novel minimally-invasive method to sample human endothelial cells for molecular profiling.

    Directory of Open Access Journals (Sweden)

    Stephen W Waldo

    Full Text Available The endothelium is a key mediator of vascular homeostasis and cardiovascular health. Molecular research on the human endothelium may provide insight into the mechanisms underlying cardiovascular disease. Prior methodology used to isolate human endothelial cells has suffered from poor yields and contamination with other cell types. We thus sought to develop a minimally invasive technique to obtain endothelial cells derived from human subjects with higher yields and purity.Nine healthy volunteers underwent endothelial cell harvesting from antecubital veins using guidewires. Fluorescence-activated cell sorting (FACS was subsequently used to purify endothelial cells from contaminating cells using endothelial surface markers (CD34/CD105/CD146 with the concomitant absence of leukocyte and platelet specific markers (CD11b/CD45. Endothelial lineage in the purified cell population was confirmed by expression of endothelial specific genes and microRNA using quantitative polymerase chain reaction (PCR.A median of 4,212 (IQR: 2161-6583 endothelial cells were isolated from each subject. Quantitative PCR demonstrated higher expression of von Willebrand Factor (vWF, P<0.001, nitric oxide synthase 3 (NOS3, P<0.001 and vascular cell adhesion molecule 1 (VCAM-1, P<0.003 in the endothelial population compared to similarly isolated leukocytes. Similarly, the level of endothelial specific microRNA-126 was higher in the purified endothelial cells (P<0.001.This state-of-the-art technique isolates human endothelial cells for molecular analysis in higher purity and greater numbers than previously possible. This approach will expedite research on the molecular mechanisms of human cardiovascular disease, elucidating its pathophysiology and potential therapeutic targets.

  2. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  3. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Science.gov (United States)

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  4. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    OpenAIRE

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  5. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics

    NARCIS (Netherlands)

    van Ginkel, Joost H.; van den Broek, Daan A.; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M.; Huibers, Manon M.H.

    2017-01-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for

  6. Robust Load Cell Cell for Discrete Contact Force Measurements of Sampling Systems and/or Instruments, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Bear Engineering proposes to develop a simple, robust, extreme environment compatible, mechanical load cell to enable the control of contact forces for placement of...

  7. A Comparative Study of Sample Preparation for Staining and Immunodetection of Plant Cell Walls by Light Microscopy

    Science.gov (United States)

    Verhertbruggen, Yves; Walker, Jesse L.; Guillon, Fabienne; Scheller, Henrik V.

    2017-01-01

    Staining and immunodetection by light microscopy are methods widely used to investigate plant cell walls. The two techniques have been crucial to study the cell wall architecture in planta, its deconstruction by chemicals or cell wall-degrading enzymes. They have been instrumental in detecting the presence of cell types, in deciphering plant cell wall evolution and in characterizing plant mutants and transformants. The success of immunolabeling relies on how plant materials are embedded and sectioned. Agarose coating, wax and resin embedding are, respectively, associated with vibratome, microtome and ultramicrotome sectioning. Here, we have systematically carried out a comparative analysis of these three methods of sample preparation when they are applied for cell wall staining and cell wall immunomicroscopy. In order to help the plant community in understanding and selecting adequate methods of embedding and sectioning for cell wall immunodetection, we review in this article the advantages and limitations of these three methods. Moreover, we offer detailed protocols of embedding for studying plant materials through microscopy. PMID:28900439

  8. Expression of T helper cell-associated inflammatory mediator mRNAs in cells of bronchoalveolar lavage fluid samples and oxygen concentration in arterial blood samples from healthy horses exposed to hyperbaric oxygen.

    Science.gov (United States)

    Looijen, Maty G P; New, Dallas J; Fischer, Carrie D; Dardari, Rkia; Irwin, Karyn M; Berezowski, Christopher J; Bond, Stephanie L; Léguillette, Renaud

    2016-10-01

    OBJECTIVE To evaluate the mRNA expression of T helper (Th)1, Th2, and Th17 cell-associated inflammatory mediators in cells of bronchoalveolar lavage fluid samples collected from healthy horses exposed to hyperbaric oxygen (HBO) and to monitor blood oxygen concentration during and following HBO therapy. ANIMALS 8 healthy horses. PROCEDURES In a randomized controlled crossover design study, each horse was exposed (beginning day 1) to 100% oxygen at a maximum of 3 atmospheres absolute (304 kPa) daily for 10 days or ambient air at atmospheric pressure in the HBO chamber for an equivalent amount of time (control). Bronchoalveolar lavage fluid samples were collected on days 0 and 10. After validation of candidate reference genes, relative mRNA expressions of various innate inflammatory, Th1 cell-derived, Th2 cell-derived (including eotaxin-2), Th17 cell-derived, and regulatory cytokines were measured by quantitative PCR assays. For 3 horses, arterial blood samples were collected for blood gas analysis during a separate HBO session. RESULTS The optimal combination of reference genes was glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine ribosyltransferase, and ribosomal protein L32. Compared with day 0 findings, expression of eotaxin-2 mRNA was significantly lower (0.12-fold reduction) and the percentage of neutrophils in bronchoalveolar lavage fluid samples was significantly lower on day 10 when horses received HBO therapy. Values of Pao2 rapidly increased (> 800 mm Hg) but immediately decreased to pretreatment values when HBO sessions ended. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that HBO therapy does not increase mRNA expression of inflammatory cytokines, but reduces eotaxin-2 mRNA transcription. The Pao2 increase was transient with no cumulative effects of HBO.

  9. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    International Nuclear Information System (INIS)

    Lazovic, Sasa; Puac, Nevena; Maletic, Dejan; Malovic, Gordana; Petrovic, Zoran; Miletic, Maja; Pavlica, Dusan; Jovanovic, Milena; Milenkovic, Pavle; Bugarski, Diana; Mojsilovic, Slavko

    2010-01-01

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  10. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Lazovic, Sasa; Puac, Nevena; Maletic, Dejan; Malovic, Gordana; Petrovic, Zoran [Institute of Physics, Pregrevica 118, 11080 Belgrade (Serbia); Miletic, Maja; Pavlica, Dusan; Jovanovic, Milena; Milenkovic, Pavle [Faculty of Stomatology, Dr Subotica 8, 11000 Belgrade (Serbia); Bugarski, Diana; Mojsilovic, Slavko, E-mail: lazovic@ipb.ac.r [Institute for Medical Research, Dr Subotica-starijeg 4, 11000 Belgrade (Serbia)

    2010-08-15

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  11. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    Science.gov (United States)

    Lazović, Saša; Puač, Nevena; Miletić, Maja; Pavlica, Dušan; Jovanović, Milena; Bugarski, Diana; Mojsilović, Slavko; Maletić, Dejan; Malović, Gordana; Milenković, Pavle; Petrović, Zoran

    2010-08-01

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  12. Determination of bismuth in environmental samples by ICP-MS and basic examination of cell toxicity for their compounds

    International Nuclear Information System (INIS)

    Kobayashi, Jun; Matsukawa, Takehisa; Chiba, Momoko; Yokoyama, Kazuhito; Terada, Hiroshi; Sugiyama, Hideo

    2011-01-01

    We examined both bismuth content levels in some environmental water samples (tapwater, bottled drinking water and slag obtained by sewage disposal) by inductively coupled plasma mass spectrometry (ICP-MS) and cultured cell toxicity of their compounds by the MTT assay. For ICP-MS, the conditions examined were addition of internal standard (IS), apparatus condition, and determination range, etc. When we examined an IS, the advantage was not clear that the ICP-MS response of the IS candidate elements was very variable. However, the sample induction rate into ICP-MS is more changeable at any time. Since the correction of analytical results was enabled by the addition of IS, Tl-203 was selected for IS, and was used in this study. The determination lower limit was 11 ppt by using 10 ppb Tl. Bi was detected in a few environmental water samples at 20.4 ppt - 6.8 ppb (0.07-6.83 μg/g original slags), but Bi concentrations of most samples were lower than the determination limit. On the other hand, concerning cell toxicity, the subgallate and free gallic acid affected the lives of cultured cells. Especially, the toxicity of free gallic acid was higher. It has been understood that the toxicity is weakly adjusted by chelating with Bi. (author)

  13. Determination of thorium and uranium contents in soil samples ...

    Indian Academy of Sciences (India)

    using CR-39 and LR-115-II solid-state nuclear track detectors (SSNTDs). ... standard soil samples have been determined and compared with its known values. ... measure α-tracks activity [1], where SSNTDs have been used in geology [2–6] ...

  14. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  15. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  16. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

    Science.gov (United States)

    van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

    2017-10-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  17. Distinct Roles of Th17 and Th1 Cells in Inflammatory Responses Associated with the Presentation of Paucibacillary Leprosy and Leprosy Reactions.

    Science.gov (United States)

    Santos, M B; de Oliveira, D T; Cazzaniga, R A; Varjão, C S; Dos Santos, P L; Santos, M L B; Correia, C B; Faria, D R; Simon, M do V; Silva, J S; Dutra, W O; Reed, S G; Duthie, M S; de Almeida, R P; de Jesus, A R

    2017-07-01

    It is well established that helper T cell responses influence resistance or susceptibility to Mycobacterium leprae infection, but the role of more recently described helper T cell subsets in determining severity is less clear. To investigate the involvement of Th17 cells in the pathogenesis of leprosy, we determined the immune profile with variant presentations of leprosy. Firstly, IL-17A, IFN-γ and IL-10 were evaluated in conjunction with CD4 + T cell staining by confocal microscopy of lesion biopsies from tuberculoid (TT) and lepromatous leprosy (LL) patients. Secondly, inflammatory cytokines were measured by multiplex assay of serum samples from Multibacillary (MB, n = 28) and Paucibacillary (PB, n = 23) patients and household contacts (HHC, n = 23). Patients with leprosy were also evaluated for leprosy reaction occurrence: LR+ (n = 8) and LR- (n = 20). Finally, peripheral blood mononuclear cells were analysed by flow cytometry used to determine the phenotype of cytokine-producing cells. Lesions from TT patients were found to have more CD4 + IL-17A + cells than those from LL patients. Higher concentrations of IL-17A and IL-1β were observed in serum from PB than MB patients. The highest serum IFN-γ concentrations were, however, detected in sera from MB patients that developed leprosy reactions (MB LR + ). Together, these results indicate that Th1 cells were associated with both the PB presentation and also with leprosy reactions. In contrast, Th17 cells were associated with an effective inflammatory response that is present in the PB forms but were not predictive of leprosy reactions in MB patients. © 2017 The Foundation for the Scandinavian Journal of Immunology.

  18. A reaction cell with sample laser heating for in situ soft X-ray absorption spectroscopy studies under environmental conditions.

    Science.gov (United States)

    Escudero, Carlos; Jiang, Peng; Pach, Elzbieta; Borondics, Ferenc; West, Mark W; Tuxen, Anders; Chintapalli, Mahati; Carenco, Sophie; Guo, Jinghua; Salmeron, Miquel

    2013-05-01

    A miniature (1 ml volume) reaction cell with transparent X-ray windows and laser heating of the sample has been designed to conduct X-ray absorption spectroscopy studies of materials in the presence of gases at atmospheric pressures. Heating by laser solves the problems associated with the presence of reactive gases interacting with hot filaments used in resistive heating methods. It also facilitates collection of a small total electron yield signal by eliminating interference with heating current leakage and ground loops. The excellent operation of the cell is demonstrated with examples of CO and H2 Fischer-Tropsch reactions on Co nanoparticles.

  19. A method for multiple sequential analyses of macrophage functions using a small single cell sample

    Directory of Open Access Journals (Sweden)

    F.R.F. Nascimento

    2003-09-01

    Full Text Available Microbial pathogens such as bacillus Calmette-Guérin (BCG induce the activation of macrophages. Activated macrophages can be characterized by the increased production of reactive oxygen and nitrogen metabolites, generated via NADPH oxidase and inducible nitric oxide synthase, respectively, and by the increased expression of major histocompatibility complex class II molecules (MHC II. Multiple microassays have been developed to measure these parameters. Usually each assay requires 2-5 x 10(5 cells per well. In some experimental conditions the number of cells is the limiting factor for the phenotypic characterization of macrophages. Here we describe a method whereby this limitation can be circumvented. Using a single 96-well microassay and a very small number of peritoneal cells obtained from C3H/HePas mice, containing as little as <=2 x 10(5 macrophages per well, we determined sequentially the oxidative burst (H2O2, nitric oxide production and MHC II (IAk expression of BCG-activated macrophages. More specifically, with 100 µl of cell suspension it was possible to quantify H2O2 release and nitric oxide production after 1 and 48 h, respectively, and IAk expression after 48 h of cell culture. In addition, this microassay is easy to perform, highly reproducible and more economical.

  20. Automated flow cytometric analysis across large numbers of samples and cell types.

    Science.gov (United States)

    Chen, Xiaoyi; Hasan, Milena; Libri, Valentina; Urrutia, Alejandra; Beitz, Benoît; Rouilly, Vincent; Duffy, Darragh; Patin, Étienne; Chalmond, Bernard; Rogge, Lars; Quintana-Murci, Lluis; Albert, Matthew L; Schwikowski, Benno

    2015-04-01

    Multi-parametric flow cytometry is a key technology for characterization of immune cell phenotypes. However, robust high-dimensional post-analytic strategies for automated data analysis in large numbers of donors are still lacking. Here, we report a computational pipeline, called FlowGM, which minimizes operator input, is insensitive to compensation settings, and can be adapted to different analytic panels. A Gaussian Mixture Model (GMM)-based approach was utilized for initial clustering, with the number of clusters determined using Bayesian Information Criterion. Meta-clustering in a reference donor permitted automated identification of 24 cell types across four panels. Cluster labels were integrated into FCS files, thus permitting comparisons to manual gating. Cell numbers and coefficient of variation (CV) were similar between FlowGM and conventional gating for lymphocyte populations, but notably FlowGM provided improved discrimination of "hard-to-gate" monocyte and dendritic cell (DC) subsets. FlowGM thus provides rapid high-dimensional analysis of cell phenotypes and is amenable to cohort studies. Copyright © 2015. Published by Elsevier Inc.

  1. A human monocytic NF-κB fluorescent reporter cell line for detection of microbial contaminants in biological samples.

    Directory of Open Access Journals (Sweden)

    Claire Battin

    Full Text Available Sensing of pathogens by innate immune cells is essential for the initiation of appropriate immune responses. Toll-like receptors (TLRs, which are highly sensitive for various structurally and evolutionary conserved molecules derived from microbes have a prominent role in this process. TLR engagement results in the activation of the transcription factor NF-κB, which induces the expression of cytokines and other inflammatory mediators. The exquisite sensitivity of TLR signalling can be exploited for the detection of bacteria and microbial contaminants in tissue cultures and in protein preparations. Here we describe a cellular reporter system for the detection of TLR ligands in biological samples. The well-characterized human monocytic THP-1 cell line was chosen as host for an NF-ᴋB-inducible enhanced green fluorescent protein reporter gene. We studied the sensitivity of the resultant reporter cells for a variety of microbial components and observed a strong reactivity towards TLR1/2 and TLR2/6 ligands. Mycoplasma lipoproteins are potent TLR2/6 agonists and we demonstrate that our reporter cells can be used as reliable and robust detection system for mycoplasma contaminations in cell cultures. In addition, a TLR4-sensitive subline of our reporters was engineered, and probed with recombinant proteins expressed in different host systems. Bacterially expressed but not mammalian expressed proteins induced strong reporter activity. We also tested proteins expressed in an E. coli strain engineered to lack TLR4 agonists. Such preparations also induced reporter activation in THP-1 cells highlighting the importance of testing recombinant protein preparations for microbial contaminations beyond endotoxins. Our results demonstrate the usefulness of monocytic reporter cells for high-throughput screening for microbial contaminations in diverse biological samples, including tissue culture supernatants and recombinant protein preparations. Fluorescent reporter

  2. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  3. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

    Science.gov (United States)

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  4. Portraying the Expression Landscapes of B-CellLymphoma-Intuitive Detection of Outlier Samples and of Molecular Subtypes

    Directory of Open Access Journals (Sweden)

    Lydia Hopp

    2013-12-01

    Full Text Available We present an analytic framework based on Self-Organizing Map (SOM machine learning to study large scale patient data sets. The potency of the approach is demonstrated in a case study using gene expression data of more than 200 mature aggressive B-cell lymphoma patients. The method portrays each sample with individual resolution, characterizes the subtypes, disentangles the expression patterns into distinct modules, extracts their functional context using enrichment techniques and enables investigation of the similarity relations between the samples. The method also allows to detect and to correct outliers caused by contaminations. Based on our analysis, we propose a refined classification of B-cell Lymphoma into four molecular subtypes which are characterized by differential functional and clinical characteristics.

  5. Fast filtration sampling protocol for mammalian suspension cells tailored for phosphometabolome profiling by capillary ion chromatography - tandem mass spectrometry.

    Science.gov (United States)

    Kvitvang, Hans F N; Bruheim, Per

    2015-08-15

    Capillary ion chromatography (capIC) is the premium separation technology for low molecular phosphometabolites and nucleotides in biological extracts. Removal of excessive amounts of salt during sample preparation stages is a prerequisite to enable high quality capIC separation in combination with reproducible and sensitive MS detection. Existing sampling protocols for mammalian cells used for GC-MS and LC-MS metabolic profiling can therefore not be directly applied to capIC separations. Here, the development of a fast filtration sampling protocol for mammalian suspension cells tailored for quantitative profiling of the phosphometabolome on capIC-MS/MS is presented. The whole procedure from sampling the culture to transfer of filter to quenching and extraction solution takes less than 10s. To prevent leakage it is critical that a low vacuum pressure is applied, and satisfactorily reproducibility was only obtained by usage of a vacuum pressure controlling device. A vacuum of 60mbar was optimal for filtration of multiple myeloma Jjn-3 cell cultures through 5μm polyvinylidene (PVDF) filters. A quick deionized water (DI-water) rinse step prior to extraction was tested, and significantly higher metabolite yields were obtained during capIC-MS/MS analyses in this extract compared to extracts prepared by saline and reduced saline (25%) washing steps only. In addition, chromatographic performance was dramatically improved. Thus, it was verified that a quick DI-water rinse is tolerated by the cells and can be included as the final stage during filtration. Over 30 metabolites were quantitated in JJN-3 cell extracts by using the optimized sampling protocol with subsequent capIC-MS/MS analysis, and up to 2 million cells can be used in a single filtration step for the chosen filter and vacuum pressure. The technical set-up is also highly advantageous for microbial metabolome filtration protocols after optimization of vacuum pressure and washing solutions, and the reduced salt

  6. Cell Chirality Drives Left-Right Asymmetric Morphogenesis.

    Science.gov (United States)

    Inaki, Mikiko; Sasamura, Takeshi; Matsuno, Kenji

    2018-01-01

    Most macromolecules found in cells are chiral, meaning that they cannot be superimposed onto their mirror image. However, cells themselves can also be chiral, a subject that has received little attention until very recently. In our studies on the mechanisms of left-right (LR) asymmetric development in Drosophila , we discovered that cells can have an intrinsic chirality to their structure, and that this "cell chirality" is generally responsible for the LR asymmetric development of certain organs in this species. The actin cytoskeleton plays important roles in the formation of cell chirality. In addition, Myosin31DF ( Myo31DF ), which encodes Drosophila Myosin ID, was identified as a molecular switch for cell chirality. In other invertebrate species, including snails and Caenorhabditis elegans , chirality of the blastomeres, another type of cell chirality, determines the LR asymmetry of structures in the body. Thus, chirality at the cellular level may broadly contribute to LR asymmetric development in various invertebrate species. Recently, cell chirality was also reported for various vertebrate cultured cells, and studies suggested that cell chirality is evolutionarily conserved, including the essential role of the actin cytoskeleton. Although the biological roles of cell chirality in vertebrates remain unknown, it may control LR asymmetric development or other morphogenetic events. The investigation of cell chirality has just begun, and this new field should provide valuable new insights in biology and medicine.

  7. Sample to answer visualization pipeline for low-cost point-of-care blood cell counting

    CSIR Research Space (South Africa)

    Smith, S

    2015-02-01

    Full Text Available and flow rates, and 2) a microscopy analysis system to investigate homogeneity and concentration of blood cells. Fluidic parameters were derived from the optical flow as well as color-based segmentation of the different fluids using a hue...

  8. IgG4-positive cell infiltration in various cardiovascular disorders - results from histopathological analysis of surgical samples.

    Science.gov (United States)

    Hourai, Ryoto; Kasashima, Satomi; Sohmiya, Koichi; Yamauchi, Yohei; Ozawa, Hideki; Hirose, Yoshinobu; Ogino, Yasuhiro; Katsumata, Takahiro; Daimon, Masahiro; Fujita, Shu-Ichi; Hoshiga, Masaaki; Ishizaka, Nobukazu

    2017-02-03

    The diagnosis of Immunoglobulin G4 (IgG4)-related disease (IgG4-RD), in general, depends on serum IgG4 concentrations and histopathological findings; therefore, diagnosis of IgG4-RD in cardiovascular organs/tissues is often difficult owing to the risk of tissue sampling. Prevalence of IgG4-positive lymphoplasmacytic infiltration in 103 consecutive cardiovascular surgical samples from 98 patients with various cardiovascular diseases was analyzed immunohistochemically. The diagnoses of the enrolled patients included aortic aneurysm (abdominal, n = 8; thoracic, n = 9); aortic dissection (n = 20); aortic stenosis (n = 24), aortic regurgitation (n = 10), and mitral stenosis/regurgitation (n = 17). In total, 10 (9.7%) of the 103 specimens showed IgG4-positive cell infiltration with various intensities; five of these were aortic valve specimens from aortic stenosis, and IgG4-positive cell infiltration was present at >10 /HPF in three of them. In one aortic wall sample from an abdominal aortic aneurysm, various histopathological features of IgG4-RD, such as IgG4-positive cell infiltration, obliterating phlebitis, and storiform fibrosis, were observed. IgG4-positive cell infiltration was observed in 9.7% of the surgical cardiovascular specimens, mainly in the aortic valve from aortic stenosis and in the aortic wall from aortic aneurysm. Whether IgG4-positive cell infiltration has pathophysiological importance in the development or progression of cardiovascular diseases should be investigated in future studies.

  9. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    International Nuclear Information System (INIS)

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  10. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  11. Determination of protein carbonyls in plasma, cell extracts, tissue homogenates, isolated proteins: Focus on sample preparation and derivatization conditions.

    Science.gov (United States)

    Weber, Daniela; Davies, Michael J; Grune, Tilman

    2015-08-01

    Protein oxidation is involved in regulatory physiological events as well as in damage to tissues and is thought to play a key role in the pathophysiology of diseases and in the aging process. Protein-bound carbonyls represent a marker of global protein oxidation, as they are generated by multiple different reactive oxygen species in blood, tissues and cells. Sample preparation and stabilization are key steps in the accurate quantification of oxidation-related products and examination of physiological/pathological processes. This review therefore focuses on the sample preparation processes used in the most relevant methods to detect protein carbonyls after derivatization with 2,4-dinitrophenylhydrazine with an emphasis on measurement in plasma, cells, organ homogenates, isolated proteins and organelles. Sample preparation, derivatization conditions and protein handling are presented for the spectrophotometric and HPLC method as well as for immunoblotting and ELISA. An extensive overview covering these methods in previously published articles is given for researchers who plan to measure protein carbonyls in different samples. © 2015 Published by Elsevier Ltd.

  12. Accurate and reproducible measurements of RhoA activation in small samples of primary cells.

    Science.gov (United States)

    Nini, Lylia; Dagnino, Lina

    2010-03-01

    Rho GTPase activation is essential in a wide variety of cellular processes. Measurement of Rho GTPase activation is difficult with limited material, such as tissues or primary cells that exhibit stringent culture requirements for growth and survival. We defined parameters to accurately and reproducibly measure RhoA activation (i.e., RhoA-GTP) in cultured primary keratinocytes in response to serum and growth factor stimulation using enzyme-linked immunosorbent assay (ELISA)-based G-LISA assays. We also established conditions that minimize RhoA-GTP in unstimulated cells without affecting viability, allowing accurate measurements of RhoA activation on stimulation or induction of exogenous GTPase expression. Copyright 2009 Elsevier Inc. All rights reserved.

  13. Locoregional failures following thoracic irradiation in patients with limited-stage small cell lung carcinoma

    International Nuclear Information System (INIS)

    Giuliani, Meredith E.; Lindsay, Patricia E.; Sun, Alexander; Bezjak, Andrea; Le, Lisa W.; Brade, Anthony; Cho, John; Leighl, Natasha B.; Shepherd, Frances A.; Hope, Andrew J.

    2012-01-01

    Purpose: To determine the patterns of loco-regional (LR) and distant failure in patients with limited-stage small cell lung carcinoma (LS-SCLC) treated with curative intent. Methods: From 1997 to 2008, 253 LS-SCLC patients were treated with curative intent chemo-radiation at our institution. A retrospective review identified sites of failure. The cumulative LR failure (LRF) rate was calculated. Distant failure-free survival (FFS) and overall survival (OS) were calculated using the Kaplan–Meier method. Volumetric images of LR failures were delineated and registered with the original radiation treatment plans if available. Dosimetric parameters for the delineated failure volumes were calculated from the original treatment information. Results: The median follow-up was 19 months. The site of first failure was LR in 34, distant in 80 and simultaneous LR and distant in 31 patients. The cumulative LRF rate was 29% and 38% at 2 and 5 years. OS was 44% at 2 years. Seventy patients had electronically archived treatment plans of which there were 16 LR failures (7 local and 39 regional failure volumes). Of the local and regional failure volumes 29% and 31% were in-field, respectively. Conclusions: The predominant pattern of LR failure was marginal or out-of-field. LR failures may be preventable with improved radiotherapy target definition.

  14. Differences between the genomes of lymphoblastoid cell lines and blood-derived samples

    Directory of Open Access Journals (Sweden)

    Joesch-Cohen LM

    2017-02-01

    Full Text Available Lena M Joesch-Cohen, Gustavo Glusman Institute for Systems Biology, Seattle, WA, USA Abstract: Lymphoblastoid cell lines (LCLs represent a convenient research tool for expanding the amount of biologic material available from an individual. LCLs are commonly used as reference materials, most notably from the Genome in a Bottle Consortium. However, the question remains how faithfully LCL-derived genome assemblies represent the germline genome of the donor individual as compared to the genome assemblies derived from peripheral blood mononuclear cells. We present an in-depth comparison of a large collection of LCL- and peripheral blood mononuclear cell-derived genomes in terms of distributions of coverage and copy number alterations. We found significant differences in the depth of coverage and copy number calls, which may be driven by differential replication timing. Importantly, these copy number changes preferentially affect regions closer to genes and with higher GC content. This suggests that genomic studies based on LCLs may display locus-specific biases, and that conclusions based on analysis of depth of coverage and copy number variation may require further scrutiny. Keywords: genomics, whole-genome sequencing, viral transformation, copy number changes, bioinformatics

  15. Effect of red blood cell aggregation and sedimentation on optical coherence tomography signals from blood samples

    International Nuclear Information System (INIS)

    Kirillin, M Yu; Priezzhev, A V; Tuchin, V V; Wang, R K; Myllylae, R

    2005-01-01

    In this work, Monte Carlo simulation is used to obtain model optical coherence tomography (OCT) signals from a horizontally orientated blood layer at different stages of red blood cell (RBC) aggregation and sedimentation processes. The parameters for aggregating and sedimenting blood cells were chosen based on the data available from the literature and our earlier experimental studies. We consider two different cases: a suspension of washed RBCs in physiological solution (where aggregation does not take place) and RBCs in blood plasma (which provides necessary conditions for aggregation). Good agreement of the simulation results with the available experimental data shows that the chosen optical parameters are reasonable. The dependence of the numbers of photons contributing to the OCT signal on the number of experienced scattering events was analysed for each simulated signal. It was shown that the maxima of these dependences correspond to the peaks in the OCT signals related to the interfaces between the layers of blood plasma and blood cells. Their positions can be calculated from the optical thicknesses of the layers, and the absorption and scattering coefficients of the media

  16. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Science.gov (United States)

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

    2016-01-01

    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  17. The Relationship Between Cell Phone Use and Academic Performance in a Sample of U.S. College Students

    Directory of Open Access Journals (Sweden)

    Andrew Lepp

    2015-02-01

    Full Text Available The cell phone is ever-present on college campuses and is frequently used in settings where learning occurs. This study assessed the relationship between cell phone use and actual college grade point average (GPA after controlling for known predictors. As such, 536 undergraduate students from 82 self-reported majors at a large, public university were sampled. A hierarchical regression (R2 = .449 demonstrated that cell phone use was significantly (p < .001 and negatively (β = −.164 related to actual college GPA after controlling for demographic variables, self-efficacy for self-regulated learning, self-efficacy for academic achievement, and actual high school GPA, which were all significant predictors (p < .05. Thus, after controlling for other established predictors, increased cell phone use was associated with decreased academic performance. Although more research is needed to identify the underlying mechanisms, findings suggest a need to sensitize students and educators about the potential academic risks associated with high-frequency cell phone use.

  18. An automated laboratory-scale methodology for the generation of sheared mammalian cell culture samples.

    Science.gov (United States)

    Joseph, Adrian; Goldrick, Stephen; Mollet, Michael; Turner, Richard; Bender, Jean; Gruber, David; Farid, Suzanne S; Titchener-Hooker, Nigel

    2017-05-01

    Continuous disk-stack centrifugation is typically used for the removal of cells and cellular debris from mammalian cell culture broths at manufacturing-scale. The use of scale-down methods to characterise disk-stack centrifugation performance enables substantial reductions in material requirements and allows a much wider design space to be tested than is currently possible at pilot-scale. The process of scaling down centrifugation has historically been challenging due to the difficulties in mimicking the Energy Dissipation Rates (EDRs) in typical machines. This paper describes an alternative and easy-to-assemble automated capillary-based methodology to generate levels of EDRs consistent with those found in a continuous disk-stack centrifuge. Variations in EDR were achieved through changes in capillary internal diameter and the flow rate of operation through the capillary. The EDRs found to match the levels of shear in the feed zone of a pilot-scale centrifuge using the experimental method developed in this paper (2.4×10 5 W/Kg) are consistent with those obtained through previously published computational fluid dynamic (CFD) studies (2.0×10 5 W/Kg). Furthermore, this methodology can be incorporated into existing scale-down methods to model the process performance of continuous disk-stack centrifuges. This was demonstrated through the characterisation of culture hold time, culture temperature and EDRs on centrate quality. © 2017 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Characteristics of HIV target CD4 T cells collected using different sampling methods from the genital tract of HIV seronegative women.

    Science.gov (United States)

    Iyer, Smita S; Sabula, Michael J; Mehta, C Christina; Haddad, Lisa B; Brown, Nakita L; Amara, Rama R; Ofotokun, Igho; Sheth, Anandi N

    2017-01-01

    Understanding the immune profile of CD4 T cells, the primary targets for HIV, in the female genital tract (FGT) is critical for evaluating and developing effective biomedical HIV prevention strategies in women. However, longitudinal investigation of HIV susceptibility markers expressed by FGT CD4 T cells has been hindered by low cellular yield and risk of sampling-associated trauma. We investigated three minimally invasive FGT sampling methods to characterize and compare CD4 T cell yield and phenotype with the goal of establishing feasible sampling strategies for immune profiling of mucosal CD4 T cells. FGT samples were collected bimonthly from 12 healthy HIV negative women of reproductive age in the following order: 1) Cervicovaginal lavage (CVL), 2) two sequential endocervical flocked swabs (FS), and 3) two sequential endocervical cytobrushes (CB1, CB2). Cells were isolated and phentoyped via flow cytometry. CD4 T cell recovery was highest from each individual CB compared to either CVL or FS (p sampling method, expressed CCR5 relative to peripheral blood (p samples. Using three different mucosal sampling methods collected longitudinally we demonstrate that CD4 T cells within the FGT express CCR5 and α4β7 and are highly activated, attributes which could act in concert to facilitate HIV acquisition. FS and CB sampling methods can allow for investigation of strategies to reduce HIV target cells in the FGT and could inform the design and interpretation microbicide and vaccine studies in women.

  20. Human papilloma virus 18 detection in oral squamous cell carcinoma and potentially malignant lesions using saliva samples.

    Science.gov (United States)

    Goot-Heah, Khor; Kwai-Lin, Thong; Froemming, Gabriele Ruth Anisah; Abraham, Mannil Thomas; Nik Mohd Rosdy, Nik Mohd Mazuan; Zain, Rosnah Binti

    2012-01-01

    Oral cancer has become one of the most prevalent cancers worldwide and human Papillomavirus is one of the risk factors for developing oral cancer. For this study HPV18 was chosen as it is one of the high risk HPV types and may lead to carcinogenesis. However, prevalence of HPV18 infection in Oral Squamous Cell Carcinoma in Malaysia remains unclear. This study aimed to investigate the viral load of HPV18 DNA in OSCC and potentially malignant lesions using saliva samples. Genomic DNAs of thirty saliva samples of normal subjects and thirty saliva samples compromised of 16 samples from potentially malignant lesions and 14 of OSCC patients were amplified for HPV18 DNA using a nested polymerase chain reaction analysis. All PCR products were then analyzed using the Bioanalyzer to confirm presence of HPV18 DNA. From thirty patients examined, only one of 30 (3.3%) cases was found to be positive for HPV18 in this study. The finding of this study revealed that there is a low viral detection of HPV18 in Malaysian OSCC by using saliva samples, suggesting that prevalence of HPV18 may not be important in this group of Malaysian OSCC.

  1. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  2. Neutron sample cell suitable for the diffraction of aligned biomaterials and capable of exerting up to 370 MPa of hydrostatic pressure

    International Nuclear Information System (INIS)

    Watson, M.J.; Nieh, M.-P.; Harroun, T.A.; Katsaras, J.

    2003-01-01

    We describe a temperature controlled sample cell suitable for the study of biomimetic materials (e.g., lipid bilayers) using neutron diffraction, and capable of exerting hydrostatic pressures of up to 370 MPa. The advantage of this sample cell, compared to previous high-pressure cells of its type, is that it allows for the use of samples aligned on a solid support which, compared to 'powder' or so-called liposomal preparations, requires only small amounts of sample and allows for the clear differentiation between in-plane and out-of-plane structure

  3. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    International Nuclear Information System (INIS)

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  5. Recent results of the investigation of a micro-fluidic sampling chip and sampling system for hot cell aqueous processing streams

    International Nuclear Information System (INIS)

    Tripp, J.; Smith, T.; Law, J.

    2013-01-01

    A Fuel Cycle Research and Development project has investigated an innovative sampling method that could evolve into the next generation sampling and analysis system for metallic elements present in aqueous processing streams. Initially sampling technologies were evaluated and micro-fluidic sampling chip technology was selected and tested. A conceptual design for a fully automated microcapillary-based system was completed and a robotic automated sampling system was fabricated. The mechanical and sampling operation of the completed sampling system was investigated. Different sampling volumes have been tested. It appears that the 10 μl volume has produced data that had much smaller relative standard deviations than the 2 μl volume. In addition, the production of a less expensive, mass produced sampling chip was investigated to avoid chip reuse thus increasing sampling reproducibility/accuracy. The micro-fluidic-based robotic sampling system's mechanical elements were tested to ensure analytical reproducibility and the optimum robotic handling of micro-fluidic sampling chips. (authors)

  6. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  7. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  8. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  9. Glycosyltransferases as marker genes for the quantitative polymerase chain reaction-based detection of circulating tumour cells from blood samples of patients with breast cancer undergoing adjuvant therapy.

    Science.gov (United States)

    Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich

    2015-08-01

    Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.

  10. Determination of ethanol in acetic acid-containing samples by a biosensor based on immobilized Gluconobacter cells

    Directory of Open Access Journals (Sweden)

    VALENTINA A. KRATASYUK

    2012-11-01

    Full Text Available Reshetilov AN, Kitova AE, Arkhipova AV, Kratasyuk VA, Rai MK. 2012. Determination of ethanol in acetic acid containing samples by a biosensor based on immobilized Gluconobacter cells. Nusantara Bioscience 4: 97-100. A biosensor based on Gluconobacter oxydans VKM B-1280 bacteria was used for detection of ethanol in the presence of acetic acid. It was assumed that this assay could be useful for controlling acetic acid production from ethanol and determining the final stage of the fermentation process. Measurements were made using a Clark electrode-based amperometric biosensor. The effect of pH of the medium on the sensor signal and the analytical parameters of the sensor (detection range, sensitivity were investigated. The residual content of ethanol in acetic acid samples was analyzed. The results of the study are important for monitoring the acetic acid production process, as they represent a method of tracking its stages

  11. Fluoride sample matrices and reaction cells — new capabilities for isotope measurements in accelerator mass spectrometry

    Directory of Open Access Journals (Sweden)

    Eliades J.

    2012-04-01

    Full Text Available Two new techniques, which extend the range of elements that can be analyzed by Accelerator Mass Spectrometry (AMS, and which increase its isobar selection capabilities, have been recently introduced. The first consists of embedding the sample material in a fluoride matrix (e.g. PbF2, which facilitates the production, in the ion source, of fluoride molecular anions that include the isotope of interest. In addition to forming anions with large electron binding energies and thereby increasing the range of analysable elements, in many cases by selection of a molecular form with a particular number of fluorine atoms, some isobar discrimination can be obtained. The second technique, for the significant reduction of atomic isobar interferences, is used following mass selection of the rare isotope. It consists of the deceleration, cooling and reaction of the rare mass beam with a gas, selected so that unwanted isobars are greatly attenuated in comparison with the isotope of interest. Proof of principle measurements for the analysis of 36C1 and 41Ca have provided encouraging results and work is proceeding on the integration of these techniques in a new AMS system planned for installation in late 2012 at the University of Ottawa.

  12. Fetal cell detection in maternal blood : A study in 236 samples using erythroblast morphology, DAB and HbF staining, and FISH analysis

    NARCIS (Netherlands)

    Oosterwijk, JC; Mesker, WE; Ouwerkerk-van Velzen, MCM; Knepfle, CFHM; Wiesmeijer, KC; Beverstock, GC; van Ommen, GJB; Kanhai, HHH; Tanke, HJ

    1998-01-01

    A protocol to detect fetal nucleated red blood cells (NRBCs) was tested in 217 pregnant women and in 19 nonpregnant controls. All the pregnant women were sampled after chorionic villus sampling (CVS); 20 were also sampled pre-CVS. NRBC recognition was based upon morphology by using staining of

  13. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    International Nuclear Information System (INIS)

    Cerrada, Lucia; San Martin, Jesus

    2011-01-01

    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  14. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  15. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  16. Toxicity and Kinetics of (3H)Microcystin-LR in Isolated Perfused Rat Livers

    Science.gov (United States)

    1990-03-20

    with a Waters 490 multiwavelength detector, as described by Robinson et al. (1989). A C-18 column (Adsorbosphere HS, 4.6 x 250 mm, 5 Am, Alltech ...1988). The isolated perfused liver has several advantages over other model systems for the study of hepatotoxins. Unlike the in-vitro cell systems

  17. Sample Preparation Methodologies for In Situ Liquid and Gaseous Cell Analytical Transmission Electron Microscopy of Electropolished Specimens.

    Science.gov (United States)

    Zhong, Xiang Li; Schilling, Sibylle; Zaluzec, Nestor J; Burke, M Grace

    2016-12-01

    In recent years, an increasing number of studies utilizing in situ liquid and/or gaseous cell scanning/transmission electron microscopy (S/TEM) have been reported. Because of the difficulty in the preparation of suitable specimens, these environmental S/TEM studies have been generally limited to studies of nanoscale structured materials such as nanoparticles, nanowires, or sputtered thin films. In this paper, we present two methodologies which have been developed to facilitate the preparation of electron-transparent samples from conventional bulk metals and alloys for in situ liquid/gaseous cell S/TEM experiments. These methods take advantage of combining sequential electrochemical jet polishing followed by focused ion beam extraction techniques to create large electron-transparent areas for site-specific observation. As an example, we illustrate the application of this methodology for the preparation of in situ specimens from a cold-rolled Type 304 austenitic stainless steel sample, which was subsequently examined in both 1 atm of air as well as fully immersed in a H2O environment in the S/TEM followed by hyperspectral imaging. These preparation techniques can be successfully applied as a general procedure for a wide range of metals and alloys, and are suitable for a variety of in situ analytical S/TEM studies in both aqueous and gaseous environments.

  18. Investigating the compatibility of PEEK polymer for the fabrication of sample cells for use in muon spin spectroscopy

    International Nuclear Information System (INIS)

    Chandrasena, L; McKenzie, I; Brodovitch, J-C; Mozafari, M; Percival, P W; Cottrell, S P

    2014-01-01

    Polyether ether ketone (PEEK) is a thermoplastic polymer with a wide range of applications due to its chemical inertness and thermal stability, and for these reasons sample cells for gas and liquid phase μSR have been constructed from PEEK. Muon levelcrossing resonance (μLCR) studies of PEEK revealed a broad, strong μLCR signal that, we hypothesize, is due to multiple overlapping resonances from the various muonium (Mu) adducts of PEEK. To investigate this, two monomer units from PEEK (4,4'-dihydroxybenzophenone and para-dimethoxybenzene) were studied in solution using transverse-field muon spin rotation (TF-μSR) and μLCR. Two different muoniated radicals were formed by Mu addition to 4,4 / - dihydroxybenzophenone and one radical was formed in para-dimethoxybenzene. The μSR spectra were assigned by comparing the experimentally measured muon and proton hyperfine coupling constants with values calculated for the possible structures using Gaussian-09 software with the B3LYP functional and 6-31G basis set. Good agreement was found for cyclohexadienyl- type radicals formed by Mu addition to the benzene rings of the monomer units. We can also infer that these radicals are being formed in PEEK, and based on this we conclude that sample cells made of PEEK are unsuitable for many types of μSR experiment

  19. Cell chirality: emergence of asymmetry from cell culture.

    Science.gov (United States)

    Wan, Leo Q; Chin, Amanda S; Worley, Kathryn E; Ray, Poulomi

    2016-12-19

    Increasing evidence suggests that intrinsic cell chirality significantly contributes to the left-right (LR) asymmetry in embryonic development, which is a well-conserved characteristic of living organisms. With animal embryos, several theories have been established, but there are still controversies regarding mechanisms associated with embryonic LR symmetry breaking and the formation of asymmetric internal organs. Recently, in vitro systems have been developed to determine cell chirality and to recapitulate multicellular chiral morphogenesis on a chip. These studies demonstrate that chirality is indeed a universal property of the cell that can be observed with well-controlled experiments such as micropatterning. In this paper, we discuss the possible benefits of these in vitro systems to research in LR asymmetry, categorize available platforms for single-cell chirality and multicellular chiral morphogenesis, and review mathematical models used for in vitro cell chirality and its applications in in vivo embryonic development. These recent developments enable the interrogation of the intracellular machinery in LR axis establishment and accelerate research in birth defects in laterality.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

  20. Comparison of different sample preparation methods for platinum determination in cultured cells by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Man Xiao

    2017-01-01

    Full Text Available Background Platinum-based agents are widely used in chemotherapy against solid tumors and insufficient intracellular drug accumulation is one of the leading causes of platinum resistance which is associated with poor survival of tumor patients. Thus, the detection of intracellular platinum is pivotal for studies aiming to overcome platinum resistance. In the present study, we aimed to establish a reliable graphite furnace atomic absorption spectrometry (GFAAS-based assay to quantify the intracellular platinum content for cultured cells. Methods Several most commonly applied cell preparation methods, including 0.2% HNO3, 0.2% Triton X-100, concentrated nitric acid, RIPA combined with concentrated nitric acid and hydroxide, followed by GFAAS for platinum detection were compared in ovarian, cervical and liver cancer cell lines to obtain the optimal one, and parameters regarding linearity, accuracy, precision and sensitivity were evaluated. Influence of other metals on platinum detection and the storage conditions of samples were also determined. Results The treatment of cells with 0.2% HNO3 was superior to other approaches with fewer platinum loss and better repeatability. The recovery rate and precision of this method were 97.3%–103.0% and 1.4%–3.8%, respectively. The average recoveries in the presence of other metals were 95.1%–103.1%. The detection limit was 13.23 ug/L. The recovery rate of platinum remained acceptable even in cell samples stored in −20 °C or −80 °C for two months. Discussion After comparison, we found that 0.2% HNO3 was optimal for intracellular platinum quantification based on GFAAS, which presented values compatible with that of inductively-coupled plasma mass-spectrometry (ICP-MS, and this is partially attributed to the simplicity of this method. Moreover, the assay was proved to be accurate, sensitive, cost-effective and suitable for the research of platinum-based antitumor therapy.

  1. First report of an Anabaena Bory strain containing microcystin-LR in ...

    African Journals Online (AJOL)

    In South Africa, little is known about the production of microcystin by the genus Anabaena Bory. In April 2012, during a cyanobacterial bloom event in Theewaterskloof Dam, Western Cape province, the plankton was sampled on 10 occasions. The dominant algae belonged to the genus Anabaena, a family of filamentous ...

  2. Isolation and characterization of two kinds of stem cells from the same human skin back sample with therapeutic potential in spinal cord injury.

    Directory of Open Access Journals (Sweden)

    Zhaowen Zong

    Full Text Available BACKGROUNDS AND OBJECTIVE: Spinal cord injury remains to be a challenge to clinicians and it is attractive to employ autologous adult stem cell transplantation in its treatment, however, how to harvest cells with therapeutic potential easily and how to get enough number of cells for transplantation are challenging issues. In the present study, we aimed to isolate skin-derived precursors (SKPs and dermal multipotent stem cells (dMSCs simultaneously from single human skin samples from patients with paraplegia. METHODS: Dissociated cells were initially generated from the dermal layer of skin samples from patients with paraplegia and cultured in SKPs proliferation medium. Four hours later, many cells adhered to the base of the flask. The suspended cells were then transferred to another flask for further culture as SKPs, while the adherent cells were cultured in dMSCs proliferation medium. Twenty-four hours later, the adherent cells were harvested and single-cell colonies were generated using serial dilution method. [(3H]thymidine incorporation assay, microchemotaxis Transwell chambers assay, RT-PCR and fluorescent immunocytochemistry were employed to examine the characterizations of the isolated cells. RESULTS: SKPs and dMSCs were isolated simultaneously from a single skin sample. SKPs and dMSCs differed in several respects, including in terms of intermediate protein expression, proliferation capacities, and differentiation tendencies towards mesodermal and neural progenies. However, both SKPs and dMSCs showed high rates of differentiation into neurons and Schwann cells under appropriate inducing conditions. dMSCs isolated by this method showed no overt differences from dMSCs isolated by routine methods. CONCLUSIONS: Two kinds of stem cells, namely SKPs and dMSCs, can be isolated simultaneously from individual human skin sample from paraplegia patients. Both of them show ability to differentiate into neural cells under proper inducing conditions

  3. Success and failure rates of tumor genotyping techniques in routine pathological samples with non-small-cell lung cancer.

    Science.gov (United States)

    Vanderlaan, Paul A; Yamaguchi, Norihiro; Folch, Erik; Boucher, David H; Kent, Michael S; Gangadharan, Sidharta P; Majid, Adnan; Goldstein, Michael A; Huberman, Mark S; Kocher, Olivier N; Costa, Daniel B

    2014-04-01

    Identification of some somatic molecular alterations in non-small-cell lung cancer (NSCLC) has become evidence-based practice. The success and failure rate of using commercially available tumor genotyping techniques in routine day-to-day NSCLC pathology samples is not well described. We sought to evaluate the success and failure rate of EGFR mutation, KRAS mutation, and ALK FISH in a cohort of lung cancers subjected to routine clinical tumor genotype. Clinicopathologic data, tumor genotype success and failure rates were retrospectively compiled and analyzed from 381 patient-tumor samples. From these 381 patients with lung cancer, the mean age was 65 years, 61.2% were women, 75.9% were white, 27.8% were never smokers, 73.8% had advanced NSCLC and 86.1% had adenocarcinoma histology. The tumor tissue was obtained from surgical specimens in 48.8%, core needle biopsies in 17.9%, and as cell blocks from aspirates or fluid in 33.3% of cases. Anatomic sites for tissue collection included lung (49.3%), lymph nodes (22.3%), pleura (11.8%), bone (6.0%), brain (6.0%), among others. The overall success rate for EGFR mutation analysis was 94.2%, for KRAS mutation 91.6% and for ALK FISH 91.6%. The highest failure rates were observed when the tissue was obtained from image-guided percutaneous transthoracic core-needle biopsies (31.8%, 27.3%, and 35.3% for EGFR, KRAS, and ALK tests, respectively) and bone specimens (23.1%, 15.4%, and 23.1%, respectively). In specimens obtained from bone, the failure rates were significantly higher for biopsies than resection specimens (40% vs. 0%, p=0.024 for EGFR) and for decalcified compared to non-decalcified samples (60% vs. 5.5%, p=0.021 for EGFR). Tumor genotype techniques are feasible in most samples, outside small image-guided percutaneous transthoracic core-needle biopsies and bone samples from core biopsies with decalcification, and therefore expansion of routine tumor genotype into the care of patients with NSCLC may not require special

  4. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  5. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  6. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  7. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    International Nuclear Information System (INIS)

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

    1998-01-01

    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  8. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    NARCIS (Netherlands)

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

    2016-01-01

    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  9. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  10. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  11. Investigation of CPD and HMDS Sample Preparation Techniques for Cervical Cells in Developing Computer-Aided Screening System Based on FE-SEM/EDX

    Science.gov (United States)

    Ng, Siew Cheok; Abu Osman, Noor Azuan

    2014-01-01

    This paper investigated the effects of critical-point drying (CPD) and hexamethyldisilazane (HMDS) sample preparation techniques for cervical cells on field emission scanning electron microscopy and energy dispersive X-ray (FE-SEM/EDX). We investigated the visualization of cervical cell image and elemental distribution on the cervical cell for two techniques of sample preparation. Using FE-SEM/EDX, the cervical cell images are captured and the cell element compositions are extracted for both sample preparation techniques. Cervical cell image quality, elemental composition, and processing time are considered for comparison of performances. Qualitatively, FE-SEM image based on HMDS preparation technique has better image quality than CPD technique in terms of degree of spread cell on the specimen and morphologic signs of cell deteriorations (i.e., existence of plate and pellet drying artifacts and membrane blebs). Quantitatively, with mapping and line scanning EDX analysis, carbon and oxygen element compositions in HMDS technique were higher than the CPD technique in terms of weight percentages. The HMDS technique has shorter processing time than the CPD technique. The results indicate that FE-SEM imaging, elemental composition, and processing time for sample preparation with the HMDS technique were better than CPD technique for cervical cell preparation technique for developing computer-aided screening system. PMID:25610902

  12. A novel method for sample preparation of fresh lung cancer tissue for proteomics analysis by tumor cell enrichment and removal of blood contaminants

    Directory of Open Access Journals (Sweden)

    Orre Lotta

    2010-02-01

    Full Text Available Abstract Background In-depth proteomics analyses of tumors are frequently biased by the presence of blood components and stromal contamination, which leads to large experimental variation and decreases the proteome coverage. We have established a reproducible method to prepare freshly collected lung tumors for proteomics analysis, aiming at tumor cell enrichment and reduction of plasma protein contamination. We obtained enriched tumor-cell suspensions (ETS from six lung cancer cases (two adenocarcinomas, two squamous-cell carcinomas, two large-cell carcinomas and from two normal lung samples. The cell content of resulting ETS was evaluated with immunocytological stainings and compared with the histologic pattern of the original specimens. By means of a quantitative mass spectrometry-based method we evaluated the reproducibility of the sample preparation protocol and we assessed the proteome coverage by comparing lysates from ETS samples with the direct lysate of corresponding fresh-frozen samples. Results Cytological analyses on cytospin specimens showed that the percentage of tumoral cells in the ETS samples ranged from 20% to 70%. In the normal lung samples the percentage of epithelial cells was less then 10%. The reproducibility of the sample preparation protocol was very good, with coefficient of variation at the peptide level and at the protein level of 13% and 7%, respectively. Proteomics analysis led to the identification of a significantly higher number of proteins in the ETS samples than in the FF samples (244 vs 109, respectively. Albumin and hemoglobin were among the top 5 most abundant proteins identified in the FF samples, showing a high contamination with blood and plasma proteins, whereas ubiquitin and the mitochondrial ATP synthase 5A1 where among the top 5 most abundant proteins in the ETS samples. Conclusion The method is feasible and reproducible. We could obtain a fair enrichment of cells but the major benefit of the method

  13. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Science.gov (United States)

    Siuly; Li, Yan; Paul Wen, Peng

    2014-03-01

    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Mutational status of synchronous and metachronous tumor samples in patients with metastatic non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Quéré, Gilles; Descourt, Renaud; Robinet, Gilles; Autret, Sandrine; Raguenes, Odile; Fercot, Brigitte; Alemany, Pierre; Uguen, Arnaud; Férec, Claude; Quintin-Roué, Isabelle; Le Gac, Gérald

    2016-01-01

    Despite reported discordance between the mutational status of primary lung cancers and their metastases, metastatic sites are rarely biopsied and targeted therapy is guided by genetic biomarkers detected in the primary tumor. This situation is mostly explained by the apparent stability of EGFR-activating mutations. Given the dramatic increase in the range of candidate drugs and high rates of drug resistance, rebiopsy or liquid biopsy may become widespread. The purpose of this study was to test genetic biomarkers used in clinical practice (EGFR, ALK) and candidate biomarkers identified by the French National Cancer Institute (KRAS, BRAF, PIK3CA, HER2) in patients with metastatic non-small-cell lung cancer for whom two tumor samples were available. A retrospective study identified 88 tumor samples collected synchronously or metachronously, from the same or two different sites, in 44 patients. Mutation analysis used SNaPshot (EGFR, KRAS, BRAF missense mutations), pyrosequencing (EGFR and PIK3CA missense mutations), sizing assays (EGFR and HER2 indels) and IHC and/or FISH (ALK rearrangements). About half the patients (52 %) harbored at least one mutation. Five patients had an activating mutation of EGFR in both the primary tumor and the metastasis. The T790M resistance mutation was detected in metastases in 3 patients with acquired resistance to EGFR tyrosine kinase inhibitors. FISH showed discordance in ALK status between a small biopsy sample and the surgical specimen. KRAS mutations were observed in 36 % of samples, six patients (14 %) having discordant genotypes; all discordances concerned sampling from different sites. Two patients (5 %) showed PI3KCA mutations. One metastasis harbored both PI3KCA and KRAS mutations, while the synchronously sampled primary tumor was mutation free. No mutations were detected in BRAF and HER2. This study highlighted noteworthy intra-individual discordance in KRAS mutational status, whereas EGFR status was stable. Intratumoral

  15. Sample size requirements for studies of treatment effects on beta-cell function in newly diagnosed type 1 diabetes.

    Science.gov (United States)

    Lachin, John M; McGee, Paula L; Greenbaum, Carla J; Palmer, Jerry; Pescovitz, Mark D; Gottlieb, Peter; Skyler, Jay

    2011-01-01

    Preservation of β-cell function as measured by stimulated C-peptide has recently been accepted as a therapeutic target for subjects with newly diagnosed type 1 diabetes. In recently completed studies conducted by the Type 1 Diabetes Trial Network (TrialNet), repeated 2-hour Mixed Meal Tolerance Tests (MMTT) were obtained for up to 24 months from 156 subjects with up to 3 months duration of type 1 diabetes at the time of study enrollment. These data provide the information needed to more accurately determine the sample size needed for future studies of the effects of new agents on the 2-hour area under the curve (AUC) of the C-peptide values. The natural log(x), log(x+1) and square-root (√x) transformations of the AUC were assessed. In general, a transformation of the data is needed to better satisfy the normality assumptions for commonly used statistical tests. Statistical analysis of the raw and transformed data are provided to estimate the mean levels over time and the residual variation in untreated subjects that allow sample size calculations for future studies at either 12 or 24 months of follow-up and among children 8-12 years of age, adolescents (13-17 years) and adults (18+ years). The sample size needed to detect a given relative (percentage) difference with treatment versus control is greater at 24 months than at 12 months of follow-up, and differs among age categories. Owing to greater residual variation among those 13-17 years of age, a larger sample size is required for this age group. Methods are also described for assessment of sample size for mixtures of subjects among the age categories. Statistical expressions are presented for the presentation of analyses of log(x+1) and √x transformed values in terms of the original units of measurement (pmol/ml). Analyses using different transformations are described for the TrialNet study of masked anti-CD20 (rituximab) versus masked placebo. These results provide the information needed to accurately

  16. Sample size requirements for studies of treatment effects on beta-cell function in newly diagnosed type 1 diabetes.

    Directory of Open Access Journals (Sweden)

    John M Lachin

    Full Text Available Preservation of β-cell function as measured by stimulated C-peptide has recently been accepted as a therapeutic target for subjects with newly diagnosed type 1 diabetes. In recently completed studies conducted by the Type 1 Diabetes Trial Network (TrialNet, repeated 2-hour Mixed Meal Tolerance Tests (MMTT were obtained for up to 24 months from 156 subjects with up to 3 months duration of type 1 diabetes at the time of study enrollment. These data provide the information needed to more accurately determine the sample size needed for future studies of the effects of new agents on the 2-hour area under the curve (AUC of the C-peptide values. The natural log(x, log(x+1 and square-root (√x transformations of the AUC were assessed. In general, a transformation of the data is needed to better satisfy the normality assumptions for commonly used statistical tests. Statistical analysis of the raw and transformed data are provided to estimate the mean levels over time and the residual variation in untreated subjects that allow sample size calculations for future studies at either 12 or 24 months of follow-up and among children 8-12 years of age, adolescents (13-17 years and adults (18+ years. The sample size needed to detect a given relative (percentage difference with treatment versus control is greater at 24 months than at 12 months of follow-up, and differs among age categories. Owing to greater residual variation among those 13-17 years of age, a larger sample size is required for this age group. Methods are also described for assessment of sample size for mixtures of subjects among the age categories. Statistical expressions are presented for the presentation of analyses of log(x+1 and √x transformed values in terms of the original units of measurement (pmol/ml. Analyses using different transformations are described for the TrialNet study of masked anti-CD20 (rituximab versus masked placebo. These results provide the information needed to

  17. The examination of urine samples for pathogenic microbes by the luciferase assay for ATP. 1: The effect of the presence of fungi, fungal like bacteria and kidney cells in urine samples

    Science.gov (United States)

    Bush, V. N.

    1973-01-01

    A method for accurately determining urinary tract infections in man is introduced. The method is based on adenosine triphosphate (ATP) concentration in urine samples after removing nonbacterial ATP. Adenosine triphosphate concentration is measured from the bioluminescent reaction of luciferase when mixed with ATP. An examination was also made of the effectiveness of rupturing agents on monkey kidney cells Candia albicans, a Rhodotorula species, and a Streptomyces species in determining whether these cells could contribute ATP to the bacterial ATP value of a urine sample.

  18. Mesenchymal Stem Cells Enhance Liver Regeneration via Improving Lipid Accumulation and Hippo Signaling

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2018-01-01

    Full Text Available The liver has the potential to regenerate after injury. It is a challenge to improve liver regeneration (LR after liver resection in clinical practice. Bone morrow-derived mesenchymal stem cells (MSCs have shown to have a role in various liver diseases. To explore the effects of MSCs on LR, we established a model of 70% partial hepatectomy (PHx. Results revealed that infusion of MSCs could improve LR through enhancing cell proliferation and cell growth during the first 2 days after PHx, and MSCs could also restore liver synthesis function. Infusion of MSCs also improved liver lipid accumulation partly via mechanistic target of rapamycin (mTOR signaling and enhanced lipid β-oxidation support energy for LR. Rapamycin-induced inhibition of mTOR decreased liver lipid accumulation at 24 h after PHx, leading to impaired LR. And after infusion of MSCs, a proinflammatory environment formed in the liver, evidenced by increased expression of IL-6 and IL-1β, and thus the STAT3 and Hippo-YAP pathways were activated to improve cell proliferation. Our results demonstrated the function of MSCs on LR after PHx and provided new evidence for stem cell therapy of liver diseases.

  19. Multi-element Analysis of variable sample matrices using collision/reaction cell inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Zahran, N.F.; Helal, A.I.; Amr, M.A.; Amr, M.A.; Al-saad, K.A.

    2008-01-01

    An ICP-MS with an octopole reaction/collision cell is used for the multielement determination of trace elements in water, plants, and soil samples. The use of a reaction or collision gas reduces serious spectral interferences from matrix elements such as Ar Cl or Ar Na. The background equivalent concentration (BEC) is reduced one order of magnitude at helium flow rate of 1 mL/min. Certified reference material namely , NIST Water-1643d, Tomato leaves 1573a, and Montana soil 2711 are used. The trace elements Mn, Fe, Co, Ni, Cu, Zn, As, Mo, Cd and Pb are determined in the different matrices with a accuracy better than 8% to the certified values

  20. Classifying the Progression of Ductal Carcinoma from Single-Cell Sampled Data via Integer Linear Programming: A Case Study.

    Science.gov (United States)

    Catanzaro, Daniele; Shackney, Stanley E; Schaffer, Alejandro A; Schwartz, Russell

    2016-01-01

    Ductal Carcinoma In Situ (DCIS) is a precursor lesion of Invasive Ductal Carcinoma (IDC) of the breast. Investigating its temporal progression could provide fundamental new insights for the development of better diagnostic tools to predict which cases of DCIS will progress to IDC. We investigate the problem of reconstructing a plausible progression from single-cell sampled data of an individual with synchronous DCIS and IDC. Specifically, by using a number of assumptions derived from the observation of cellular atypia occurring in IDC, we design a possible predictive model using integer linear programming (ILP). Computational experiments carried out on a preexisting data set of 13 patients with simultaneous DCIS and IDC show that the corresponding predicted progression models are classifiable into categories having specific evolutionary characteristics. The approach provides new insights into mechanisms of clonal progression in breast cancers and helps illustrate the power of the ILP approach for similar problems in reconstructing tumor evolution scenarios under complex sets of constraints.

  1. Classification of bladder cancer cell lines using Raman spectroscopy: a comparison of excitation wavelength, sample substrate and statistical algorithms

    Science.gov (United States)

    Kerr, Laura T.; Adams, Aine; O'Dea, Shirley; Domijan, Katarina; Cullen, Ivor; Hennelly, Bryan M.

    2014-05-01

    Raman microspectroscopy can be applied to the urinary bladder for highly accurate classification and diagnosis of bladder cancer. This technique can be applied in vitro to bladder epithelial cells obtained from urine cytology or in vivo as an optical biopsy" to provide results in real-time with higher sensitivity and specificity than current clinical methods. However, there exists a high degree of variability across experimental parameters which need to be standardised before this technique can be utilized in an everyday clinical environment. In this study, we investigate different laser wavelengths (473 nm and 532 nm), sample substrates (glass, fused silica and calcium fluoride) and multivariate statistical methods in order to gain insight into how these various experimental parameters impact on the sensitivity and specificity of Raman cytology.

  2. VLE measurements using a static cell vapor phase manual sampling method accompanied with an empirical data consistency test

    International Nuclear Information System (INIS)

    Freitag, Joerg; Kosuge, Hitoshi; Schmelzer, Juergen P.; Kato, Satoru

    2015-01-01

    Highlights: • We use a new, simple static cell vapor phase manual sampling method (SCVMS) for VLE (x, y, T) measurement. • The method is applied to non-azeotropic, asymmetric and two-liquid phase forming azeotropic binaries. • The method is approved by a data consistency test, i.e., a plot of the polarity exclusion factor vs. pressure. • The consistency test reveals that with the new SCVMS method accurate VLE near ambient temperature can be measured. • Moreover, the consistency test approves that the effect of air in the SCVMS system is negligible. - Abstract: A new static cell vapor phase manual sampling (SCVMS) method is used for the simple measurement of constant temperature x, y (vapor + liquid) equilibria (VLE). The method was applied to the VLE measurements of the (methanol + water) binary at T/K = (283.2, 298.2, 308.2 and 322.9), asymmetric (acetone + 1-butanol) binary at T/K = (283.2, 295.2, 308.2 and 324.2) and two-liquid phase forming azeotropic (water + 1-butanol) binary at T/K = (283.2 and 298.2). The accuracy of the experimental data was approved by a data consistency test, that is, an empirical plot of the polarity exclusion factor, β, vs. the system pressure, P. The SCVMS data are accurate, because the VLE data converge to the same lnβ vs. lnP straight line determined from conventional distillation-still method and a headspace gas chromatography method

  3. Quantitation of circulating tumor cells in blood samples from ovarian and prostate cancer patients using tumor-specific fluorescent ligands.

    Science.gov (United States)

    He, Wei; Kularatne, Sumith A; Kalli, Kimberly R; Prendergast, Franklyn G; Amato, Robert J; Klee, George G; Hartmann, Lynn C; Low, Philip S

    2008-10-15

    Quantitation of circulating tumor cells (CTCs) can provide information on the stage of a malignancy, onset of disease progression and response to therapy. In an effort to more accurately quantitate CTCs, we have synthesized fluorescent conjugates of 2 high-affinity tumor-specific ligands (folate-AlexaFluor 488 and DUPA-FITC) that bind tumor cells >20-fold more efficiently than fluorescent antibodies. Here we determine whether these tumor-specific dyes can be exploited for quantitation of CTCs in peripheral blood samples from cancer patients. A CTC-enriched fraction was isolated from the peripheral blood of ovarian and prostate cancer patients by an optimized density gradient centrifugation protocol and labeled with the aforementioned fluorescent ligands. CTCs were then quantitated by flow cytometry. CTCs were detected in 18 of 20 ovarian cancer patients (mean 222 CTCs/ml; median 15 CTCs/ml; maximum 3,118 CTCs/ml), whereas CTC numbers in 16 gender-matched normal volunteers were negligible (mean 0.4 CTCs/ml; median 0.3 CTCs/ml; maximum 1.5 CTCs/ml; p < 0.001, chi(2)). CTCs were also detected in 10 of 13 prostate cancer patients (mean 26 CTCs/ml, median 14 CTCs/ml, maximum 94 CTCs/ml) but not in 18 gender-matched healthy donors (mean 0.8 CTCs/ml, median 1, maximum 3 CTC/ml; p < 0.0026, chi(2)). Tumor-specific fluorescent antibodies were much less efficient in quantitating CTCs because of their lower CTC labeling efficiency. Use of tumor-specific fluorescent ligands to label CTCs in peripheral blood can provide a simple, accurate and sensitive method for determining the number of cancer cells circulating in the bloodstream.

  4. Maternal red blood cell alloantibodies identified in blood samples obtained from Iranian pregnant women: the first population study in Iran.

    Science.gov (United States)

    Shahverdi, Ehsan; Moghaddam, Mostafa; Gorzin, Fateme

    2017-01-01

    The objective was to determine the frequency of occurrence of alloantibodies among pregnant women in Iran. This was a prospective cross-sectional study, which was carried out in the immunohematology reference laboratory of the Iranian Blood Transfusion Organization in Tehran, Iran, in 2008 to 2015. Screening and identification of red blood cell (RBC) alloantibodies was done on the sera of 7340 pregnant females using the standard tube method and gel column agglutination technique. Alloantibodies were identified in the serum of 332 of the 7340 (4.5%) pregnant women. A total of 410 antibodies were detected in 332 positive maternal serum samples with no previous history of blood transfusion. Anti-D was the most common antibody accounting for 70.5% of all the antibodies formed in D- women. The incidence of specific alloimmunization other than Rh group was 14.4%. We concluded that the alloimmunization rate was high in comparison with wide pattern in previous studies. In Iran, like other developing countries, alloimmunization screening tests are performed only to detect anti-D in pregnant D- women. This high rate of alloimmunization, quite possibly, is due to the fact that the majority of blood samples came from pregnant women known to have previous obstetric problems. However, we suggest that RBC antibody screening tests should be extended to all D+ women. © 2016 AABB.

  5. MicroRNA profiling of dogs with transitional cell carcinoma of the bladder using blood and urine samples.

    Science.gov (United States)

    Kent, Michael S; Zwingenberger, Allison; Westropp, Jodi L; Barrett, Laura E; Durbin-Johnson, Blythe P; Ghosh, Paramita; Vinall, Ruth L

    2017-11-15

    Early signs of canine transitional cell carcinoma (TCC) are frequently assumed to be caused by other lower urinary tract diseases (LUTD) such as urinary tract infections, resulting in late diagnosis of TCC which could be fatal. The development of a non-invasive clinical test for TCC could dramatically reduce mortality. To determine whether microRNAs (miRNAs) can be used as non-invasive diagnostic biomarkers, we assessed miRNA expression in blood and/or urine from dogs with clinically normal bladders (n = 28), LUTD (n = 25), and TCC (n = 17). Expression levels of 5 miRNA associated with TCC pathophysiology (miR-34a, let-7c, miR-16, miR-103b, and miR-106b) were assessed by quantitative real-time PCR. Statistical analyses using ranked ANOVA identified significant differences in miR-103b and miR-16 levels between urine samples from LUTD and TCC patients (miR-103b, p = 0.002; and miR-16, p = 0.016). No statistically significant differences in miRNA levels were observed between blood samples from LUTD versus TCC patients. Expression levels of miR-34a trended with miR-16, let-7c, and miR-103b levels in individual normal urine samples, however, this coordination was completely lost in TCC urine samples. In contrast, co-ordination of miR-34a, miR-16, let-7c, and miR-103b expression levels was maintained in blood samples from TCC patients. Our combined data indicate a potential role for miR-103b and miR-16 as diagnostic urine biomarkers for TCC, and that further investigation of miR-103b and miR-16 in the dysregulation of coordinated miRNA expression in bladder carcinogenesis is warranted.

  6. Expression of Biglycan in First Trimester Chorionic Villous Sampling Placental Samples and Altered Function in Telomerase-Immortalized Microvascular Endothelial Cells

    NARCIS (Netherlands)

    Chui, Amy; Gunatillake, Tilini; Brennecke, Shaun P.; Ignjatovic, Vera; Monagle, Paul T.; Whitelock, John M.; van Zanten, Dagmar E.; Eijsink, Jasper; Wang, Yao; Deane, James; Borg, Anthony J.; Stevenson, Janet; Erwich, Jan Jaap; Said, Joanne M.; Murthi, Padma

    Objective-Biglycan (BGN) has reduced expression in placentae from pregnancies complicated by fetal growth restriction (FGR). We used first trimester placental samples from pregnancies with later small for gestational age (SGA) infants as a surrogate for FGR. The functional consequences of reduced

  7. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  8. Critical Role of Endoplasmic Reticulum Stress in Cognitive Impairment Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Fei Cai

    2015-11-01

    Full Text Available Recent studies showed that cyanobacteria-derived microcystin-leucine-arginine (MCLR can cause hippocampal pathological damage and trigger cognitive impairment; but the underlying mechanisms have not been well understood. The objective of the present study was to investigate the mechanism of MCLR-induced cognitive deficit; with a focus on endoplasmic reticulum (ER stress. The Morris water maze test and electrophysiological study demonstrated that MCLR caused spatial memory injury in male Wistar rats; which could be inhibited by ER stress blocker; tauroursodeoxycholic acid (TUDCA. Meanwhile; real-time polymerase chain reaction (real-time PCR and immunohistochemistry demonstrated that the expression level of the 78-kDa glucose-regulated protein (GRP78; C/EBP homologous protein (CHOP and caspase 12 were significantly up-regulated. These effects were rescued by co-administration of TUDCA. In agreement with this; we also observed that treatment of rats with TUDCA blocked the alterations in ER ultrastructure and apoptotic cell death in CA1 neurons from rats exposed to MCLR. Taken together; the present results suggested that ER stress plays an important role in potential memory impairments in rats treated with MCLR; and amelioration of ER stress may serve as a novel strategy to alleviate damaged cognitive function triggered by MCLR.

  9. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Directory of Open Access Journals (Sweden)

    Maya Safira Dewi

    2011-05-01

    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  10. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    International Nuclear Information System (INIS)

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  11. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  12. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    International Nuclear Information System (INIS)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  13. Optical characterization of epidermal cells and their relationship to DNA recovery from touch samples [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Cristina E. Stanciu

    2015-11-01

    Full Text Available The goal of this study was to investigate the relative contributions of different cellular and genetic components to biological samples created by touch or contact with a surface – one of the most challenging forms of forensic evidence. Touch samples were generated by having individuals hold an object for five minutes and analyzed for quantity of intact epidermal cells, extracellular DNA, and DNA from pelleted cell material after elution from the collection swab. Comparisons were made between samples where individuals had washed their hands immediately prior to handling and those where hand washing was not controlled. The vast majority (84-100% of DNA detected in these touch samples was extracellular and was uncorrelated to the number of epidermal cells detected. Although little to no extracellular or cell pellet-associated DNA was detected when individuals washed their hands prior to substrate handling, we found that a significant number of epidermal cells (between ~5x103 and ~1x105 could still be recovered from these samples, suggesting that other types of biological information may be present even when no amplifiable nuclear DNA is present. These results help to elucidate the biological context for touch samples and characterize factors that may contribute to patterns of transfer and persistence of genetic material in forensic evidence.

  14. Presence of Donor-Derived DNA in Semen Samples From Cancer Survivors Who Underwent Donor Stem Cell Transplant

    Science.gov (United States)

    2014-12-08

    Cancer Survivor; Chronic Myeloproliferative Disorders; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Testicular Germ Cell Tumor

  15. Screening of Chlamydomonas reinhardtii Populations with Single-Cell Resolution by Using a High-Throughput Microscale Sample Preparation for Matrix-Assisted Laser Desorption Ionization Mass Spectrometry.

    Science.gov (United States)

    Krismer, Jasmin; Sobek, Jens; Steinhoff, Robert F; Fagerer, Stephan R; Pabst, Martin; Zenobi, Renato

    2015-08-15

    The consequences of cellular heterogeneity, such as biocide persistence, can only be tackled by studying each individual in a cell population. Fluorescent tags provide tools for the high-throughput analysis of genomes, RNA transcripts, or proteins on the single-cell level. However, the analysis of lower-molecular-weight compounds that elude tagging is still a great challenge. Here, we describe a novel high-throughput microscale sample preparation technique for single cells that allows a mass spectrum to be obtained for each individual cell within a microbial population. The approach presented includes spotting Chlamydomonas reinhardtii cells, using a noncontact microarrayer, onto a specialized slide and controlled lysis of cells separated on the slide. Throughout the sample preparation, analytes were traced and individual steps optimized using autofluorescence detection of chlorophyll. The lysates of isolated cells are subjected to a direct, label-free analysis using matrix-assisted laser desorption ionization mass spectrometry. Thus, we were able to differentiate individual cells of two Chlamydomonas reinhardtii strains based on single-cell mass spectra. Furthermore, we showed that only population profiles with real single-cell resolution render a nondistorted picture of the phenotypes contained in a population. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. A population of Langerin-positive dendritic cells in murine Peyer's patches involved in sampling β-glucan microparticles.

    Directory of Open Access Journals (Sweden)

    Magdia De Jesus

    Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within

  17. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    International Nuclear Information System (INIS)

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

    1987-01-01

    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  18. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    International Nuclear Information System (INIS)

    Vallejo Delgado, L.R.

    1989-01-01

    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  19. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  20. Metabolic fingerprinting of fresh lymphoma samples used to discriminate between follicular and diffuse large B-cell lymphomas.

    Science.gov (United States)

    Barba, Ignasi; Sanz, Carolina; Barbera, Angels; Tapia, Gustavo; Mate, José-Luis; Garcia-Dorado, David; Ribera, Josep-Maria; Oriol, Albert

    2009-11-01

    To investigate if proton nuclear magnetic resonance ((1)H NMR) spectroscopy-based metabolic profiling was able to differentiate follicular lymphoma (FL) from diffuse large B-cell lymphoma (DLBCL) and to study which metabolites were responsible for the differences. High-resolution (1)H NMR spectra was obtained from fresh samples of lymph node biopsies obtained consecutively at one center (14 FL and 17 DLBCL). Spectra were processed using pattern-recognition methods. Discriminant models were able to differentiate between the two tumor types with a 86% sensitivity and a 76% specificity; the metabolites that most contributed to the discrimination were a relative increase of alanine in the case of DLBCL and a relative increase of taurine in FL. Metabolic models had a significant but weak correlation with Ki67 expression (r(2)=0.42; p=0.002) We have proved that it is possible to differentiate between FL and DLBCL based on their NMR metabolic profiles. This approach may potentially be applicable as a noninvasive tool for diagnostic and treatment follow-up in the clinical setting using conventional magnetic resonance systems.

  1. Combining censored and uncensored data in a U-statistic: design and sample size implications for cell therapy research.

    Science.gov (United States)

    Moyé, Lemuel A; Lai, Dejian; Jing, Kaiyan; Baraniuk, Mary Sarah; Kwak, Minjung; Penn, Marc S; Wu, Colon O

    2011-01-01

    The assumptions that anchor large clinical trials are rooted in smaller, Phase II studies. In addition to specifying the target population, intervention delivery, and patient follow-up duration, physician-scientists who design these Phase II studies must select the appropriate response variables (endpoints). However, endpoint measures can be problematic. If the endpoint assesses the change in a continuous measure over time, then the occurrence of an intervening significant clinical event (SCE), such as death, can preclude the follow-up measurement. Finally, the ideal continuous endpoint measurement may be contraindicated in a fraction of the study patients, a change that requires a less precise substitution in this subset of participants.A score function that is based on the U-statistic can address these issues of 1) intercurrent SCE's and 2) response variable ascertainments that use different measurements of different precision. The scoring statistic is easy to apply, clinically relevant, and provides flexibility for the investigators' prospective design decisions. Sample size and power formulations for this statistic are provided as functions of clinical event rates and effect size estimates that are easy for investigators to identify and discuss. Examples are provided from current cardiovascular cell therapy research.

  2. Chiral Orientation of Skeletal Muscle Cells Requires Rigid Substrate

    Directory of Open Access Journals (Sweden)

    Ninghao Zhu

    2017-06-01

    Full Text Available Reconstitution of tissue morphology with inherent left–right (LR asymmetry is essential for tissue/organ functions. For skeletal muscle, the largest tissue in mammalian organisms, successful myogenesis requires the regulation of the LR asymmetry to form the appropriate muscle alignment. However, the key factor for reproducing the LR asymmetry of skeletal tissues in a controllable, engineering context remains largely unknown. Recent reports indicate that cell chirality may underlie the LR development in tissue morphogenesis. Here, we report that a rigid substrate is required for the chirality of skeletal muscle cells. By using alternating micropatterned cell-adherent and cell-repellent stripes on a rigid substrate, we found that C2C12 skeletal muscle myoblasts exhibited a unidirectional tilted orientation with respect to the stripe boundary. Importantly, such chiral orientation was reduced when soft substrates were used instead. In addition, we demonstrated the key role of actin stress fibers in the formation of the chiral orientation. This study reveals that a rigid substrate is required for the chiral pattern of myoblasts, paving the way for reconstructing damaged muscle tissue with inherent LR asymmetry in the future.

  3. Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

    Science.gov (United States)

    Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

    2011-05-15

    Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Type-specific detection of high-risk human papillomavirus (HPV) in self-sampled cervicovaginal cells applied to FTA elute cartridge.

    Science.gov (United States)

    Gustavsson, Inger; Sanner, Karin; Lindell, Monica; Strand, Anders; Olovsson, Matts; Wikström, Ingrid; Wilander, Erik; Gyllensten, Ulf

    2011-08-01

    Most procedures for self-sampling of cervical cells are based on liquid-based media for transportation and storage. An alternative is to use a solid support, such as dry filter paper media. To evaluate if self-sampling of cervicovaginal fluid using a cytobrush (Viba-brush; Rovers Medical Devices B.V., Oss, The Netherlands) and a solid support such as the Whatman Indicating FTA Elute cartridge (GE Healthcare, United Kingdom) can be used for reliable typing of human papillomavirus (HPV), as compared to cervical samples obtained by a physician using a cytobrush and the indicating FTA Elute Micro card and biopsy analysis. A total of 50 women with a previous high-risk (HR) HPV positive test were invited to perform self-sampling using the Viba-brush and the FTA cartridge and thereafter a physician obtained a cervical sample using the cytobrush and a FTA card, together with a cervical biopsy for histology and HPV typing. Detection of HR-HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and 59 was performed using three multiplex real-time polymerase chain reaction (PCR) assays. All samples contained sufficient amounts of genomic DNA and the self-samples yielded on average 3.5 times more DNA than those obtained by the physician. All women that were positive for HR-HPV in the biopsy sample also typed positive both by self-sampling and physician-obtained sampling. For women with a histological diagnosis of cervical intraepithelial neoplasia grades 2-3 (CIN 2-3) all three HPV samples showed 100% concordance. A higher number of women were HPV positive by self-sampling than by physician-obtained sampling or by biopsy analysis. The Viba-brush and the FTA cartridge are suitable for self-sampling of vaginal cells and subsequent HR-HPV typing. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  6. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  7. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    OpenAIRE

    Jacobs, Loraine Cristina do Valle

    2011-01-01

    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  8. Isolation of endothelial colony-forming cells from blood samples collected from the jugular and cephalic veins of healthy adult horses.

    Science.gov (United States)

    Sharpe, Ashley N; Seeto, Wen J; Winter, Randolph L; Zhong, Qiao; Lipke, Elizabeth A; Wooldridge, Anne A

    2016-10-01

    OBJECTIVE To evaluate optimal isolation of endothelial colony-forming cells (ECFCs) from peripheral blood of horses. SAMPLE Jugular and cephalic venous blood samples from 17 adult horses. PROCEDURES Each blood sample was divided; isolation was performed with whole blood adherence (WBA) and density gradient centrifugation (DGC). Isolated cells were characterized by uptake of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate-labeled acetylated low-density lipoprotein (DiI-Ac-LDL), vascular tubule formation, and expression of endothelial (CD34, CD105, vascular endothelial growth factor receptor-2, and von Willebrand factor) and hematopoietic (CD14) cell markers by use of indirect immunofluorescence assay (IFA) and flow cytometry. RESULTS Colonies with cobblestone morphology were isolated from 15 of 17 horses. Blood collected from the cephalic vein yielded colonies significantly more often (14/17 horses) than did blood collected from the jugular vein (8/17 horses). Of 14 cephalic blood samples with colonies, 13 were obtained with DGC and 8 with WBA. Of 8 jugular blood samples with colonies, 8 were obtained with DGC and 4 with WBA. Colony frequency (colonies per milliliter of blood) was significantly higher for cephalic blood samples and samples isolated with DGC. Cells formed vascular tubules, had uptake of DiI-Ac-LDL, and expressed endothelial markers by use of IFA and flow cytometry, which confirmed their identity as ECFCs. CONCLUSIONS AND CLINICAL RELEVANCE Maximum yield of ECFCs was obtained for blood samples collected from both the jugular and cephalic veins and use of DGC to isolate cells. Consistent yield of ECFCs from peripheral blood of horses will enable studies to evaluate diagnostic and therapeutic uses.

  9. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  10. Generation of induced pluripotent stem cell line (ZZUi011-A from urine sample of a normal human

    Directory of Open Access Journals (Sweden)

    Huifang Sun

    2018-05-01

    Full Text Available Urine cells collected from 200 mL clean midsection urine of a 25-year-old healthy man were reprogrammed into pluripotent stem cells via Sendai virus delivery system. The induced pluripotent stem cells showed a normal karyotype and exhibited the potential to differentiate into three germ layers in a teratoma assay. This cell line may serve as a useful control for comparison with other pluripotent stem cell lines induced from somatic cells of patients with genetic neurodegenerative disorders.

  11. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  12. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. In Vitro Evaluation of Swine-Derived Lactobacillus reuteri: Probiotic Properties and Effects on Intestinal Porcine Epithelial Cells Challenged with Enterotoxigenic Escherichia coli K88.

    Science.gov (United States)

    Wang, Zhilin; Wang, Li; Chen, Zhuang; Ma, Xianyong; Yang, Xuefen; Zhang, Jian; Jiang, Zongyong

    2016-06-28

    Probiotics are considered as the best effective alternatives to antibiotics. The aim of this study was to characterize the probiotic potential of lactobacilli for use in swine farming by using in vitro evaluation methods. A total of 106 lactic acid bacterial isolates, originating from porcine feces, were first screened for the capacity to survive stresses considered important for putative probiotic strains. Sixteen isolates showed notable acid and bile resistance, antibacterial activity, and adherence to intestinal porcine epithelial cells (IPEC-1). One isolate, LR1, identified as Lactobacillus reuteri, was selected for extensive study of its probiotic and functional properties in IPEC-1 cell models. L. reuteri LR1 exhibited good adhesion to IPEC-1 cells and could inhibit the adhesion of enterotoxigenic Escherichia coli (ETEC) to IPEC-1 cells. L. reuteri LR1 could also modulate transcript and protein expression of cytokines involved in inflammation in IPEC-1 cells; the Lactobacillus strain inhibited the ETEC-induced expression of proinflammatory transcripts (IL-6 and TNF-α) and protein (IL-6), and increased the level of anti-inflammatory cytokine (IL-10). Measurement of the permeation of FD-4 showed that L. reuteri LR1 could maintain barrier integrity in monolayer IPEC-1 cells exposed to ETEC. Immunolocalization experiments showed L. reuteri LR1 could also prevent ETEC-induced tight junction ZO-1 disruption. Together, these results indicate that L. reuteri LR1 exhibits desirable probiotic properties and could be a potential probiotic for use in swine production.

  14. EZH2 and CD79B mutational status over time in B-cell non-Hodgkin lymphomas detected by high-throughput sequencing using minimal samples

    Science.gov (United States)

    Saieg, Mauro Ajaj; Geddie, William R; Boerner, Scott L; Bailey, Denis; Crump, Michael; da Cunha Santos, Gilda

    2013-01-01

    BACKGROUND: Numerous genomic abnormalities in B-cell non-Hodgkin lymphomas (NHLs) have been revealed by novel high-throughput technologies, including recurrent mutations in EZH2 (enhancer of zeste homolog 2) and CD79B (B cell antigen receptor complex-associated protein beta chain) genes. This study sought to determine the evolution of the mutational status of EZH2 and CD79B over time in different samples from the same patient in a cohort of B-cell NHLs, through use of a customized multiplex mutation assay. METHODS: DNA that was extracted from cytological material stored on FTA cards as well as from additional specimens, including archived frozen and formalin-fixed histological specimens, archived stained smears, and cytospin preparations, were submitted to a multiplex mutation assay specifically designed for the detection of point mutations involving EZH2 and CD79B, using MassARRAY spectrometry followed by Sanger sequencing. RESULTS: All 121 samples from 80 B-cell NHL cases were successfully analyzed. Mutations in EZH2 (Y646) and CD79B (Y196) were detected in 13.2% and 8% of the samples, respectively, almost exclusively in follicular lymphomas and diffuse large B-cell lymphomas. In one-third of the positive cases, a wild type was detected in a different sample from the same patient during follow-up. CONCLUSIONS: Testing multiple minimal tissue samples using a high-throughput multiplex platform exponentially increases tissue availability for molecular analysis and might facilitate future studies of tumor progression and the related molecular events. Mutational status of EZH2 and CD79B may vary in B-cell NHL samples over time and support the concept that individualized therapy should be based on molecular findings at the time of treatment, rather than on results obtained from previous specimens. Cancer (Cancer Cytopathol) 2013;121:377–386. © 2013 American Cancer Society. PMID:23361872

  15. Approaches for cytogenetic and molecular analyses of small flow-sorted cell populations from childhood leukemia bone marrow samples

    DEFF Research Database (Denmark)

    Obro, Nina Friesgaard; Madsen, Hans O.; Ryder, Lars Peter

    2011-01-01

    defined cell populations with subsequent analyses of leukemia-associated cytogenetic and molecular marker. The approaches described here optimize the use of the same tube of unfixed, antibody-stained BM cells for flow-sorting of small cell populations and subsequent exploratory FISH and PCR-based analyses....

  16. Development and Application of a Sample Holder for In Situ Gaseous TEM Studies of Membrane Electrode Assemblies for Polymer Electrolyte Fuel Cells.

    Science.gov (United States)

    Kamino, Takeo; Yaguchi, Toshie; Shimizu, Takahiro

    2017-10-01

    Polymer electrolyte fuel cells hold great potential for stationary and mobile applications due to high power density and low operating temperature. However, the structural changes during electrochemical reactions are not well understood. In this article, we detail the development of the sample holder equipped with gas injectors and electric conductors and its application to a membrane electrode assembly of a polymer electrolyte fuel cell. Hydrogen and oxygen gases were simultaneously sprayed on the surfaces of the anode and cathode catalysts of the membrane electrode assembly sample, respectively, and observation of the structural changes in the catalysts were simultaneously carried out along with measurement of the generated voltages.

  17. Preparation and Loading Process of Single Crystalline Samples into a Gas Environmental Cell Holder for In Situ Atomic Resolution Scanning Transmission Electron Microscopic Observation.

    Science.gov (United States)

    Straubinger, Rainer; Beyer, Andreas; Volz, Kerstin

    2016-06-01

    A reproducible way to transfer a single crystalline sample into a gas environmental cell holder for in situ transmission electron microscopic (TEM) analysis is shown in this study. As in situ holders have only single-tilt capability, it is necessary to prepare the sample precisely along a specific zone axis. This can be achieved by a very accurate focused ion beam lift-out preparation. We show a step-by-step procedure to prepare the sample and transfer it into the gas environmental cell. The sample material is a GaP/Ga(NAsP)/GaP multi-quantum well structure on Si. Scanning TEM observations prove that it is possible to achieve atomic resolution at very high temperatures in a nitrogen environment of 100,000 Pa.

  18. Mapping cell populations in flow cytometry data for cross‐sample comparison using the Friedman–Rafsky test statistic as a distance measure

    Science.gov (United States)

    Hsiao, Chiaowen; Liu, Mengya; Stanton, Rick; McGee, Monnie; Qian, Yu

    2015-01-01

    Abstract Flow cytometry (FCM) is a fluorescence‐based single‐cell experimental technology that is routinely applied in biomedical research for identifying cellular biomarkers of normal physiological responses and abnormal disease states. While many computational methods have been developed that focus on identifying cell populations in individual FCM samples, very few have addressed how the identified cell populations can be matched across samples for comparative analysis. This article presents FlowMap‐FR, a novel method for cell population mapping across FCM samples. FlowMap‐FR is based on the Friedman–Rafsky nonparametric test statistic (FR statistic), which quantifies the equivalence of multivariate distributions. As applied to FCM data by FlowMap‐FR, the FR statistic objectively quantifies the similarity between cell populations based on the shapes, sizes, and positions of fluorescence data distributions in the multidimensional feature space. To test and evaluate the performance of FlowMap‐FR, we simulated the kinds of biological and technical sample variations that are commonly observed in FCM data. The results show that FlowMap‐FR is able to effectively identify equivalent cell populations between samples under scenarios of proportion differences and modest position shifts. As a statistical test, FlowMap‐FR can be used to determine whether the expression of a cellular marker is statistically different between two cell populations, suggesting candidates for new cellular phenotypes by providing an objective statistical measure. In addition, FlowMap‐FR can indicate situations in which inappropriate splitting or merging of cell populations has occurred during gating procedures. We compared the FR statistic with the symmetric version of Kullback–Leibler divergence measure used in a previous population matching method with both simulated and real data. The FR statistic outperforms the symmetric version of KL‐distance in distinguishing

  19. Mapping cell populations in flow cytometry data for cross-sample comparison using the Friedman-Rafsky test statistic as a distance measure.

    Science.gov (United States)

    Hsiao, Chiaowen; Liu, Mengya; Stanton, Rick; McGee, Monnie; Qian, Yu; Scheuermann, Richard H

    2016-01-01

    Flow cytometry (FCM) is a fluorescence-based single-cell experimental technology that is routinely applied in biomedical research for identifying cellular biomarkers of normal physiological responses and abnormal disease states. While many computational methods have been developed that focus on identifying cell populations in individual FCM samples, very few have addressed how the identified cell populations can be matched across samples for comparative analysis. This article presents FlowMap-FR, a novel method for cell population mapping across FCM samples. FlowMap-FR is based on the Friedman-Rafsky nonparametric test statistic (FR statistic), which quantifies the equivalence of multivariate distributions. As applied to FCM data by FlowMap-FR, the FR statistic objectively quantifies the similarity between cell populations based on the shapes, sizes, and positions of fluorescence data distributions in the multidimensional feature space. To test and evaluate the performance of FlowMap-FR, we simulated the kinds of biological and technical sample variations that are commonly observed in FCM data. The results show that FlowMap-FR is able to effectively identify equivalent cell populations between samples under scenarios of proportion differences and modest position shifts. As a statistical test, FlowMap-FR can be used to determine whether the expression of a cellular marker is statistically different between two cell populations, suggesting candidates for new cellular phenotypes by providing an objective statistical measure. In addition, FlowMap-FR can indicate situations in which inappropriate splitting or merging of cell populations has occurred during gating procedures. We compared the FR statistic with the symmetric version of Kullback-Leibler divergence measure used in a previous population matching method with both simulated and real data. The FR statistic outperforms the symmetric version of KL-distance in distinguishing equivalent from nonequivalent cell

  20. High-resolution Melting Analysis for Gene Scanning of Adenomatous Polyposis Coli (APC) Gene With Oral Squamous Cell Carcinoma Samples.

    Science.gov (United States)

    Chang, Ya-Sian; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng Mao; Chang, Jan-Gowth

    2016-02-01

    There have been many different mutations reported for the large adenomatous polyposis coli (APC) tumor suppressor gene. APC mutations result in inactivation of APC tumor suppressor action, allowing the progression of tumorigenesis. The present study utilized a highly efficient method to identify APC mutations and investigated the association between the APC genetic variants Y486Y, A545A, T1493T, and D1822V and susceptibility to oral squamous cell carcinoma (OSCC). High-resolution melting (HRM) analysis was used to characterize APC mutations. Genomic DNA was extracted from 83 patient specimens of OSCC and 50 blood samples from healthy control subjects. The 14 exons and mutation cluster region of exon 15 were screened by HRM analysis. All mutations were confirmed by direct DNA sequencing. Three mutations and 4 single nucleotide polymorphisms (SNPs) were found in this study. The mutations were c.573T>C (Y191Y) in exon 5, c.1005A>G (L335L) in exon 9, and c.1488A>T (T496T) in exon 11. Two SNPs, c.4479G>A (T1493T) and c.5465A>T (D1822V), were located in exon 15, whereas c.1458T>C (Y486Y) and c.1635G>A (A545A) were located in exon 11 and 13, respectively. There was no observed association between OSCC risk and genotype for any of the 4 APC SNPs. The mutation of APC is rare in Taiwanese patients with OSCC. HRM analysis is a reliable, accurate, and fast screening method for APC mutations.

  1. Age-related changes of healthy bone marrow cell signaling in response to growth factors provide insight into low risk MDS.

    Science.gov (United States)

    Kornblau, Steven M; Cohen, Aileen C; Soper, David; Huang, Ying-Wen; Cesano, Alessandra

    2014-11-01

    Single Cell Network Profiling (SCNP) is a multiparametric flow cytometry-based assay that quantifiably and simultaneously measures changes in intracellular signaling proteins in response to in vitro extracellular modulators at the single cell level. Myelodysplastic syndrome (MDS) is a heterogeneous clonal disorder of hematopoietic stem cells that occurs in elderly subjects and is characterized by dysplasia and ineffective hematopoiesis. The functional responsiveness of MDS bone marrow (BM) hematopoietic cells, including functionally distinct myeloid and erythroid precursor subsets, to hematopoietic growth factors (HGF) and the relationship of modulated signaling to disease characteristics is poorly understood. SCNP was used first to examine the effects of age on erythropoietin (EPO) and granulocyte colony stimulating factor (GCSF)-induced signaling in myeloid, nucleated red blood cells (nRBC), and CD34 expressing cell subsets in healthy BM (n = 15). SCNP was then used to map functional signaling profiles in low risk (LR) MDS (n = 7) for comparison to signaling in samples from healthy donors and to probe signaling associations within clinically defined subgroups. In healthy BM samples, signaling responses to HGF were quite homogeneous (i.e., tightly regulated) with age-dependent effects observed in response to EPO but not to GCSF. Despite the relatively small number of samples assayed in the study, LR MDS could be classified into distinct subgroups based on both cell subset frequency and signaling profiles. As a correlate of underlying genetic abnormalities, signal transduction analyses may provide a functional and potentially clinically relevant classification of MDS. Further evaluation in a larger cohort is warranted. © 2013 Clinical Cytometry Society.

  2. Towards a non-invasive method for early detection of testicular neoplasia in semen samples by identification of fetal germ cell-specific markers

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Carlsen, E; Jorgensen, N

    2007-01-01

    /gonocyte markers is presented. METHODS: Immunocytological staining for AP-2gamma [and in some cases, OCT-3/4, NANOG or placental alkaline phosphatase (PLAP)] was performed in semen samples from 294 infertile patients and 209 patients with TGCTs or other diseases. RESULTS: Presence of AP-2gamma-stained cells...... but reduced in participants with overt TGCTs, perhaps because of obstruction. Assay specificity was 93.6%, positive predictive value (PPV) 83.3% and negative predictive value (NPV) 60.3%. CONCLUSIONS: Immunocytological semen analysis based on expression of fetal germ cell markers in exfoliated cells has...

  3. Lactobacillus reuteri DSM 17938 changes the frequency of Foxp3+ regulatory T cells in the intestine and mesenteric lymph node in experimental necrotizing enterocolitis.

    Directory of Open Access Journals (Sweden)

    Yuying Liu

    Full Text Available Necrotizing enterocolitis (NEC is an inflammatory disease of the intestine in premature infants. Lactobacillus reuteri DSM 17938 improves survival and reduces the incidence and severity of NEC in a rodent model. Foxp3(+ regulatory T cells (Tregs maintain intestinal homeostasis by controlling inflammation and inducing tolerance. To determine whether there are insufficient numbers of Tregs to control inflammation in NEC and to determine if LR17938 increases the frequency of Tregs, we studied selected groups of newborn Sprague-Dawley rats according to feeding plan: dam±LR17938, formula±LR17938, and NEC±LR17938. NEC was induced by gavage feeding with special formula and exposure to hypoxic conditions. Lymphocytes isolated from ileum, mesenteric lymph nodes (MLN, spleen and thymus were labeled for T cell surface markers (CD3, CD4, CD8 and intracellular Foxp3; and labeled cells were analyzed by flow cytometry. The percentage of CD3(+ T cells and Foxp3(+ Tregs in the ileum significantly decreased in pups with NEC, compared to normal controls. Feeding LR17938 to neonatal rats with NEC increased the % of Foxp3(+ T cells in the ileum while decreasing the percentage of cells in the MLN. Administration of LR17938 to dam-fed rats significantly increased Foxp3(+Tregs in the ileum as early as day of life (DOL1 but did not produce an increase in Tregs in formula-fed rats on DOL1. These results suggest that factors in breast milk may enhance the early immunomodulatory effects of LR17938. An anti-inflammatory effect of LR17938 in NEC was associated with the modulation of immune responses and induction and what appears to be migration of Foxp3(+ Tregs to the diseased gut. Probiotic-facilitated development of Tregs might play an important role in the prevention of NEC.

  4. A novel double staining strategy for improved detection of testicular carcinoma in situ cells in human semen samples

    DEFF Research Database (Denmark)

    Nielsen, J E; Kristensen, D M; Almstrup, K

    2012-01-01

    by immunohistochemistry or in situ hybridisation in urogenital epithelia, which may interfere with detection of CIS cells in semen. In addition to OCT3/4, the expression of AP-2¿ and NANOG or their variants was detected in urogenital epithelia, while other CIS markers, including PLAP/alkaline phosphatase were absent...... of CIS cells in semen. In conclusion, transcription factors related to pluripotency and undifferentiated state of cells, which most likely have several variants or modifications, are unexpectedly detected using currently available antibodies in urogenital epithelial cells which may be shed into semen...

  5. Sample types applied for molecular diagnosis of therapeutic management of advanced non-small cell lung cancer in the precision medicine.

    Science.gov (United States)

    Han, Yanxi; Li, Jinming

    2017-10-26

    In this era of precision medicine, molecular biology is becoming increasingly significant for the diagnosis and therapeutic management of non-small cell lung cancer. The specimen as the primary element of the whole testing flow is particularly important for maintaining the accuracy of gene alteration testing. Presently, the main sample types applied in routine diagnosis are tissue and cytology biopsies. Liquid biopsies are considered as the most promising alternatives when tissue and cytology samples are not available. Each sample type possesses its own strengths and weaknesses, pertaining to the disparity of sampling, preparation and preservation procedures, the heterogeneity of inter- or intratumors, the tumor cellularity (percentage and number of tumor cells) of specimens, etc., and none of them can individually be a "one size to fit all". Therefore, in this review, we summarized the strengths and weaknesses of different sample types that are widely used in clinical practice, offered solutions to reduce the negative impact of the samples and proposed an optimized strategy for choice of samples during the entire diagnostic course. We hope to provide valuable information to laboratories for choosing optimal clinical specimens to achieve comprehensive functional genomic landscapes and formulate individually tailored treatment plans for NSCLC patients that are in advanced stages.

  6. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Science.gov (United States)

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  7. The notochord breaks bilateral symmetry by controlling cell shapes in the zebrafish laterality organ.

    Science.gov (United States)

    Compagnon, Julien; Barone, Vanessa; Rajshekar, Srivarsha; Kottmeier, Rita; Pranjic-Ferscha, Kornelija; Behrndt, Martin; Heisenberg, Carl-Philipp

    2014-12-22

    Kupffer's vesicle (KV) is the zebrafish organ of laterality, patterning the embryo along its left-right (LR) axis. Regional differences in cell shape within the lumen-lining KV epithelium are essential for its LR patterning function. However, the processes by which KV cells acquire their characteristic shapes are largely unknown. Here, we show that the notochord induces regional differences in cell shape within KV by triggering extracellular matrix (ECM) accumulation adjacent to anterior-dorsal (AD) regions of KV. This localized ECM deposition restricts apical expansion of lumen-lining epithelial cells in AD regions of KV during lumen growth. Our study provides mechanistic insight into the processes by which KV translates global embryonic patterning into regional cell shape differences required for its LR symmetry-breaking function. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. R5 HIV-1 envelope attracts dendritic cells to cross the human intestinal epithelium and sample luminal virions via engagement of the CCR5.

    Science.gov (United States)

    Cavarelli, Mariangela; Foglieni, Chiara; Rescigno, Maria; Scarlatti, Gabriella

    2013-05-01

    The gastrointestinal tract is a principal route of entry and site of persistence of human immunodeficiency virus type 1 (HIV-1). The intestinal mucosa, being rich of cells that are the main target of the virus, represents a primary site of viral replication and CD4(+) T-cell depletion. Here, we show both in vitro and ex vivo that HIV-1 of R5 but not X4 phenotype is capable of selectively triggering dendritic cells (DCs) to migrate within 30 min between intestinal epithelial cells to sample virions and transfer infection to target cells. The engagement of the chemokine receptor 5 on DCs and the viral envelope, regardless of the genetic subtype, drive DC migration. Viruses penetrating through transient opening of the tight junctions likely create a paracellular gradient to attract DCs. The formation of junctions with epithelial cells may initiate a haptotactic process of DCs and at the same time favour cell-to-cell viral transmission. Our findings indicate that HIV-1 translocation across the intestinal mucosa occurs through the selective engagement of DCs by R5 viruses, and may guide the design of new prevention strategies. Copyright © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

  9. Individual cell lag time distributions of Cronobacter (Enterobacter sakazakii) and impact of pooling samples on its detection in powdered infant formula.

    Science.gov (United States)

    Miled, Rabeb Bennour; Guillier, Laurent; Neves, Sandra; Augustin, Jean-Christophe; Colin, Pierre; Besse, Nathalie Gnanou

    2011-06-01

    Cells of six strains of Cronobacter were subjected to dry stress and stored for 2.5 months at ambient temperature. The individual cell lag time distributions of recovered cells were characterized at 25 °C and 37 °C in non-selective broth. The individual cell lag times were deduced from the times taken by cultures from individual cells to reach an optical density threshold. In parallel, growth curves for each strain at high contamination levels were determined in the same growth conditions. In general, the extreme value type II distribution with a shape parameter fixed to 5 (EVIIb) was the most effective at describing the 12 observed distributions of individual cell lag times. Recently, a model for characterizing individual cell lag time distribution from population growth parameters was developed for other food-borne pathogenic bacteria such as Listeria monocytogenes. We confirmed this model's applicability to Cronobacter by comparing the mean and the standard deviation of individual cell lag times to populational lag times observed with high initial concentration experiments. We also validated the model in realistic conditions by studying growth in powdered infant formula decimally diluted in Buffered Peptone Water, which represents the first enrichment step of the standard detection method for Cronobacter. Individual lag times and the pooling of samples significantly affect detection performances. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Assessment of real-time PCR method for detection of EGFR mutation using both supernatant and cell pellet of malignant pleural effusion samples from non-small-cell lung cancer patients.

    Science.gov (United States)

    Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A

    2017-10-26

    EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.

  11. Comparison of Different Sample Preparation Protocols Reveals Lysis Buffer-Specific Extraction Biases in Gram-Negative Bacteria and Human Cells.

    Science.gov (United States)

    Glatter, Timo; Ahrné, Erik; Schmidt, Alexander

    2015-11-06

    We evaluated different in-solution and FASP-based sample preparation strategies for absolute protein quantification. Label-free quantification (LFQ) was employed to compare different sample preparation strategies in the bacterium Pseudomonas aeruginosa and human embryonic kidney cells (HEK), and organismal-specific differences in general performance and enrichment of specific protein classes were noted. The original FASP protocol globally enriched for most proteins in the bacterial sample, whereas the sodium deoxycholate in-solution strategy was more efficient with HEK cells. Although detergents were found to be highly suited for global proteome analysis, higher intensities were obtained for high-abundant nucleic acid-associated protein complexes, like the ribosome and histone proteins, using guanidine hydrochloride. Importantly, we show for the first time that the observable total proteome mass of a sample strongly depends on the sample preparation protocol, with some protocols resulting in a significant underestimation of protein mass due to incomplete protein extraction of biased protein groups. Furthermore, we demonstrate that some of the observed abundance biases can be overcome by incorporating a nuclease treatment step or, alternatively, a correction factor for complementary sample preparation approaches.

  12. TMI-2 [Three Mile Island Nuclear Power Station] fuel canister and core sample handling equipment used in INEL hot cells

    International Nuclear Information System (INIS)

    McConnell, J.W. Jr.; Shurtliff, W.T.; Lynch, R.J.; Croft, K.M.; Whitmill, L.J.; Allen, S.M.

    1987-01-01

    This paper describes the specialized remote handling equipment developed and used at the Idaho National Engineering Laboratory (INEL) to handle samples obtained from the core of the damaged Unit 2 reactor at Three Mile Island Nuclear Power Station (TM-2). Samples of the core were removed, placed in TMI-2 fuel canisters, and transported to the INEL. Those samples will be examined as part of the analysis of the TMI-2 accident. The equipment described herein was designed for removing sample materials from the fuel canisters, assisting with initial examination, and processing samples in preparation for detailed examinations. The more complex equipment used microprocessor remote controls with electric motor drives providing the required force and motion capabilities. The remaining components were unpowered and manipulator assisted

  13. A modified approach to estimating sample size for simple logistic regression with one continuous covariate.

    Science.gov (United States)

    Novikov, I; Fund, N; Freedman, L S

    2010-01-15

    Different methods for the calculation of sample size for simple logistic regression (LR) with one normally distributed continuous covariate give different results. Sometimes the difference can be large. Furthermore, some methods require the user to specify the prevalence of cases when the covariate equals its population mean, rather than the more natural population prevalence. We focus on two commonly used methods and show through simulations that the power for a given sample size may differ substantially from the nominal value for one method, especially when the covariate effect is large, while the other method performs poorly if the user provides the population prevalence instead of the required parameter. We propose a modification of the method of Hsieh et al. that requires specification of the population prevalence and that employs Schouten's sample size formula for a t-test with unequal variances and group sizes. This approach appears to increase the accuracy of the sample size estimates for LR with one continuous covariate.

  14. Transmission and fluorescence X-ray absorption spectroscopy cell/flow reactor for powder samples under vacuum or in reactive atmospheres

    KAUST Repository

    Hoffman, A. S.; Debefve, L. M.; Bendjeriou-Sedjerari, Anissa; Ould-Chikh, Samy; Bare, Simon R.; Basset, Jean-Marie; Gates, B. C.

    2016-01-01

    X-ray absorption spectroscopy is an element-specific technique for probing the local atomic-scale environment around an absorber atom. It is widely used to investigate the structures of liquids and solids, being especially valuable for characterization of solid-supported catalysts. Reported cell designs are limited in capabilities—to fluorescence or transmission and to static or flowing atmospheres, or to vacuum. Our goal was to design a robust and widely applicable cell for catalyst characterizations under all these conditions—to allow tracking of changes during genesis and during operation, both under vacuum and in reactive atmospheres. Herein, we report the design of such a cell and a demonstration of its operation both with a sample under dynamic vacuum and in the presence of gases flowing at temperatures up to 300 °C, showing data obtained with both fluorescence and transmission detection. The cell allows more flexibility in catalyst characterization than any reported.

  15. Transmission and fluorescence X-ray absorption spectroscopy cell/flow reactor for powder samples under vacuum or in reactive atmospheres

    KAUST Repository

    Hoffman, A. S.

    2016-07-26

    X-ray absorption spectroscopy is an element-specific technique for probing the local atomic-scale environment around an absorber atom. It is widely used to investigate the structures of liquids and solids, being especially valuable for characterization of solid-supported catalysts. Reported cell designs are limited in capabilities—to fluorescence or transmission and to static or flowing atmospheres, or to vacuum. Our goal was to design a robust and widely applicable cell for catalyst characterizations under all these conditions—to allow tracking of changes during genesis and during operation, both under vacuum and in reactive atmospheres. Herein, we report the design of such a cell and a demonstration of its operation both with a sample under dynamic vacuum and in the presence of gases flowing at temperatures up to 300 °C, showing data obtained with both fluorescence and transmission detection. The cell allows more flexibility in catalyst characterization than any reported.

  16. [Study of testicular cancer gene expression in samples of oral leukoplakia and squamous cell carcinoma of the mouth].

    Science.gov (United States)

    Skorodumova, L O; Muraev, A A; Zakharova, E S; Shepelev, M V; Korobko, I V; Zaderenko, I A; Ivanov, S Iu; Gnuchev, N V; Georgiev, G P; Larin, S S

    2012-01-01

    Cancer-testis (CT) antigens are normally expressed mostly in human germ cells, there is also an aberrant expression in some tumor cells. This expression profile makes them potential tumor growth biomarkers and a promising target for tumor immunotherapy. Specificity of CT genes expression in oral malignant and potentially malignant diseases, e.g. oral leukoplakia, is not yet studied. Data on CT genes expression profile in leukoplakia would allow developing new diagnostic methods with potential value for immunotherapy and prophylaxis of leukoplakia malignization. In our study we compared CT genes expression in normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma. We are the first to describe CT genes expression in oral leukoplakia without dysplasia. This findings make impossible differential diagnosis of oral leukoplakia and squamous cell carcinoma on the basis of CT genes expression. The prognostic value of CT genes expression is still unclear, therefore the longitudinal studies are necessary.

  17. Age-specific prevalence of HPV genotypes in cervical cytology samples with equivocal or low-grade lesions

    Science.gov (United States)

    Brismar-Wendel, S; Froberg, M; Hjerpe, A; Andersson, S; Johansson, B

    2009-01-01

    Background: To define the spectrum of human papillomavirus (HPV) types and establish an age limit for triage HPV testing in atypical squamous cells of undetermined significance (ASCUS) and low-grade squamous intraepithelial lesion (LSIL). Materials and methods: 343 liquid-based cytological samples from the population-based screening programme with minor abnormalities were subjected to HPV genotyping (Linear Array, Roche, Basel, Switzerland). Results: High-risk human papillomavirus (HR-HPV) was found in 71% of LSIL and 49% of ASCUS cases (Page-dependent in LSIL (P=0.01), with decreasing prevalence until the age of 50 years, followed by a slight increase. Human papillomavirus type 16 was the most common HR-HPV, found in 23% of HPV-positive women. Human papillomavirus type 18 was the sixth most common, found in 9.9% (Page-dependent quadratic trend was observed for multiple infections (P=0.01) with a trough at about 42 years. The most common HR-HPV types to show a coinfection with HPV16 (clade 9) were HPV39 (28%), 45 (38%), and 59 (46%), belonging to HPV18 clade 7. The frequency of low-risk (LR) vs probable HR and HR-HPV also followed an age-dependent quadratic trend. Conclusions: After the age of 25 years, HR-HPV prevalence is similar in LSIL and ASCUS cases, motivating a low age limit for triage HPV testing. Multiple infections and LR/HR-HPV dominance are age-dependent. Genotyping in longitudinal design is needed to elucidate the importance of multiple infections in cancer progression and in cross-protection from vaccination. PMID:19623178

  18. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  19. The relationship between cell phone use, physical and sedentary activity, and cardiorespiratory fitness in a sample of U.S. college students.

    Science.gov (United States)

    Lepp, Andrew; Barkley, Jacob E; Sanders, Gabriel J; Rebold, Michael; Gates, Peter

    2013-06-21

    Today's cell phones increase opportunities for activities traditionally defined as sedentary behaviors (e.g., surfing the internet, playing video games). People who participate in large amounts of sedentary behaviors, relative to those who do not, tend to be less physically active, less physically fit, and at greater risk for health problems. However, cell phone use does not have to be a sedentary behavior as these devices are portable. It can occur while standing or during mild-to-moderate intensity physical activity. Thus, the relationship between cell phone use, physical and sedentary activity, and physical fitness is unclear. The purpose of this study was to investigate these relationships among a sample of healthy college students. Participants were first interviewed about their physical activity behavior and cell phone use. Then body composition was assessed and the validated self-efficacy survey for exercise behaviors completed. This was followed by a progressive exercise test on a treadmill to exhaustion. Peak oxygen consumption (VO2 peak) during exercise was used to measure cardiorespiratory fitness. Hierarchical regression was used to assess the relationship between cell phone use and cardiorespiratory fitness after controlling for sex, self-efficacy, and percent body fat. Interview data was transcribed, coded, and Chi-square analysis was used to compare the responses of low and high frequency cell phone users. Cell phone use was significantly (p = 0.047) and negatively (β = -0.25) related to cardio respiratory fitness independent of sex, self-efficacy, and percent fat which were also significant predictors (p cell phone use indicated a broader pattern of sedentary behaviors apart from cell phone use, such as watching television. Cell phone use, like traditional sedentary behaviors, may disrupt physical activity and reduce cardiorespiratory fitness.

  20. [Cultivation of a permanent fish cell line in serum-free media special experiences with a cytotoxicity test for waste water samples

    Science.gov (United States)

    Kohlpoth, Martin; Rusche, Brigitte

    1997-01-01

    The use of fetal calf serum (FCS) as standard medium additive for the cell cultivation must be regarded critically from the point of view of animal welfare as well as for scientific reasons and makes it necessary to look for alternatives. In the last years an in vitro cytotoxicity assay for the testing of industrial waste waters with the permanent fish cell line RTG-2 was established and pre-validated as an alternative to the fish test with the golden orfe. The application of FCS is also a special problem with regard to the testing of waste waters in a cytotoxicity test so that FCS-alternatives were tested. The RTG-2 cells were successfully adapted to the two solvents Basal Medium Supplement (BMS) and Ultroser-G (U-G) that are used to replace serum. The characterisation of these adapted cell lines showed no significant differences in growth rate, adhesion rate, viability and sensitivity to chemicals in comparison to the original RTG-2 cells. On the determination of the cytotoxicity of industrial waste waters the RTG-2 cells adapted to the BMS medium indicated a clearly higher toxicity of the waste water samples than the original RTG-2 cells. This result confirms the thesis that serum components react with waste water elements and thus change the bio-availability of toxic compounds.

  1. Determination of alpha-dose rates and chronostratigraphical study of travertine samples

    International Nuclear Information System (INIS)

    Oufni, L.; University Moulay Ismail, Errachidia; Misdaq, M.A.; Boudad, L.; Kabiri, L.

    2001-01-01

    Uranium and thorium contents in different layers of stratigraphical sedimentary deposits have been evaluated by using LR-115 type II and CR-39 solid state nuclear track detectors (SSNTD). A method has been developed for determining the alpha-dose rates of the sedimentary travertine samples. Using the U/Th dating method, we succeeded in age dating carbonated level sampled in the sedimentary deposits. Correlation between the stratigraphy, alpha-dose rates and age has been investigated. (author)

  2. Treatment and Prognosis of Isolated Local Relapse after Stereotactic Body Radiotherapy for Clinical Stage I Non-Small-Cell Lung Cancer: Importance of Salvage Surgery.

    Science.gov (United States)

    Hamaji, Masatsugu; Chen, Fengshi; Matsuo, Yukinori; Ueki, Nami; Hiraoka, Masahiro; Date, Hiroshi

    2015-11-01

    Many efforts have been made to detect local relapse (LR) in the follow-up after stereotactic body radiotherapy (SBRT) for non-small-cell lung cancer (NSCLC) although limited data are available on its treatment and prognosis. We aimed to characterize treatment options and clarify long-term outcomes of isolated LR after SBRT for patients with clinical stage I NSCLC. We reviewed our institutional database in search of patients with isolated LR after SBRT for clinical stage I NSCLC at our institution between 1999 and 2013. Patient characteristics were compared with Mann-Whitney U test, χ2 test, or Fisher's exact test as appropriate. Survival outcomes were estimated with Kaplan-Meier method. Potential prognostic factors were investigated using Cox proportional hazard model. Of 308 patients undergoing SBRT for clinical stage I NSCLC, 49 patients were identified to have isolated LR. Twelve patients underwent salvage surgery, none underwent radiotherapy, and eight patients received chemotherapy, whereas 29 patients received best supportive care. No patient characteristic except operability was significantly related with patient selection for LR treatments. Five-year overall survival (OS) rate of the whole cohort was 47.9% from SBRT and 25.7% from LR. Salvage surgery was associated with improved OS after LR (p = 0.014), and 5-year OS for patients undergoing salvage surgery was 79.5% from LR. It was confirmed that our patient selection for salvage surgery for isolated LR was associated with favorable survival outcomes. Operability based on multidisciplinary conferences, rather than measurable patient characteristics, is essential for appropriate patient selection for salvage surgery.

  3. Antibody-supervised deep learning for quantification of tumor-infiltrating immune cells in hematoxylin and eosin stained breast cancer samples.

    Science.gov (United States)

    Turkki, Riku; Linder, Nina; Kovanen, Panu E; Pellinen, Teijo; Lundin, Johan

    2016-01-01

    Immune cell infiltration in tumor is an emerging prognostic biomarker in breast cancer. The gold standard for quantification of immune cells in tissue sections is visual assessment through a microscope, which is subjective and semi-quantitative. In this study, we propose and evaluate an approach based on antibody-guided annotation and deep learning to quantify immune cell-rich areas in hematoxylin and eosin (H&E) stained samples. Consecutive sections of formalin-fixed parafin-embedded samples obtained from the primary tumor of twenty breast cancer patients were cut and stained with H&E and the pan-leukocyte CD45 antibody. The stained slides were digitally scanned, and a training set of immune cell-rich and cell-poor tissue regions was annotated in H&E whole-slide images using the CD45-expression as a guide. In analysis, the images were divided into small homogenous regions, superpixels, from which features were extracted using a pretrained convolutional neural network (CNN) and classified with a support of vector machine. The CNN approach was compared to texture-based classification and to visual assessments performed by two pathologists. In a set of 123,442 labeled superpixels, the CNN approach achieved an F-score of 0.94 (range: 0.92-0.94) in discrimination of immune cell-rich and cell-poor regions, as compared to an F-score of 0.88 (range: 0.87-0.89) obtained with the texture-based classification. When compared to visual assessment of 200 images, an agreement of 90% (κ = 0.79) to quantify immune infiltration with the CNN approach was achieved while the inter-observer agreement between pathologists was 90% (κ = 0.78). Our findings indicate that deep learning can be applied to quantify immune cell infiltration in breast cancer samples using a basic morphology staining only. A good discrimination of immune cell-rich areas was achieved, well in concordance with both leukocyte antigen expression and pathologists' visual assessment.

  4. Antibody-supervised deep learning for quantification of tumor-infiltrating immune cells in hematoxylin and eosin stained breast cancer samples

    Directory of Open Access Journals (Sweden)

    Riku Turkki

    2016-01-01

    Full Text Available Background: Immune cell infiltration in tumor is an emerging prognostic biomarker in breast cancer. The gold standard for quantification of immune cells in tissue sections is visual assessment through a microscope, which is subjective and semi-quantitative. In this study, we propose and evaluate an approach based on antibody-guided annotation and deep learning to quantify immune cell-rich areas in hematoxylin and eosin (H&E stained samples. Methods: Consecutive sections of formalin-fixed parafin-embedded samples obtained from the primary tumor of twenty breast cancer patients were cut and stained with H&E and the pan-leukocyte CD45 antibody. The stained slides were digitally scanned, and a training set of immune cell-rich and cell-poor tissue regions was annotated in H&E whole-slide images using the CD45-expression as a guide. In analysis, the images were divided into small homogenous regions, superpixels, from which features were extracted using a pretrained convolutional neural network (CNN and classified with a support of vector machine. The CNN approach was compared to texture-based classification and to visual assessments performed by two pathologists. Results: In a set of 123,442 labeled superpixels, the CNN approach achieved an F-score of 0.94 (range: 0.92-0.94 in discrimination of immune cell-rich and cell-poor regions, as compared to an F-score of 0.88 (range: 0.87-0.89 obtained with the texture-based classification. When compared to visual assessment of 200 images, an agreement of 90% (k = 0.79 to quantify immune infiltration with the CNN approach was achieved while the inter-observer agreement between pathologists was 90% (k = 0.78. Conclusions: Our findings indicate that deep learning can be applied to quantify immune cell infiltration in breast cancer samples using a basic morphology staining only. A good discrimination of immune cell-rich areas was achieved, well in concordance with both leukocyte antigen expression and

  5. Detection of Small Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental Water, Sewage, and Food Samples by a Seminested PCR Assay

    Science.gov (United States)

    Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg

    1999-01-01

    A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261

  6. Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

    International Nuclear Information System (INIS)

    Azuma, Koichi; Tsurutani, Junji; Sakai, Kazuko; Kaneda, Hiroyasu; Fujisaka, Yasuhito; Takeda, Masayuki; Watatani, Masahiro; Arao, Tokuzo; Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu; Nishio, Kazuto; Nakagawa, Kazuhiko

    2011-01-01

    Highlights: → A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. → Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. → Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC 50 of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

  7. Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

    Energy Technology Data Exchange (ETDEWEB)

    Azuma, Koichi [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Tsurutani, Junji, E-mail: tsurutani_j@dotd.med.kindai.ac.jp [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Sakai, Kazuko; Kaneda, Hiroyasu [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Fujisaka, Yasuhito; Takeda, Masayuki [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Watatani, Masahiro [Department of Surgery, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Arao, Tokuzo [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nishio, Kazuto [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan)

    2011-04-01

    Highlights: {yields} A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. {yields} Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. {yields} Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC{sub 50} of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

  8. Conventional and molecular cytogenetics of human non-medullary thyroid carcinoma: characterization of eight cell line models and review of the literature on clinical samples

    International Nuclear Information System (INIS)

    Ribeiro, Franclim Ricardo; Meireles, Ana Margarida; Rocha, Ana Sofia; Teixeira, Manuel Rodrigues

    2008-01-01

    Cell lines are often poorly characterized from a genetic point of view, reducing their usefulness as tumor models. Our purpose was to assess the genetic background of eight commonly used human thyroid carcinoma models and to compare the findings with those reported for primary tumors of the gland. We used chromosome banding analysis and comparative genomic hybridization to profile eight non-medullary thyroid carcinoma cell lines of papillary (TPC-1, FB2, K1 and B-CPAP), follicular (XTC-1) or anaplastic origin (8505C, C643 and HTH74). To assess the representativeness of the findings, we additionally performed a thorough review of cytogenetic (n = 125) and DNA copy number information (n = 270) available in the literature on clinical samples of thyroid carcinoma. The detailed characterization of chromosomal markers specific for each cell line revealed two cases of mistaken identities: FB2 was shown to derive from TPC-1 cells, whereas K1 cells have their origin in cell line GLAG-66. All cellular models displayed genomic aberrations of varying complexity, and recurrent gains at 5p, 5q, 8q, and 20q (6/7 cell lines) and losses at 8p, 13q, 18q, and Xp (4/7 cell lines) were seen. Importantly, the genomic profiles were compatible with those of the respective primary tumors, as seen in the meta-analysis of the existing literature data. We provide the genomic background of seven independent thyroid carcinoma models representative of the clinical tumors of the corresponding histotypes, and highlight regions of recurrent aberrations that may guide future studies aimed at identifying target genes. Our findings further support the importance of routinely performing cytogenetic studies on cell lines, to detect cross-contamination mishaps such as those identified here

  9. MicroRNA alterations and associated aberrant DNA methylation patterns across multiple sample types in oral squamous cell carcinoma

    DEFF Research Database (Denmark)

    Wiklund, Erik Digman; Gao, Shan; Hulf, Toby

    2011-01-01

    MicroRNA (miRNA) expression is broadly altered in cancer, but few studies have investigated miRNA deregulation in oral squamous cell carcinoma (OSCC). Epigenetic mechanisms are involved in the regulation of >30 miRNA genes in a range of tissues, and we aimed to investigate this further in OSCC....

  10. Outsourcing cytological samples to a referral laboratory for EGFR testing in non-small cell lung cancer: does theory meet practice?

    Science.gov (United States)

    Vigliar, E; Malapelle, U; Bellevicine, C; de Luca, C; Troncone, G

    2015-10-01

    Guidelines from the College of American Pathologists (CAP), the International Association for the Study of Lung Cancer (IASLC) and the Association for Molecular Pathology (AMP) consider cytology suitable for testing epidermal growth factor receptor (EGFR) mutations in lung adenocarcinoma. The guidelines recommend that cytopathologists first discuss the possibility of testing squamous cell carcinomas (SqCC) in multidisciplinary meetings. Second, cell blocks should be analysed rather than smear preparations and, third, specimens should be sent to external molecular laboratories within three working days of receiving requests. This study monitored how these recommendations are met in practice. Our laboratory received 596 requests from cytologists from 13 different institutions. For each case, the cytological diagnosis, cytopreparation type, and time between the request and sample mailing were compared with the recommendations. Of the 596 samples, 32 (5.4%) had been reported as SqCC. Three of these (9.4%) showed EGFR mutation. Cytological slides, either ThinPrep(™) (51.2%) or direct smears (43.2%), were more frequently received than cell blocks (5.7%). The mean time between the oncologist's request and specimen dispatching was 5.8 working days. The occurrence of mutations in samples reported as SqCC was higher than expected. This questions the reliability of the original diagnosis, which reinforced the recommendation to evaluate the opportunity for testing non-adenocarcinoma cytology on a case-by-case basis. In spite of CAP/IASLC/AMP recommendations, cell blocks were underutilized for EGFR testing, but cytological slides were suitable for DNA analyses. Significant efforts are needed to avoid delays in outsourcing cytological samples for EGFR testing. © 2014 John Wiley & Sons Ltd.

  11. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Science.gov (United States)

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

    2017-01-01

    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  12. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    International Nuclear Information System (INIS)

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

    2010-01-01

    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  13. Preparation and Testing of Impedance-based Fluidic Biochips with RTgill-W1 Cells for Rapid Evaluation of Drinking Water Samples for Toxicity.

    Science.gov (United States)

    Brennan, Linda M; Widder, Mark W; McAleer, Michael K; Mayo, Michael W; Greis, Alex P; van der Schalie, William H

    2016-03-07

    This manuscript describes how to prepare fluidic biochips with Rainbow trout gill epithelial (RTgill-W1) cells for use in a field portable water toxicity sensor. A monolayer of RTgill-W1 cells forms on the sensing electrodes enclosed within the biochips. The biochips are then used for testing in a field portable electric cell-substrate impedance sensing (ECIS) device designed for rapid toxicity testing of drinking water. The manuscript further describes how to run a toxicity test using the prepared biochips. A control water sample and the test water sample are mixed with pre-measured powdered media and injected into separate channels of the biochip. Impedance readings from the sensing electrodes in each of the biochip channels are measured and compared by an automated statistical software program. The screen on the ECIS instrument will indicate either "Contamination Detected" or "No Contamination Detected" within an hour of sample injection. Advantages are ease of use and rapid response to a broad spectrum of inorganic and organic chemicals at concentrations that are relevant to human health concerns, as well as the long-term stability of stored biochips in a ready state for testing. Limitations are the requirement for cold storage of the biochips and limited sensitivity to cholinesterase-inhibiting pesticides. Applications for this toxicity detector are for rapid field-portable testing of drinking water supplies by Army Preventative Medicine personnel or for use at municipal water treatment facilities.

  14. Determination of total selenium and Se-77 in isotopically enriched human samples by ICP-dynamic reaction cell-MS

    DEFF Research Database (Denmark)

    Sloth, Jens Jørgen; Larsen, Erik Huusfeldt; Bügel, Susanne H.

    2003-01-01

    and the digested faecal samples were diluted using an aqueous diluent containing 0.5% Triton X-100, 2% nitric acid and 3% methanol. Selenium was detected as Se-76, Se-77 and Se-80 by ICP- DRC- MS. Selenium originating from the natural isotope abundance yeast and other selenium sources from the diet was determined...

  15. The relationship between cell phone use, physical and sedentary activity, and cardiorespiratory fitness in a sample of U.S. college students

    Science.gov (United States)

    2013-01-01

    Background Today’s cell phones increase opportunities for activities traditionally defined as sedentary behaviors (e.g., surfing the internet, playing video games). People who participate in large amounts of sedentary behaviors, relative to those who do not, tend to be less physically active, less physically fit, and at greater risk for health problems. However, cell phone use does not have to be a sedentary behavior as these devices are portable. It can occur while standing or during mild-to-moderate intensity physical activity. Thus, the relationship between cell phone use, physical and sedentary activity, and physical fitness is unclear. The purpose of this study was to investigate these relationships among a sample of healthy college students. Methods Participants were first interviewed about their physical activity behavior and cell phone use. Then body composition was assessed and the validated self-efficacy survey for exercise behaviors completed. This was followed by a progressive exercise test on a treadmill to exhaustion. Peak oxygen consumption (VO2 peak) during exercise was used to measure cardiorespiratory fitness. Hierarchical regression was used to assess the relationship between cell phone use and cardiorespiratory fitness after controlling for sex, self-efficacy, and percent body fat. Interview data was transcribed, coded, and Chi-square analysis was used to compare the responses of low and high frequency cell phone users. Results Cell phone use was significantly (p = 0.047) and negatively (β = −0.25) related to cardio respiratory fitness independent of sex, self-efficacy, and percent fat which were also significant predictors (p < 0.05). Interview data offered several possible explanations for this relationship. First, high frequency users were more likely than low frequency users to report forgoing opportunities for physical activity in order to use their cell phones for sedentary behaviors. Second, low frequency users were more

  16. A core invasiveness gene signature reflects epithelial-to-mesenchymal transition but not metastatic potential in breast cancer cell lines and tissue samples.

    Directory of Open Access Journals (Sweden)

    Melike Marsan

    Full Text Available INTRODUCTION: Metastases remain the primary cause of cancer-related death. The acquisition of invasive tumour cell behaviour is thought to be a cornerstone of the metastatic cascade. Therefore, gene signatures related to invasiveness could aid in stratifying patients according to their prognostic profile. In the present study we aimed at identifying an invasiveness gene signature and investigated its biological relevance in breast cancer. METHODS & RESULTS: We collected a set of published gene signatures related to cell motility and invasion. Using this collection, we identified 16 genes that were represented at a higher frequency than observed by coincidence, hereafter named the core invasiveness gene signature. Principal component analysis showed that these overrepresented genes were able to segregate invasive and non-invasive breast cancer cell lines, outperforming sets of 16 randomly selected genes (all P<0.001. When applied onto additional data sets, the expression of the core invasiveness gene signature was significantly elevated in cell lines forced to undergo epithelial-mesenchymal transition. The link between core invasiveness gene expression and epithelial-mesenchymal transition was also confirmed in a dataset consisting of 2420 human breast cancer samples. Univariate and multivariate Cox regression analysis demonstrated that CIG expression is not associated with a shorter distant metastasis free survival interval (HR = 0.956, 95%C.I. = 0.896-1.019, P = 0.186. DISCUSSION: These data demonstrate that we have identified a set of core invasiveness genes, the expression of which is associated with epithelial-mesenchymal transition in breast cancer cell lines and in human tissue samples. Despite the connection between epithelial-mesenchymal transition and invasive tumour cell behaviour, we were unable to demonstrate a link between the core invasiveness gene signature and enhanced metastatic potential.

  17. The innovative potential of Lactobacillus rhamnosus LR06, Lactobacillus pentosus LPS01, Lactobacillus plantarum LP01, and Lactobacillus delbrueckii Subsp. delbrueckii LDD01 to restore the "gastric barrier effect" in patients chronically treated with PPI: a pilot study.

    Science.gov (United States)

    Del Piano, Mario; Anderloni, Andrea; Balzarini, Marco; Ballarè, Marco; Carmagnola, Stefania; Montino, Franco; Orsello, Marco; Pagliarulo, Michela; Tari, Roberto; Soattini, Liliana; Sforza, Filomena; Mogna, Luca; Mogna, Giovanni

    2012-10-01

    Gastroesophageal reflux disease is a very widespread condition. In Europe, it is estimated that about 175 million people suffer from this disease and have to chronically take drugs to increase gastric pH. The proton pump inhibitors (PPIs) such as omeprazole, lansoprazole, and esomeprazole are the most widely used drug typology in this regard. However, the inhibition of normal gastric acid secretion has important side effects, the most important being bacterial overgrowth in the stomach and duodenum with a concentration of >10⁵ viable cells/mL. As a major consequence of this, many harmful or even pathogenic bacteria contained in some foods could survive the gastric transit and colonize either the stomach itself, the duodenum, or the gut, where they could establish acute and even chronic infections with unavoidable consequences for the host's health. In other words, the "gastric barrier effect" is strongly reduced or even disrupted. To date, there are no real strategies to deal with this widespread, although still relatively little known, problem. The aim of this study was to confirm the gastric bacterial overgrowth in long-term PPI consumers and to assess the efficacy of some probiotic bacteria, belonging to both genera Lactobacillus and Bifidobacterium, in the reduction of gastric and duodenal bacterial overgrowth, therefore partially restoring the gastric barrier effect against foodborne pathogenic bacteria. For this purpose, probiotics with a strong demonstrated inhibitory activity on gram-negative bacteria, such as Escherichia coli, were tested in a human intervention trial involving a total of 30 subjects treated with PPIs for either 3 to 12 consecutive months (short-term) or >12 consecutive months (long-term). An additional 10 subjects not taking PPIs were enrolled and used as a control group representing the general population. Four selected probiotics Probiotical SpA (Novara, Italy), namely Lactobacillus rhamnosus LR06 (DSM 21981), Lactobacillus pentosus

  18. Developing a short form of the simple Rathus assertiveness schedule using a sample of adults with sickle cell disease.

    Science.gov (United States)

    Jenerette, Coretta; Dixon, Jane

    2010-10-01

    Ethnic and cultural norms influence an individual's assertiveness. In health care, assertiveness may play an important role in health outcomes, especially for predominantly minority populations, such as adults with sickle cell disease. Therefore, it is important to develop measures to accurately assess assertiveness. It is also important to reduce response burden of lengthy instruments while retaining instrument reliability and validity. The purpose of this article is to describe development of a shorter version of the Simple Rathus Assertiveness Schedule (SRAS). Data from a cross-sectional descriptive study of adults with sickle cell disease were used to construct a short form of the SRAS, guided by stepwise regression analysis. The 19-item Simple Rathus Assertiveness Scale-Short Form (SRAS-SF) had acceptable reliability (α = .81) and construct validity and was highly correlated with the SRAS (r = .98, p = .01). The SRAS-SF reduces response burden, while maintaining reliability and validity.

  19. Cell proliferation and apoptosis in the primary enamel knot measured by flow cytometry of laser microdissected samples

    Czech Academy of Sciences Publication Activity Database

    Matalová, Eva; Dubská, L.; Fleischmannová, Jana; Chlastáková, Ivana; Janečková, Eva; Tucker, A. S.

    2010-01-01

    Roč. 55, č. 8 (2010), s. 570-575 ISSN 0003-9969 R&D Projects: GA AV ČR KJB500450802; GA AV ČR IAA600450904; GA ČR GA203/08/1680 Institutional research plan: CEZ:AV0Z50450515 Keywords : Laser capture microdissection * Flow cytometry * Primary enamel knot Subject RIV: EA - Cell Biology Impact factor: 1.463, year: 2010

  20. A study on identification of bacteria in environmental samples using single-cell Raman spectroscopy: feasibility and reference libraries.

    Science.gov (United States)

    Baritaux, Jean-Charles; Simon, Anne-Catherine; Schultz, Emmanuelle; Emain, C; Laurent, P; Dinten, Jean-Marc

    2016-05-01

    We report on our recent efforts towards identifying bacteria in environmental samples by means of Raman spectroscopy. We established a database of Raman spectra from bacteria submitted to various environmental conditions. This dataset was used to verify that Raman typing is possible from measurements performed in non-ideal conditions. Starting from the same dataset, we then varied the phenotype and matrix diversity content included in the reference library used to train the statistical model. The results show that it is possible to obtain models with an extended coverage of spectral variabilities, compared to environment-specific models trained on spectra from a restricted set of conditions. Broad coverage models are desirable for environmental samples since the exact conditions of the bacteria cannot be controlled.

  1. Liquid-based cytology and cell block immunocytochemistry in veterinary medicine: comparison with standard cytology for the evaluation of canine lymphoid samples.

    Science.gov (United States)

    Fernandes, N C C A; Guerra, J M; Réssio, R A; Wasques, D G; Etlinger-Colonelli, D; Lorente, S; Nogueira, E; Dagli, M L Z

    2016-08-01

    Liquid-based Cytology (LBC) consists of immediate wet cell fixation with automated slide preparation. We applied LBC, cell block (CB) and immunocytochemistry to diagnose canine lymphoma and compare results with conventional cytology. Samples from enlarged lymph nodes of 18 dogs were collected and fixed in preservative solution for automated slide preparation (LBC), CB inclusion and immunophenotyping. Two CB techniques were tested: fixed sediment method (FSM) and agar method (AM). Anti-CD79a, anti-Pax5, anti-CD3 and anti-Ki67 were used in immunocytochemistry. LBC smears showed better nuclear and nucleolar definition, without cell superposition, but presented smaller cell size and worse cytoplasmic definition. FSM showed consistent cellular groups and were employed for immunocytochemistry, while AM CBs presented sparse groups of lymphocytes, with compromised analysis. Anti-Pax-5 allowed B-cell identification, both in reactive and neoplastic lymph nodes. Our preliminary report suggests that LBC and FSM together may be promising tools to improve lymphoma diagnosis through fine-needle aspiration. © 2015 John Wiley & Sons Ltd.

  2. Sampling the light-organ microenvironment of Euprymna scolopes: description of a population of host cells in association with the bacterial symbiont Vibrio fischeri.

    Science.gov (United States)

    Nyholm, S V; McFall-Ngai, M J

    1998-10-01

    The symbiosis between the squid Euprymna scolopes and the luminous bacterium Vibrio fischeri has a pronounced diel rhythm, one component of which is the venting of the contents of the light organ into the surrounding seawater each day at dawn. In this study, we explored the use of this behavior to sample the microenvironment of the light-organ crypts. Intact crypt contents, which emerge from the lateral pores of the organ as a thick paste-like exudate, were collected from anesthetized host animals that had been exposed to a light cue. Microscopy revealed that the expelled material is composed of a conspicuous population of host cells in association with the bacterial symbionts, all of which are embedded in a dense acellular matrix that strongly resembles the bacteria-based biofilms described in other systems. Assays of the viability of expelled crypt cells revealed no dead bacterial symbionts and a mixture of live and dead host cells. Analyses of the ultrastructure, biochemistry, and phagocytic activity of a subset of the host cell population suggested that some of these cells are macrophage-like molluscan hemocytes.

  3. Effects of Kapton Sample Cell Windows on the Detection Limit of Smectite: Implications for CheMin on the Mars Science Laboratory Mission

    Science.gov (United States)

    Achilles, C. N.; Ming, Douglas W.; Morris, R. V.; Blake, D. F.

    2012-01-01

    The CheMin instrument on the Mars Science Laboratory (MSL) rover Curiosity is an X-ray diffraction (XRD) and X-ray fluorescence (XRF) instrument capable of providing the mineralogical and chemical compositions of rocks and soils on the surface of Mars. CheMin uses a microfocus X-ray tube with a Co target, transmission geometry, and an energy-discriminating X-ray sensitive CCD to produce simultaneous 2-D XRD patterns and energy-dispersive X-ray histograms from powdered samples. CheMin has two different window materials used for sample cells -- Mylar and Kapton. Instrument details are provided elsewhere. Fe/Mg-smectite (e.g., nontronite) has been identified in Gale Crater, the MSL future landing site, by CRISM spectra. While large quantities of phyllosilicate minerals will be easily detected by CheMin, it is important to establish detection limits of such phases to understand capabilities and limitations of the instrument. A previous study indicated that the (001) peak of smectite at 15 Ang was detectable in a mixture of 1 wt.% smectite with olivine when Mylar is the window material for the sample cell. Complications arise when Kapton is the window material because Kapton itself also has a diffraction peak near 15 Ang (6.8 deg 2 Theta). This study presents results of mineral mixtures of smectite and olivine to determine smectite detection limits for Kapton sample cells. Because the intensity and position of the smectite (001) peak depends on the hydration state, we also analyzed mixtures with "hydrated" and "dehydrated"h smectite to examine the effects of hydration state on detection limits.

  4. Tumor-related markers in histologically normal margins correlate with locally recurrent oral squamous cell carcinoma: a retrospective study.

    Science.gov (United States)

    Wang, Xinhong; Chen, Si; Chen, Xinming; Zhang, Cuicui; Liang, Xueyi

    2016-02-01

    Oral squamous cell carcinoma (OSCC) is characterized by a high rate of local recurrence (LR) even when the surgical margins are considered histopathologically 'normal'. The aim of our study was to determine the relationship between early tumor-related markers detected in histologically normal margins (HNM) and LR as well as disease-free survival in OSCC. The loss of heterozygosity (LOH) of markers on 9p21 (D9s1747, RPS6, D9s162) and 17p13 (TP53) and the immunostaining results of the corresponding mutant P53, P14, P15, and P16 proteins were assessed and correlated with LR and disease-free survival in 71 OSCC patients who had HNM. Fifteen of 71 patients with HNM developed LR. The presence of the following molecular markers in surgical margins was significantly correlated with the development of LR: LOH on chromosome 9p21 (D9s1747 + RPS6 + D9s162), any LOH, P16, and P53 (chi-square test, P tumor-related markers in histologically 'normal' resection margins may be a useful method for assessing LR in OSCC patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Left-right asymmetry is formed in individual cells by intrinsic cell chirality.

    Science.gov (United States)

    Hatori, Ryo; Ando, Tadashi; Sasamura, Takeshi; Nakazawa, Naotaka; Nakamura, Mitsutoshi; Taniguchi, Kiichiro; Hozumi, Shunya; Kikuta, Junichi; Ishii, Masaru; Matsuno, Kenji

    2014-08-01

    Many animals show left-right (LR) asymmetric morphology. The mechanisms of LR asymmetric development are evolutionarily divergent, and they remain elusive in invertebrates. Various organs in Drosophila melanogaster show stereotypic LR asymmetry, including the embryonic gut. The Drosophila embryonic hindgut twists 90° left-handedly, thereby generating directional LR asymmetry. We recently revealed that the hindgut epithelial cell is chiral in shape and other properties; this is termed planar cell chirality (PCC). We previously showed by computer modeling that PCC is sufficient to induce the hindgut rotation. In addition, both the PCC and the direction of hindgut twisting are reversed in Myosin31DF (Myo31DF) mutants. Myo31DF encodes Drosophila MyosinID, an actin-based motor protein, whose molecular functions in LR asymmetric development are largely unknown. Here, to understand how PCC directs the asymmetric cell-shape, we analyzed PCC in genetic mosaics composed of cells homozygous for mutant Myo31DF, some of which also overexpressed wild-type Myo31DF. Wild-type cell-shape chirality only formed in the Myo31DF-overexpressing cells, suggesting that cell-shape chirality was established in each cell and reflects intrinsic PCC. A computer model recapitulating the development of this genetic mosaic suggested that mechanical interactions between cells are required for the cell-shape behavior seen in vivo. Our mosaic analysis also suggested that during hindgut rotation in vivo, wild-type Myo31DF suppresses the elongation of cell boundaries, supporting the idea that cell-shape chirality is an intrinsic property determined in each cell. However, the amount and distribution of F-actin and Myosin II, which are known to help generate the contraction force on cell boundaries, did not show differences between Myo31DF mutant cells and wild-type cells, suggesting that the static amount and distribution of these proteins are not involved in the suppression of cell-boundary elongation

  6. Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

    International Nuclear Information System (INIS)

    Byun, Eui-Baek; Choi, Han-Gyu; Sung, Nak-Yun; Byun, Eui-Hong

    2012-01-01

    Highlights: ► Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. ► EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. ► EGCG-treated DCs inhibited MAPKs activation and NF-κB p65 translocation via 67LR. ► EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-α, interleukin [IL]-1β, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor κB (NF-κB) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

  7. Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

    Energy Technology Data Exchange (ETDEWEB)

    Byun, Eui-Baek [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Choi, Han-Gyu [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of); Sung, Nak-Yun [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Byun, Eui-Hong, E-mail: ehbyun80@gmail.com [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited MAPKs activation and NF-{kappa}B p65 translocation via 67LR. Black-Right-Pointing-Pointer EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-1{beta}, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor {kappa}B (NF-{kappa}B) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

  8. Expansion and differentiation of germline-derived pluripotent stem cells on biomaterials.

    Science.gov (United States)

    Hoss, Mareike; Šarić, Tomo; Denecke, Bernd; Peinkofer, Gabriel; Bovi, Manfred; Groll, Jürgen; Ko, Kinarm; Salber, Jochen; Halbach, Marcel; Schöler, Hans R; Zenke, Martin; Neuss, Sabine

    2013-05-01

    Stem cells with broad differentiation potential, such as the recently described germline-derived pluripotent stem cells (gPS cells), are an appealing source for tissue engineering strategies. Biomaterials can inhibit, support, or induce proliferation and differentiation of stem cells. Here we identified (1) polymers that maintain self-renewal and differentiation potential of gPS cells for feeder-free expansion and (2) polymers supporting the cardiomyogenic fate of gPS cells by analyzing a panel of polymers of an established biomaterial bank previously used to assess growth of diverse stem cell types. Identification of cytocompatible gPS cell/biomaterial combinations required analysis of several parameters, including morphology, viability, cytotoxicity, apoptosis, proliferation, and differentiation potential. Pluripotency of gPS cells was visualized by the endogenous Oct4-promoter-driven GFP and by Sox2 and Nanog immunofluorescence. Viability assay, proliferation assay, and flow cytometry showed that gPS cells efficiently adhere and are viable on synthetic polymers, such as Resomer(®) LR704 (poly(L-lactic-D,L-lactic acid), poly(tetrafluor ethylene) (PTFE), poly(vinylidene fluoride) (PVDF), and on gelatine-coated tissue culture polystyrene. Expansion experiments showed that Resomer LR704 is an alternative substrate for feeder-free gPS cell maintenance. Resomer LR704, PTFE, and PVDF were found to be suitable for gPS cell differentiation. Spontaneous beating in embryoid bodies cultured on Resomer LR704 occurred already on day 8 of differentiation, much earlier compared to the other surfaces. This indicates that Resomer LR704 supports spontaneous cardiomyogenic differentiation of gPS cells, which was also confirmed on molecular, protein and functional level.

  9. Population Pharmacokinetics and Optimal Sampling Strategy for Model-Based Precision Dosing of Melphalan in Patients Undergoing Hematopoietic Stem Cell Transplantation.

    Science.gov (United States)

    Mizuno, Kana; Dong, Min; Fukuda, Tsuyoshi; Chandra, Sharat; Mehta, Parinda A; McConnell, Scott; Anaissie, Elias J; Vinks, Alexander A

    2018-05-01

    High-dose melphalan is an important component of conditioning regimens for patients undergoing hematopoietic stem cell transplantation. The current dosing strategy based on body surface area results in a high incidence of oral mucositis and gastrointestinal and liver toxicity. Pharmacokinetically guided dosing will individualize exposure and help minimize overexposure-related toxicity. The purpose of this study was to develop a population pharmacokinetic model and optimal sampling strategy. A population pharmacokinetic model was developed with NONMEM using 98 observations collected from 15 adult patients given the standard dose of 140 or 200 mg/m 2 by intravenous infusion. The determinant-optimal sampling strategy was explored with PopED software. Individual area under the curve estimates were generated by Bayesian estimation using full and the proposed sparse sampling data. The predictive performance of the optimal sampling strategy was evaluated based on bias and precision estimates. The feasibility of the optimal sampling strategy was tested using pharmacokinetic data from five pediatric patients. A two-compartment model best described the data. The final model included body weight and creatinine clearance as predictors of clearance. The determinant-optimal sampling strategies (and windows) were identified at 0.08 (0.08-0.19), 0.61 (0.33-0.90), 2.0 (1.3-2.7), and 4.0 (3.6-4.0) h post-infusion. An excellent correlation was observed between area under the curve estimates obtained with the full and the proposed four-sample strategy (R 2  = 0.98; p strategy promises to achieve the target area under the curve as part of precision dosing.

  10. Downregulation of the non-integrin laminin receptor reduces cellular viability by inducing apoptosis in lung and cervical cancer cells.

    Directory of Open Access Journals (Sweden)

    Kiashanee Moodley

    Full Text Available The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR, is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and angiogenesis. This study investigated whether LRP/LR is implicated in the maintenance of cellular viability in lung and cervical cancer cell lines. Here we show a significant reduction in cellular viability in the aforementioned cell lines as a result of the siRNA-mediated downregulation of LRP. This reduction in cellular viability is due to increased apoptotic processes, reflected by the loss of nuclear integrity and the significant increase in the activity of caspase-3. These results indicate that LRP/LR is involved in the maintenance of cellular viability in tumorigenic lung and cervix uteri cells through the blockage of apoptosis. Knockdown of LRP/LR by siRNA might represent an alternative therapeutic strategy for the treatment of lung and cervical cancer.

  11. ASSESSMENT OF ACUTE LUNG INJURY INDUCED BY PM 2.5 SAMPLES FROM TWO CITIES IN GERMANY WITH DIFFERING INCIDENCE OF ALLERGIES AND ASTHMA

    Science.gov (United States)

    ASSESSMENT OF ACUTE LUNG INJURY INDUCED BY PM 2.5 SAMPLES FROM TWO CITIES IN GERMANY WITH DIFFERING INCIDENCE OF ALLERGIES AND ASTHMA.LR Bishop, J Heinrich*, MK Selgrade & MI Gilmour. Experimental Toxicology Division, ORD/ NHEERL, U.S. EPA, RTP, NC. *GSF, Neuherberg,...

  12. Evaluation of spectral libraries and sample preparation for DIA-LC-MS analysis of host cell proteins

    DEFF Research Database (Denmark)

    Heissel, Søren; Bunkenborg, Jakob; Kristiansen, Max Per

    2018-01-01

    in the field of tuberculosis and has not previously been studied by LC-MS. The developed method and acquired experiences served to develop a generalized strategy for HCP-characterization in our laboratory. We evaluated the use of different spectral libraries, recorded in data-dependent mode for obtaining...... the highest HCP coverage, combined with SWATH-based absolute quantification. The accuracy of two label-free absolute quantification strategies was evaluated using stable isotope peptides. Two different sample preparation workflows were evaluated for optimal HCP yield. . The label-free strategy produced...... accurate quantification across several orders of magnitude, and the calculated purity was found to be in agreement with previously obtained ELISA data....

  13. Assessment of different sample preparation routes for mass spectrometric monitoring and imaging of lipids in bone cells via ToF-SIMS

    Science.gov (United States)

    Schaepe, Kaija; Kokesch-Himmelreich, Julia; Rohnke, Marcus; Wagner, Alena-Svenja; Schaaf, Thimo; Wenisch, Sabine; Janek, Jürgen

    2015-01-01

    In ToF-SIMS analysis, the experimental outcome from cell experiments is to a great extent influenced by the sample preparation routine. In order to better judge this critical influence in the case of lipid analysis, a detailed comparison of different sample preparation routines is performed—aiming at an optimized preparation routine for systematic lipid imaging of cell cultures. For this purpose, human mesenchymal stem cells were analyzed: (a) as chemically fixed, (b) freeze-dried, and (c) frozen-hydrated. For chemical fixation, different fixatives, i.e., glutaraldehyde, paraformaldehyde, and a mixture of both, were tested with different postfixative handling procedures like storage in phosphate buffered saline, water or critical point drying. Furthermore, secondary lipid fixation via osmium tetroxide was taken into account and the effect of an ascending alcohol series with and without this secondary lipid fixation was evaluated. Concerning freeze-drying, three different postprocessing possibilities were examined. One can be considered as a pure cryofixation technique while the other two routes were based on chemical fixation. Cryofixation methods known from literature, i.e., freeze-fracturing and simple frozen-hydrated preparation, were also evaluated to complete the comparison of sample preparation techniques. Subsequent data evaluation of SIMS spectra in both, positive and negative, ion mode was performed via principal component analysis by use of peak sets representative for lipids. For freeze-fracturing, these experiments revealed poor reproducibility making this preparation route unsuitable for systematic investigations and statistic data evaluation. Freeze-drying after cryofixation showed improved reproducibility and well preserved lipid contents while the other freeze-drying procedures showed drawbacks in one of these criteria. In comparison, chemical fixation techniques via glutar- and/or paraformaldehyde proved most suitable in terms of reproducibility

  14. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.

    2000-01-01

    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  15. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    Science.gov (United States)

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

    2011-01-01

    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  16. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

    2015-01-01

    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  17. Dedicated Tool for Irradiation and Electrical Measurement of Large Surface Samples on the Beamline of a 2.5 Mev Pelletron Electron Accelerator: Application to Solar Cells

    OpenAIRE

    Lefèvre Jérémie; Le Houedec Patrice; Losco Jérôme; Cavani Olivier; Boizot Bruno

    2017-01-01

    We designed a tool allowing irradiation of large samples over a surface of A5 size dimension by means of a 2.5 MeV Pelletron electron accelerator. in situ electrical measurements (I-V, conductivity, etc.) can also be performed, in the dark or under illumination, to study radiation effects in materials. Irradiations and electrical measurements are achievable over a temperature range from 100 K to 300 K. The setup was initially developed to test real-size triple junction solar cells at low t...

  18. Direct Human Papillomavirus E6 Whole-Cell Enzyme-Linked Immunosorbent Assay for Objective Measurement of E6 Oncoproteins in Cytology Samples

    OpenAIRE

    Yang, Yi-Shan; Smith-McCune, Karen; Darragh, Teresa M.; Lai, Yvonne; Lin, Ju-Hwa; Chang, Ting-Chang; Guo, Hsiao-Yun; Kesler, Tiea; Carter, Alicia; Castle, Philip E.; Cheng, Shuling

    2012-01-01

    A novel, whole-cell enzyme-linked immunosorbent assay (ELISA) based on a non-type-specific anti-human papillomavirus (HPV) E6 antibody was tested on 182 residual cytological specimens. For samples with a designation of more severe than cervical intraepithelial neoplasia grade 3 (CIN3+), 83% tested positive for E6; in a subset with paired testing for E6 ELISA and HPV DNA, 72% tested E6 positive and 92% tested high-risk (HR)-HPV DNA positive (P = 0.2). Among the women with a less than CIN3 diag...

  19. The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

    Directory of Open Access Journals (Sweden)

    Jeong Byung-Hoon

    2011-08-01

    Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

  20. Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

    Science.gov (United States)

    Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

    2013-11-01

    While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Chiral cell sliding drives left-right asymmetric organ twisting

    Science.gov (United States)

    Inaki, Mikiko; Hatori, Ryo; Nakazawa, Naotaka; Okumura, Takashi; Ishibashi, Tomoki; Kikuta, Junichi; Ishii, Masaru

    2018-01-01

    Polarized epithelial morphogenesis is an essential process in animal development. While this process is mostly attributed to directional cell intercalation, it can also be induced by other mechanisms. Using live-imaging analysis and a three-dimensional vertex model, we identified ‘cell sliding,’ a novel mechanism driving epithelial morphogenesis, in which cells directionally change their position relative to their subjacent (posterior) neighbors by sliding in one direction. In Drosophila embryonic hindgut, an initial left-right (LR) asymmetry of the cell shape (cell chirality in three dimensions), which occurs intrinsically before tissue deformation, is converted through LR asymmetric cell sliding into a directional axial twisting of the epithelial tube. In a Drosophila inversion mutant showing inverted cell chirality and hindgut rotation, cell sliding occurs in the opposite direction to that in wild-type. Unlike directional cell intercalation, cell sliding does not require junctional remodeling. Cell sliding may also be involved in other cases of LR-polarized epithelial morphogenesis. PMID:29891026

  2. Radionuclides detected in lime samples that consumed with tobacco and betel nuts by people of Northeast India where head and neck squamous cells cancer (HNSCC) is prevalent

    International Nuclear Information System (INIS)

    Dilip Bhattacharjee; Satoru Endo; Kenichi Tanaka; Masaharu Hoshi

    2007-01-01

    Complete text of publication follows. Head and neck squamous cell cancer (HNSCC) is a very predominant type of cancer amongst the population of northeastern states of India than the rest of the world. Epidemiological and other data suggest consumption of betel nuts with/without tobacco and lime or tobacco alone with lime is a probable cause of high cancer incidence. The fundamental question arises that why this particular cancer is induced more in this region while people follow the similar habits elsewhere. Here we report the results on analysis of lime samples, collected from 12 different locations spectrophotometrically by high-purity germanium detector. The calculated activity of radionuclides showed to an average of 2.68, 0.10 and 0.83 Bq/gm for 238 U, 235 U and 232 Th series respectively for ten samples which are about 8 times higher than the normal background level of 0.37, 0.02 and 0.02 Bq/gm for 238 U, 235 U and 232 Th series found in control samples, collected from outside of northeast. The results conclusively showed for the first time that the lime samples almost throughout the northeastern India contain high proportion of radionuclides of uranium, thorium and actinides series. Further, annual effective dose of gamma radiation calculations from these results of earth's crust in northeast showed that gamma rays emitted at an average dose of up to 2.5 mSv/year/consumer approximately. This dose calculation in the oral cavity is underestimated as short range radiations by decay of alpha, beta and electron-capture etc are not considered in the present study. Continuous exposure of such low dose radiations emitting from different radionuclides to the sensitive squamous cells of the oral cavity for a long twenty years or more amounting to a total minimum dose of at least 50 mSv evidently contributes towards excessive HNSCC to the people of northeast than other parts of India.

  3. Reduction of Powerplex(®) Y23 reaction volume for genotyping buccal cell samples on FTA(TM) cards.

    Science.gov (United States)

    Raziel, Aliza; Dell'Ariccia-Carmon, Aviva; Zamir, Ashira

    2015-01-01

    PowerPlex(®) Y23 is a novel kit for Y-STR typing that includes new highly discriminating loci. The Israel DNA Database laboratory has recently adopted it for routine Y-STR analysis. This study examined PCR amplification from 1.2-mm FTA punch in reduced volumes of 5 and 10 μL. Direct amplification and washing of the FTA punches were examined in different PCR cycle numbers. One short robotically performed wash was found to improve the quality and the percent of profiles obtained. The optimal PCR cycle number was determined for 5 and 10 μL reaction volumes. The percent of obtained profiles, color balance, and reproducibility were examined. High-quality profiles were achieved in 90% and 88% of the samples amplified in 5 and 10 μL, respectively, in the first attempt. Volume reduction to 5 μL has a vast economic impact especially for DNA database laboratories. © 2014 American Academy of Forensic Sciences.

  4. Comparative study of cyanotoxins affecting cytoskeletal and chromatin structures in CHO-K1 cells.

    Science.gov (United States)

    Gácsi, Mariann; Antal, Otilia; Vasas, Gábor; Máthé, Csaba; Borbély, György; Saker, Martin L; Gyori, János; Farkas, Anna; Vehovszky, Agnes; Bánfalvi, Gáspár

    2009-06-01

    In this study we compared the effects of the two frequently occuring and most dangerous cyanobacterial toxins on the cellular organization of microfilaments, microtubules and on the chromatin structure in Chinese hamster ovary (CHO-K1) cells. These compounds are the widely known microcystin-LR (MC-LR) and cylindrospermopsin (CYN) classified as the highest-priority cyanotoxin. Toxic effects were tested in a concentration and time dependent manner. The hepatotoxic MC-LR did not cause significant cytotoxicity on CHO-K1 cells under 20 microM, but caused apoptotic changes at higher concentrations. Apoptotic shrinkage was associated with the shortening and loss of actin filaments and with a concentration dependent depolymerization of microtubules. No necrosis was observed over the concentration range (1-50 microM MC-LR) tested. Cylindrospermopsin did cause apoptosis at low concentrations (1-2 microM) and over short exposure periods (12h). Necrosis was observed at higher concentrations (5-10 microM) and following longer exposure periods (24 or 48h). Cyanotoxins also affected the chromatin structure. The condensation process was inhibited by MC-LR at a later stage and manifested as broken elongated prechromosomes. CYN inhibited chromatin condensation at the early fibrillary stage leading to blurred fluorescent images of apoptotic bodies and preventing the formation of metaphase chromosomes. Cylindrospermopsin exhibited a more pronounced toxic effect causing cytoskeletal and nuclear changes as well as apoptotic and necrotic alterations.

  5. Boat sampling

    International Nuclear Information System (INIS)

    Citanovic, M.; Bezlaj, H.

    1994-01-01

    This presentation describes essential boat sampling activities: on site boat sampling process optimization and qualification; boat sampling of base material (beltline region); boat sampling of weld material (weld No. 4); problems accompanied with weld crown varieties, RPV shell inner radius tolerance, local corrosion pitting and water clarity. The equipment used for boat sampling is described too. 7 pictures

  6. Graph sampling

    OpenAIRE

    Zhang, L.-C.; Patone, M.

    2017-01-01

    We synthesise the existing theory of graph sampling. We propose a formal definition of sampling in finite graphs, and provide a classification of potential graph parameters. We develop a general approach of Horvitz–Thompson estimation to T-stage snowball sampling, and present various reformulations of some common network sampling methods in the literature in terms of the outlined graph sampling theory.

  7. Development of a silicone-membrane passive sampler for monitoring cylindrospermopsin and microcystin LR-YR-RR in natural waters

    Science.gov (United States)

    Nyoni, Hlengilizwe; Mamba, Bhekie B.; Msagati, Titus A. M.

    2017-08-01

    Silicone membrane tubes were functionalised by filling them with synthesised γ-Fe2O3 nanoparticles and used as a passive sampling device for monitoring microcystins and cylindrospermopsin in aquatic environments. This novel device was calibrated for the measurement of microcystin and cylindrospermopsin concentrations in water. The effect of temperature and hydrodynamics on the sampler performance was studied in a flow-through system under controlled conditions. The chemical uptake of microcystins (MCs) and cylindrospermopsin (CYN) into the passive sampler remained linear and integrative throughout the exposure period. The rate of accumulation of most of the MC compounds tested was dependent on temperature and flow velocity. The use of 13C labelled polychlorinated biphenyls as performance reference compounds (PRCs) in silicone membrane/γ-Fe2O3 nanoparticle passive sampler, Chemcatcher and polar organic chemical integrative sampler (POCIS) was evaluated. The majority of PRCs improved the semi quantitative nature of water concentration estimated by the three samplers. The corrected sampling rate values of model biotoxin compounds were used to estimate the time-weighted average concentrations in natural cyanobacterial water blooms of the Hartbeespoort dam. The corrected sampling rates RScorr values varied from 0.1140 to 0.5628 Ld-1 between samplers with silicone membrane having the least RScorr values compared to the Chemcatcher and POCIS. The three passive sampling devises provided a more relevant picture of the biotoxin concentration in the Hartbeespoort dam. The results suggested that the three sampling devices are suitable for use in monitoring microcystins and cylindrospermopsin concentrations in aquatic environments.

  8. Cellular and Nuclear Alignment Analysis for Determining Epithelial Cell Chirality

    Science.gov (United States)

    Raymond, Michael J.; Ray, Poulomi; Kaur, Gurleen; Singh, Ajay V.; Wan, Leo Q.

    2015-01-01

    Left-right (LR) asymmetry is a biologically conserved property in living organisms t