WorldWideScience

Sample records for lr mutant virus

  1. LR1: a candidate RNA virus of Leishmania.

    OpenAIRE

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  2. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  3. Temperature-Sensitive Mutants of Mouse Hepatitis Virus Strain A59: Isolation, Characterization and Neuropathogenic Properties.

    NARCIS (Netherlands)

    M.J.M. Koolen (Marck); A.D.M.E. Osterhaus (Albert); G. van Steenis (Bert); M.C. Horzinek; B.A.M. van der Zeijst (Ben)

    1983-01-01

    textabstractTwenty 5-fluorouracil-induced temperature-sensitive (ts) mutants of mouse hepatitis virus strain A59 were isolated from 1284 virus clones. Mutants were preselected on the basis of their inability to induce syncytia in infected cells at the restrictive temperature (40 degrees) vs the

  4. The pathogenicity of thymidine kinase-deficient mutants of herpes simplex virus in mice.

    Science.gov (United States)

    Field, H J; Wildy, P

    1978-10-01

    The pathogenicity for mice of two mutants of herpes simplex virus (type 1 and type 2), which fail to induce thymidine kinase, were compared with their respective parent strains. The mutants were much less virulent than the parents following either intracerebral or peripheral inoculation. The replication of the virus at the site of inoculation and its progression into the nervous system were studied. Following a very large inoculum in the ear, the type 1 mutant was found to establish a latent infection in the cervical dorsal root ganglia. Mice inoculated intracerebrally with small doses of the mutant viruses were solidly immune to challenge with lethal doses of the parent strain.

  5. Molecular Characterization of Prostate Cancer Cell Oncolysis by Herpes Simplex Virus ICP0 Mutants

    National Research Council Canada - National Science Library

    Mossman, Karen

    2005-01-01

    .... Briefly, the goals of the proposal were to characterize the oncolytic capacity of Herpes simplex virus type 1 ICPO mutants in prostate cancer cells given the relationship between ICPO and two tumor...

  6. Molecular Characterization of Prostate Cancer Cell Oncolysis by Herpes Simplex Virus ICP0 Mutants

    National Research Council Canada - National Science Library

    Mossman, Karen

    2006-01-01

    .... Briefly, the goals of the proposal were to characterize the oncolytic capacity of Herpes simplex virus type 1 ICP0 mutants in prostate cancer cells given the relationship between ICP0 and two tumor...

  7. Temperature-sensitive host range mutants of herpes simplex virus type 2

    International Nuclear Information System (INIS)

    Koment, R.W.; Rapp, F.

    1975-01-01

    Herpesviruses are capable of several types of infection of a host cell. To investigate the early events which ultimately determine the nature of the virus-host cell interaction, a system was established utilizing temperature-sensitive mutants of herpes simplex virus type 2. Four mutants have been isolated which fail to induce cytopathic effects and do not replicate at 39 C in hamster embryo fibroblast cells. At least one mutant is virus DNA negative. Since intracellular complementation is detectable between pairs of mutants, a virus function is known to be temperature sensitive. However, all four mutants induce cytopathic effects and replicate to parental virus levels in rabbit kidney cells at 39 C. This suggests that a host cell function, lacking or nonfunctional in HEF cells but present in rabbit kidney cells at 39 C, is required for the replication of these mutants in hamster embryo fibroblast cells at 39 C. Therefore, we conclude that these mutants are both temperature sensitive and exhibit host range properties

  8. Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

    Science.gov (United States)

    Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

    2014-02-01

    The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Isolation and characterization of acyclovir-resistant mutants of herpes simplex virus.

    Science.gov (United States)

    Field, H J; Darby, G; Wildy, P

    1980-07-01

    Mutants of HSV which are resistant to acyclovir (acycloguanosine) have been isolated following serial passages of several herpes simplex virus (HSV) strains in the presence of the drug. The majority of the mutants isolated are defective in induction of thymidine kinase (TK) and this is consistent with the observation that independently isolated TK- viruses are naturally resistant to ACV. One mutant is described (SC16 R9C2) which is resistant in biochemically transformed cells which express HSV TK. This suggests that its resistance resides at a level other than TK. It is also resistant to phosphonoacetic acid, suggesting that the DNA polymerase locus may be involved. A further mutant is described [Cl (101) P2C5] which induces normal levels of TK, although the nature of resistance of this virus is not yet elucidated.

  10. The morphogenesis of herpes simplex virus type 1 in infected parental mouse L fibroblasts and mutant gro29 cells

    DEFF Research Database (Denmark)

    Jensen, Helle Lone; Norrild, Bodil

    2003-01-01

    Mutants of cell lines and viruses are important biological tools. The pathway of herpesvirus particle maturation and egress are contentious issues. The mutant gro29 line of mouse L cells is defective for egress of herpes simplex virus type 1 (HSV-1) virions, and a candidate for studies of virus...

  11. Counteracting quasispecies adaptability: extinction of a ribavirin-resistant virus mutant by an alternative mutagenic treatment.

    Directory of Open Access Journals (Sweden)

    Celia Perales

    Full Text Available BACKGROUND: Lethal mutagenesis, or virus extinction promoted by mutagen-induced elevation of mutation rates of viruses, may meet with the problem of selection of mutagen-resistant variants, as extensively documented for standard, non-mutagenic antiviral inhibitors. Previously, we characterized a mutant of foot-and-mouth disease virus that included in its RNA-dependent RNA polymerase replacement M296I that decreased the sensitivity of the virus to the mutagenic nucleoside analogue ribavirin. METHODOLOGY AND PRINCIPAL FINDINGS: Replacement M296I in the viral polymerase impedes the extinction of the mutant foot-and-mouth disease virus by elevated concentrations of ribavirin. In contrast, wild type virus was extinguished by the same ribavirin treatment and, interestingly, no mutants resistant to ribavirin were selected from the wild type populations. Decreases of infectivity and viral load of the ribavirin-resistant M296I mutant were attained with a combination of the mutagen 5-fluorouracil and the non-mutagenic inhibitor guanidine hydrocloride. However, extinction was achieved with a sequential treatment, first with ribavirin, and then with a minimal dose of 5-fluorouracil in combination with guanidine hydrochloride. Both, wild type and ribavirin-resistant mutant M296I exhibited equal sensitivity to this combination, indicating that replacement M296I in the polymerase did not confer a significant cross-resistance to 5-fluorouracil. We discuss these results in relation to antiviral designs based on lethal mutagenesis. CONCLUSIONS: (i When dominant in the population, a mutation that confers partial resistance to a mutagenic agent can jeopardize virus extinction by elevated doses of the same mutagen. (ii A wild type virus, subjected to identical high mutagenic treatment, need not select a mutagen-resistant variant, and the population can be extinguished. (iii Extinction of the mutagen-resistant variant can be achieved by a sequential treatment of a

  12. Generation and characterization of mutants of tomato spotted wilt virus

    NARCIS (Netherlands)

    Oliveira Resende, de R.

    1993-01-01

    In nature, tospoviruses like tomato spotted wilt virus (TSWV) are exclusively transmitted by thrips species (Sakimura, 1962) producing numerous enveloped virions during infection, which accumulate in the cisternae of the endoplasmatic. reticulum. system (Kitajima, 1965; Milne, 1970; Ie,

  13. Intracellular localization and movement phenotypes of alfalfa mosaic virus movement protein mutants

    NARCIS (Netherlands)

    Huang, M.; Jongejan, L.; Zheng, H.; Zhang, L.; Bol, J. F.

    2001-01-01

    Thirteen mutations were introduced in the movement protein (MP) gene of Alfalfa mosaic virus (AMV) fused to the green fluorescent protein (GFP) gene and the mutant MP-GFP fusions were expressed transiently in tobacco protoplasts, tobacco suspension cells, and epidermal cells of tobacco leaves. In

  14. Temperature-sensitive mutants of fowl plague virus: isolation and genetic characterization

    International Nuclear Information System (INIS)

    Almond, J.W.; McGeoch, D.; Barry, R.D.

    1979-01-01

    Forty-nine temperature-sensitive mutants of fowl plague virus (FPV) strain Rostock and four ts mutants of FPV-strain Dobson were isolated by utilizing two methods of plaque screening, after either spontaneous or chemically induced mutagenesis. Twenty-nine of the FPV-Rostock mutants were further characterized by genetic recombination studies and were found to fall into six high frequency recombination groups. The genome segment carrying the ts mutation in each group was identified by analyzing the gene composition of ts + recombinants generated from crosses between representatives of each group and ts mutants of FPV-Dobson. It was concluded that the six groups correspond to mutations in six different genome segments, namely, those coding for the P 1 , P 2 , P 3 , HA, NP, and NS proteins

  15. Effect of uv-irradiation on genetic recombination of Simian virus 40 mutants

    International Nuclear Information System (INIS)

    Gentil, A.; Margot, A.; Sarasin, A.

    1983-01-01

    Genetic recombination in monkey kidney cells has been studied using Simian virus 40 (SV40) as a molecular probe. Control or uv-irradiated cells have been co-infected with two thermosensitive mutants of SV40, tsA58 and tsA30. Recombination between the two viral genomes gives rise to a wild type virus phenotype, able to grow at the restrictive temperature of 41 0 C, which was taken as a measure of the recombination activity of the host cells. Results show that recombination takes place at a low frequency when viruses are not uv-irradiated. Irradiation of one or both viruses increases drastically recombination frequency. Pretreatment of the host cells with uv-light or mitomycin C 24 hours before being infected does not increase recombination frequency measured in our experimental conditions. 23 references, 5 tables

  16. Hepatitis B surface gene 145 mutant as a minor population in hepatitis B virus carriers

    Directory of Open Access Journals (Sweden)

    Komatsu Haruki

    2012-01-01

    Full Text Available Abstract Background Hepatitis B virus (HBV can have mutations that include the a determinant, which causes breakthrough infection. In particular, a single mutation at amino acid 145 of the surface protein (G145 is frequently reported in the failure of prophylactic treatment. The aim of this study was to evaluate the frequency of the a determinant mutants, especially the G145 variant, in Japan, where universal vaccination has not been adopted. Methods The present study was a retrospective study. The study cohorts were defined as follows: group 1, children with failure to prevent mother-to-child transmission despite immunoprophylaxis (n = 18, male/female = 8/10, age 1-14 years; median 6 years; group 2, HBV carriers who had not received vaccination or hepatitis B immunoglobulin (n = 107, male/female = 107, age 1-52 years; median 16 years. To detect the G145R and G145A mutants in patients, we designed 3 probes for real-time PCR. We also performed direct sequencing and cloning of PCR products. Results By mutant-specific real-time PCR, one subject (5.6% was positive for the G145R mutant in group 1, while the G145 mutant was undetectable in group 2. The a determinant mutants were detected in one (5.6% of the group 1 subjects and 10 (9.3% of the group 2 subjects using direct sequencing, but direct sequencing did not reveal the G145 mutant as a predominant strain in the two groups. However, the subject who was positive according to the mutant-specific real-time PCR in group 1 had overlapped peaks at nt 587 in the electropherogram. In group 2, 11 patients had overlapped peaks at nt 587 in the electropherogram. Cloning of PCR products allowed detection of the G145R mutant as a minor strain in 7 (group 1: 1 subject, group 2: 6 subjects of 12 subjects who had overlapped peaks at nt 587 in the electropherogram. Conclusions The frequency of the a determinant mutants was not high in Japan. However, the G145R mutant was often present as a minor population in

  17. Temporal and spatial alterations in mutant swarm size of St. Louis encephalitis virus in mosquito hosts.

    Science.gov (United States)

    Ciota, Alexander T; Koch, Evan M; Willsey, Graham G; Davis, Lauren J; Jerzak, Greta V S; Ehrbar, Dylan J; Wilke, Claus O; Kramer, Laura D

    2011-03-01

    St. Louis encephalitis virus (SLEV; Flaviviridae; Flavivirus) is a member of the Japanese encephalitis serocomplex and a close relative of West Nile virus (WNV). Although SLEV remains endemic to the US, both levels of activity and geographical dispersal are relatively constrained when compared to the widespread distribution of WNV. In recent years, WNV appears to have displaced SLEV in California, yet both viruses currently coexist in Texas and several other states. It has become clear that viral swarm characterization is required if we are to fully evaluate the relationship between viral genomes, viral evolution, and epidemiology. Mutant swarm size and composition may be particularly important for arboviruses, which require replication not only in diverse tissues but also divergent hosts. In order to evaluate temporal, spatial, and host-specific patterns in the SLEV mutant swarm, we determined the size, composition, and phylogeny of the intrahost swarm within primary mosquito isolates from both Texas and California. Results indicate a general trend of decreasing intrahost diversity over time in both locations, with recent isolates being highly genetically homogeneous. Additionally, phylogenic analyses provide detailed information on the relatedness of minority variants both within and among strains and demonstrate how both geographic isolation and seasonal maintenance have shaped the viral swarm. Overall, these data generally provide insight into how time, space, and unique transmission cycles influence the SLEV mutant swarm and how understanding these processes can ultimately lead to a better understanding of arbovirus evolution and epidemiology. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Modelling Hepatitis B Virus Antiviral Therapy and Drug Resistant Mutant Strains

    Science.gov (United States)

    Bernal, Julie; Dix, Trevor; Allison, Lloyd; Bartholomeusz, Angeline; Yuen, Lilly

    Despite the existence of vaccines, the Hepatitis B virus (HBV) is still a serious global health concern. HBV targets liver cells. It has an unusual replication process involving an RNA pre-genome that the reverse transcriptase domain of the viral polymerase protein translates into viral DNA. The reverse transcription process is error prone and together with the high replication rates of the virus, allows the virus to exist as a heterogeneous population of mutants, known as a quasispecies, that can adapt and become resistant to antiviral therapy. This study presents an individual-based model of HBV inside an artificial liver, and associated blood serum, undergoing antiviral therapy. This model aims to provide insights into the evolution of the HBV quasispecies and the individual contribution of HBV mutations in the outcome of therapy.

  19. Glycoprotein cytoplasmic domain sequences required for rescue of a vesicular stomatitis virus glycoprotein mutant

    International Nuclear Information System (INIS)

    Whitt, M.A.; Chong, L.; Rose, J.K.

    1989-01-01

    The authors have used transient expression of the wild-type vesicular stomatitis virus (VSV) glycoprotein (G protein) from cloned cDNA to rescue a temperature-sensitive G protein mutant of VSV in cells at the nonpermissive temperature. Using cDNAs encoding G proteins with deletions in the normal 29-amino-acid cytoplasmic domain, they determined that the presence of either the membrane-proximal 9 amino acids or the membrane-distal 12 amino acids was sufficient for rescue of the temperature-sensitive mutant. G proteins with cytoplasmic domains derived from other cellular or viral G proteins did not rescue the mutant, nor did G proteins with one or three amino acids of the normal cytoplasmic domain. Rescue correlated directly with the ability of the G proteins to be incorporated into virus particles. This was shown by analysis of radiolabeled particles separated on sucrose gradients as well as by electron microscopy of rescued virus after immunogold labeling. Quantitation of surface expression showed that all of the mutated G proteins were expressed less efficiently on the cell surface than was wild-type G protein. However, they were able to correct for differences in rescue efficiency resulting from differences in the level of surface expression by reducing wild-type G protein expression to levels equivalent to those observed for the mutated G proteins. The results provide evidence that at least a portion of the cytoplasmic domain is required for efficient assembly of the VSV G protein into virions during virus budding

  20. Neutralization escape mutants define a dominant immunogenic neutralization site on hepatitis A virus

    International Nuclear Information System (INIS)

    Stapleton, J.T.; Lemon, S.M.

    1987-01-01

    Hepatitis A virus is an hepatotrophic human picornavirus which demonstrates little antigenic variability. To topologically map immunogenic sites on hepatitis A virus which elicit neutralizing antibodies, eight neutralizing monoclonal antibodies were evaluated in competition immunoassays employing radiolabeled monoclonal antibodies and HM-175 virus. Whereas two antibodies (K3-4C8 and K3-2F2) bound to intimately overlapping epitopes, the epitope bound by a third antibody (B5-B3) was distinctly different as evidenced by a lack of competition between antibodies for binding to the virus. The other five antibodies variably blocked the binding of both K3-4C8-K3-2F2 and B5-B3, suggesting that these epitopes are closely spaced and perhaps part of a single neutralization immunogenic site. Several combinations of monoclonal antibodies blocked the binding of polyclonal human convalescent antibody by greater than 96%, indicating that the neutralization epitopes bound by these antibodies are immunodominant in humans. Spontaneously arising HM-175 mutants were selected for resistance to monoclonal antibody-mediated neutralization. Neutralization resistance was associated with reduced antibody binding. These results suggest that hepatitis A virus may differ from poliovirus in possessing a single, dominant neutralization immunogenic site and therefore may be a better candidate for synthetic peptide or antiidiotype vaccine development

  1. Prevalence of precore-defective mutant of hepatitis B virus in HBV carriers.

    Science.gov (United States)

    Niitsuma, H; Ishii, M; Saito, Y; Miura, M; Kobayashi, K; Ohori, H; Toyota, T

    1995-08-01

    Two hundred and seventy-three serum specimens from hepatitis B virus (HBV) carriers were examined for the presence of a characteristic one point mutation at nucleotide (nt) 1896 from the EcoRI site of the HBV genome in the precore region (the preC mutant) using restriction fragment length polymorphism (RFLP) analysis. This assay approach could detect preC mutants or wild-type sequences when either form constituted more than 10% of the total sample. Overall, 65.5% (76/116) of HBeAg-positive carriers had only the preC wild-type. All HBeAg-positive asymptomatic carriers (n = 14) had only the preC wild-type. In patients with chronic hepatitis B and in anti-HBe-positive asymptomatic carriers, increased prevalence of the preC mutant was associated with the development of anti-HBe antibodies and normalization of the serum alanine aminotransferase concentration. Furthermore, 27 (29.0%) of 93 HBeAg-negative carriers had unexpectedly preC wild-type sequences only. Direct sequencing of the HBV precore region of HBV specimens from 24 patients revealed no mutation at nt 1896, supporting the specificity of the RFLP analysis. These results suggest that RFLP analysis was accurate for the detection of the preC mutation and that the absence of serum HBeAg cannot be explained solely by the dominance of the preC mutant.

  2. Attempts to induce mutants resistant or tolerant to golden mosaic virus in dry beans (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    Tulmann Neto, A.; Ando, A.; Costa, A.S.

    1977-01-01

    The golden mosaic of dry beans (Phaseolus vulgaris L.) that is present in the tropical parts of the American continent has become a major hindrance for the cultivation of this food legume of great importance to many Latin America countries. Good control measures are not known and bean germ plasm resistant or tolerant to this virus disease is not yet available. Attempts to induce bean mutants with this desirable characteristic were made using gamma radiation and chemical mutagen. Some M 2 plants from one progeny of the cultivar Carioca treated with 0.48% ethyl methane sulphonate (EMS), 6 hours of treatment at 20 0 C, showed milder symptoms than the control progenies, and at the same time they showed a tendency to recover. This mutant is being tested under field conditions and used in crosses with other bean types that show a certain degree of tolerance, aiming at adding the favourable characters of both parents. Seeds of the hybrids, as well as those of the parent types, are also being further submitted to mutagenic treatments in order to obtain still better mutants that will be satisfactory for direct or indirect control of bean golden mosaic. (author)

  3. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  4. Efficacy of hepatitis B vaccine against antiviral drug-resistant hepatitis B virus mutants in the chimpanzee model.

    Science.gov (United States)

    Kamili, Saleem; Sozzi, Vitini; Thompson, Geoff; Campbell, Katie; Walker, Christopher M; Locarnini, Stephen; Krawczynski, Krzysztof

    2009-05-01

    Hepatitis B virus (HBV) mutants resistant to treatment with nucleoside or nucleotide analogs and those with the ability to escape from HBV-neutralizing antibody have the potential to infect HBV-vaccinated individuals. To address this potential serious public health challenge, we tested the efficacy of immunity induced by a commercial hepatitis B vaccine against a tissue culture-derived, clonal HBV polymerase mutant in HBV seronegative chimpanzees. The polymerase gene mutant contained a combination of three mutations (rtV173L, rtL180M, rtM204V), two of which resulted in changes to the overlapping viral envelope of the hepatitis B surface antigen (sE164D, sI195M). Prior to the HBV mutant challenge of vaccinated chimpanzees, we established virologic, serologic, and pathologic characteristics of infections resulting from intravenous inoculation of the HBV polymerase gene mutant and the sG145R vaccine-escape surface gene mutant. Cloning and sequencing experiments determined that the three mutations in the polymerase gene mutant remained stable and that the single mutation in the surface gene mutant reverted to the wild-type sequence. Immunological evidence of HBV replication was observed in the vaccinated chimpanzees after challenge with the polymerase gene mutant as well as after rechallenge with serum-derived wild-type HBV (5,000 chimpanzee infectious doses administered intravenously), despite robust humoral and cellular anti-HBV immune responses after hepatitis B vaccination. Our data showing successful experimental infection by HBV mutants despite the presence of high anti-HBs levels considered protective in the vaccinated host are consistent with clinical reports on breakthrough infection in anti-HBs-positive patients infected with HBV mutants. In the absence of a protective humoral immunity, adaptive cellular immune responses elicited by infection may limit HBV replication and persistence.

  5. Herpes simplex virus type 1 gene UL14: phenotype of a null mutant and identification of the encoded protein.

    Science.gov (United States)

    Cunningham, C; Davison, A J; MacLean, A R; Taus, N S; Baines, J D

    2000-01-01

    Herpes simplex virus type 1 (HSV-1) gene UL14 is located between divergently transcribed genes UL13 and UL15 and overlaps the promoters for both of these genes. UL14 also exhibits a substantial overlap of its coding region with that of UL13. It is one of the few HSV-1 genes for which a phenotype and protein product have not been described. Using mass spectrometric and immunological approaches, we demonstrated that the UL14 protein is a minor component of the virion tegument of 32 kDa which is expressed late in infection. In infected cells, the UL14 protein was detected in the nucleus at discrete sites within electron-dense nuclear bodies and in the cytoplasm initially in a diffuse distribution and then at discrete sites. Some of the UL14 protein was phosphorylated. A mutant with a 4-bp deletion in the central region of UL14 failed to produce the UL14 protein and generated small plaques. The mutant exhibited an extended growth cycle at low multiplicity of infection and appeared to be compromised in efficient transit of virus particles from the infected cell. In mice injected intracranially, the 50% lethal dose of the mutant was reduced more than 30,000-fold. Recovery of the mutant from the latently infected sacral ganglia of mice injected peripherally was significantly less than that of wild-type virus, suggesting a marked defect in the establishment of, or reactivation from, latent infection.

  6. Peramivir analogues bearing hydrophilic side chains exhibit higher activities against H275Y mutant than wild-type influenza virus.

    Science.gov (United States)

    Chiu, Din-Chi; Lin, Tzu-Chen; Huang, Wen-I; Cheng, Ting-Jen; Tsai, Keng-Chang; Fang, Jim-Min

    2017-11-29

    Peramivir is an effective anti-influenza drug in the clinical treatment of influenza, but its efficacy toward the H275Y mutant is reduced. The previously reported cocrystal structures of inhibitors in the mutant neuraminidase (NA) suggest that the hydrophobic side chain should be at the origin of reduced binding affinity. In contrast, zanamivir having a hydrophilic glycerol side chain still possesses high affinity toward the H275Y NA. We thus designed five peramivir analogues (5-9) carrying hydrophilic glycol or glycerol side chains, and evaluated their roles in anti-influenza activity, especially for the H275Y mutant. The synthetic sequence involves a key step of (3 + 2) cycloaddition reactions between alkenes and nitrile oxides to construct the scaffold of peramivir carrying the desired hydrophilic side chains and other appropriate functional groups. The molecular docking experiments reveal that the hydrophilic side chain can provide extra hydrogen bonding with the translocated Glu-276 residue in the H275Y NA active site. Thus, the H275Y mutant may be even more sensitive than wild-type virus toward the peramivir analogues bearing hydrophilic side chains. Notably, the peramivir analogue bearing a glycerol side chain inhibits the H275Y mutant with an IC 50 value of 35 nM, which is better than the WSN virus by 9 fold.

  7. Identification and molecular characterization of a naturally occurring RNA virus mutant defective in the initiation of host recovery

    International Nuclear Information System (INIS)

    Xin Hongwu; Ding Shouwei

    2003-01-01

    The host recovery response is characterized by the disappearance of disease symptoms and activation of the RNA silencing virus resistance in the new growth following an initial symptomatic infection. However, it is not clear what triggers the initiation of recovery, which occurs naturally only in some virus-host interactions. Here we report the identification and characterization of a spontaneous mutant of Tobacco streak virus (TSV) that became defective in triggering recovery in tobacco plants. Infectious full-length cDNA clones corresponding to the tripartite RNA genome were constructed from both the wild-type and the nonrecovery mutant of TSV (TSVnr), the first sets of infectious cDNA clones from an Ilarvirus. Genetic and molecular analyses identified an A → G mutation in the TSVnr genome that was sufficient to confer nonrecovery when introduced into TSV. The mutation was located in the intergenic region of RNA 3 upstream of the mapped transcriptional start site of the coat protein mRNA. Intriguingly, induction of recovery by TSV was not accompanied by virus clearance and TSV consistently accumulated to significantly higher levels than TSVnr did even though TSVnr-infected plants displayed severe symptoms throughout the course of infection. Thus, our findings indicate that recovery of host can be initiated by minimal genetic changes in a viral genome and may occur in the absence of virus clearance. Mechanisms possibly involved in the initiation of host recovery are discussed

  8. The Shift of the Intestinal Microbiome in the Innate Immunity-Deficient Mutant rde-1 Strain of C. elegans upon Orsay Virus Infection

    Directory of Open Access Journals (Sweden)

    Yuanyuan Guo

    2017-05-01

    Full Text Available The status of intestinal microbiota is a determinant of host health. However, the alteration of the gut microbiota caused by the innate immune response to virus infection is unclear. Caenorhabditis elegans and its natural virus Orsay provide an excellent model of host–virus interactions. We evaluated the intestinal microbial community complexity of the wild-type N2 and the innate immunity-deficient mutant rde-1 (ne219 strains of C. elegans upon Orsay virus infection. The gut microbiota diversity was decreased in rde-1 (ne219 mutant animals, and a large number of genes were associated with the difference between infected and uninfected rde-1 (ne219 mutant animals. Therefore, this study provides the first evaluation of the alterations caused by Orsay virus on intestinal microbiota in wildtype and innate immunity-deficient animals using C. elegans as the model species. Our findings indicate that virus infection may alters the microbiome in animals with defective immune response.

  9. The Shift of the Intestinal Microbiome in the Innate Immunity-Deficient Mutant rde-1 Strain of C. elegans upon Orsay Virus Infection.

    Science.gov (United States)

    Guo, Yuanyuan; Xun, Zhe; Coffman, Stephanie R; Chen, Feng

    2017-01-01

    The status of intestinal microbiota is a determinant of host health. However, the alteration of the gut microbiota caused by the innate immune response to virus infection is unclear. Caenorhabditis elegans and its natural virus Orsay provide an excellent model of host-virus interactions. We evaluated the intestinal microbial community complexity of the wild-type N2 and the innate immunity-deficient mutant rde-1 ( ne219 ) strains of C. elegans upon Orsay virus infection. The gut microbiota diversity was decreased in rde-1 ( ne219 ) mutant animals, and a large number of genes were associated with the difference between infected and uninfected rde-1 ( ne219 ) mutant animals. Therefore, this study provides the first evaluation of the alterations caused by Orsay virus on intestinal microbiota in wildtype and innate immunity-deficient animals using C. elegans as the model species. Our findings indicate that virus infection may alters the microbiome in animals with defective immune response.

  10. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    Science.gov (United States)

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  11. An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

    International Nuclear Information System (INIS)

    Geller, A.I.; Keyomarsi, K.; Bryan, J.; Pardee, A.B.

    1990-01-01

    The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli β-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; ts mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses β-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system

  12. UV irradiation analysis of complementation between, and replication of, RNA-negative temperature-sensitivie mutants of Newcastle disease virus

    International Nuclear Information System (INIS)

    Peeples, M.E.; Bratt, M.A.

    1982-01-01

    Random uv irradiation-induced lesions destroy the infectivity of Newcastle disease virus (NDV) by blocking downstream transcription from the single viral promoter. The nucleocapsid-associated polypeptides most likely to be involved in RNA synthesis are located at the extreme ends of the genome: NP and P are promoter proximal genes, and L is the most distal gene. We attempted to order the two temperature-sensitive (ts) RNA-negative (RNA-) mutant groups of NDV by determining the uv target sizes for the complementing abilities of mutants A1 and E1. After uv irradiation, E1 was unable to complement A1, a result compatible with the A mutation lying in the L gene. In contrast, after uv irradiation A1 was able to complement E1 for both virus production and viral protein synthesis, with a target size most consistent with the E mutation lying in the P gene. UV-irradiated virus was unable to replicate as indicated by its absence in the yields of multiply infected cells, either as infectious virus or as particles with complementing activity. After irradiation, ts mutant B1ΔP, with a non-ts mutation affecting the electrophoretic mobility of the P protein, complemented E1 in a manner similar to A1, but it did not amplify the expression of ΔP in infected cells. This too is consistent with irradiated virus being unable to replicate despite the presence of the components needed for replication of E1. At high uv doses, A1 was able to complement E1 in a different, uv-resistant manner, probably by direct donation of input polypeptides. Multiplicity reactivation has previously been observed at high-multiplicity infection by uv-irradiated paramyxoviruses. In this case, virions which are noninfectious because they lack a protein component may be activated by a protein from irradiated virions

  13. Infidelity of SARS-CoV Nsp14-exonuclease mutant virus replication is revealed by complete genome sequencing.

    Directory of Open Access Journals (Sweden)

    Lance D Eckerle

    2010-05-01

    Full Text Available Most RNA viruses lack the mechanisms to recognize and correct mutations that arise during genome replication, resulting in quasispecies diversity that is required for pathogenesis and adaptation. However, it is not known how viruses encoding large viral RNA genomes such as the Coronaviridae (26 to 32 kb balance the requirements for genome stability and quasispecies diversity. Further, the limits of replication infidelity during replication of large RNA genomes and how decreased fidelity impacts virus fitness over time are not known. Our previous work demonstrated that genetic inactivation of the coronavirus exoribonuclease (ExoN in nonstructural protein 14 (nsp14 of murine hepatitis virus results in a 15-fold decrease in replication fidelity. However, it is not known whether nsp14-ExoN is required for replication fidelity of all coronaviruses, nor the impact of decreased fidelity on genome diversity and fitness during replication and passage. We report here the engineering and recovery of nsp14-ExoN mutant viruses of severe acute respiratory syndrome coronavirus (SARS-CoV that have stable growth defects and demonstrate a 21-fold increase in mutation frequency during replication in culture. Analysis of complete genome sequences from SARS-ExoN mutant viral clones revealed unique mutation sets in every genome examined from the same round of replication and a total of 100 unique mutations across the genome. Using novel bioinformatic tools and deep sequencing across the full-length genome following 10 population passages in vitro, we demonstrate retention of ExoN mutations and continued increased diversity and mutational load compared to wild-type SARS-CoV. The results define a novel genetic and bioinformatics model for introduction and identification of multi-allelic mutations in replication competent viruses that will be powerful tools for testing the effects of decreased fidelity and increased quasispecies diversity on viral replication

  14. Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development.

    Science.gov (United States)

    Puckette, Michael; Clark, Benjamin A; Smith, Justin D; Turecek, Traci; Martel, Erica; Gabbert, Lindsay; Pisano, Melia; Hurtle, William; Pacheco, Juan M; Barrera, José; Neilan, John G; Rasmussen, Max

    2017-11-15

    The foot-and-mouth disease virus (FMDV) afflicts livestock in more than 80 countries, limiting food production and global trade. Production of foot-and-mouth disease (FMD) vaccines requires cytosolic expression of the FMDV 3C protease to cleave the P1 polyprotein into mature capsid proteins, but the FMDV 3C protease is toxic to host cells. To identify less-toxic isoforms of the FMDV 3C protease, we screened 3C mutants for increased transgene output in comparison to wild-type 3C using a Gaussia luciferase reporter system. The novel point mutation 3C(L127P) increased yields of recombinant FMDV subunit proteins in mammalian and bacterial cells expressing P1-3C transgenes and retained the ability to process P1 polyproteins from multiple FMDV serotypes. The 3C(L127P) mutant produced crystalline arrays of FMDV-like particles in mammalian and bacterial cells, potentially providing a practical method of rapid, inexpensive FMD vaccine production in bacteria. IMPORTANCE The mutant FMDV 3C protease L127P significantly increased yields of recombinant FMDV subunit antigens and produced virus-like particles in mammalian and bacterial cells. The L127P mutation represents a novel advancement for economical FMD vaccine production. Copyright © 2017 Puckette et al.

  15. Crystallization of mutants of Turnip yellow mosaic virus protease/ubiquitin hydrolase designed to prevent protease self-recognition.

    Science.gov (United States)

    Ayach, Maya; Bressanelli, Stéphane

    2015-04-01

    Processing of the polyprotein of Turnip yellow mosaic virus is mediated by the protease PRO. PRO cleaves at two places, one of which is at the C-terminus of the PRO domain of another polyprotein molecule. In addition to this processing activity, PRO possesses an ubiquitin hydrolase (DUB) activity. The crystal structure of PRO has previously been reported in its polyprotein-processing mode with the C-terminus of one PRO inserted into the catalytic site of the next PRO, generating PRO polymers in the crystal packing of the trigonal space group. Here, two mutants designed to disrupt specific PRO-PRO interactions were generated, produced and purified. Crystalline plates were obtained by seeding and cross-seeding from initial `sea urchin'-like microcrystals of one mutant. The plates diffracted to beyond 2 Å resolution at a synchrotron source and complete data sets were collected for the two mutants. Data processing and analysis indicated that both mutant crystals belonged to the same monoclinic space group, with two molecules of PRO in the asymmetric unit.

  16. Live Cell Analysis and Mathematical Modeling Identify Determinants of Attenuation of Dengue Virus 2'-O-Methylation Mutant.

    Directory of Open Access Journals (Sweden)

    Bianca Schmid

    2015-12-01

    Full Text Available Dengue virus (DENV is the most common mosquito-transmitted virus infecting ~390 million people worldwide. In spite of this high medical relevance, neither a vaccine nor antiviral therapy is currently available. DENV elicits a strong interferon (IFN response in infected cells, but at the same time actively counteracts IFN production and signaling. Although the kinetics of activation of this innate antiviral defense and the timing of viral counteraction critically determine the magnitude of infection and thus disease, quantitative and kinetic analyses are lacking and it remains poorly understood how DENV spreads in IFN-competent cell systems. To dissect the dynamics of replication versus antiviral defense at the single cell level, we generated a fully viable reporter DENV and host cells with authentic reporters for IFN-stimulated antiviral genes. We find that IFN controls DENV infection in a kinetically determined manner that at the single cell level is highly heterogeneous and stochastic. Even at high-dose, IFN does not fully protect all cells in the culture and, therefore, viral spread occurs even in the face of antiviral protection of naïve cells by IFN. By contrast, a vaccine candidate DENV mutant, which lacks 2'-O-methylation of viral RNA is profoundly attenuated in IFN-competent cells. Through mathematical modeling of time-resolved data and validation experiments we show that the primary determinant for attenuation is the accelerated kinetics of IFN production. This rapid induction triggered by mutant DENV precedes establishment of IFN-resistance in infected cells, thus causing a massive reduction of virus production rate. In contrast, accelerated protection of naïve cells by paracrine IFN action has negligible impact. In conclusion, these results show that attenuation of the 2'-O-methylation DENV mutant is primarily determined by kinetics of autocrine IFN action on infected cells.

  17. Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease.

    Science.gov (United States)

    Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P

    2015-05-01

    Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.

  18. Transmission of Hemagglutinin D222G Mutant Strain of Pandemic (H1N1) 2009 Virus

    Science.gov (United States)

    Facchini, Marzia; Spagnolo, Domenico; De Marco, Maria A.; Calzoletti, Laura; Zanetti, Alessandro; Fumagalli, Roberto; Tanzi, Maria L.; Cassone, Antonio; Rezza, Giovanni; Donatelli, Isabella

    2010-01-01

    A pandemic (H1N1) 2009 virus strain carrying the D222G mutation was identified in a severely ill man and was transmitted to a household contact. Only mild illness developed in the contact, despite his obesity and diabetes. The isolated virus reacted fully with an antiserum against the pandemic vaccine strain. PMID:20409386

  19. Immunogenicity in African Green Monkeys of M Protein Mutant Vesicular Stomatitis Virus Vectors and Contribution of Vector-Encoded Flagellin

    Directory of Open Access Journals (Sweden)

    Marlena M. Westcott

    2018-03-01

    Full Text Available Recombinant vesicular stomatitis virus (VSV is a promising platform for vaccine development. M51R VSV, an attenuated, M protein mutant strain, is an effective inducer of Type I interferon and dendritic cell (DC maturation, which are desirable properties to exploit for vaccine design. We have previously evaluated M51R VSV (M51R and M51R VSV that produces flagellin (M51R-F as vaccine vectors using murine models, and found that flagellin enhanced DC activation and VSV-specific antibody production after low-dose vaccination. In this report, the immunogenicity of M51R vectors and the adjuvant effect of virus-produced flagellin were evaluated in nonhuman primates following high-dose (108 pfu and low-dose (105 pfu vaccination. A single intramuscular vaccination of African green monkeys with M51R or M51R-F induced VSV-specific, dose-dependent humoral immune responses. Flagellin induced a significant increase in antibody production (IgM, IgG and neutralizing antibody at the low vaccination dose. A VSV-specific cellular response was detected at 6 weeks post-vaccination, but was neither dose-dependent nor enhanced by flagellin; similar numbers of VSV-specific, IFNγ-producing cells were detected in lymph node and spleen of all animals. These results indicate that virus-directed, intracellular flagellin production may improve VSV-based vaccines encoding heterologous antigens by lowering the dose required to achieve humoral immunity.

  20. Complementation and recombination between alfalfa mosaic virus RNA3 mutants in tobacco plants

    NARCIS (Netherlands)

    van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.

    1991-01-01

    Deletions were made in an infectious cDNA clone of alfalfa mosaic virus (AIMV) RNA3 and the replication of RNA transcripts of these cDNAs was studied in tobacco plants transformed with AIMV replicase genes (P12 plants). Previously, we found that deletions in the P3 gene did not affect accumulation

  1. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    Science.gov (United States)

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  2. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    Science.gov (United States)

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  3. PE2 cleavage mutants of Sindbis virus : Correlation between viral infectivity and pH-dependent membrane fusion activation of the spike heterodimer

    NARCIS (Netherlands)

    Smit, JM; Klimstra, WB; Ryman, KD; Bittman, R; Johnston, RE; Wilschut, J

    2001-01-01

    The spike glycoprotein E2 of Sindbis virus (SIN) is synthesized in the infected cell as a PE2 precursor protein, which matures through cleavage by a cellular furin-like protease. Previous work has shown that SIN mutants impaired in PE2 cleavage are noninfectious on BHK-21 cells, the block in

  4. Prolonged protection against Intranasal challenge with influenza virus following systemic immunization or combinations of mucosal and systemic immunizations with a heat-labile toxin mutant.

    Science.gov (United States)

    Zhou, Fengmin; Goodsell, Amanda; Uematsu, Yasushi; Vajdy, Michael

    2009-04-01

    Seasonal influenza virus infections cause considerable morbidity and mortality in the world, and there is a serious threat of a pandemic influenza with the potential to cause millions of deaths. Therefore, practical influenza vaccines and vaccination strategies that can confer protection against intranasal infection with influenza viruses are needed. In this study, we demonstrate that using LTK63, a nontoxic mutant of the heat-labile toxin from Escherichia coli, as an adjuvant for both mucosal and systemic immunizations, systemic (intramuscular) immunization or combinations of mucosal (intranasal) and intramuscular immunizations protected mice against intranasal challenge with a lethal dose of live influenza virus at 3.5 months after the second immunization.

  5. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  6. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  7. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  8. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  9. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  10. Correction of mutant Fanconi anemia gene by homologous recombination in human hematopoietic cells using adeno-associated virus vector.

    Science.gov (United States)

    Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke

    2009-11-01

    Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.

  11. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  12. Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells.

    OpenAIRE

    Wang, F; Marchini, A; Kieff, E

    1991-01-01

    The objective of these experiments was to develop strategies for creation and identification of recombinant mutant Epstein-Barr viruses (EBV). EBV recombinant molecular genetics has been limited to mutations within a short DNA segment deleted from a nontransforming EBV and an underlying strategy which relies on growth transformation of primary B lymphocytes for identification of recombinants. Thus, mutations outside the deletion or mutations which affect transformation cannot be easily recove...

  13. Deletions of the hypervariable region (HVR) in open reading frame 1 of hepatitis E virus do not abolish virus infectivity: evidence for attenuation of HVR deletion mutants in vivo.

    Science.gov (United States)

    Pudupakam, R S; Huang, Y W; Opriessnig, T; Halbur, P G; Pierson, F W; Meng, X J

    2009-01-01

    Hepatitis E virus (HEV) is an important human pathogen, although little is known about its biology and replication. Comparative sequence analysis revealed a hypervariable region (HVR) with extensive sequence variations in open reading frame 1 of HEV. To elucidate the role of the HVR in HEV replication, we first constructed two HVR deletion mutants, hHVRd1 and hHVRd2, with in-frame deletion of amino acids (aa) 711 to 777 and 747 to 761 in the HVR of a genotype 1 human HEV replicon. Evidence of HEV replication was detected in Huh7 cells transfected with RNA transcripts from mutant hHVRd2, as evidenced by expression of enhanced green fluorescent protein. To confirm the in vitro results, we constructed three avian HEV mutants with various HVR deletions: mutants aHVRd1, with deletion of aa 557 to 585 (Delta557-585); aHVRd2 (Delta612-641); and aHVRd3 (Delta557-641). Chickens intrahepatically inoculated with capped RNA transcripts from mutants aHVRd1 and aHVRd2 developed active viral infection, as evidenced by seroconversion, viremia, and fecal virus shedding, although mutant aHVRd3, with complete HVR deletion, was apparently attenuated in chickens. To further verify the results, we constructed four additional HVR deletion mutants using the genotype 3 swine HEV as the backbone. Mutants sHVRd2 (Delta722-781), sHVRd3 (Delta735-765), and sHVRd4 (Delta712-765) were shown to tolerate deletions and were infectious in pigs intrahepatically inoculated with capped RNA transcripts from the mutants, whereas mutant sHVRd1 (Delta712-790), with a nearly complete HVR deletion, exhibited an attenuation phenotype in infected pigs. The data from these studies indicate that deletions in HVR do not abolish HEV infectivity in vitro or in vivo, although evidence for attenuation was observed for HEV mutants with a larger or nearly complete HVR deletion.

  14. Decreased reactivation of a herpes simplex virus type 1 (HSV-1) latency associated transcript (LAT) mutant using the in vivo mouse UV-B model of induced reactivation

    Science.gov (United States)

    BenMohamed, Lbachir; Osorio, Nelson; Srivastava, Ruchi; Khan, Arif A.; Simpson, Jennifer L.; Wechsler, Steven L.

    2015-01-01

    Blinding ocular herpetic disease in humans is due to herpes simplex virus type 1 (HSV-1) reactivations from latency, rather than to primary acute infection. The cellular and molecular mechanisms that control the HSV-1 latency-reactivation cycle remain to be fully elucidated. The aim of this study was to determine if reactivation of the HSV-1 latency associated transcript (LAT) deletion mutant (dLAT2903) was impaired in this model, as it is in the rabbit model of induced and spontaneous reactivation and in the explant TG induced reactivation model in mice. The eyes of mice latently infected with wild type HSV-1 strain McKrae (LAT(+) virus) or dLAT2903 (LAT(−) virus) were irradiated with UV-B and reactivation was determined. We found that compared to LAT(−) virus, LAT(+) virus reactivated at a higher rate as determined by shedding of virus in tears on days 3 to 7 after UV-B treatment. Thus, the UV-B induced reactivation model of HSV-1 appears to be a useful small animal model for studying the mechanisms involved in how LAT enhances the HSV-1 reactivation phenotype. The utility of the model for investigating the immune evasion mechanisms regulating the HSV-1 latency/reactivation cycle and for testing the protective efficacy of candidate therapeutic vaccines and drugs are discussed. PMID:26002839

  15. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    Science.gov (United States)

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional

  16. Generation of herpesvirus entry mediator (HVEM)-restricted herpes simplex virus type 1 mutant viruses: resistance of HVEM-expressing cells and identification of mutations that rescue nectin-1 recognition.

    Science.gov (United States)

    Uchida, Hiroaki; Shah, Waris A; Ozuer, Ali; Frampton, Arthur R; Goins, William F; Grandi, Paola; Cohen, Justus B; Glorioso, Joseph C

    2009-04-01

    Both initial infection and cell-to-cell spread by herpes simplex virus type 1 (HSV-1) require the interaction of the viral glycoprotein D (gD) with an entry receptor on the cell surface. The two major HSV entry receptors, herpesvirus entry mediator (HVEM) and nectin-1, mediate infection independently but are coexpressed on a variety of cells. To determine if both receptors are active in these instances, we have established mutant viruses that are selectively impaired for recognition of one or the other receptor. In plaque assays, these viruses showed approximately 1,000-fold selectivity for the matched receptor over the mismatched receptor. Separate assays showed that each virus is impaired for both infection and spread through the mismatched receptor. We tested several human tumor cell lines for susceptibility to these viruses and observed that HT29 colon carcinoma cells are susceptible to infection by nectin-1-restricted virus but are highly resistant to HVEM-restricted virus infection, despite readily detectable HVEM expression on the cell surface. HVEM cDNA isolated from HT29 cells rendered HSV-resistant cells permissive for infection by the HVEM-restricted virus, suggesting that HT29 cells lack a cofactor for HVEM-mediated infection or express an HVEM-specific inhibitory factor. Passaging of HVEM-restricted virus on nectin-1-expressing cells yielded a set of gD missense mutations that each restored functional recognition of nectin-1. These mutations identify residues that likely play a role in shaping the nectin-1 binding site of gD. Our findings illustrate the utility of these receptor-restricted viruses in studying the early events in HSV infection.

  17. Induction of sustained hypercholesterolemia by single adeno-associated virus-mediated gene transfer of mutant hPCSK9.

    Science.gov (United States)

    Roche-Molina, Marta; Sanz-Rosa, David; Cruz, Francisco M; García-Prieto, Jaime; López, Sergio; Abia, Rocío; Muriana, Francisco J G; Fuster, Valentín; Ibáñez, Borja; Bernal, Juan A

    2015-01-01

    Patients with mutations in the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene have hypercholesterolemia and are at high risk of adverse cardiovascular events. We aimed to stably express the pathological human D374Y gain-of-function mutant form of PCSK9 (PCSK9(DY)) in adult wild-type mice to generate a hyperlipidemic and proatherogenic animal model, achieved with a single systemic injection with adeno-associated virus (AAV). We constructed an AAV-based vector to support targeted transfer of the PCSK9(DY) gene to liver. After injection with 3.5×10(10) viral particles, mice in the C57BL/6J, 129/SvPasCrlf, or FVB/NCrl backgrounds developed long-term hyperlipidemia with a strong increase in serum low-density lipoprotein. Macroscopic and histological analysis showed atherosclerotic lesions in the aortas of AAV-PCSK9(DY) mice fed a high-fat-diet. Advanced lesions in these high-fat-diet-fed mice also showed evidence of macrophage infiltration and fibrous cap formation. Hepatic AAV-PCSK9(DY) infection did not result in liver damage or signs of immunologic response. We further tested the use of AAV-PCSK9(DY) to study potential genetic interaction with the ApoE gene. Histological analysis of ApoE(-/-) AAV-PCSK9(DY) mice showed a synergistic response to ApoE deficiency, with aortic lesions twice as extensive in ApoE(-/-) AAV-PCSK9(DY)-transexpressing mice as in ApoE(-/-) AAV-Luc controls without altering serum cholesterol levels. Single intravenous AAV-PCSK9(DY) injection is a fast, easy, and cost-effective approach, resulting in rapid and long-term sustained hyperlipidemia and atherosclerosis. We demonstrate as a proof of concept the synergy between PCSK9(DY) gain-of-function and ApoE deficiency. This methodology could allow testing of the genetic interaction of several mutations without the need for complex and time-consuming backcrosses. © 2014 American Heart Association, Inc.

  18. Filament-producing mutants of influenza A/Puerto Rico/8/1934 (H1N1 virus have higher neuraminidase activities than the spherical wild-type.

    Directory of Open Access Journals (Sweden)

    Jill Seladi-Schulman

    Full Text Available Influenza virus exhibits two morphologies - spherical and filamentous. Strains that have been grown extensively in laboratory substrates are comprised predominantly of spherical virions while clinical or low passage isolates produce a mixture of spheres and filamentous virions of varying lengths. The filamentous morphology can be lost upon continued passage in embryonated chicken eggs, a common laboratory substrate for influenza viruses. The fact that the filamentous morphology is maintained in nature but lost in favor of a spherical morphology in ovo suggests that filaments confer a selective advantage within the infected host that is not necessary for growth in laboratory substrates. Indeed, we have recently shown that filament-producing variant viruses are selected upon passage of the spherical laboratory strain A/Puerto Rico/8/1934 (H1N1 [PR8] in guinea pigs. Toward determining the nature of the selective advantage conferred by filaments, we sought to identify functional differences between spherical and filamentous particles. We compared the wild-type PR8 virus to two previously characterized recombinant PR8 viruses in which single point mutations within M1 confer a filamentous morphology. Our results indicate that these filamentous PR8 mutants have higher neuraminidase activities than the spherical PR8 virus. Conversely, no differences were observed in HAU:PFU or HAU:RNA ratios, binding avidity, sensitivity to immune serum in hemagglutination inhibition assays, or virion stability at elevated temperatures. Based on these results, we propose that the pleomorphic nature of influenza virus particles is important for the optimization of neuraminidase functions in vivo.

  19. Mutations in the Schmallenberg Virus Gc Glycoprotein Facilitate Cellular Protein Synthesis Shutoff and Restore Pathogenicity of NSs Deletion Mutants in Mice.

    Science.gov (United States)

    Varela, Mariana; Pinto, Rute Maria; Caporale, Marco; Piras, Ilaria M; Taggart, Aislynn; Seehusen, Frauke; Hahn, Kerstin; Janowicz, Anna; de Souza, William Marciel; Baumgärtner, Wolfgang; Shi, Xiaohong; Palmarini, Massimo

    2016-06-01

    Serial passage of viruses in cell culture has been traditionally used to attenuate virulence and identify determinants of viral pathogenesis. In a previous study, we found that a strain of Schmallenberg virus (SBV) serially passaged in tissue culture (termed SBVp32) unexpectedly displayed increased pathogenicity in suckling mice compared to wild-type SBV. In this study, we mapped the determinants of SBVp32 virulence to the viral genome M segment. SBVp32 virulence is associated with the capacity of this virus to reach high titers in the brains of experimentally infected suckling mice. We also found that the Gc glycoprotein, encoded by the M segment of SBVp32, facilitates host cell protein shutoff in vitro Interestingly, while the M segment of SBVp32 is a virulence factor, we found that the S segment of the same virus confers by itself an attenuated phenotype to wild-type SBV, as it has lost the ability to block the innate immune system of the host. Single mutations present in the Gc glycoprotein of SBVp32 are sufficient to compensate for both the attenuated phenotype of the SBVp32 S segment and the attenuated phenotype of NSs deletion mutants. Our data also indicate that the SBVp32 M segment does not act as an interferon (IFN) antagonist. Therefore, SBV mutants can retain pathogenicity even when they are unable to fully control the production of IFN by infected cells. Overall, this study suggests that the viral glycoprotein of orthobunyaviruses can compensate, at least in part, for the function of NSs. In addition, we also provide evidence that the induction of total cellular protein shutoff by SBV is determined by multiple viral proteins, while the ability to control the production of IFN maps to the NSs protein. The identification of viral determinants of pathogenesis is key to the development of prophylactic and intervention measures. In this study, we found that the bunyavirus Gc glycoprotein is a virulence factor. Importantly, we show that mutations in the Gc

  20. Herpes simplex virus mutant generation and dual-detection methods for gaining insight into latent/lytic cycles in vivo.

    Science.gov (United States)

    Sawtell, Nancy M; Thompson, Richard L

    2014-01-01

    Two important components to a useful strategy to examine viral gene regulation in vivo are (1) a highly efficient protocol to generate viral mutants that limits undesired mutation and retains full replication competency in vivo and (2) an efficient system to detect and quantify viral promoter activity in rare cells in vivo. Our strategy and protocols for generating, characterizing, and employing HSV viral promoter/reporter mutants in vivo are provided in this two-part chapter.

  1. Characterization of a thymidine kinase-deficient mutant of equine herpesvirus 4 and in vitro susceptibility of the virus to antiviral agents.

    Science.gov (United States)

    Azab, Walid; Tsujimura, Koji; Kato, Kentaro; Arii, Jun; Morimoto, Tomomi; Kawaguchi, Yasushi; Tohya, Yukinobu; Matsumura, Tomio; Akashi, Hiroomi

    2010-02-01

    Equine herpesvirus 4 (EHV-4) is an important equine pathogen that causes respiratory tract disease among horses worldwide. A thymidine kinase (TK)-deletion mutant has been generated by using bacterial artificial chromosome (BAC) technology to investigate the role of TK in pathogenesis. Deletion of TK had virtually no effect on the growth characteristics of WA79DeltaTK in cell culture when compared to the parent virus. Also, virus titers and plaque formation were unaffected in the absence of the TK gene. The sensitivity of EHV-4 to inhibition by acyclovir (ACV) and ganciclovir (GCV) was studied by means of a plaque reduction assay. GCV proved to be more potent and showed a superior anti-EHV-4 activity. On the other hand, ACV showed very poor ability to inhibit EHV-4 replication. As predicted, WA79DeltaTK was insensitive to GCV. Although EHV-4 is normally insensitive to ACV, it showed >20-fold increase in sensitivity when the equine herpesvirus-1 (EHV-1) TK was supplied in trans. Furthermore, both ACV and GCV resulted in a significant reduction of plaque size induced by EHV-4 and 1. Taken together, these data provided direct evidence that GCV is a potent selective inhibitor of EHV-4 and that the virus-encoded TK is an important determinant of the virus susceptibility to nucleoside analogues. Copyright 2009 Elsevier B.V. All rights reserved.

  2. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  3. Evaluation of the G145R Mutant of the Hepatitis B Virus as a Minor Strain in Mother-to-Child Transmission.

    Directory of Open Access Journals (Sweden)

    Haruki Komatsu

    Full Text Available The role of the hepatitis B virus (HBV mutant G145R, with a single change in amino acid 145 of the surface protein, as a minor population remains unknown in mother-to-child transmission. The minor strain as well as the major strain of the G145R mutant were evaluated in three cohorts using a locked nucleic acid probe-based real-time PCR. The breakthrough cohort consisted of children who were born to HBV carrier mothers and became HBV carriers despite immnoprophylaxis (n = 25. The control cohort consisted of HBV carriers who had no history of receiving the hepatitis B vaccine, hepatitis B immunoglobulin or antiviral treatment (n = 126. The pregnant cohort comprised pregnant women with chronic HBV infection (n = 31. In the breakthrough cohort, 6 showed positive PCR results (major, 2; minor, 4. In the control cohort, 13 showed positive PCR results (major, 0; minor, 13. HBeAg-positive patients were prone to have the G145R mutant as a minor population. Deep sequencing was performed in a total of 32 children (PCR positive, n = 13; negative, n = 19. In the breakthrough cohort, the frequency of the G145R mutant ranged from 0.54% to 6.58%. In the control cohort, the frequency of the G145R mutant ranged from 0.42% to 4.1%. Of the 31 pregnant women, 4 showed positive PCR results (major, n = 0; minor, n = 4. All of the pregnant women were positive for HBeAg and showed a high viral load. Three babies born to 3 pregnant women with the G145R mutant were evaluated. After the completion of immunoprophylaxis, 2 infants became negative for HBsAg. The remaining infant became negative for HBsAg after the first dose of HB vaccine. G145R was detected in one-fourth of the children with immunoprophylaxis failure. However, the pre-existence of the G145R mutant as a minor population in pregnant women does not always cause breakthrough infection in infants.

  4. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  5. Novel rabies virus-neutralizing epitope recognized by human monoclonal antibody: Fine mapping and escape mutant analysis

    NARCIS (Netherlands)

    Marissen, W.E.; Kramer, R.A.; Rice, A.; Weldon, W.C.; Niezgoda, M.; Faber, M.; Slootstra, J.W.; Meloen, R.H.; Clijsters-van der Horst, M.; Visser, T.J.; Jongeneelen, M.; Thijsse, S.; Throsby, M.; Kruif, de J.; Rupprecht, C.E.; Dietzschold, B.; Goudsmit, J.; Bakker, A.B.H.

    2005-01-01

    Anti-rabies virus immunoglobulin combined with rabies vaccine protects humans from lethal rabies infections. For cost and safety reasons, replacement of the human or equine polyclonal immunoglobulin is advocated, and the use of rabies virus-specific monoclonal antibodies (MAbs) is recommended. We

  6. Novel rabies virus-neutralizing epitope recognized by human monoclonal antibody: fine mapping and escape mutant analysis

    NARCIS (Netherlands)

    Marissen, Wilfred E.; Kramer, R. Arjen; Rice, Amy; Weldon, William C.; Niezgoda, Michael; Faber, Milosz; Slootstra, Jerry W.; Meloen, Rob H.; Clijsters-van der Horst, Marieke; Visser, Therese J.; Jongeneelen, Mandy; Thijsse, Sandra; Throsby, Mark; de Kruif, John; Rupprecht, Charles E.; Dietzschold, Bernhard; Goudsmit, Jaap; Bakker, Alexander B. H.

    2005-01-01

    Anti-rabies virus immunoglobulin combined with rabies vaccine protects humans from lethal rabies infections. For cost and safety reasons, replacement of the human or equine polyclonal immunoglobulin is advocated, and the use of rabies virus-specific monoclonal antibodies (MAbs) is recommended. We

  7. Structural characterization of respiratory syncytial virus fusion inhibitor escape mutants: homology model of the F protein and a syncytium formation assay

    International Nuclear Information System (INIS)

    Morton, Craig J.; Cameron, Rachel; Lawrence, Lynne J.; Lin Bo; Lowe, Melinda; Luttick, Angela; Mason, Anthony; McKimm-Breschkin, Jenny; Parker, Michael W.; Ryan, Jane; Smout, Michael; Sullivan, Jayne; Tucker, Simon P.; Young, Paul R.

    2003-01-01

    Respiratory syncytial virus (RSV) is a ubiquitous human pathogen and the leading cause of lower respiratory tract infections in infants. Infection of cells and subsequent formation of syncytia occur through membrane fusion mediated by the RSV fusion protein (RSV-F). A novel in vitro assay of recombinant RSV-F function has been devised and used to characterize a number of escape mutants for three known inhibitors of RSV-F that have been isolated. Homology modeling of the RSV-F structure has been carried out on the basis of a chimera derived from the crystal structures of the RSV-F core and a fragment from the orthologous fusion protein from Newcastle disease virus (NDV). The structure correlates well with the appearance of RSV-F in electron micrographs, and the residues identified as contributing to specific binding sites for several monoclonal antibodies are arranged in appropriate solvent-accessible clusters. The positions of the characterized resistance mutants in the model structure identify two promising regions for the design of fusion inhibitors

  8. Three Herpes Simplex Virus Type 1 Latency-Associated Transcript Mutants with Distinct and Asymmetric Effects on Virulence in Mice Compared with Rabbits

    Science.gov (United States)

    Perng, Guey-Chuen; Esmaili, Daniel; Slanina, Susan M.; Yukht, Ada; Ghiasi, Homayon; Osorio, Nelson; Mott, Kevin R.; Maguen, Barak; Jin, Ling; Nesburn, Anthony B.; Wechsler, Steven L.

    2001-01-01

    Herpes simplex virus type 1 latency-associated transcript (LAT)-null mutants have decreased reactivation but normal virulence in rabbits and mice. We report here on dLAT1.5, a mutant with LAT nucleotides 76 to 1667 deleted. Following ocular infection of rabbits, dLAT1.5 reactivated at a lower rate than its wild-type parent McKrae (6.1 versus 11.8%; P = 0.0025 [chi-square test]). Reactivation was restored in the marker-rescued virus dLAT1.5R (12.6%; P = 0.53 versus wild type), confirming the importance of the deleted region in spontaneous reactivation. Compared with wild-type or marker-rescued virus, dLAT1.5 had similar or slightly reduced virulence in rabbits (based on survival following ocular infection). In contrast, in mice, dLAT1.5 had increased virulence (P Wechsler, J. Virol. 73:920–929, 1999), had decreased virulence in mice (P = 0.03). In addition, we also found that dLAT371, a LAT mutant that we previously reported to have wild-type virulence in rabbits (G. C. Perng, S. M. Slanina, H. Ghiasi, A. B. Nesburn, and S. L. Wechsler, J. Virol. 70:2014–2018, 1996), had decreased virulence in mice (P < 0.05). Thus, these three mutants, each of which encodes a different LAT RNA, have different virulence phenotypes. dLAT1.5 had wild-type virulence in rabbits but increased virulence in mice. In contrast, LAT2.9A had increased virulence in rabbits but decreased virulence in mice, and dLAT371 had wild-type virulence in rabbits but decreased virulence in mice. Taken together, these results suggest that (i) the 5′ end of LAT and/or a gene that overlaps part of this region is involved in viral virulence, (ii) this virulence appears to have species-specific effects, and (iii) regulation of this virulence may be complex. PMID:11533165

  9. Hepatitis B virus X protein mutant HBxΔ127 promotes proliferation of hepatoma cells through up-regulating miR-215 targeting PTPRT

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fabao [Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); You, Xiaona [Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Chi, Xiumei [Department of Hepatology, The First Hospital, Jilin University, Changchun 130021 (China); Wang, Tao [Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Niu, Junqi, E-mail: junqiniu@yahoo.com.cn [Department of Hepatology, The First Hospital, Jilin University, Changchun 130021 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2014-02-07

    Highlights: • Relative to wild type HBx, HBX mutant HBxΔ127 strongly enhances cell proliferation. • Relative to wild type HBx, HBxΔ127 remarkably up-regulates miR-215 in hepatoma cells. • HBxΔ127-elevated miR-215 promotes cell proliferation via targeting PTPRT mRNA. - Abstract: The mutant of virus is a frequent event. Hepatitis B virus X protein (HBx) plays a vital role in the development of hepatocellular carcinoma (HCC). Therefore, the identification of potent mutant of HBx in hepatocarcinogenesis is significant. Previously, we identified a natural mutant of the HBx gene (termed HBxΔ127). Relative to wild type HBx, HBxΔ127 strongly enhanced cell proliferation and migration in HCC. In this study, we aim to explore the mechanism of HBxΔ127 in promotion of proliferation of hepatoma cells. Our data showed that both wild type HBx and HBxΔ127 could increase the expression of miR-215 in hepatoma HepG2 and H7402 cells. However, HBxΔ127 was able to significantly increase miR-215 expression relative to wild type HBx in the cells. We identified that protein tyrosine phosphatase, receptor type T (PTPRT) was one of the target genes of miR-215 through targeting 3′UTR of PTPRT mRNA. In function, miR-215 was able to promote the proliferation of hepatoma cells. Meanwhile anti-miR-215 could partially abolish the enhancement of cell proliferation mediated by HBxΔ127 in vitro. Knockdown of PTPRT by siRNA could distinctly suppress the decrease of cell proliferation mediated by anti-miR-215 in HepG2-XΔ127/H7402-XΔ127 cells. Moreover, we found that anti-miR-215 remarkably inhibited the tumor growth of hepatoma cells in nude mice. Collectively, relative to wild type HBx, HBxΔ127 strongly enhances proliferation of hepatoma cells through up-regulating miR-215 targeting PTPRT. Our finding provides new insights into the mechanism of HBx mutant HBxΔ127 in promotion of proliferation of hepatoma cells.

  10. Temperature-sensitive mutants of influenza A virus. XIV. Production and evaluation of influenza A/Georgia/74-ts-1[E] recombinant viruses in human adults.

    Science.gov (United States)

    Richman, D D; Murphy, B R; Belshe, R B; Rusten, H M; Chanock, R M; Blacklow, N R; Parrino, T A; Rose, F B; Levine, M M; Caplan, E

    1977-08-01

    The two temperature-sensitive (ts) lesions present in influenza A/Hong Kong/68-ts-1[E] (H3N2 68) virus were transferred via genetic reassortment to influenza A/Georgia/74 (H3N2 74) wild-type virus. A recombinant clone possessing both ts lesions and the shutoff temperature of 38 C of the Hong Kong/68 ts donor and the two surface antigens of the Georgia/74 wild-type virus was administered to 32 seronegative adult volunteers. Thirty-one volunteers were infected, of whom only five experienced mild afebrile upper respiratory tract illness. The wild-type recipient virus was a cloned population that induced illness in five of six infected volunteers. Therfore, the attenuation exhibited by the Georgia/74-ts-1[E] virus could reasonably be assumed to be due to the acquisition of the two ts-1[E] lesions by the Georgia/74 wild-type virus. The serum and nasal wash antibody responses of the ts-1[E] vaccinees were equivalent to those of the volunteers who received wild-type virus. The two ts lesions present in the Hong Kong/68-ts-1[E] virus have now been transferred three times to a wild-type virus bearing a new hemagglutinin, and in each instance the new ts recombination exhibited a similar, satisfactory level of attenuation and antigenicity for adults. It seems likely that the transfer of the ts-1[E] lesions to any new influenza virus will regularly result in attenuation of a recombinat virus possessing the new surface antigens.

  11. Impaired STING Pathway in Human Osteosarcoma U2OS Cells Contributes to the Growth of ICP0-Null Mutant Herpes Simplex Virus.

    Science.gov (United States)

    Deschamps, Thibaut; Kalamvoki, Maria

    2017-05-01

    Human herpes simplex virus 1 (HSV-1) is a widespread pathogen, with 80% of the population being latently infected. To successfully evade the host, the virus has evolved strategies to counteract antiviral responses, including the gene-silencing and innate immunity machineries. The immediately early protein of the virus, infected cell protein 0 (ICP0), plays a central role in these processes. ICP0 blocks innate immunity, and one mechanism is by degrading hostile factors with its intrinsic E3 ligase activity. ICP0 also functions as a promiscuous transactivator, and it blocks repressor complexes to enable viral gene transcription. For these reasons, the growth of a ΔICP0 virus is impaired in most cells, except cells of the human osteosarcoma cell line U2OS, and it is only partially impaired in cells of the human osteosarcoma cell line Saos-2. We found that the two human osteosarcoma cell lines that supported the growth of the ΔICP0 virus failed to activate innate immune responses upon treatment with 2'3'-cyclic GAMP (2'3'-cGAMP), the natural agonist of STING (i.e., stimulator of interferon genes) or after infection with the ΔICP0 mutant virus. Innate immune responses were restored in these cells by transient expression of the STING protein but not after overexpression of interferon-inducible protein 16 (IFI16). Restoration of STING expression resulted in suppression of ΔICP0 virus gene expression and a decrease in viral yields. Overexpression of IFI16 also suppressed ΔICP0 virus gene expression, albeit to a lesser extent than STING. These data suggest that the susceptibility of U2OS and Saos-2 cells to the ΔICP0 HSV-1 is in part due to an impaired STING pathway. IMPORTANCE The DNA sensor STING plays pivotal role in controlling HSV-1 infection both in cell culture and in mice. The HSV-1 genome encodes numerous proteins that are dedicated to combat host antiviral responses. The immediate early protein of the virus ICP0 plays major role in this process as it targets

  12. Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate.

    OpenAIRE

    Coen, D M; Kosz-Vnenchak, M; Jacobson, J G; Leib, D A; Bogard, C L; Schaffer, P A; Tyler, K L; Knipe, D M

    1989-01-01

    Herpes simplex virus infection of mammalian hosts involves lytic replication at a primary site, such as the cornea, translocation by axonal transport to sensory ganglia and replication, and latent infection at a secondary site, ganglionic neurons. The virus-encoded thymidine kinase, which is a target for antiviral drugs such as acyclovir, is not essential for lytic replication yet evidently is required at the secondary site for replication and some phase of latent infection. To determine the ...

  13. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  14. Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells.

    Science.gov (United States)

    Wang, F; Marchini, A; Kieff, E

    1991-04-01

    The objective of these experiments was to develop strategies for creation and identification of recombinant mutant Epstein-Barr viruses (EBV). EBV recombinant molecular genetics has been limited to mutations within a short DNA segment deleted from a nontransforming EBV and an underlying strategy which relies on growth transformation of primary B lymphocytes for identification of recombinants. Thus, mutations outside the deletion or mutations which affect transformation cannot be easily recovered. In these experiments we investigated whether a toxic drug resistance gene, guanine phosphoribosyltransferase or hygromycin phosphotransferase, driven by the simian virus 40 promoter can be recombined into the EBV genome and can function to identify B-lymphoma cells infected with recombinant virus. Two different strategies were used to recombine the drug resistance marker into the EBV genome. Both utilized transfection of partially permissive, EBV-infected B95-8 cells and positive selection for cells which had incorporated a functional drug resistance gene. In the first series of experiments, B95-8 clones were screened for transfected DNA that had recombined into the EBV genome. In the second series of experiments, the transfected drug resistance marker was linked to the plasmid and lytic EBV origins so that it was maintained as an episome and could recombine with the B95-8 EBV genome during virus replication. The recombinant EBV from either experiment could be recovered by infection and toxic drug selection of EBV-negative B-lymphoma cells. The EBV genome in these B-lymphoma cells is frequently an episome. Virus genes associated with latent infection of primary B lymphocytes are expressed. Expression of Epstein-Barr virus nuclear antigen 2 (EBNA-2) and the EBNA-3 genes is variable relative to that of EBNA-1, as is characteristic of some naturally infected Burkitt tumor cells. Moreover, the EBV-infected B-lymphoma cells are often partially permissive for early replicative

  15. Widely Used Herpes Simplex Virus 1 ICP0 Deletion Mutant Strain dl1403 and Its Derivative Viruses Do Not Express Glycoprotein C Due to a Secondary Mutation in the gC Gene.

    Directory of Open Access Journals (Sweden)

    Cristina W Cunha

    Full Text Available Herpes simplex virus 1 (HSV-1 ICP0 is a multi-functional phosphoprotein expressed with immediate early kinetics. An ICP0 deletion mutant, HSV-1 dl1403, has been widely used to study the roles of ICP0 in the HSV-1 replication cycle including gene expression, latency, entry and assembly. We show that HSV-1 dl1403 virions lack detectable levels of envelope protein gC, and that gC is not synthesized in infected cells. Sequencing of the gC gene from HSV-1 dl1403 revealed a single amino acid deletion that results in a frameshift mutation. The HSV-1 dl1403 gC gene is predicted to encode a polypeptide consisting of the original 62 N-terminal amino acids of the gC protein followed by 112 irrelevant, non-gC residues. The mutation was also present in a rescuant virus and in two dl1403-derived viruses, D8 and FXE, but absent from the parental 17+, suggesting that the mutation was introduced during the construction of the dl1403 virus, and not as a result of passage in culture.

  16. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  17. Cyclophilin A Levels Dictate Infection Efficiency of Human Immunodeficiency Virus Type 1 Capsid Escape Mutants A92E and G94D ▿

    Science.gov (United States)

    Ylinen, Laura M. J.; Schaller, Torsten; Price, Amanda; Fletcher, Adam J.; Noursadeghi, Mahdad; James, Leo C.; Towers, Greg J.

    2009-01-01

    Cyclophilin A (CypA) is an important human immunodeficiency virus type 1 (HIV-1) cofactor in human cells. HIV-1 A92E and G94D capsid escape mutants arise during CypA inhibition and in certain cell lines are dependent on CypA inhibition. Here we show that dependence on CypA inhibition is due to high CypA levels. Restricted HIV-1 is stable, and remarkably, restriction is augmented by arresting cell division. Nuclear entry is not inhibited. We propose that high CypA levels and capsid mutations combine to disturb uncoating, leading to poor infectivity, particularly in arrested cells. Our data suggest a role for CypA in uncoating the core of HIV-1 to facilitate integration. PMID:19073742

  18. ALIX Rescues Budding of a Double PTAP/PPEY L-Domain Deletion Mutant of Ebola VP40: A Role for ALIX in Ebola Virus Egress.

    Science.gov (United States)

    Han, Ziying; Madara, Jonathan J; Liu, Yuliang; Liu, Wenbo; Ruthel, Gordon; Freedman, Bruce D; Harty, Ronald N

    2015-10-01

    Ebola (EBOV) is an enveloped, negative-sense RNA virus belonging to the family Filoviridae that causes hemorrhagic fever syndromes with high-mortality rates. To date, there are no licensed vaccines or therapeutics to control EBOV infection and prevent transmission. Consequently, the need to better understand the mechanisms that regulate virus transmission is critical to developing countermeasures. The EBOV VP40 matrix protein plays a central role in late stages of virion assembly and egress, and independent expression of VP40 leads to the production of virus-like particles (VLPs) by a mechanism that accurately mimics budding of live virus. VP40 late (L) budding domains mediate efficient virus-cell separation by recruiting host ESCRT and ESCRT-associated proteins to complete the membrane fission process. L-domains consist of core consensus amino acid motifs including PPxY, P(T/S)AP, and YPx(n)L/I, and EBOV VP40 contains overlapping PPxY and PTAP motifs whose interactions with Nedd4 and Tsg101, respectively, have been characterized extensively. Here, we present data demonstrating for the first time that EBOV VP40 possesses a third L-domain YPx(n)L/I consensus motif that interacts with the ESCRT-III protein Alix. We show that the YPx(n)L/I motif mapping to amino acids 18-26 of EBOV VP40 interacts with the Alix Bro1-V fragment, and that siRNA knockdown of endogenous Alix expression inhibits EBOV VP40 VLP egress. Furthermore, overexpression of Alix Bro1-V rescues VLP production of the budding deficient EBOV VP40 double PTAP/PPEY L-domain deletion mutant to wild-type levels. Together, these findings demonstrate that EBOV VP40 recruits host Alix via a YPx(n)L/I motif that can function as an alternative L-domain to promote virus egress. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Coat protein deletion mutants elicit more severe symptoms than wild-type virus in multiple cereal hosts

    Science.gov (United States)

    The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...

  20. Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RNA

    Directory of Open Access Journals (Sweden)

    Ristic Natalia

    2010-09-01

    Full Text Available Abstract Background The viral genome of HIV-1 contains several secondary structures that are important for regulating viral replication. The stem-loop 1 (SL1 sequence in the 5' untranslated region directs HIV-1 genomic RNA dimerization and packaging into the virion. Without SL1, HIV-1 cannot replicate in human T cell lines. The replication restriction phenotype in the SL1 deletion mutant appears to be multifactorial, with defects in viral RNA dimerization and packaging in producer cells as well as in reverse transcription of the viral RNA in infected cells. In this study, we sought to characterize SL1 mutant replication restrictions and provide insights into the underlying mechanisms of compensation in revertants. Results HIV-1 lacking SL1 (NLΔSL1 did not replicate in PM-1 cells until two independent non-synonymous mutations emerged: G913A in the matrix domain (E42K on day 18 postinfection and C1907T in the SP1 domain (P10L on day 11 postinfection. NLΔSL1 revertants carrying either compensatory mutation showed enhanced infectivity in PM-1 cells. The SL1 revertants produced significantly more infectious particles per nanogram of p24 than did NLΔSL1. The SL1 deletion mutant packaged less HIV-1 genomic RNA and more cellular RNA, particularly signal recognition particle RNA, in the virion than the wild-type. NLΔSL1 also packaged 3- to 4-fold more spliced HIV mRNA into the virion, potentially interfering with infectious virus production. In contrast, both revertants encapsidated 2.5- to 5-fold less of these HIV-1 mRNA species. Quantitative RT-PCR analysis of RNA cross-linked with Gag in formaldehyde-fixed cells demonstrated that the compensatory mutations reduced the association between Gag and spliced HIV-1 RNA, thereby effectively preventing these RNAs from being packaged into the virion. The reduction of spliced viral RNA in the virion may have a major role in facilitating infectious virus production, thus restoring the infectivity of NLΔSL1

  1. Construction of a hepatitis B virus neutralizing chimeric monoclonal antibody recognizing escape mutants of the viral surface antigen (HBsAg).

    Science.gov (United States)

    Golsaz-Shirazi, Forough; Amiri, Mohammad Mehdi; Farid, Samira; Bahadori, Motahareh; Bohne, Felix; Altstetter, Sebastian; Wolff, Lisa; Kazemi, Tohid; Khoshnoodi, Jalal; Hojjat-Farsangi, Mohammad; Chudy, Michael; Jeddi-Tehrani, Mahmood; Protzer, Ulrike; Shokri, Fazel

    2017-08-01

    Hepatitis B virus (HBV) infection is a global burden on the health-care system and is considered as the tenth leading cause of death in the world. Over 248 million patients are currently suffering from chronic HBV infection worldwide and annual mortality rate of this infection is 686000. The "a" determinant is a hydrophilic region present in all antigenic subtypes of hepatitis B surface antigen (HBsAg), and antibodies against this region can neutralize the virus and are protective against all subtypes. We have recently generated a murine anti-HBs monoclonal antibody (4G4), which can neutralize HBV infection in HepaRG cells and recognize most of the escape mutant forms of HBsAg. Here, we describe the production and characterization of the chimeric human-murine antibody 4G4 (c-4G4). Variable region genes of heavy and light chains of the m-4G4 were cloned and fused to constant regions of human kappa and IgG1 by splice overlap extension (SOE) PCR. The chimeric antibody was expressed in Chinese Hamster Ovary (CHO)-K1 cells and purified from culture supernatant. Competition ELISA proved that both antibodies bind the same epitope within HBsAg. Antigen-binding studies using ELISA and Western blot showed that c-4G4 has retained the affinity and specificity of the parental murine antibody, and displayed a similar pattern of reactivity to 13 escape mutant forms of HBsAg. Both, the parental and c-4G4 showed a comparably high HBV neutralization capacity in cell culture even at the lowest concentration (0.6μg/ml). Due to the ability of c-4G4 to recognize most of the sub-genotypes and escape mutants of HBsAg, this antibody either alone or in combination with other anti-HBs antibodies could be considered as a potent alternative for Hepatitis B immune globulin (HBIG) as an HBV infection prophylactic or for passive immunotherapy against HBV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. WWER safety investigations on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  3. Herpes Simplex Virus 1 Mutant with Point Mutations in UL39 Is Impaired for Acute Viral Replication in Mice, Establishment of Latency, and Explant-Induced Reactivation.

    Science.gov (United States)

    Mostafa, Heba H; Thompson, Thornton W; Konen, Adam J; Haenchen, Steve D; Hilliard, Joshua G; Macdonald, Stuart J; Morrison, Lynda A; Davido, David J

    2018-04-01

    In the process of generating herpes simplex virus 1 (HSV-1) mutations in the viral regulatory gene encoding infected cell protein 0 (ICP0), we isolated a viral mutant, termed KOS-NA, that was severely impaired for acute replication in the eyes and trigeminal ganglia (TG) of mice, defective in establishing a latent infection, and reactivated poorly from explanted TG. To identify the secondary mutation(s) responsible for the impaired phenotypes of this mutant, we sequenced the KOS-NA genome and noted that it contained two nonsynonymous mutations in UL39 , which encodes the large subunit of ribonucleotide reductase, ICP6. These mutations resulted in lysine-to-proline (residue 393) and arginine-to-histidine (residue 950) substitutions in ICP6. To determine whether alteration of these amino acids was responsible for the KOS-NA phenotypes in vivo , we recombined the wild-type UL39 gene into the KOS-NA genome and rescued its acute replication phenotypes in mice. To further establish the role of UL39 in KOS-NA's decreased pathogenicity, the UL39 mutations were recombined into HSV-1 (generating UL39 mut ), and this mutant virus showed reduced ocular and TG replication in mice comparable to that of KOS-NA. Interestingly, ICP6 protein levels were reduced in KOS-NA-infected cells relative to the wild-type protein. Moreover, we observed that KOS-NA does not counteract caspase 8-induced apoptosis, unlike wild-type strain KOS. Based on alignment studies with other HSV-1 ICP6 homologs, our data suggest that amino acid 950 of ICP6 likely plays an important role in ICP6 accumulation and inhibition of apoptosis, consequently impairing HSV-1 pathogenesis in a mouse model of HSV-1 infection. IMPORTANCE HSV-1 is a major human pathogen that infects ∼80% of the human population and can be life threatening to infected neonates or immunocompromised individuals. Effective therapies for treatment of recurrent HSV-1 infections are limited, which emphasizes a critical need to understand in

  4. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  5. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  6. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  7. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  8. Herpes Simplex Virus 1 Us3 Deletion Mutant is Infective Despite Impaired Capsid Translocation to the Cytoplasm

    Directory of Open Access Journals (Sweden)

    Peter Wild

    2015-01-01

    Full Text Available Herpes simplex virus 1 (HSV-1 capsids are assembled in the nucleus bud at the inner nuclear membrane into the perinuclear space, acquiring envelope and tegument. In theory, these virions are de-enveloped by fusion of the envelope with the outer nuclear membrane and re-enveloped by Golgi membranes to become infective. Us3 enables the nucleus to cytoplasm capsid translocation. Nevertheless, Us3 is not essential for the production of infective progeny viruses. Determination of phenotype distribution by quantitative electron microscopy, and calculation per mean nuclear or cell volume revealed the following: (i The number of R7041(∆US3 capsids budding at the inner nuclear membrane was significantly higher than that of wild type HSV-1; (ii The mean number of R7041(∆US3 virions per mean cell volume was 2726, that of HSV-1 virions 1460 by 24 h post inoculation; (iii 98% of R7041(∆US3 virions were in the perinuclear space; (iv The number of R7041(∆US3 capsids in the cytoplasm, including those budding at Golgi membranes, was significantly reduced. Cell associated R7041(∆US3 yields were 2.37 × 108 and HSV-1 yields 1.57 × 108 PFU/mL by 24 h post inoculation. We thus conclude that R7041(∆US3 virions, which acquire envelope and tegument by budding at the inner nuclear membrane into the perinuclear space, are infective.

  9. Evaluation of the safety and adjuvant effect of a detoxified listeriolysin O mutant on the humoral response to dengue virus antigens.

    Science.gov (United States)

    Hernández-Flores, K G; Calderón-Garcidueñas, A L; Mellado-Sánchez, G; Ruiz-Ramos, R; Sánchez-Vargas, L A; Thomas-Dupont, P; Izaguirre-Hernández, I Y; Téllez-Sosa, J; Martínez-Barnetche, J; Wood, L; Paterson, Y; Cedillo-Barrón, L; López-Franco, O; Vivanco-Cid, H

    2017-04-01

    Listeriolysin O (LLO) has been proposed as a potential carrier or adjuvant molecule in the vaccination field. However, the cytotoxic and pro-apoptotic effects of LLO are the major limitations for this purpose. Here, we have performed a preclinical safety evaluation and characterized a new potential adjuvant application for a non-cytolytic LLO mutant (dtLLO) to enhance and modulate the immune response against the envelope (E) protein from dengue virus. In addition, we have studied the adjuvant effects of dtLLO on human immune cells and the role of membrane cholesterol for the binding and proinflammatory property of the toxoid. Our in-vivo results in the murine model confirmed that dtLLO is a safer molecule than wild-type LLO (wtLLO), with a significantly increased survival rate for mice challenged with dtLLO compared with mice challenged with wtLLO (P < 0·001). Histopathological analysis showed non-toxic effects in key target organs such as brain, heart, liver, spleen, kidney and lung after challenge with dtLLO. In vitro, dtLLO retained the capacity of binding to plasma membrane cholesterol on the surface of murine and human immune cells. Immunization of 6-8-week-old female BALB/c mice with a combination of dtLLO mixed with E protein elicited a robust specific humoral response with isotype diversification of immunoglobulin (Ig)G antibodies (IgG1 and IgG2a). Finally, we demonstrated that cholesterol and lipid raft integrity are required to induce a proinflammatory response by human cells. Taken together, these findings support a potential use of the dtLLO mutant as a safe and effective adjuvant molecule in vaccination. © 2016 British Society for Immunology.

  10. Absolute Transition Rates in {sup 188}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  11. A dominant negative mutant of rab5 inhibits infection of cells by foot-and-mouth disease virus; implications for virus entry

    DEFF Research Database (Denmark)

    Johns, Helen; Berryman, Stephen; Monaghan, Paul

    2009-01-01

    Foot-and-mouth disease virus (FMDV) can use a number of different integrins (alphavβ1, alphavβ3, alphavβ6, and alphavβ8) as receptors to initiate infection. Infection mediated by alphavβ6 is known to occur by clathrin-mediated endocytosis and is dependent on the acidic pH within endosomes....... On internalization, virus is detected rapidly in early endosomes (EE) and subsequently in perinuclear recycling endosomes (PNRE), but not in late endosomal compartments. Due to the extreme sensitivity of FMDV to acidic pH, it is thought that EE can provide a pH low enough for infection to occur; however, definitive...... proof that infection takes place from within these compartments is still lacking. Here we have investigated the intracellular transport steps required for FMDV infection of IBRS-2 cells, which express vβ8 as their FMDV receptor. These experiments confirmed that FMDV infection mediated by alphavβ8...

  12. Bovine Herpes Virus 1 (BHV-1) and Herpes Simplex Virus Type 1 (HSV-1) Promote Survival of Latently Infected Sensory Neurons, in Part by Inhibiting Apoptosis

    Science.gov (United States)

    Jones, Clinton

    2013-01-01

    α-Herpesvirinae subfamily members, including herpes simplex virus type 1 (HSV-1) and bovine herpes virus 1 (BHV-1), initiate infection in mucosal surfaces. BHV-1 and HSV-1 enter sensory neurons by cell-cell spread where a burst of viral gene expression occurs. When compared to non-neuronal cells, viral gene expression is quickly extinguished in sensory neurons resulting in neuronal survival and latency. The HSV-1 latency associated transcript (LAT), which is abundantly expressed in latently infected neurons, inhibits apoptosis, viral transcription, and productive infection, and directly or indirectly enhances reactivation from latency in small animal models. Three anti-apoptosis genes can be substituted for LAT, which will restore wild type levels of reactivation from latency to a LAT null mutant virus. Two small non-coding RNAs encoded by LAT possess anti-apoptosis functions in transfected cells. The BHV-1 latency related RNA (LR-RNA), like LAT, is abundantly expressed during latency. The LR-RNA encodes a protein (ORF2) and two microRNAs that are expressed in certain latently infected neurons. Wild-type expression of LR gene products is required for stress-induced reactivation from latency in cattle. ORF2 has anti-apoptosis functions and interacts with certain cellular transcription factors that stimulate viral transcription and productive infection. ORF2 is predicted to promote survival of infected neurons by inhibiting apoptosis and sequestering cellular transcription factors which stimulate productive infection. In addition, the LR encoded microRNAs inhibit viral transcription and apoptosis. In summary, the ability of BHV-1 and HSV-1 to interfere with apoptosis and productive infection in sensory neurons is crucial for the life-long latency-reactivation cycle in their respective hosts. PMID:25278776

  13. A Herpes Simplex Virus Type 1 Mutant Expressing a Baculovirus Inhibitor of Apoptosis Gene in Place of Latency-Associated Transcript Has a Wild-Type Reactivation Phenotype in the Mouse

    Science.gov (United States)

    Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.

    2005-01-01

    The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155

  14. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  15. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  16. Evolution of Soybean mosaic virus-G7 molecularly cloned genome in Rsv1-genotype soybean results in emergence of a mutant capable of evading Rsv1-mediated recognition

    International Nuclear Information System (INIS)

    Hajimorad, M.R.; Eggenberger, A.L.; Hill, J.H.

    2003-01-01

    Plant resistance (R) genes direct recognition of pathogens harboring matching avirluent signals leading to activation of defense responses. It has long been hypothesized that under selection pressure the infidelity of RNA virus replication together with large population size and short generation times results in emergence of mutants capable of evading R-mediated recognition. In this study, the Rsv1/Soybean mosaic virus (SMV) pathosystem was used to investigate this hypothesis. In soybean line PI 96983 (Rsv1), the progeny of molecularly cloned SMV strain G7 (pSMV-G7) provokes a lethal systemic hypersensitive response (LSHR) with up regulation of a defense-associated gene transcript (PR-1). Serial passages of a large population of the progeny in PI 96983 resulted in emergence of a mutant population (vSMV-G7d), incapable of provoking either Rsv1-mediated LSHR or PR-1 protein gene transcript up regulation. An infectious clone of the mutant (pSMV-G7d) was synthesized whose sequences were very similar but not identical to the vSMV-G7d population; however, it displayed a similar phenotype. The genome of pSMV-G7d differs from parental pSMV-G7 by 17 substitutions, of which 10 are translationally silent. The seven amino acid substitutions in deduced sequences of pSMV-G7d differ from that of pSMV-G7 by one each in P1 proteinase, helper component-proteinase, and coat protein, respectively, and by four in P3. To the best of our knowledge, this is the first demonstration in which experimental evolution of a molecularly cloned plant RNA virus resulted in emergence of a mutant capable of evading an R-mediated recognition

  17. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  18. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  19. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  20. Separation of foot-and-mouth disease virus leader protein activities; identification of mutants that retain efficient self-processing activity but poorly induce eIF4G cleavage.

    Science.gov (United States)

    Guan, Su Hua; Belsham, Graham J

    2017-04-01

    Foot-and-mouth disease virus is a picornavirus and its RNA genome encodes a large polyprotein. The N-terminal part of this polyprotein is the leader protein, a cysteine protease, termed Lpro. The virus causes the rapid inhibition of host cell cap-dependent protein synthesis within infected cells. This results from the Lpro-dependent cleavage of the cellular translation initiation factor eIF4G. Lpro also releases itself from the virus capsid precursor by cleaving the L/P1 junction. Using site-directed mutagenesis of the Lpro coding sequence, we have investigated the role of 51 separate amino acid residues in the functions of this protein. These selected residues either are highly conserved or are charged and exposed on the protein surface. Using transient expression assays, within BHK-21 cells, it was found that residues around the active site (W52, L53 and A149) of Lpro and others located elsewhere (K38, K39, R44, H138 and W159) are involved in the induction of eIF4G cleavage but not in the processing of the L/P1 junction. Modified viruses, encoding such amino acid substitutions within Lpro, can replicate in BHK-21 cells but did not grow well in primary bovine thyroid cells. This study characterizes mutant viruses that are deficient in blocking host cell responses to infection (e.g. interferon induction) and can assist in the rational design of antiviral agents targeting this process and in the production of attenuated viruses.

  1. Generation of mutant Uukuniemi viruses lacking the nonstructural protein NSs by reverse genetics indicates that NSs is a weak interferon antagonist.

    Science.gov (United States)

    Rezelj, Veronica V; Överby, Anna K; Elliott, Richard M

    2015-05-01

    Uukuniemi virus (UUKV) is a tick-borne member of the Phlebovirus genus (family Bunyaviridae) and has been widely used as a safe laboratory model to study aspects of bunyavirus replication. Recently, a number of new tick-borne phleboviruses have been discovered, some of which, like severe fever with thrombocytopenia syndrome virus and Heartland virus, are highly pathogenic in humans. UUKV could now serve as a useful comparator to understand the molecular basis for the different pathogenicities of these related viruses. We established a reverse-genetics system to recover UUKV entirely from cDNA clones. We generated two recombinant viruses, one in which the nonstructural protein NSs open reading frame was deleted from the S segment and one in which the NSs gene was replaced with green fluorescent protein (GFP), allowing convenient visualization of viral infection. We show that the UUKV NSs protein acts as a weak interferon antagonist in human cells but that it is unable to completely counteract the interferon response, which could serve as an explanation for its inability to cause disease in humans. Uukuniemi virus (UUKV) is a tick-borne phlebovirus that is apathogenic for humans and has been used as a convenient model to investigate aspects of phlebovirus replication. Recently, new tick-borne phleboviruses have emerged, such as severe fever with thrombocytopenia syndrome virus in China and Heartland virus in the United States, that are highly pathogenic, and UUKV will now serve as a comparator to aid in the understanding of the molecular basis for the virulence of these new viruses. To help such investigations, we have developed a reverse-genetics system for UUKV that permits manipulation of the viral genome. We generated viruses lacking the nonstructural protein NSs and show that UUKV NSs is a weak interferon antagonist. In addition, we created a virus that expresses GFP and thus allows convenient monitoring of virus replication. These new tools represent a

  2. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  3. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  4. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  5. Bulk etch rate of LR-115 cellulose nitrate film

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  6. Replication-deficient mutant Herpes Simplex Virus-1 targets professional antigen presenting cells and induces efficient CD4+ T helper responses.

    OpenAIRE

    Fiorentini, Simona; Marconi, Peggy; Avolio, Manuela; Marini, Elena; Garrafa, Emirena; Caracciolo, Sonia; Rossi, Daniele; Bozac, Alexandra; Becker, Pablo D; Gentili, Francesca; Facchetti, Fabio; Guzman, Carlos A; Manservigi, Roberto; Caruso, Arnaldo

    2007-01-01

    Both neutralizing antibodies and cytotoxic T-cells are necessary to control a viral infection. However, vigorous T helper responses are essential for their elicitation and maintenance. Here we show that a recombinant replication-deficient Herpes Simplex Virus (HSV)-1 vector encoding the Human Immunodeficiency Virus (HIV)-1 matrix protein p17 (T0-p17) was capable of infecting professional antigen presenting cells (APCs) in vitro and in vivo. The injection of T0-p17 in the mouse dermis generate...

  7. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  8. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  9. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  10. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  11. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Classification of cryo electron microscopy images, noisy tomographic images recorded with unknown projection directions, by simultaneously estimating reconstructions and application to an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22

    Science.gov (United States)

    Lee, Junghoon; Zheng, Yili; Yin, Zhye; Doerschuk, Peter C.; Johnson, John E.

    2010-08-01

    Cryo electron microscopy is frequently used on biological specimens that show a mixture of different types of object. Because the electron beam rapidly destroys the specimen, the beam current is minimized which leads to noisy images (SNR substantially less than 1) and only one projection image per object (with an unknown projection direction) is collected. For situations where the objects can reasonably be described as coming from a finite set of classes, an approach based on joint maximum likelihood estimation of the reconstruction of each class and then use of the reconstructions to label the class of each image is described and demonstrated on two challenging problems: an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22.

  13. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  14. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  15. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  16. Assignment of 1H, 13C, and 15N resonances of WT matrix protein and its R55F mutant from Mason-Pfizer monkey virus

    Czech Academy of Sciences Publication Activity Database

    Vlach, J.; Lipov, J.; Veverka, V.; Rumlová, Michaela; Ruml, T.; Hrabal, R.

    2005-01-01

    Roč. 31, - (2005), s. 381-382 ISSN 0925-2738 R&D Projects: GA ČR GA203/03/0490 Institutional research plan: CEZ:AV0Z4055905 Keywords : Mason-Pfizer monkey virus * NMR resonance assignment * matrix protein Subject RIV: CE - Biochemistry Impact factor: 2.180, year: 2005

  17. Replication-deficient mutant Herpes Simplex Virus-1 targets professional antigen presenting cells and induces efficient CD4+ T helper responses.

    Science.gov (United States)

    Fiorentini, Simona; Marconi, Peggy; Avolio, Manuela; Marini, Elena; Garrafa, Emirena; Caracciolo, Sonia; Rossi, Daniele; Bozac, Alexandra; Becker, Pablo D; Gentili, Francesca; Facchetti, Fabio; Guzman, Carlos A; Manservigi, Roberto; Caruso, Arnaldo

    2007-07-01

    Both neutralizing antibodies and cytotoxic T-cells are necessary to control a viral infection. However, vigorous T helper responses are essential for their elicitation and maintenance. Here we show that a recombinant replication-deficient Herpes Simplex Virus (HSV)-1 vector encoding the Human Immunodeficiency Virus (HIV)-1 matrix protein p17 (T0-p17) was capable of infecting professional antigen presenting cells (APCs) in vitro and in vivo. The injection of T0-p17 in the mouse dermis generated a strong p17-specific CD4+ T helper response preceding both p17-specific humoral and effector T cell responses. Moreover, we show that T0-p17 infection did not interfere with the endogenous processing of the transgene encoded antigen, since infected APCs were able to evoke a strong recall response in vitro. Our results demonstrate that replication-deficient HSV vectors can be appealing candidates for the development of vaccines able to trigger T helper responses.

  18. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  19. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  20. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  1. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  2. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  3. Fine mapping of the latency-related gene of herpes simplex virus type 1: alternative splicing produces distinct latency-related RNAs containing open reading frames

    International Nuclear Information System (INIS)

    Wechsler, S.L.; Nesburn, A.B.; Watson, R.; Slanina, S.M.; Ghiasi, H.

    1988-01-01

    The latency-related (LR) gene of herpes simplex virus type 1 (HSV-1) is transcriptionally active during HSV-1 latency, producing at least two LR-RNAs. The LR gene partially overlaps the immediate-early gene ICP0 and is transcribed in the opposite direction from ICP0, producing LR-RNAs that are complementary (antisense) to ICP0 mRNA. The LR gene is thought to be involved in HSV-1 latency. The authors report here the time mapping and partial sequence analysis of this HSV-1 LR gene. 32 P-labeled genomic DNA restriction fragments and synthetic oligonucleotides were used as probes for in situ hybridizations and Northern (RNA) blot hybridizations of RNA from trigeminal ganglia of rabbits latently infected with HSV-1. The two most abundant LR-RNAs appeared to share their 5' and 3' ends and to be produced by alternative splicing. These LR-RNAs were approximately 2 and 1.3 to 1.5 kilobases in length and were designated LR-RNA 1 and LF-RNA 2, respectively. LR-RNA 1 appeared to have at least one intron removed, while LR-RNA 2 appeared to have at least two introns removed. The LR-RNAs contained two potential long open reading frames, suggesting the possibility that one or more of the LR-RNAs may be a functional mRNA

  4. Human immunodeficiency virus type 1 KK26-27 matrix mutants display impaired infectivity, circularization and integration but not nuclear import

    International Nuclear Information System (INIS)

    Mannioui, Abdelkrim; Nelson, Elisabeth; Schiffer, Cecile

    2005-01-01

    We analyzed the role of human immunodeficiency virus (HIV)-1 matrix protein (MA) during the virus replication afferent phase. Single-round infection of H9 T lymphocytes showed that the combined mutation of MA Lys residues 26-27 in MA reported nuclear localization signal (NLS)-1 [Haffar, O.K., Popov, S., Dubrovsky, L., Agostini, I., Tang, H., Pushkarsky, T., Nadler, S.G., Bukrinsky, M., 2000. Two nuclear localization signals in the HIV-1 matrix protein regulate nuclear import of the HIV-1 pre-integration complex. J. Mol. Biol. 299 (2): 359-368] impaired infectivity, abrogated 2-LTR-circle formation and significantly reduced integration. However, the mutation did not affect viral DNA docking to chromatin in either interphasic or mitotic cells, indicating that MA N-terminal basic domain should not represent a major determinant of HIV-1 nuclear import in T lymphocytes. These data point to a previously unreported role of MA in the late, post-chromatin-binding, afferent phase of HIV-1 replication cycle

  5. Perturbation measurements in reactor LR-0 and their evaluation

    International Nuclear Information System (INIS)

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  6. Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor

    Directory of Open Access Journals (Sweden)

    Siliciano Robert F

    2011-08-01

    Full Text Available Abstract Elite suppressors or controllers (ES are HIV-1 infected patients who maintain undetectable viral loads without treatment. While HLA-B*57-positive ES are usually infected with virus that is unmutated at CTL epitopes, a single, dominant variant containing CTL escape mutations is typically seen in plasma during chronic infection. We describe an ES who developed seven distinct and rare escape variants at an HLA-B*57-restricted Gag epitope over a five year period. Interestingly, he developed proliferative, de novo CTL responses that suppressed replication of each of these variants. These responses, in combination with low viral fitness of each variant, may contribute to sustained elite control in this ES.

  7. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  8. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  10. Differential gene expression in porcine SK6 cells infected with wild-type and SAP domain-mutant foot-and-mouth disease virus.

    Science.gov (United States)

    Ni, Zixin; Yang, Fan; Cao, Weijun; Zhang, Xiangle; Jin, Ye; Mao, Ruoqing; Du, Xiaoli; Li, Weiwei; Guo, Jianhong; Liu, Xiangtao; Zhu, Zixiang; Zheng, Haixue

    2016-06-01

    Foot-and-mouth disease virus (FMDV) is the causative agent of a highly contagious disease in livestock. The viral proteinase L(pro) of FMDV is involved in pathogenicity, and mutation of the L(pro) SAP domain reduces FMDV pathogenicity in pigs. To determine the gene expression profiles associated with decreased pathogenicity in porcine cells, we performed transcriptome analysis using next-generation sequencing technology and compared differentially expressed genes in SK6 cells infected with FMDV containing L(pro) with either a wild-type or mutated version of the SAP domain. This analysis yielded 1,853 genes that exhibited a ≥ 2-fold change in expression and was validated by real-time quantitative PCR detection of several differentially expressed genes. Many of the differentially expressed genes correlated with antiviral responses corresponded to genes associated with transcription factors, immune regulation, cytokine production, inflammatory response, and apoptosis. Alterations in gene expression profiles may be responsible for the variations in pathogenicity observed between the two FMDV variants. Our results provided genes of interest for the further study of antiviral pathways and pathogenic mechanisms related to FMDV L(pro).

  11. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

    Science.gov (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

    2005-01-01

    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  12. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  13. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  15. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  16. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  17. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  18. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  19. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  20. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  1. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  2. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  3. Comparative Proteomic Analysis of Wild-Type and SAP Domain Mutant Foot-and-Mouth Disease Virus-Infected Porcine Cells Identifies the Ubiquitin-Activating Enzyme UBE1 Required for Virus Replication.

    Science.gov (United States)

    Zhu, Zixiang; Yang, Fan; Zhang, Keshan; Cao, Weijun; Jin, Ye; Wang, Guoqing; Mao, Ruoqing; Li, Dan; Guo, Jianhong; Liu, Xiangtao; Zheng, Haixue

    2015-10-02

    Leader protein (L(pro)) of foot-and-mouth disease virus (FMDV) manipulates the activities of several host proteins to promote viral replication and pathogenicity. L(pro) has a conserved protein domain SAP that is suggested to subvert interferon (IFN) production to block antiviral responses. However, apart from blocking IFN production, the roles of the SAP domain during FMDV infection in host cells remain unknown. Therefore, we identified host proteins associated with the SAP domain of L(pro) by a high-throughput quantitative proteomic approach [isobaric tags for relative and absolute quantitation (iTRAQ) in conjunction with liquid chromatography/electrospray ionization tandem mass spectrometry]. Comparison of the differentially regulated proteins in rA/FMDVΔmSAP- versus rA/FMDV-infected SK6 cells revealed 45 down-regulated and 32 up-regulated proteins that were mostly associated with metabolic, ribosome, spliceosome, and ubiquitin-proteasome pathways. The results also imply that the SAP domain has a function similar to SAF-A/B besides its potential protein inhibitor of activated signal transducer and activator of transcription (PIAS) function. One of the identified proteins UBE1 was further analyzed and displayed a novel role for the SAP domain of L(pro). Overexpression of UBE1 enhanced the replication of FMDV, and knockdown of UBE1 decreased FMDV replication. This shows that FMDV manipulates UBE1 for increased viral replication, and the SAP domain was involved in this process.

  4. Novel mutations in β-tubulin gene in Trichoderma harzianum mutants resistant to methyl benzimidazol-2-yl carbamate.

    Science.gov (United States)

    Li, M; Zhang, H Y; Liang, B

    2013-01-01

    Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.

  5. Promising rice mutants

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1988-01-01

    Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs

  6. Mutant heterosis in rice

    International Nuclear Information System (INIS)

    1987-01-01

    In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent

  7. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  9. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  10. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

    Directory of Open Access Journals (Sweden)

    Valentina Kubale

    2016-07-01

    Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

  11. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  12. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  13. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  14. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  15. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  16. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  17. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  18. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  19. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  20. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  1. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  3. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  4. Separation of foot-and-mouth disease virus leader protein activities; identification of mutants that retain efficient self-processing activity but poorly induce eIF4G cleavage

    DEFF Research Database (Denmark)

    Belsham, Graham; Hua Guan, Su

    2017-01-01

    Foot-and-mouth disease virus (FMDV) is a picornavirus and its RNA genome encodes a large polyprotein. The N-terminal part of this polyprotein is the Leader protein, a cysteine protease, termed Lpro. The virus causes the rapid inhibition of host cell capdependent protein synthesis within infected...

  5. Fitness and virulence of a coxsackievirus mutant that can circumnavigate the need for phosphatidylinositol 4-kinase class III beta

    NARCIS (Netherlands)

    Thibaut, Hendrik Jan; van der Schaar, Hilde M; Lanke, Kjerstin H W; Verbeken, Erik; Andrews, Martin; Leyssen, Pieter; Neyts, Johan; van Kuppeveld, Frank J M

    2014-01-01

    Coxsackieviruses require phosphatidylinositol-4-kinase IIIβ (PI4KIIIβ) for replication but can bypass this need by an H57Y mutation in protein 3A (3A-H57Y). We show that mutant coxsackievirus is not outcompeted by wild-type virus during 10 passages in vitro. In mice, the mutant virus proved as

  6. alpha-particle radioactivity from LR 115 by two methods of analysis

    CERN Document Server

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  7. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  8. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    CERN Document Server

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  9. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  10. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Science.gov (United States)

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  11. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  12. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  13. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  14. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    NARCIS (Netherlands)

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  15. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  16. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  17. Productive mutants of niger

    International Nuclear Information System (INIS)

    Misra, R.C.

    2001-01-01

    Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

  18. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  20. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  1. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  2. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  3. Mutant lines of currant tomato, valuable germplasm with multiple disease resistance

    International Nuclear Information System (INIS)

    Govorova, G.F.; Khrustaleva, V.V.; Shcherbakov, V.K.

    1987-01-01

    Studies were carried out for two years on eight mutant lines of currant tomato at the Krymsk Experimental Breeding Station of the N.I. Vavilov All-Union Scientific Research Institute of Plant-Growing (VIR). The station is situated in an area of commercial field tomato growing (Krasnodar region). The mutant lines of currant tomato (VIR specimen No. k-4053) were obtained through chronic gamma-irradiation. A disease resistance evaluation of the mutants was carried out for Verticillium wilt (Verticillium albo-atrum Rein. and Berth.), for black bacterial spotting (Xanthomonas vesicatoria Dows.), for tobacco mosaic virus Nicotiana 1 Smith), for streak virus (Nicotiana 1), for the combination TMV with X and Y potato viruses, for cucumber virus (Cucumis 1), and also for top rot. Fifty plants of each mutant line were evaluated and checks were made three times in each season. A comparison of the currant tomato mutants with the standard tomato varieties demonstrates the better resistance shown by the mutant germplasm to the main pathogens. The degree to which some currant tomato mutants were affected by Verticillium was lower than that of the most VerticiIlium-resistant samples of tomato evaluated between 1975 and 1981. The mutants of currant tomato should therefore be of interest as germplasm in breeding tomatoes for improved multiple disease resistance

  4. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  5. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  6. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  7. The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion

    International Nuclear Information System (INIS)

    Huang, Claire Y.-H.; Butrapet, Siritorn; Moss, Kelly J.; Childers, Thomas; Erb, Steven M.; Calvert, Amanda E.; Silengo, Shawn J.; Kinney, Richard M.; Blair, Carol D.; Roehrig, John T.

    2010-01-01

    The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could not re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.

  8. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  9. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Directory of Open Access Journals (Sweden)

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  10. Connexin mutants and cataracts

    Directory of Open Access Journals (Sweden)

    Eric C Beyer

    2013-04-01

    Full Text Available The lens is a multicellular, but avascular tissue that must stay transparent to allow normal transmission of light and focusing of it on the retina. Damage to lens cells and/or proteins can cause cataracts, opacities that disrupt these processes. The normal survival of the lens is facilitated by an extensive network of gap junctions formed predominantly of connexin46 and connexin50. Mutations of the genes that encode these connexins (GJA3 and GJA8 have been identified and linked to inheritance of cataracts in human families and mouse lines. In vitro expression studies of several of these mutants have shown that they exhibit abnormalities that may lead to disease. Many of the mutants reduce or modify intercellular communication due to channel alterations (including loss of function or altered gating or due to impaired cellular trafficking which reduces the number of gap junction channels within the plasma membrane. However, the abnormalities detected in studies of other mutants suggest that they cause cataracts through other mechanisms including gain of hemichannel function (leading to cell injury and death and formation of cytoplasmic accumulations (that may act as light scattering particles. These observations and the anticipated results of ongoing studies should elucidate the mechanisms of cataract development due to mutations of lens connexins and abnormalities of other lens proteins. They may also contribute to our understanding of the mechanisms of disease due to connexin mutations in other tissues.

  11. Cell lines that support replication of a novel herpes simplex virus 1 UL31 deletion mutant can properly target UL34 protein to the nuclear rim in the absence of UL31

    International Nuclear Information System (INIS)

    Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D.

    2004-01-01

    Previous results indicated that the herpes simplex virus 1 (HSV-1) U L 31 gene is necessary and sufficient for localization of the U L 34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U L 31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U L 31 gene. The replication of the U L 31 deletion virus was restored on U L 31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U L 34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U L 34 protein localized at the nuclear membrane in rabbit skin cells, and U L 31 complementing CV1 cells infected with the U L 31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U L 34 protein to the nuclear membrane. We speculate that this function partially complements that of U L 31 and may explain why U L 31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells

  12. Direct determination of bulk etching rate for LR-115-II solid state ...

    Indian Academy of Sciences (India)

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  13. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Directory of Open Access Journals (Sweden)

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  14. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  15. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  16. Selection of an entecavir-resistant mutant despite prolonged hepatitis B virus DNA suppression, in a chronic hepatitis B patient with preexistent lamivudine resistance : successful rescue therapy with tenofovir

    NARCIS (Netherlands)

    Leemans, Wilhelmus F; Niesters, Hubert G; van der Eijk, Annemiek A; Janssen, Harry L; Schalm, Solko W; de Man, Robert A

    BACKGROUND AND OBJECTIVE: Entecavir has potent activity against hepatitis B virus. Drug resistance has not been reported in nucleoside-naïve patients and is low in lamivudine-refractory patients. METHODS AND RESULTS: A 43-year-old man was treated with lamivudine for hepatitis B e antigen-positive

  17. Protection from genital herpes disease, seroconversion and latent infection in a non-lethal murine genital infection model by immunization with an HSV-2 replication-defective mutant virus.

    Science.gov (United States)

    Diaz, Fernando M; Knipe, David M

    2016-01-15

    Viral vaccines have traditionally protected against disease, but for viruses that establish latent infection, it is desirable for the vaccine to reduce infection to reduce latent infection and reactivation. While seroconversion has been used in clinical trials of herpes simplex virus (HSV) vaccines to measure protection from infection, this has not been modeled in animal infection systems. To measure the ability of a genital herpes vaccine candidate to protect against various aspects of infection, we established a non-lethal murine model of genital HSV-2 infection, an ELISA assay to measure antibodies specific for infected cell protein 8 (ICP8), and a very sensitive qPCR assay. Using these assays, we observed that immunization with HSV-2 dl5-29 virus reduced disease, viral shedding, seroconversion, and latent infection by the HSV-2 challenge virus. Therefore, it may be feasible to obtain protection against genital disease, seroconversion and latent infection by immunization, even if sterilizing immunity is not achieved. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. On the role of vaccine dose and antigenic distance in the transmission dynamics of Highly Pathogenic Avian Influenza (HPAI) H5N1 virus and its selected mutants in vaccinated animals

    NARCIS (Netherlands)

    Sitaras, Ioannis

    2017-01-01

    Influenza virus infections can cause high morbidity and mortality rates among animals and humans, and result in staggering direct and indirect financial losses amounting to billions of US dollars. Ever since it emerged in 1996 in Guangdong province, People’s Republic of China, one particular

  19. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    International Nuclear Information System (INIS)

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  20. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    Science.gov (United States)

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  1. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  2. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  3. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  4. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  5. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  6. Efficient production of infectious viruses requires enzymatic activity of Epstein-Barr virus protein kinase.

    Science.gov (United States)

    Murata, Takayuki; Isomura, Hiroki; Yamashita, Yoriko; Toyama, Shigenori; Sato, Yoshitaka; Nakayama, Sanae; Kudoh, Ayumi; Iwahori, Satoko; Kanda, Teru; Tsurumi, Tatsuya

    2009-06-20

    The Epstein-Barr virus (EBV) BGLF4 gene product is the only protein kinase encoded by the virus genome. In order to elucidate its physiological roles in viral productive replication, we here established a BGLF4-knockout mutant and a revertant virus. While the levels of viral DNA replication of the deficient mutant were equivalent to those of the wild-type and the revertant, virus production was significantly impaired. Expression of the BGLF4 protein in trans fully complemented the low yield of the mutant virus, while expression of a kinase-dead (K102I) form of the protein failed to restore the virus titer. These results demonstrate that BGLF4 plays a significant role in production of infectious viruses and that the kinase activity is crucial.

  7. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Modulation of Translation Initiation Efficiency in Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Friis, Martin Barfred; Rasmussen, Thomas Bruun; Belsham, Graham

    2012-01-01

    Modulation of translation initiation efficiency on classical swine fever virus (CSFV) RNA can be achieved by targeted mutations within the internal ribosome entry site (IRES). In this study, cDNAs corresponding to the wild type (wt) or mutant forms of the IRES of CSFV strain Paderborn were...... in vitro and electroporated into porcine PK15 cells. Rescued mutant viruses were obtained from RNAs that contained mutations within domain IIIf which retained more than 75% of wt translation efficiency. Sequencing of cDNA generated from these rescued viruses verified the maintenance of the introduced...... changes within the IRES. The growth characteristics of each rescued mutant virus were compared to that of the wt virus. It was shown that viable mutant viruses with reduced translation initiation efficiency can be designed and generated and that viruses containing mutations within domain IIIf of the IRES...

  9. Photorepair mutants of Arabidopsis

    International Nuclear Information System (INIS)

    Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

    1997-01-01

    UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

  10. Construindo Marcas Mutantes

    Directory of Open Access Journals (Sweden)

    Elizete De Azevedo Kreutz

    2012-09-01

    Full Text Available O presente artigo é o resultado de estudos realizados desde 2000 e busca instrumentalizar os proñssionals para a construção de Marcas Mutantes, que é   uma tendência contemporânea nas estratégias comunicacionais e de branding. Embora esta estratégia ainda não esteja consolidada, observamos que a mesma tem obtido um crescimento constante e tem sido adotadas pelas mais diferentes categorias de marcas e não apenas por aquelas direcionadas aos jovens, ao esporte, ao entretenimento, como era no principia. Com base na Hermenêutica de Profundidade de Thompson (1995, alicerçada nas pesquisas bibliográficas, de intemet, entrevistas e análise semiótica, desenhamos um método de construção de Marcas Mutantes dividido em sete fases. Como resultado, esperamos que este estudo possa auxiliar na compreensão dos processos envolvidos, ao mesmo tempo que provoque a discussão sobreo mesmo e, por consequência, o seu aprimoramento.

  11. Pathogenesis and micro-anatomic characterization of a cell-adapted mutant foot-and-mouth disease virus in cattle: Impact of the Jumonji C-domain containing protein 6 (JMJD6) and route of inoculation.

    Science.gov (United States)

    Lawrence, Paul; Pacheco, Juan; Stenfeldt, Carolina; Arzt, Jonathan; Rai, Devendra K; Rieder, Elizabeth

    2016-05-01

    A companion study reported Jumonji-C domain containing protein 6 (JMJD6) is involved in an integrin- and HS-independent pathway of FMDV infection in CHO cells. JMJD6 localization was investigated in animal tissues from cattle infected with either wild type A24-FMDV (A24-WT) or mutant FMDV (JMJD6-FMDV) carrying E95K/S96L and RGD to KGE mutations in VP1. Additionally, pathogenesis of mutant JMJD6-FMDV was investigated in cattle through aerosol and intraepithelial lingual (IEL) inoculation. Interestingly, JMJD6-FMDV pathogenesis was equivalent to A24-WT administered by IEL route. In contrast, JMJD6-FMDV aerosol-infected cattle did not manifest signs of FMD and animals showed no detectable viremia. Immunofluorescent microscopy of post-mortem tissue revealed JMJD6-FMDV exclusively co-localized with JMJD6(+) cells while A24-WT was occasionally found in JMJD6(+) cells. In vitro, chemical uptake inhibitors demonstrated JMJD6-FMDV entered cells via clathrin-coated pit endocytosis. In vivo, JMJD6-FMDV exhibited preference for JMJD6(+) cells, but availability of this alternative receptor likely depends on route of inoculation. Copyright © 2016. Published by Elsevier Inc.

  12. Nasally administered Lactobacillus rhamnosus strains differentially modulate respiratory antiviral immune responses and induce protection against respiratory syncytial virus infection.

    Science.gov (United States)

    Tomosada, Yohsuke; Chiba, Eriko; Zelaya, Hortensia; Takahashi, Takuya; Tsukida, Kohichiro; Kitazawa, Haruki; Alvarez, Susana; Villena, Julio

    2013-08-15

    Some studies have shown that nasally administered immunobiotics had the potential to improve the outcome of influenza virus infection. However, the capacity of immunobiotics to improve protection against respiratory syncytial virus (RSV) infection was not investigated before. The aims of this study were: a) to evaluate whether the nasal administration of Lactobacillus rhamnosus CRL1505 (Lr05) and L. rhamnosus CRL1506 (Lr06) are able to improve respiratory antiviral defenses and beneficially modulate the immune response triggered by TLR3/RIG-I activation; b) to investigate whether viability of Lr05 or Lr06 is indispensable to modulate respiratory immunity and; c) to evaluate the capacity of Lr05 and Lr06 to improve the resistance of infant mice against RSV infection. Nasally administered Lr05 and Lr06 differentially modulated the TLR3/RIG-I-triggered antiviral respiratory immune response. Lr06 administration significantly modulated the production of IFN-α, IFN-β and IL-6 in the response to poly(I:C) challenge, while nasal priming with Lr05 was more effective to improve levels of IFN-γ and IL-10. Both viable Lr05 and Lr06 strains increased the resistance of infant mice to RSV infection while only heat-killed Lr05 showed a protective effect similar to those observed with viable strains. The present work demonstrated that nasal administration of immunobiotics is able to beneficially modulate the immune response triggered by TLR3/RIG-I activation in the respiratory tract and to increase the resistance of mice to the challenge with RSV. Comparative studies using two Lactobacillus rhamnosus strains of the same origin and with similar technological properties showed that each strain has an specific immunoregulatory effect in the respiratory tract and that they differentially modulate the immune response after poly(I:C) or RSV challenges, conferring different degree of protection and using distinct immune mechanisms. We also demonstrated in this work that it is possible

  13. The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

    Directory of Open Access Journals (Sweden)

    Jeong Byung-Hoon

    2011-08-01

    Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

  14. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  15. Isozyme differences in barley mutants

    Energy Technology Data Exchange (ETDEWEB)

    AI-Jibouri, A A.M.; Dham, K M [Department of Botany, Nuclear Research Centre, Baghdad (Iraq)

    1990-01-01

    Full text: Thirty mutants (M{sub 11}) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  16. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  17. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    International Nuclear Information System (INIS)

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  18. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  19. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  20. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    International Nuclear Information System (INIS)

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  1. Application of the LR-56 at DOE Facilities in the United States

    International Nuclear Information System (INIS)

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  2. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    International Nuclear Information System (INIS)

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  3. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  4. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  5. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  6. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  7. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    International Nuclear Information System (INIS)

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  8. Evaluation of tall rice mutant

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1989-01-01

    One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs

  9. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Comparative evaluation of oral and intranasal priming with replication-competent adenovirus 5 host range mutant (Ad5hr)-simian immunodeficiency virus (SIV) recombinant vaccines on immunogenicity and protective efficacy against SIV(mac251).

    Science.gov (United States)

    Zhou, Qifeng; Hidajat, Rachmat; Peng, Bo; Venzon, David; Aldrich, M Kristine; Richardson, Ersell; Lee, Eun Mi; Kalyanaraman, V S; Grimes, George; Gómez-Román, V Raúl; Summers, L Ebonita; Malkevich, Nina; Robert-Guroff, Marjorie

    2007-11-19

    Oral, replication-competent Ad-HIV vaccines are advancing to human trials. Previous evaluation of protective efficacy in non-human primates has primarily followed upper respiratory tract administrations. Here we compared sequential oral (O/O) versus intranasal/oral (I/O) priming of rhesus macaques with Ad5 host range mutant-SIV recombinants expressing SIV env/rev, gag, and nef genes followed by boosting with SIV gp120 protein. Cellular immune responses in PBMC were stronger and more frequent after I/O administration. Both groups developed mucosal immunity, including memory cells in bronchial alveolar lavage, and gut-homing receptors on PBMC. Following intrarectal SIV(mac251) challenge, both groups exhibited equivalent, significant protection and robust post-challenge cellular immunity. Our results illustrate the promise of oral replication-competent Ad-recombinant vaccines. Pre-challenge PBMC ELISPOT and proliferative responses did not predict protection in the O/O group, highlighting the need for simple, non-invasive methods to reliably assess mucosal immunity.

  11. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  13. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    International Nuclear Information System (INIS)

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  14. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  15. The Swedish mutant barley collection

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-07-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  16. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  17. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  18. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  19. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  20. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    International Nuclear Information System (INIS)

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  1. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    International Nuclear Information System (INIS)

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  2. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    International Nuclear Information System (INIS)

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  3. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    International Nuclear Information System (INIS)

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  4. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  5. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    International Nuclear Information System (INIS)

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  6. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    International Nuclear Information System (INIS)

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  7. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    International Nuclear Information System (INIS)

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  8. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  9. Fluorometric assay for phenotypic differentiation of drug-resistant HIV mutants

    OpenAIRE

    Zhu, Qinchang; Yu, Zhiqiang; Kabashima, Tsutomu; Yin, Sheng; Dragusha, Shpend; El-Mahdy, Ahmed F. M.; Ejupi, Valon; Shibata, Takayuki; Kai, Masaaki

    2015-01-01

    Convenient drug-resistance testing of viral mutants is indispensable to effective treatment of viral infection. We developed a novel fluorometric assay for phenotypic differentiation of drug-resistant mutants of human immunodeficiency virus-I protease (HIV-PR) which uses enzymatic and peptide-specific fluorescence (FL) reactions and high-performance liquid chromatography (HPLC) of three HIV-PR substrates. This assay protocol enables use of non-purified enzyme sources and multiple substrates f...

  10. Root hair mutants of barley

    International Nuclear Information System (INIS)

    Engvild, K.C.; Rasmussen, K.

    2005-01-01

    Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

  11. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  12. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  13. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  14. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  15. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  16. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    DEFF Research Database (Denmark)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  17. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  18. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  19. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  20. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  1. Mutants induced in winter rye (Secale cereale L.): Short straw-mutant No. 2714 and late-senescence mutant

    Energy Technology Data Exchange (ETDEWEB)

    Muszynski, S; Darlewska, M [Department of Plant Breeding and Seed Science, Warsaw Agricultural University, Warsaw (Poland)

    1990-01-01

    Full text: Mutants were induced by treating dormant seeds with ionizing radiation (fast neutrons) or chemicals (N-nitroso-N-ethyl urea or sodium azide). Among several mutants obtained, of special value is the short-straw mutant No. 2714 and a late senescent mutant. (author)

  2. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Science.gov (United States)

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  4. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  5. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  6. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Directory of Open Access Journals (Sweden)

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  7. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    International Nuclear Information System (INIS)

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  8. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  9. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  10. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Directory of Open Access Journals (Sweden)

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  11. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  12. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  13. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  14. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  16. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    OpenAIRE

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  17. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  18. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  19. Mutant power: using mutant allele collections for yeast functional genomics.

    Science.gov (United States)

    Norman, Kaitlyn L; Kumar, Anuj

    2016-03-01

    The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Directory of Open Access Journals (Sweden)

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  1. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  2. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  3. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  4. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  5. An extra early mutant of pigeonpea

    International Nuclear Information System (INIS)

    Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

    2001-01-01

    The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

  6. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  7. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  8. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Science.gov (United States)

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  9. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    OpenAIRE

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  11. Rational design of a live attenuated dengue vaccine: 2'-o-methyltransferase mutants are highly attenuated and immunogenic in mice and macaques.

    Directory of Open Access Journals (Sweden)

    Roland Züst

    Full Text Available Dengue virus is transmitted by Aedes mosquitoes and infects at least 100 million people every year. Progressive urbanization in Asia and South-Central America and the geographic expansion of Aedes mosquito habitats have accelerated the global spread of dengue, resulting in a continuously increasing number of cases. A cost-effective, safe vaccine conferring protection with ideally a single injection could stop dengue transmission. Current vaccine candidates require several booster injections or do not provide protection against all four serotypes. Here we demonstrate that dengue virus mutants lacking 2'-O-methyltransferase activity are highly sensitive to type I IFN inhibition. The mutant viruses are attenuated in mice and rhesus monkeys and elicit a strong adaptive immune response. Monkeys immunized with a single dose of 2'-O-methyltransferase mutant virus showed 100% sero-conversion even when a dose as low as 1,000 plaque forming units was administrated. Animals were fully protected against a homologous challenge. Furthermore, mosquitoes feeding on blood containing the mutant virus were not infected, whereas those feeding on blood containing wild-type virus were infected and thus able to transmit it. These results show the potential of 2'-O-methyltransferase mutant virus as a safe, rationally designed dengue vaccine that restrains itself due to the increased susceptibility to the host's innate immune response.

  12. Dwarf mutant of rice variety Seratus Malam

    International Nuclear Information System (INIS)

    Mugiono, P. S.; Soemanggono, A.M.R.

    1989-01-01

    Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)

  13. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  14. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    Directory of Open Access Journals (Sweden)

    R. Greco

    2013-09-01

    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  15. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  16. Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

    International Nuclear Information System (INIS)

    Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee; Schriewer, Jill; Evans, David H.; Buller, R. Mark; Barry, Michele

    2014-01-01

    Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus

  17. Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

    Energy Technology Data Exchange (ETDEWEB)

    Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Schriewer, Jill [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Evans, David H. [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Buller, R. Mark [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Barry, Michele, E-mail: michele.barry@ualberta.ca [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada)

    2014-05-15

    Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus.

  18. PNRI mutant variety: Cordyline 'Afable'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2012-01-01

    Cordyline 'Afable', registered by the Philippine Nuclear Research Institute as NSIC 2009 Or-83, is an induced mutant developed from Cordyline 'Kiwi' by treating stem cuttings with acute gamma radiation from a Cobalt-60 source. The new mutant is identical to Cordyline 'Kiwi' in growth habit but differs in foliage color, and exhibits field resistance to Phytophthora sp., a fungus that causes leaf blight and rot in Ti plants. Results of this mutation breeding experiment showed that leaf color was altered by gamma irradiation and resistance to fungal diseases was improved. It also demonstrated how mutations that occur in nature may be generated artificially. Propagation of cordyline 'Afable' is true-to-type by vegetative propagation methods, such as separation of suckers and offshoots, shoot tip cutting, and top cutting. Aside from landscaping material, terrarium or dish-garden plant, it is ideal as containerized plant for indoor and outdoor use. The leaves or shoots may be harvested as cut foliage for flower arrangements. (author)

  19. Shallow Boomerang-shaped Influenza Hemagglutinin G13A Mutant Structure Promotes Leaky Membrane Fusion*

    Science.gov (United States)

    Lai, Alex L.; Tamm, Lukas K.

    2010-01-01

    Our previous studies showed that an angled boomerang-shaped structure of the influenza hemagglutinin (HA) fusion domain is critical for virus entry into host cells by membrane fusion. Because the acute angle of ∼105° of the wild-type fusion domain promotes efficient non-leaky membrane fusion, we asked whether different angles would still support fusion and thus facilitate virus entry. Here, we show that the G13A fusion domain mutant produces a new leaky fusion phenotype. The mutant fusion domain structure was solved by NMR spectroscopy in a lipid environment at fusion pH. The mutant adopted a boomerang structure similar to that of wild type but with a shallower kink angle of ∼150°. G13A perturbed the structure of model membranes to a lesser degree than wild type but to a greater degree than non-fusogenic fusion domain mutants. The strength of G13A binding to lipid bilayers was also intermediate between that of wild type and non-fusogenic mutants. These membrane interactions provide a clear link between structure and function of influenza fusion domains: an acute angle is required to promote clean non-leaky fusion suitable for virus entry presumably by interaction of the fusion domain with the transmembrane domain deep in the lipid bilayer. A shallower angle perturbs the bilayer of the target membrane so that it becomes leaky and unable to form a clean fusion pore. Mutants with no fixed boomerang angle interacted with bilayers weakly and did not promote any fusion or membrane perturbation. PMID:20826788

  20. Target virus log10 reduction values determined for two reclaimed wastewater irrigation scenarios in Japan based on tolerable annual disease burden.

    Science.gov (United States)

    Ito, Toshihiro; Kitajima, Masaaki; Kato, Tsuyoshi; Ishii, Satoshi; Segawa, Takahiro; Okabe, Satoshi; Sano, Daisuke

    2017-11-15

    Multiple-barriers are widely employed for managing microbial risks in water reuse, in which different types of wastewater treatment units (biological treatment, disinfection, etc.) and health protection measures (use of personal protective gear, vegetable washing, etc.) are combined to achieve a performance target value of log 10 reduction (LR) of viruses. The LR virus target value needs to be calculated based on the data obtained from monitoring the viruses of concern and the water reuse scheme in the context of the countries/regions where water reuse is implemented. In this study, we calculated the virus LR target values under two exposure scenarios for reclaimed wastewater irrigation in Japan, using the concentrations of indigenous viruses in untreated wastewater and a defined tolerable annual disease burden (10 -4 or 10 -6 disability-adjusted life years per person per year (DALY pppy )). Three genogroups of norovirus (norovirus genogroup I (NoV GI), geogroup II (NoV GII), and genogroup IV (NoV GIV)) in untreated wastewater were quantified as model viruses using reverse transcription-microfluidic quantitative PCR, and only NoV GII was present in quantifiable concentration. The probabilistic distribution of NoV GII concentration in untreated wastewater was then estimated from its concentration dataset, and used to calculate the LR target values of NoV GII for wastewater treatment. When an accidental ingestion of reclaimed wastewater by Japanese farmers was assumed, the NoV GII LR target values corresponding to the tolerable annual disease burden of 10 -6 DALY pppy were 3.2, 4.4, and 5.7 at 95, 99, and 99.9%tile, respectively. These percentile values, defined as "reliability," represent the cumulative probability of NoV GII concentration distribution in untreated wastewater below the corresponding tolerable annual disease burden after wastewater reclamation. An approximate 1-log 10 difference of LR target values was observed between 10 -4 and 10 -6 DALY pppy

  1. Gamma ray induced mutants in Coleus

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

  2. Gamma ray induced mutants in Coleus

    Energy Technology Data Exchange (ETDEWEB)

    Vasudevan, K; Jos, J S [Central Tuber Crops Research Institute, Trivandrum, Kerala (India)

    1988-07-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M{sub 1}V{sub 1} generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m{sup 2} area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing.

  3. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  4. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

    Science.gov (United States)

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  6. Immunization against Genital Herpes with a Vaccine Virus That has Defects in Productive and Latent Infection

    Science.gov (United States)

    da Costa, Xavier J.; Jones, Cheryl A.; Knipe, David M.

    1999-06-01

    An effective vaccine for genital herpes has been difficult to achieve because of the limited efficacy of subunit vaccines and the safety concerns about live viruses. As an alternative approach, mutant herpes simplex virus strains that are replication-defective can induce protective immunity. To increase the level of safety and to prove that replication was not needed for immunization, we constructed a mutant herpes simplex virus 2 strain containing two deletion mutations, each of which eliminated viral replication. The double-mutant virus induces protective immunity that can reduce acute viral shedding and latent infection in a mouse genital model, but importantly, the double-mutant virus shows a phenotypic defect in latent infection. This herpes vaccine strain, which is immunogenic but has defects in both productive and latent infection, provides a paradigm for the design of vaccines and vaccine vectors for other sexually transmitted diseases, such as AIDS.

  7. Calreticulin mutants in mice induce an MPL-dependent thrombocytosis with frequent progression to myelofibrosis.

    Science.gov (United States)

    Marty, Caroline; Pecquet, Christian; Nivarthi, Harini; El-Khoury, Mira; Chachoua, Ilyas; Tulliez, Micheline; Villeval, Jean-Luc; Raslova, Hana; Kralovics, Robert; Constantinescu, Stefan N; Plo, Isabelle; Vainchenker, William

    2016-03-10

    Frameshift mutations in the calreticulin (CALR) gene are seen in about 30% of essential thrombocythemia and myelofibrosis patients. To address the contribution of the CALR mutants to the pathogenesis of myeloproliferative neoplasms, we engrafted lethally irradiated recipient mice with bone marrow cells transduced with retroviruses expressing these mutants. In contrast to wild-type CALR, CALRdel52 (type I) and, to a lesser extent, CALRins5 (type II) induced thrombocytosis due to a megakaryocyte (MK) hyperplasia. Disease was transplantable into secondary recipients. After 6 months, CALRdel52-, in contrast to rare CALRins5-, transduced mice developed a myelofibrosis associated with a splenomegaly and a marked osteosclerosis. Monitoring of virus-transduced populations indicated that CALRdel52 leads to expansion at earlier stages of hematopoiesis than CALRins5. However, both mutants still specifically amplified the MK lineage and platelet production. Moreover, a mutant deleted of the entire exon 9 (CALRdelex9) did not induce a disease, suggesting that the oncogenic property of CALR mutants was related to the new C-terminus peptide. To understand how the CALR mutants target the MK lineage, we used a cell-line model and demonstrated that the CALR mutants, but not CALRdelex9, specifically activate the thrombopoietin (TPO) receptor (MPL) to induce constitutive activation of Janus kinase 2 and signal transducer and activator of transcription 5/3/1. We confirmed in c-mpl- and tpo-deficient mice that expression of Mpl, but not of Tpo, was essential for the CALR mutants to induce thrombocytosis in vivo, although Tpo contributes to disease penetrance. Thus, CALR mutants are sufficient to induce thrombocytosis through MPL activation. © 2016 by The American Society of Hematology.

  8. Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

    Science.gov (United States)

    Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

    2018-06-01

    There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

  9. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    International Nuclear Information System (INIS)

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  10. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  11. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  12. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Science.gov (United States)

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

    2012-10-01

    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  13. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  14. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Science.gov (United States)

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

    2016-01-01

    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  15. Studies on reduced height mutants in rice

    International Nuclear Information System (INIS)

    Narahari, P.; Bhagwat, S.G.

    1984-01-01

    Two cross-bred derivatives of the mutant TR5xTR17 and TR21 continued to show promise and were advanced to wider scale testing. TR5 was found to carry a semi-dwarfing gene different from that in IR8. New semi-dwarf mutants were screened from M 2 through M 4 from two separate radiation experiments. The gibberellin response of seedlings of mutant and tester strains was evaluated and crosses of tester stocks and mutant semi-dwarfs were made for genetic analyses. (author)

  16. Involvement of C4 protein of beet severe curly top virus (family Geminiviridae in virus movement.

    Directory of Open Access Journals (Sweden)

    Kunling Teng

    Full Text Available BACKGROUND: Beet severe curly top virus (BSCTV is a leafhopper transmitted geminivirus with a monopartite genome. C4 proteins encoded by geminivirus play an important role in virus/plant interaction. METHODS AND FINDINGS: To understand the function of C4 encoded by BSCTV, two BSCTV mutants were constructed by introducing termination codons in ORF C4 without affecting the amino acids encoded by overlapping ORF Rep. BSCTV mutants containing disrupted ORF C4 retained the ability to replicate in Arabidopsis protoplasts and in the agro-inoculated leaf discs of N. benthamiana, suggesting C4 is not required for virus DNA replication. However, both mutants did not accumulate viral DNA in newly emerged leaves of inoculated N. benthamiana and Arabidopsis, and the inoculated plants were asymptomatic. We also showed that C4 expression in plant could help C4 deficient BSCTV mutants to move systemically. C4 was localized in the cytosol and the nucleus in both Arabidopsis protoplasts and N. benthamiana leaves and the protein appeared to bind viral DNA and ds/ssDNA nonspecifically, displaying novel DNA binding properties. CONCLUSIONS: Our results suggest that C4 protein in BSCTV is involved in symptom production and may facilitate virus movement instead of virus replication.

  17. Genetic fingerprinting of mutant rose cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S; Prasad, K V; Singh, K P; Singh, A.P. [Division of Floriculture and Landscaping, Indian Agricultural Research Institute, Pusa, New Delhi (India)], E-mail: kvprasad66@gmail.com

    2008-07-01

    Six rose mutants evolved at the Indian Agricultural Research Institute, New Delhi from four parent cultivars were characterized based on RAPD markers. Contrary to the earlier findings our effort has conclusively proven that the RAPD markers are indeed robust tools to discern the mutants from their parents. Among 40 primers screened, 7 primers produced inconsistent banding pattern. The number of polymorphic bands varied between 4 (OPA 14) and 10 (OPA1) with an average of 6.5 bands per primer. The percentage polymorphism ranged from 62.5 (OPM 9) to 100 percent (OPA 1). Most of the primers produced monomorphic bands between parent and mutant rose cultivars. When primer OPA 2 was used a specific band of 2.5 kb was noticed in mutant cv. Pusa Urmil and cv. Pusa Abhishek but was absent in parent cv. Jantar Mantar. A polymorphic band of 750 bp was noticed in the parent Kiss of Fire and helped in differentiating the parent from its mutant when amplified with OPK 3. Primer OPS 16 produced discriminatory band of 800 bp in mutant cv. Pink Sport of Montezuma while it was absent in its parent cv. Montezuma. Another specific band of 650 bp was present in parent cv. Montezuma and absent in its mutant cv. Pink Sport of Montezuma signifying the uniqueness of the mutant. Primer OPM 5 brought out distinct polymorphism among the parent Jantar Mantar and its three mutants with absence of a specific band of 1.5 kb in the parent. The four parents and 6 mutants were divided into four distinct groups in the Dendogram constructed by UPGMA method. The most genetically similar cultivar among the 10 cultivars analyzed are Montezuma and its pink sport of Montezuma whereas Abhisarika a mutant of cv. Kiss of Fire was distinctly different and formed a separate cluster. (author)

  18. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  19. Chikungunya virus

    Science.gov (United States)

    Chikungunya virus infection; Chikungunya ... Where Chikungunya is Found Before 2013, the virus was found in Africa, Asia, Europe, and the Indian and Pacific oceans. In late 2013, outbreaks occurred for the first time in the ...

  20. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  1. Zika Virus

    Science.gov (United States)

    ... Funding CDC Activities For Healthcare Providers Clinical Evaluation & Disease Sexual Transmission HIV Infection & Zika Virus Testing for Zika Test Specimens – At Time of Birth Diagnostic Tests Understanding Zika Virus Test Results ...

  2. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    International Nuclear Information System (INIS)

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  4. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

  5. A mutant of a mutant of a mutant of a ...: Irradiation of progressive radiation-induced mutants in a mutation-breeding programme with Chrysanthenum morifolium RAM

    International Nuclear Information System (INIS)

    Broertjes, C.; Koene, P.; Veen, J.W.H. van.

    1980-01-01

    Radiation-induced sports in Chrysanthemum morifolium RAM. have been reported for several years. It has become an everyday practice to produce flower-colour mutants from outstanding cross-breeding products, even before they are distributed for the commercial production of cut flowers. One of the most successful and recent examples is that of cv. Horim, of which hundreds of mutants were produced by successive use of radiation-induced mutants in the mutation-breeding programme. Over about 4 years a variety of flower-colour mutants was obtained, not only largely including the outstanding characteristics of the original cultivar but sometimes even with an appreciable improvement in quality and yield. It is expected that the latter types, the Miros group, will soon completely supersede the spontaneous or raditation-induced Horim sports and mutants and take over the leading position of the Horim group in the production of all-year-round (AYR) cut-flowers. (orig.)

  6. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  7. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  8. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  9. Los mutantes de la escuela

    Directory of Open Access Journals (Sweden)

    Diego Armando Jaramillo-Ocampo

    2013-01-01

    Full Text Available El presente artículo muestra los resultados parciales del estudio “Juegos en el recreo escolar: un escenario para la formación ciudadana”, cuya pretensión fue comprender los imaginarios sociales de juego en el recreo escolar y su relación con la convivencia social desde la proximidad del enfoque de complementariedad y el diseño de investigación emergente, planteado por Murcia y Jaramillo (2008. Se presentan los desarrollos logrados en dos categorías centrales del estudio: el patio y el cuerpo; dos categorías que mutan constantemente como entidades vivas en la escuela, hacia la configuración de sujetos que reconocen en el otro y lo otro su posibilidad. La escuela viva, donde es posible “ser en relación con”… se reduce a un espacio temporal y físico, limitado por la campana, “el recreo”. El texto muestra, desde la voz de los actores, esa vida que se da y se quita en la escuela y que se posiciona como una más de las imposiciones normalizadas para controlar. Reconoce, finalmente, una propuesta desde la posibilidad que estos dos mutantes propician para una escuela libre y dinámica.

  10. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  11. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    International Nuclear Information System (INIS)

    Cerrada, Lucia; San Martin, Jesus

    2011-01-01

    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  12. Fitness ranking of individual mutants drives patterns of epistatic interactions in HIV-1.

    Directory of Open Access Journals (Sweden)

    Javier P Martínez

    Full Text Available Fitness interactions between mutations, referred to as epistasis, can strongly impact evolution. For RNA viruses and retroviruses with their high mutation rates, epistasis may be particularly important to overcome fitness losses due to the accumulation of deleterious mutations and thus could influence the frequency of mutants in a viral population. As human immunodeficiency virus type 1 (HIV-1 resistance to azidothymidine (AZT requires selection of sequential mutations, it is a good system to study the impact of epistasis. Here we present a thorough analysis of a classical AZT-resistance pathway (the 41-215 cluster of HIV-1 variants by fitness measurements in single round infection assays covering physiological drug concentrations ex vivo. The sign and value of epistasis varied and did not predict the epistatic effect on the mutant frequency. This complex behavior is explained by the fitness ranking of the variants that strongly depends on environmental factors, i.e., the presence and absence of drugs and the host cells used. Although some interactions compensate fitness losses, the observed small effect on the relative mutant frequencies suggests that epistasis might be inefficient as a buffering mechanism for fitness losses in vivo. While the use of epistasis-based hypotheses to make general assumptions on the evolutionary dynamics of viral populations is appealing, our data caution their interpretation without further knowledge on the characteristics of the viral mutant spectrum under different environmental conditions.

  13. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  14. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  15. Induction of Mutants in Durum Wheat

    International Nuclear Information System (INIS)

    AL-Ubaidi, M.; Ibrahim, I.; AL-Hadithi, A.

    2002-01-01

    This investigation presents a breeding program for induction and development of a new genotype of durum wheat, resistant to lodging with high yield, by irradiation durum wheat hybrids (F2) with gamma rays 100 Gy, during 1990-1997 cultivation seasons. This program involves: induction of variability, selection evaluation of the mutants at three locations: Twaitha (Baghdad) Latifya ( Babylon) and Swari (Kutt). All mutants showed resistance to lodging and there was a significant reduction in plant height. Mutant SIXIZ-22 surpassed other mutants and its origin in lodging resistance and plant height (83.5,82.8 and 89.4 cm) in the three locations at generation M5 and M6, respectively. Also, there were significant differences between mutant and their origin in the number of spikes/M 2 and grain yild during the two successive generation. On the other hand, mutant IZxCO-105 surpassed other mutants in the number of spikes/M 2 (231.8,242.3 and 292) and grain yield (4336,3376 and 5232 kg/ha) in all testing location, respectively . (authors) 14 refs., 4 tabs

  16. Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants

    Directory of Open Access Journals (Sweden)

    Xueyong Zhu

    2015-11-01

    Full Text Available Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA mutants from ferret-transmissible H5N1 viruses of A/Vietnam/1203/2004 and A/Indonesia/5/2005 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6-linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3-linked sialosides. Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogs reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.

  17. Functional Analysis of Glycosylation of Zika Virus Envelope Protein

    Directory of Open Access Journals (Sweden)

    Camila R. Fontes-Garfias

    2017-10-01

    Full Text Available Summary: Zika virus (ZIKV infection causes devastating congenital abnormities and Guillain-Barré syndrome. The ZIKV envelope (E protein is responsible for viral entry and represents a major determinant for viral pathogenesis. Like other flaviviruses, the ZIKV E protein is glycosylated at amino acid N154. To study the function of E glycosylation, we generated a recombinant N154Q ZIKV that lacks the E glycosylation and analyzed the mutant virus in mammalian and mosquito hosts. In mouse models, the mutant was attenuated, as evidenced by lower viremia, decreased weight loss, and no mortality; however, knockout of E glycosylation did not significantly affect neurovirulence. Mice immunized with the mutant virus developed a robust neutralizing antibody response and were completely protected from wild-type ZIKV challenge. In mosquitoes, the mutant virus exhibited diminished oral infectivity for the Aedes aegypti vector. Collectively, the results demonstrate that E glycosylation is critical for ZIKV infection of mammalian and mosquito hosts. : Zika virus (ZIKV causes devastating congenital abnormities and Guillain-Barré syndrome. Fontes-Garfias et al. showed that the glycosylation of ZIKV envelope protein plays an important role in infecting mosquito vectors and pathogenesis in mouse. Keywords: Zika virus, glycosylation, flavivirus entry, mosquito transmission, vaccine

  18. Intracistronic complementation in the simian virus 40 A gene.

    Science.gov (United States)

    Tornow, J; Cole, C N

    1983-01-01

    A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

  19. Spectrum of induced floral mutants in Petunia

    International Nuclear Information System (INIS)

    Padmaja, V.; Sudhakar, P.

    1987-01-01

    A total of six floral mutants of garden Petunia isolated from the populations raised from the seed treatment with γ-rays, 2, 4-D and sodium azide are described. Five of the mutants viz. stellata, Campyloflora, Rubriflora mixed, Grandiflora and Albiflora mixed originated as segregants in M 2 generation while the chimeral floral phenotype was expressed in M 1 generation itself. Breeding behaviour of these horticulturally interesting altered floral phenotypes were studied in subsequent generations and appropriate conclusions were drawn regarding mode of inheritance of the mutant traits. 15 refs., 4 figures, 1 table. (author)

  20. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

    2018-03-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  1. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  2. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  3. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  4. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Science.gov (United States)

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  5. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    International Nuclear Information System (INIS)

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

    1998-01-01

    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  6. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

    2014-04-18

    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  7. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    NARCIS (Netherlands)

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

    2016-01-01

    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  8. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  9. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  10. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Science.gov (United States)

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

    2013-05-01

    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  11. Semi-dwarf mutants for rice improvement

    International Nuclear Information System (INIS)

    Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli

    1990-01-01

    Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)

  12. X-rays sensitive mammalian cell mutant

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1982-01-01

    A phenomenon that in x-ray-sensitive mammalian-cell mutants, cellular death due to x-ray radiation was not increased by caffeine, but on the contrary, the dead cells were resuscitated by it was discussed. The survival rate of mutant cells increased by caffein in a low concentration. This suggested that caffeine may have induced some mechanism to produce x-ray resistant mutant cells. Postirradiation treatment with caffeine increased considerably the survival rate of the mutant cells, and this suggested the existence of latent caffeine-sensitive potentially lethal damage repair system. This system, after a few hours, is thought to be substituted by caffeine-resistant repair system which is induced by caffeine, and this may be further substituted by x-ray-resistant repair system. The repair system was also induced by adenine. (Ueda, J.)

  13. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    acer

    2014-01-08

    Jan 8, 2014 ... aquatic ecosystems were studied. In the present ... logy and photosynthesis research (Stolbov, 1995;. Pedersen ... Microalgal strain and cultivation conditions ..... evaluated for their ecotoxicological effects using 124y-1 mutant.

  14. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Science.gov (United States)

    Siuly; Li, Yan; Paul Wen, Peng

    2014-03-01

    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Molecular analysis of waxy mutants in rice

    International Nuclear Information System (INIS)

    Yatou, O.; Amano, E.

    1990-01-01

    Full text: The 'waxy' gene is a structural gene coding a glycosyl transferase which synthesises amylose in the endosperm tissue. 'Non-waxy' rice cultivars have an active gene and their amylose content is 18-25% depending upon gene performance and modifier genes. In 'waxy' rice, no amylose is found because the enzyme is absent. In mutants induced by gamma rays, neutrons, EI or EMS, amylose content ranged from 0 to 20%, i.e. there are intermediate phenotypes as well. Some of them had the same amount of the enzyme as a 'non-waxy' cultivar, even fully 'waxy' mutants showed a certain amount of the enzyme. This suggests that in mutants there may be no structural change in the enzyme gene but the enzyme produced might be less active. By molecular analysis of the mutants' genes it was found that only two mutants induced by thermal neutrons show structural alterations, the changes in other mutants are either too small to be detected by Southern analysis or are outside the structural gene in question. (author)

  16. Commercialization Of Orchid Mutants For Floriculture Industry

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Zaiton Ahmad

    2014-01-01

    Orchids are the main contributors to cut flower industry in Malaysia with an existing good market and a huge business potential. Orchid industry has been established in Malaysia since 1960s but only started to develop and expand since 1980s. Continuous development of new orchid varieties is essential to meet customers' demands. Orchid mutagenesis research using gamma irradiation at Malaysian Nuclear Agency has successfully generated a number of new orchid varieties with commercial potentials. Therefore, Nuclear Malaysia has collaborated with an industrial partner, Hexagon Green Sdn Bhd (HGSB), to carry out commercialization research on these mutants under a Technofund project entitled 'Pre-Commercialization of Mutant Orchids for Cut Flowers Industry' from July 2011 to July 2014. Through this collaboration, Dendrobium orchid mutant plants developed by Nuclear Malaysia were transferred to HGSB's commercial orchid nursery at Bukit Changgang Agrotechnology Park, Banting, Selangor, for mass-propagation. The activities include evaluations on plant growth performance, flower quality, post harvest and market potential of these mutants. Mutants with good field performance have been identified and filed for Plant Variety Protection (PVP) with Department of Agriculture Malaysia. This paper describes outputs from this collaboration and activities undertaken in commercializing these mutants. (author)

  17. Detection of rainbow trout antibodies against viral haemorrhagic septicaemia virus (VHSV) by neutralisation test is highly dependent on the virus isolate used

    DEFF Research Database (Denmark)

    Fregeneda-Grandes, J.M.; Olesen, Niels Jørgen

    2007-01-01

    with VHS but with no clinical signs of infection. When the sera were examined by 50%PNT using the VHSV reference isolate DK-F1 or the heat attenuated DK-F25 mutant strain, no neutralizing antibodies were found. In contrast, when one of the virus isolates from the farm (homologous virus) was used in the 50...

  18. From one body mutant to one cell mutant. A progress of radiation breeding in crops

    International Nuclear Information System (INIS)

    Nagatomi, Shigeki

    1996-01-01

    An effective method was established to obtain non-chimeral mutants with wide spectrum of flower colors, regenerated from floral organs on which mutated sectors were come out on chronic irradiated plants. By this way, six mutant varieties of flower colors have been selected from one pink flower of chrysanthemum, and cultivated for cut-flower production. By the same method, 3 mutant varieties with small and spray type flowers were selected in Eustoma. Mutant varieties such as a rust disease resistant in sugarcane, 6 dwarfs in Cytisus and pure-white mushroom in velvet shank have been selected successively for short period. (J.P.N.)

  19. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 2. Comparison of Various Mutants

    International Nuclear Information System (INIS)

    Balchiuniene, L.

    1995-01-01

    Spontaneous and gamma-induced mutability was compared in two groups of genetically unstable barley ear structure mutants - tweaky spike (tw) and branched ear (be). Instability in different loci causes different levels of spontaneous and gamma-induced mutability. A high spontaneous level of chlorophyll mutations is peculiar to be-ust mutants. It is suggested that the high level of induced chlorophyll mutations in allelic tw mutants is a result of better surviving of chlorophyll mutation carriers in the genotypical-physiological environment created by mutant tw alleles. (author). 6 refs., 2 tabs

  20. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  1. Sequence adaptations during growth of rescued classical swine fever viruses in cell culture and within infected pigs

    DEFF Research Database (Denmark)

    Hadsbjerg, Johanne; Friis, Martin Barfred; Fahnøe, Ulrik

    2016-01-01

    RNA could be detected. However, the animals inoculated with these mutant viruses seroconverted against CSFV. Thus, these mutant viruses were highly attenuated in vivo. All 4 rescued viruses were also passaged up to 20 times in cell culture. Using full genome sequencing, the same two adaptations within......Classical swine fever virus (CSFV) causes an economically important disease of swine. Four different viruses were rescued from full-length cloned cDNAs derived from the Paderborn strain of CSFV. Three of these viruses had been modified by mutagenesis (with 7 or 8 nt changes) within stem 2...... each of four independent virus populations were observed that restored the coding sequence to that of the parental field strain. These adaptations occurred with different kinetics. The combination of reverse genetics and in depth, full genome sequencing provides a powerful approach to analyse virus...

  2. Officially released mutant varieties in China

    International Nuclear Information System (INIS)

    Liu, L.; Van Zanten, L.; Shu, Q.Y.; Maluszynski, M.

    2004-01-01

    The use of mutation techniques for crop improvement in China has a long and well-established tradition of more than 50 years. As the result of intensive research in many institutes dealing with application of nuclear technologies more than 620 cultivars of 44 crop species have been released. Numerous mutant varieties have been grown on a large scale bringing significant economic impact, sustaining crop production and greatly contributing to increase of food production also in stress prone areas of the country. However, there is still missing information not only on the number of mutant varieties released in particular crop species but also on mutagens applied, selection approaches and on the use of mutants in cross breeding. Numerous Chinese scientists collected and systematized this information. Results of their work were often published in local scientific journals in the Chinese language and as such were unavailable to breeders from other countries. Having this in mind, we requested Dr. Liu Luxiang, the Director of the Department of Plant Mutation Breeding and Genetics, Institute for Application of Atomic Energy, Chinese Academy of Agricultural Sciences in Beijing to help us in finding as much information as possible on mutant varieties officially released in China. The data has been collected in close collaboration with his colleagues from various institutions all over the country and then evaluated, edited and prepared for publication by our team responsible for the FAO/IAEA Database of Officially Released Mutant Varieties. We would like to thank all Chinese colleagues who contributed to this list of Chinese mutant varieties. We hope that this publication will stimulate plant breeders in China to collect more information on released mutant varieties and especially on the use of mutated genes in cross breeding. (author)

  3. Development of high yielding mutants in lentil

    International Nuclear Information System (INIS)

    Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.

    2001-01-01

    Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)

  4. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Science.gov (United States)

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  5. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Directory of Open Access Journals (Sweden)

    Maya Safira Dewi

    2011-05-01

    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  6. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    International Nuclear Information System (INIS)

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  7. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  8. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    International Nuclear Information System (INIS)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  9. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    explore the potential of this infection crossing the species barrier and thereby .... The virus targets mainly the brain of the unborn animal resulting in neurological ... The virus is located in the blood of the adult infected animal or in the central ...

  11. Zika Virus

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Zika Virus Credit: NIAID A female Aedes mosquito. This type of mosquito can transmit Zika, ... transmitted to humans through the bite of infected Aedes aegypti mosquitoes. Zika virus can be transmitted from an infected pregnant woman ...

  12. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  13. The research progress on plant mutant germplasm resources in China

    International Nuclear Information System (INIS)

    He Cexi; Ji Linzhen; Zhao Shirong

    1991-07-01

    Mutants induced by nuclear radiation or other mutagens are new artificial germplasm resources. Some mutants have been applied in plant breeding and great achievements have been reached. The status and progress on the collection, identification and utilization of mutants in China are introduced. A proposal for developing mutant germplasm resources with good agronomic characters is suggested

  14. Repair and mutagenesis of herpes simplex virus in UV-irradiated monkey cells

    International Nuclear Information System (INIS)

    Lytle, C.D.; Goddard, J.G.; Lin, C.H.

    1980-01-01

    Mutagenic repair in mammalian cells was investigated by determining the mutagenesis of UV-irradiated or unirradiated herpes simplex virus in UV-irradiated CV-1 monkey kidney cells. These results were compared with the results for UV-enhanced virus reactivation (UVER) in the same experimental situation. High and low multiplicities of infection were used to determine the effects of multiplicity reactivation (MR). UVER and MR were readily demonstrable and were approximately equal in amount in an infectious center assay. For this study, a forward-mutation assay was developed to detect virus mutants resistant to iododeoxycytidine (ICdR), probably an indication of the mutant virus being defective at its thymidine kinase locus. ICdR-resistant mutants did not have a growth advantage over wild-type virus in irradiated or unirradiated cells. Thus, higher fractions of mutant virus indicated greater mutagenesis during virus repair and/or replication. The data showed that: (1) unirradiated virus was mutated in unirradiated cells, providing a background level of mutagenesis; (2) unirradiated virus was mutated about 40% more in irradiated cells, indicating that virus replication (DNA synthesis) became more mutagenic as a result of cell irradiation; (3) irradiated virus was mutated much more (about 6-fold) than unirradiated virus, even in unirradiated cells; (4) cell irradiation did not change the mutagenesis of irradiated virus except at high multiplicity of infection. High multiplicity of infection did not demonstrate UVER or MR alone to be either error-free or error-prone. When the two processes were present simultaneously, they were mutagenic. (orig.)

  15. Mutagenesis-mediated virus extinction: virus-dependent effect of viral load on sensitivity to lethal defection.

    Directory of Open Access Journals (Sweden)

    Héctor Moreno

    Full Text Available BACKGROUND: Lethal mutagenesis is a transition towards virus extinction mediated by enhanced mutation rates during viral genome replication, and it is currently under investigation as a potential new antiviral strategy. Viral load and virus fitness are known to influence virus extinction. Here we examine the effect or the multiplicity of infection (MOI on progeny production of several RNA viruses under enhanced mutagenesis. RESULTS: The effect of the mutagenic base analogue 5-fluorouracil (FU on the replication of the arenavirus lymphocytic choriomeningitis virus (LCMV can result either in inhibition of progeny production and virus extinction in infections carried out at low multiplicity of infection (MOI, or in a moderate titer decrease without extinction at high MOI. The effect of the MOI is similar for LCMV and vesicular stomatitis virus (VSV, but minimal or absent for the picornaviruses foot-and-mouth disease virus (FMDV and encephalomyocarditis virus (EMCV. The increase in mutation frequency and Shannon entropy (mutant spectrum complexity as a result of virus passage in the presence of FU was more accentuated at low MOI for LCMV and VSV, and at high MOI for FMDV and EMCV. We present an extension of the lethal defection model that agrees with the experimental results. CONCLUSIONS: (i Low infecting load favoured the extinction of negative strand viruses, LCMV or VSV, with an increase of mutant spectrum complexity. (ii This behaviour is not observed in RNA positive strand viruses, FMDV or EMCV. (iii The accumulation of defector genomes may underlie the MOI-dependent behaviour. (iv LCMV coinfections are allowed but superinfection is strongly restricted in BHK-21 cells. (v The dissimilar effects of the MOI on the efficiency of mutagenic-based extinction of different RNA viruses can have implications for the design of antiviral protocols based on lethal mutagenesis, presently under development.

  16. Mutations in the S gene region of hepatitis B virus genotype D in ...

    Indian Academy of Sciences (India)

    The gene region of the hepatitis B virus (HBV) is responsible for the expression of surface antigens and includes the 'a'-determinant region. Thus, mutation(s) in this region would afford HBV variants a distinct survival advantage, permitting the mutant virus to escape from the immune system. The aim of this study was to ...

  17. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Vanessa de Farias

    2009-06-01

    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  18. Bacterio-opsin mutants of Halobacterium halobium

    Science.gov (United States)

    Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

    1983-01-01

    The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

  19. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    International Nuclear Information System (INIS)

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

    1987-01-01

    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  20. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    International Nuclear Information System (INIS)

    Vallejo Delgado, L.R.

    1989-01-01

    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  1. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  2. Chlorophyll mutants in Phaseolus vulgaris (L.) Savi

    International Nuclear Information System (INIS)

    Svetleva, D.; Petkova, S.

    1991-01-01

    Three-year investigations were conducted on chlorophyll mutants of three type: viridissima, claroviridis, flavoviridis, viridocostata and xanthomarginata produced post gamma irradiation ( 60 Co, 8 krad, 280 rad/min). Cell division rate in spectrum and in quantity of induced aberrations was found to have no significant differences with the control. Chlorophyll mutations compared to the control are less developed and their productive characters are less manifested. Cell division rate and the quantity of induced aberrations have no relation to the elements of productivity in the mutants investigated. 3 tabs., 12 refs

  3. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    Energy Technology Data Exchange (ETDEWEB)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J. [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Chen, Han [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Zhou, You [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Nebraska Center for Virology, Lincoln, NE (United States); Belshan, Michael, E-mail: michaelbelshan@creighton.edu [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Nebraska Center for Virology, Lincoln, NE (United States)

    2014-11-15

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release.

  4. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    International Nuclear Information System (INIS)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J.; Chen, Han; Zhou, You; Belshan, Michael

    2014-01-01

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release

  5. [Prevalence of transmission of zidovudine-resistant viruses in Switzerland. l'Etude suisse de cohorte VIH].

    Science.gov (United States)

    Yerly, S; Rakik, A; Kinloch-de-Loes, S; Erb, P; Vernazza, P; Hirschel, B; Perrin, L

    1996-10-26

    Zidovudine (ZDV) was the most widely used anti-HIV drug between 1987 and 1995, and, as already reported, transmission of ZDV-resistant viruses occurs. Several mutations of the reverse transcriptase gene have been identified; one of them affects the 215 codon and is associated with a high degree of resistance. We have determined, using selective PCR, the prevalence of transmission of 215 mutant isolates in 134 patients with primary HIV infection (PHI) and have identified 8 patients with 215 mutant virus between 1989 and 1995 in Switzerland. Mutant resistant viruses have been isolated from patients treated with most antiviral drugs. A systematic search for mutant viruses may provide useful information for the adaptation of treatment strategies.

  6. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  7. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  8. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    OpenAIRE

    Jacobs, Loraine Cristina do Valle

    2011-01-01

    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  9. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Science.gov (United States)

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

    2018-07-01

    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  10. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  11. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  12. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Fluorometric assay for phenotypic differentiation of drug-resistant HIV mutants

    Science.gov (United States)

    Zhu, Qinchang; Yu, Zhiqiang; Kabashima, Tsutomu; Yin, Sheng; Dragusha, Shpend; El-Mahdy, Ahmed F. M.; Ejupi, Valon; Shibata, Takayuki; Kai, Masaaki

    2015-01-01

    Convenient drug-resistance testing of viral mutants is indispensable to effective treatment of viral infection. We developed a novel fluorometric assay for phenotypic differentiation of drug-resistant mutants of human immunodeficiency virus-I protease (HIV-PR) which uses enzymatic and peptide-specific fluorescence (FL) reactions and high-performance liquid chromatography (HPLC) of three HIV-PR substrates. This assay protocol enables use of non-purified enzyme sources and multiple substrates for the enzymatic reaction. In this study, susceptibility of HIV mutations to drugs was evaluated by selective formation of three FL products after the enzymatic HIV-PR reaction. This proof-of-concept study indicates that the present HPLC-FL method could be an alternative to current phenotypic assays for the evaluation of HIV drug resistance. PMID:25988960

  14. Ethanol production using engineered mutant E. coli

    Science.gov (United States)

    Ingram, Lonnie O.; Clark, David P.

    1991-01-01

    The subject invention concerns novel means and materials for producing ethanol as a fermentation product. Mutant E. coli are transformed with a gene coding for pyruvate decarboxylase activity. The resulting system is capable of producing relatively large amounts of ethanol from a variety of biomass sources.

  15. Molecular Genetic Identification Of Some Flax Mutants

    International Nuclear Information System (INIS)

    AMER, I.M.; MOUSTAFA, H.A.M.

    2009-01-01

    Five flax genotypes (Linum usitatissimum L.) i.e., commercial cultivar Sakha 2, the mother variety Giza 4 and three mutant types induced by gamma rays, were screened for their salinity tolerance in field experiments (salinity concentration was 8600 and 8300 ppm for soil and irrigation water, respectively). Mutation 6 was the most salt tolerant as compared to the other four genotypes.RAPD technique was used to detect some molecular markers associated with salt tolerance in flax (Mut 6), RAPD-PCR results using 12 random primers exhibited 149 amplified fragments; 91.9% of them were polymorphic and twelve molecular markers (8.1%) for salt tolerant (mutant 6) were identified with molecular size ranged from 191 to 4159 bp and only eight primers successes to amplify these specific markers. Concerning the other mutants, Mut 15 and Mut 25 exhibited 4.3% and 16.2% specific markers, respectively. The induced mutants exhibited genetic similarity to the parent variety were about 51%, 58.3% and 61.1% for Mut 25, Mut 6 and Mut 15, respectively. These specific markers (SM) are used for identification of the induced mutations and it is important for new variety registration.

  16. Induced mutants for cereal grain protein improvement

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 17 papers and one summary presented, six dealing with the genetic improvement of seed protein using ionizing radiations fall within the INIS subject scope. Other topics discussed were non-radiation induced mutants used for cereal grain protein improvement

  17. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  18. Ganjam virus.

    Science.gov (United States)

    Sudeep, A B; Jadi, R S; Mishra, A C

    2009-11-01

    Ganjam virus (GANV), a member of genus Nairovirus of family Bunyavirdae is of considerable veterinary importance in India. Though, predominantly tick borne, GANV was also isolated from mosquitoes, man and sheep. Neutralizing and complement fixing antibodies to GANV have been detected in animal and human sera collected from different parts of the country. Thirty three strains of GANV have been isolated from India, mainly from Haemaphysalis ticks. The virus replicated in certain vertebrate and mosquito cell lines and found pathogenic to laboratory animals. One natural infection and five laboratory-acquired infections in men were also reported. GANV is antigenically related to Nairobi sheep disease virus (NSDV) of Africa, which is highly pathogenic for sheep and goats causing 70-90 per cent mortality among the susceptible population. Recent molecular studies have demonstrated that GANV is an Asian variant of NSDV and both these viruses are related to the dreaded Crimean Congo haemorrhagic fever (CCHF) group viruses. The versatility of the virus to replicate in different arthropod species, its ability to infect sheep, goat and man makes it an important zoonotic agent.

  19. Studies on virus-induced cell fusion. Progress report, August 1, 1975--April 30, 1976. [Herpes simplex

    Energy Technology Data Exchange (ETDEWEB)

    Person, S.

    1976-01-01

    Progress is reported on the following research projects: mechanism of cell fusion induced by fusion-causing mutants of herpes simplex virus type I; quantitative assays for kinetics of cell fusion; neutral sphingoglycolipids in wild type and mutant infected cells; effects of alteration in oligosaccharide metabolism on cell fusion; and blocking of fusion by ..beta..-galactosidase and NH/sub 4/Cl. (HLW)

  20. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  1. Investigating Ebola virus pathogenicity using molecular dynamics.

    Science.gov (United States)

    Pappalardo, Morena; Collu, Francesca; Macpherson, James; Michaelis, Martin; Fraternali, Franca; Wass, Mark N

    2017-08-11

    Ebolaviruses have been known to cause deadly disease in humans for 40 years and have recently been demonstrated in West Africa to be able to cause large outbreaks. Four Ebolavirus species cause severe disease associated with high mortality in humans. Reston viruses are the only Ebolaviruses that do not cause disease in humans. Conserved amino acid changes in the Reston virus protein VP24 compared to VP24 of other Ebolaviruses have been suggested to alter VP24 binding to host cell karyopherins resulting in impaired inhibition of interferon signalling, which may explain the difference in human pathogenicity. Here we used protein structural analysis and molecular dynamics to further elucidate the interaction between VP24 and KPNA5. As a control experiment, we compared the interaction of wild-type and R137A-mutant (known to affect KPNA5 binding) Ebola virus VP24 with KPNA5. Results confirmed that the R137A mutation weakens direct VP24-KPNA5 binding and enables water molecules to penetrate at the interface. Similarly, Reston virus VP24 displayed a weaker interaction with KPNA5 than Ebola virus VP24, which is likely to reduce the ability of Reston virus VP24 to prevent host cell interferon signalling. Our results provide novel molecular detail on the interaction of Reston virus VP24 and Ebola virus VP24 with human KPNA5. The results indicate a weaker interaction of Reston virus VP24 with KPNA5 than Ebola virus VP24, which is probably associated with a decreased ability to interfere with the host cell interferon response. Hence, our study provides further evidence that VP24 is a key player in determining Ebolavirus pathogenicity.

  2. Functional analyses of GB virus B p13 protein: development of a recombinant GB virus B hepatitis virus with a p7 protein

    DEFF Research Database (Denmark)

    Takikawa, Shingo; Engle, Ronald E; Emerson, Suzanne U

    2006-01-01

    GB virus B (GBV-B), which infects tamarins, is the virus most closely related to hepatitis C virus (HCV). HCV has a protein (p7) that is believed to form an ion channel. It is critical for viability. In vitro studies suggest that GBV-B has an analogous but larger protein (p13). We found...... plus part of p7) was nonviable. However, a mutant lacking amino acid 614-669 (p6) produced high titer viremia and acute resolving hepatitis; viruses recovered from both animals lacked the deleted sequence and had no other mutations. Thus, p6 was dispensable but p7 was essential for infectivity...... processing at both sites, suggesting that p13 is processed into two components (p6 and p7). Mutants with substitution at amino acid 669 or 681 were viable in vivo, but the recovered viruses had changes at amino acid 669 and 681, respectively, which restored cleavage. A mutant lacking amino acid 614-681 (p6...

  3. Functional analyses of GB virus B p13 protein: Development of a recombinant GB virus B hepatitis virus with a p7 protein

    DEFF Research Database (Denmark)

    Takikawa, Shingo; Engle, Ronald E; Emerson, Suzanne U

    2006-01-01

    GB virus B (GBV-B), which infects tamarins, is the virus most closely related to hepatitis C virus (HCV). HCV has a protein (p7) that is believed to form an ion channel. It is critical for viability. In vitro studies suggest that GBV-B has an analogous but larger protein (p13). We found...... plus part of p7) was nonviable. However, a mutant lacking amino acid 614-669 (p6) produced high titer viremia and acute resolving hepatitis; viruses recovered from both animals lacked the deleted sequence and had no other mutations. Thus, p6 was dispensable but p7 was essential for infectivity...... processing at both sites, suggesting that p13 is processed into two components (p6 and p7). Mutants with substitution at amino acid 669 or 681 were viable in vivo, but the recovered viruses had changes at amino acid 669 and 681, respectively, which restored cleavage. A mutant lacking amino acid 614-681 (p6...

  4. Powassan (POW) Virus Basics

    Science.gov (United States)

    ... Health Professionals Related Topics For International Travelers Powassan Virus Disease Basics Download this fact sheet formatted for ... Virus Disease Fact Sheet (PDF) What is Powassan virus? Powassan virus is a tickborne flavivirus that is ...

  5. Functional Analysis of Glycosylation of Zika Virus Envelope Protein.

    Science.gov (United States)

    Fontes-Garfias, Camila R; Shan, Chao; Luo, Huanle; Muruato, Antonio E; Medeiros, Daniele B A; Mays, Elizabeth; Xie, Xuping; Zou, Jing; Roundy, Christopher M; Wakamiya, Maki; Rossi, Shannan L; Wang, Tian; Weaver, Scott C; Shi, Pei-Yong

    2017-10-31

    Zika virus (ZIKV) infection causes devastating congenital abnormities and Guillain-Barré syndrome. The ZIKV envelope (E) protein is responsible for viral entry and represents a major determinant for viral pathogenesis. Like other flaviviruses, the ZIKV E protein is glycosylated at amino acid N154. To study the function of E glycosylation, we generated a recombinant N154Q ZIKV that lacks the E glycosylation and analyzed the mutant virus in mammalian and mosquito hosts. In mouse models, the mutant was attenuated, as evidenced by lower viremia, decreased weight loss, and no mortality; however, knockout of E glycosylation did not significantly affect neurovirulence. Mice immunized with the mutant virus developed a robust neutralizing antibody response and were completely protected from wild-type ZIKV challenge. In mosquitoes, the mutant virus exhibited diminished oral infectivity for the Aedes aegypti vector. Collectively, the results demonstrate that E glycosylation is critical for ZIKV infection of mammalian and mosquito hosts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Prestress strengthens the shell of Norwalk virus nanoparticles.

    NARCIS (Netherlands)

    Baclayon, Marian; Shoemaker, Glen K; Uetrecht, Charlotte; Crawford, Sue E; Estes, Mary K; Prasad, B V Venkataram; Heck, Albert J R; Wuite, Gijs J L; Roos, Wouter H

    2011-01-01

    We investigated the influence of the protruding domain of Norwalk virus-like particles (NVLP) on its overall structural and mechanical stability. Deletion of the protruding domain yields smooth mutant particles and our AFM nanoindentation measurements show a surprisingly altered indentation response

  7. Fulminant hepatitis B virus (HBV) infection in an infant following ...

    African Journals Online (AJOL)

    Fulminant hepatitis B virus (HBV) infection in an infant following mother-to-child transmission of an e-minus HBV mutant: Time to relook at HBV prophylaxis in South ... immune responses, and its absence was probably responsible for the infant's fulminant hepatitis, due to an uncontrolled immune attack on infected liver cells.

  8. Interferon-lambda contributes to innate immunity of mice against influenza A virus but not against hepatotropic viruses

    DEFF Research Database (Denmark)

    Mordstein, M; Kochs, G; Dumoutier, L

    2008-01-01

    Virus-infected cells secrete a broad range of interferon (IFN) subtypes which in turn trigger the synthesis of antiviral factors that confer host resistance. IFN-alpha, IFN-beta and other type I IFNs signal through a common universally expressed cell surface receptor, whereas IFN-lambda uses....... Mice lacking functional IFN-lambda receptors were only slightly more susceptible to influenza virus than wild-type mice. However, mice lacking functional receptors for both IFN-alpha/beta and IFN-lambda were hypersensitive and even failed to restrict usually non-pathogenic influenza virus mutants...

  9. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Science.gov (United States)

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  10. PNRI mutant variety: sansevieria 'Sword of Ibe'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2011-01-01

    Sansevieria 'Sword of Ibe,' registered by the Philippine Nuclear Research Institute as NSIC 2008 Or-66, is a chlorophyll mutant of Sansevieria trifasciata 'Moonshine' developed by treating its suckers or shoots arising from a rhizome with acute gamma radiation from a Cobalt-60 source. The new mutant is identical in growth habit and vigor to Sansevieria 'Moonshine,' also known as Moonglow. Results of this mutation breeding experiment showed that leaf color and flowering were altered by gamma irradiation without changing the other characteristics of the plant. Propagation is true-to-type by separation of sucker and top cutting. The plant is recommended for use as landscaping material and as pot plant for indoor and outdoor use. The leaves may be harvested as cut foliage for Japanese flower arrangements. (author)

  11. Serine:glyoxylate aminotransferase mutant of barley

    International Nuclear Information System (INIS)

    Blackwell, R.; Murray, A.; Joy, K.; Lea, P.

    1987-01-01

    A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO 2 at twice the wild type rate when it was fed [ 14 C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO 2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

  12. Intact interval timing in circadian CLOCK mutants.

    Science.gov (United States)

    Cordes, Sara; Gallistel, C R

    2008-08-28

    While progress has been made in determining the molecular basis for the circadian clock, the mechanism by which mammalian brains time intervals measured in seconds to minutes remains a mystery. An obvious question is whether the interval-timing mechanism shares molecular machinery with the circadian timing mechanism. In the current study, we trained circadian CLOCK +/- and -/- mutant male mice in a peak-interval procedure with 10 and 20-s criteria. The mutant mice were more active than their wild-type littermates, but there were no reliable deficits in the accuracy or precision of their timing as compared with wild-type littermates. This suggests that expression of the CLOCK protein is not necessary for normal interval timing.

  13. The application of shortened upper leaf mutant in barley breeding

    International Nuclear Information System (INIS)

    Jin Hua

    2004-01-01

    The shortened upper leaf mutant was induced from Fuji Nigo by γ-ray irradiation. Fuji Nigo, the mutant, cross-cut F 1 , F 2 and back-cross F 1 , F 2 were used to analyze mutant heredity by comparative study. The yield, chlorophyll content, light intensity, dry matter of mutant were investigated. The results showed that (1) the mutant character was controlled by a couple of nuclear genes which were partial dominance; (2) the transmittance of the mutant colony was better than that of Fuji Nigo and bottom dry matter was much more than that of Fuji Nigo; (3) under the condition of high fertilizer and high plant population , the yield of mutant was higher than that of Fuji Nigo; (4) the content of chlorophyll a in the mutant was higher than that in Fuji Nigo

  14. Significance of Coronavirus Mutants in Feces and Diseased Tissues of Cats Suffering from Feline Infectious Peritonitis

    Directory of Open Access Journals (Sweden)

    Niels C. Pedersen

    2009-08-01

    Full Text Available The internal FECV→FIPV mutation theory and three of its correlates were tested in four sibs/half-sib kittens, a healthy contact cat, and in four unrelated cats that died of FIP at geographically disparate regions. Coronavirus from feces and extraintestinal FIP lesions from the same cat were always >99% related in accessory and structural gene sequences. SNPs and deletions causing a truncation of the 3c gene product were found in almost all isolates from the diseased tissues of the eight cats suffering from FIP, whereas most, but not all fecal isolates from these same cats had intact 3c genes. Other accessory and structural genes appeared normal in both fecal and lesional viruses. Deliterious mutations in the 3c gene were unique to each cat, indicating that they did not originate in one cat and were subsequently passed horizontally to the others. Compartmentalization of the parental and mutant forms was not absolute; virus of lesional type was sometimes found in feces of affected cats and virus identical to fecal type was occasionally identified in diseased tissues. Although 3c gene mutants in this study were not horizontally transmitted, the parental fecal virus was readily transmitted by contact from a cat that died of FIP to its housemate. There was a high rate of mutability in all structural and accessory genes both within and between cats, leading to minor genetic variants. More than one variant could be identified in both diseased tissues and feces of the same cat. Laboratory cats inoculated with a mixture of two closely related variants from the same FIP cat developed disease from one or the other variant, but not both. Significant genetic drift existed between isolates from geographically distinct regions of the Western US.

  15. Significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis.

    Science.gov (United States)

    Pedersen, Niels C; Liu, Hongwei; Dodd, Kimberly A; Pesavento, Patricia A

    2009-09-01

    The internal FECV→FIPV mutation theory and three of its correlates were tested in four sibs/half-sib kittens, a healthy contact cat, and in four unrelated cats that died of FIP at geographically disparate regions. Coronavirus from feces and extraintestinal FIP lesions from the same cat were always >99% related in accessory and structural gene sequences. SNPs and deletions causing a truncation of the 3c gene product were found in almost all isolates from the diseased tissues of the eight cats suffering from FIP, whereas most, but not all fecal isolates from these same cats had intact 3c genes. Other accessory and structural genes appeared normal in both fecal and lesional viruses. Deliterious mutations in the 3c gene were unique to each cat, indicating that they did not originate in one cat and were subsequently passed horizontally to the others. Compartmentalization of the parental and mutant forms was not absolute; virus of lesional type was sometimes found in feces of affected cats and virus identical to fecal type was occasionally identified in diseased tissues. Although 3c gene mutants in this study were not horizontally transmitted, the parental fecal virus was readily transmitted by contact from a cat that died of FIP to its housemate. There was a high rate of mutability in all structural and accessory genes both within and between cats, leading to minor genetic variants. More than one variant could be identified in both diseased tissues and feces of the same cat. Laboratory cats inoculated with a mixture of two closely related variants from the same FIP cat developed disease from one or the other variant, but not both. Significant genetic drift existed between isolates from geographically distinct regions of the Western US.

  16. ''Fushi'' - excellent mutant germplasm for peanut improvement

    International Nuclear Information System (INIS)

    Jiang, X.; Zhou, Y.

    1989-01-01

    Full text: The mutant line ''Fushi'' was selected following seed treatment of the variety ''Shi Xuan 64'' in 1960 with 32 P. Many good peanut varieties were developed using ''Fushi'' in cross-breeding (ref. Mutation Breeding Newsletter No. 30 (July 1987) p. 2-3). In the past 10 years, planting areas of these varieties added up to 3,3 million ha in South China, peanut production was increased by more than 500 000 t valued 500 million Yuan. (author)

  17. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  18. Grain product of 34 soya mutant lines

    International Nuclear Information System (INIS)

    Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A.

    2009-01-01

    This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R 4 M 18 ) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co 60 gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L 25 and L 32 produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

  19. Multivariate analysis for selecting apple mutants

    International Nuclear Information System (INIS)

    Faedi, W.; Bagnara, G.L.; Rosati, P.; Cecchini, M.

    1992-01-01

    The mutlivariate analysis of four year records on several vegetative and productive traits of twenty-one apple mutants (3 of 'Jonathan', 3 of 'Ozark Gold', 14 of 'Mollie's Delicious', 1 of 'Neipling's Early Stayman)' induced by gamma radiations showed that observation of some traits of one-year-old shoots is the most efficient way to reveal compact growing apple mutants. In particular, basal cross-section area, total length and leaf area resulted the most appropriate parameters, while internode length together with conopy height and width are less appropriate. The most interesting mutants we found are: one of 'Mollie's Delicious for the best balance among tree and fruit traits and for high skin color; one of 'Neipling's Early Stayman' with an earlier and more extensively red colored apple than the original clone. (author)

  20. Probiotic features of Lactobacillus plantarum mutant strains.

    Science.gov (United States)

    Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela

    2012-10-01

    In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.

  1. Ebola Virus

    Directory of Open Access Journals (Sweden)

    Anusha Rangare Lakshman

    2015-09-01

    Full Text Available The disease Ebola takes its name from the Ebola River situated near a village in the Democratic Republic of Congo, where the disease first appeared in 1976. It is caused by a virus from the Filoviridae family (filovirus. The present outbreak of Ebola Virus Disease (EVD concerns four countries in West Africa, namely Guinea, Liberia, Sierra Leone and Nigeria till date. Further to widespread transmission of the disease, it has been declared as a Public Health Emergency of International Concern by the World Health Organisation on 8 August 2014. As of 4 August 2014, countries have reported 1,711 cases (1,070 confirmed, 436 probable, 205 suspect, including 932 deaths. This review paper enlightens about the awareness of Ebola virus and its preventive measures. [Archives Medical Review Journal 2015; 24(3.000: 296-305

  2. Modulation of Translation Initiation Efficiency in Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Friis, Martin Barfred; Rasmussen, Thomas Bruun; Belsham, Graham J.

    Modulation of translation initiation efficiency on classical swine fever virus (CSFV) RNA can be achieved by targeted mutations within the internal ribosome entry site (IRES). In this study, the nucleotides 47 to 427, including the IRES region of the wt CSFV strain Paderborn, were amplified...... and inserted, under T7 promoter control, into mono- and dicistronic plasmids containing the reporter genes rLuc and fLuc. Mutant fragments of the IRES sequence were generated by overlap PCR and inserted into the reporter plasmids. To evaluate IRES functionality, translation of the rLUC was placed under...... viruses were obtained after one cell culture passage from constructs with more than 75 % translation efficiency compared to the wildtype IRES. cDNA was generated from these clones and sequenced to verify the maintenance of the changes in the IRES. These results show that full-length viable mutant viruses...

  3. Radiation studies in Cajanus cajan: meiotic behaviour in some M/sub 2/ mutants

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, S.S.N.; Akhaury, S.B. (Ranchi Univ. (India). Dept. of Botany)

    1982-01-01

    A qualitative study of the mutants produced in M/sub 2/ generation has been made. The mutants were classified as: (1) chlorophyll mutant, (2) morphological mutant, (3) pollen mutant, (4) semi-sterile and (5) sterile mutant. Cytological investigations of pollen mutants, sterile and semi-sterile mutants have revealed that these mutants generally arise at higher dose levels (20 Kr and 25 Kr).

  4. Molecular analysis of mutants of the Neurospora adenylosuccinate ...

    Indian Academy of Sciences (India)

    2012-08-07

    Aug 7, 2012 ... and mutants induced with X-ray, UV or chemical mutagens. ... We have sequenced the ad-8 locus from 13 of these mutants and identified the molecular nature ..... mutants in yeast by selection for constitutive behavior in pig-.

  5. Biological changes in Barley mutants resistant to powdery mildew disease

    International Nuclear Information System (INIS)

    Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

    2012-12-01

    physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

  6. The Mutational Robustness of Influenza A Virus.

    Directory of Open Access Journals (Sweden)

    Elisa Visher

    2016-08-01

    Full Text Available A virus' mutational robustness is described in terms of the strength and distribution of the mutational fitness effects, or MFE. The distribution of MFE is central to many questions in evolutionary theory and is a key parameter in models of molecular evolution. Here we define the mutational fitness effects in influenza A virus by generating 128 viruses, each with a single nucleotide mutation. In contrast to mutational scanning approaches, this strategy allowed us to unambiguously assign fitness values to individual mutations. The presence of each desired mutation and the absence of additional mutations were verified by next generation sequencing of each stock. A mutation was considered lethal only after we failed to rescue virus in three independent transfections. We measured the fitness of each viable mutant relative to the wild type by quantitative RT-PCR following direct competition on A549 cells. We found that 31.6% of the mutations in the genome-wide dataset were lethal and that the lethal fraction did not differ appreciably between the HA- and NA-encoding segments and the rest of the genome. Of the viable mutants, the fitness mean and standard deviation were 0.80 and 0.22 in the genome-wide dataset and best modeled as a beta distribution. The fitness impact of mutation was marginally lower in the segments coding for HA and NA (0.88 ± 0.16 than in the other 6 segments (0.78 ± 0.24, and their respective beta distributions had slightly different shape parameters. The results for influenza A virus are remarkably similar to our own analysis of CirSeq-derived fitness values from poliovirus and previously published data from other small, single stranded DNA and RNA viruses. These data suggest that genome size, and not nucleic acid type or mode of replication, is the main determinant of viral mutational fitness effects.

  7. Intergenotypic replacement of lyssavirus matrix proteins demonstrates the role of lyssavirus M proteins in intracellular virus accumulation.

    Science.gov (United States)

    Finke, Stefan; Granzow, Harald; Hurst, Jose; Pollin, Reiko; Mettenleiter, Thomas C

    2010-02-01

    Lyssavirus assembly depends on the matrix protein (M). We compared lyssavirus M proteins from different genotypes for their ability to support assembly and egress of genotype 1 rabies virus (RABV). Transcomplementation of M-deficient RABV with M from European bat lyssavirus (EBLV) types 1 and 2 reduced the release of infectious virus. Stable introduction of the heterogenotypic M proteins into RABV led to chimeric viruses with reduced virus release and intracellular accumulation of virus genomes. Although the chimeras indicated genotype-specific evolution of M, rapid selection of a compensatory mutant suggested conserved mechanisms of lyssavirus assembly and the requirement for only few adaptive mutations to fit the heterogenotypic M to a RABV backbone. Whereas the compensatory mutant replicated to similar infectious titers as RABV M-expressing virus, ultrastructural analysis revealed that both nonadapted EBLV M chimeras and the compensatory mutant differed from RABV M expressing viruses in the lack of intracellular viruslike structures that are enveloped and accumulate in cisterna of the degranulated and dilated rough endoplasmic reticulum compartment. Moreover, all viruses were able to bud at the plasma membrane. Since the lack of the intracellular viruslike structures correlated with the type of M protein but not with the efficiency of virus release, we hypothesize that the M proteins of EBLV-1 and RABV differ in their target membranes for virus assembly. Although the biological function of intracellular assembly and accumulation of viruslike structures in the endoplasmic reticulum remain unclear, the observed differences could contribute to diverse host tropism or pathogenicity.

  8. Effects of Point Mutations in the Major Capsid Protein of Beet Western Yellows Virus on Capsid Formation, Virus Accumulation, and Aphid Transmission

    Science.gov (United States)

    Brault, V.; Bergdoll, M.; Mutterer, J.; Prasad, V.; Pfeffer, S.; Erdinger, M.; Richards, K. E.; Ziegler-Graff, V.

    2003-01-01

    Point mutations were introduced into the major capsid protein (P3) of cloned infectious cDNA of the polerovirus beet western yellows virus (BWYV) by manipulation of cloned infectious cDNA. Seven mutations targeted sites on the S domain predicted to lie on the capsid surface. An eighth mutation eliminated two arginine residues in the R domain, which is thought to extend into the capsid interior. The effects of the mutations on virus capsid formation, virus accumulation in protoplasts and plants, and aphid transmission were tested. All of the mutants replicated in protoplasts. The S-domain mutant W166R failed to protect viral RNA from RNase attack, suggesting that this particular mutation interfered with stable capsid formation. The R-domain mutant R7A/R8A protected ∼90% of the viral RNA strand from RNase, suggesting that lower positive-charge density in the mutant capsid interior interfered with stable packaging of the complete strand into virions. Neither of these mutants systemically infected plants. The six remaining mutants properly packaged viral RNA and could invade Nicotiana clevelandii systemically following agroinfection. Mutant Q121E/N122D was poorly transmitted by aphids, implicating one or both targeted residues in virus-vector interactions. Successful transmission of mutant D172N was accompanied either by reversion to the wild type or by appearance of a second-site mutation, N137D. This finding indicates that D172 is also important for transmission but that the D172N transmission defect can be compensated for by a “reverse” substitution at another site. The results have been used to evaluate possible structural models for the BWYV capsid. PMID:12584348

  9. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  10. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  11. Isolation of reovirus T3D mutants capable of infecting human tumor cells independent of junction adhesion molecule-A.

    Directory of Open Access Journals (Sweden)

    Diana J M van den Wollenberg

    Full Text Available Mammalian Reovirus is a double-stranded RNA virus with a distinctive preference to replicate in and lyse transformed cells. On that account, Reovirus type 3 Dearing (T3D is clinically evaluated as oncolytic agent. The therapeutic efficacy of this approach depends in part on the accessibility of the reovirus receptor Junction Adhesion Molecule-A (JAM-A on the target cells. Here, we describe the isolation and characterization of reovirus T3D mutants that can infect human tumor cells independent of JAM-A. The JAM-A-independent (jin mutants were isolated on human U118MG glioblastoma cells, which do not express JAM-A. All jin mutants harbour mutations in the S1 segments close to the region that encodes the sialic acid-binding pocket in the shaft of the spike protein. In addition, two of the jin mutants encode spike proteins with a Q336R substitution in their head domain. The jin mutants can productively infect a wide range of cell lines that resist wt reovirus T3D infection, including chicken LMH cells, hamster CHO cells, murine endothelioma cells, human U2OS and STA-ET2.1 cells, but not primary human fibroblasts. The jin-mutants rely on the presence of sialic-acid residues on the cell surface for productive infection, as is evident from wheat germ agglutinin (WGA inhibition experiments, and from the jin-reovirus resistance of CHO-Lec2 cells, which have a deficiency of sialic-acids on their glycoproteins. The jin mutants may be useful as oncolytic agents for use in tumors in which JAM-A is absent or inaccessible.

  12. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 1. Chlorophyll Mutations in Allelic tw Mutants and Their Revertants

    International Nuclear Information System (INIS)

    Vaitkuniene, V.

    1995-01-01

    Genotypical environment is an essential factor determining the mutability of mutants of the same type. Decreased chlorophyll mutant frequency was a common characteristic of all tested tw type (tw, tw 1 , tw 2 ) mutants induced in barley c. 'Auksiniai II'. The mutability of all the tested revertants was close to that of the initial c. 'Auksiniai II'. (author). 9 refs., 2 tabs

  13. SARS virus

    Indian Academy of Sciences (India)

    ... consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion. < 300 compounds screened. Glycyrrhizin (liquorics/mullatha) seems attractive. Antivirals not effective. Vaccines – animal model only in monkeys. Killed corona or knockout weakened virus as targets.

  14. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  15. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    Science.gov (United States)

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

    2002-01-01

    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  16. Elimination of A-type inclusion formation enhances cowpox virus replication in mice: implications for orthopoxvirus evolution.

    Science.gov (United States)

    Kastenmayer, Robin J; Maruri-Avidal, Liliana; Americo, Jeffrey L; Earl, Patricia L; Weisberg, Andrea S; Moss, Bernard

    2014-03-01

    Some orthopoxviruses including cowpox virus embed virus particles in dense bodies, comprised of the A-type inclusion (ATI) protein, which may provide long-term environmental protection. This strategy could be beneficial if the host population is sparse or spread is inefficient or indirect. However, the formation of ATI may be neutral or disadvantageous for orthopoxviruses that rely on direct respiratory spread. Disrupted ATI open reading frames in orthopoxviruses such as variola virus, the agent of smallpox, and monkeypox virus suggests that loss of this feature provided positive selection. To test this hypothesis, we constructed cowpox virus mutants with deletion of the ATI gene or another gene required for embedding virions. The ATI deletion mutant caused greater weight loss and higher replication in the respiratory tract than control viruses, supporting our hypothesis. Deletion of the gene for embedding virions had a lesser effect, possibly due to known additional functions of the encoded protein. Published by Elsevier Inc.

  17. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  18. Characterization of the neutralization determinants of equine arteritis virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone

    International Nuclear Information System (INIS)

    Balasuriya, Udeni B.R.; Dobbe, Jessika C.; Heidner, Hans W.; Smalley, Victoria L.; Navarrette, Andrea; Snijder, Eric J.; MacLachlan, N. James

    2004-01-01

    We have used an infectious cDNA clone of equine arteritis virus (EAV) and reverse genetics technology to further characterize the neutralization determinants in the GP5 envelope glycoprotein of the virus. We generated a panel of 20 recombinant viruses, including 10 chimeric viruses that each contained the ORF5 (which encodes GP5) of different laboratory, field, and vaccine strains of EAV, a chimeric virus containing the N-terminal ectodomain of GP5 of a European strain of porcine reproductive and respiratory syndrome virus, and 9 mutant viruses with site-specific substitutions in their GP5 proteins. The neutralization phenotype of each recombinant chimeric/mutant strain of EAV was determined with EAV-specific monoclonal antibodies and EAV strain-specific polyclonal equine antisera and compared to that of their parental viruses from which the substituted ORF5 was derived. The data unequivocally confirm that the GP5 ectodomain contains critical determinants of EAV neutralization. Furthermore, individual neutralization sites are conformationally interactive, and the interaction of GP5 with the unglycosylated membrane protein M is likely critical to expression of individual epitopes in neutralizing conformation. Substitution of individual amino acids within the GP5 ectodomain usually resulted in differences in neutralization phenotype of the recombinant viruses, analogous to differences in the neutralization phenotype of field strains of EAV and variants generated during persistent infection of EAV carrier stallions

  19. Poliovirus mutants excreted by a chronically infected hypogammaglobulinemic patient establish persistent infections in human intestinal cells

    International Nuclear Information System (INIS)

    Labadie, Karine; Pelletier, Isabelle; Saulnier, Aure; Martin, Javier; Colbere-Garapin, Florence

    2004-01-01

    Immunodeficient patients whose gut is chronically infected by vaccine-derived poliovirus (VDPV) may excrete large amounts of virus for years. To investigate how poliovirus (PV) establishes chronic infections in the gut, we tested whether it is possible to establish persistent VDPV infections in human intestinal Caco-2 cells. Four type 3 VDPV mutants, representative of the viral evolution in the gut of a hypogammaglobulinemic patient over almost 2 years [J. Virol. 74 (2000) 3001], were used to infect both undifferentiated, dividing cells, and differentiated, polarized enterocytes. A VDPV mutant excreted 36 days postvaccination by the patient was lytic in both types of intestinal cell cultures, like the parental Sabin 3 (S3) strain. In contrast, three VDPVs excreted 136, 442, and 637 days postvaccination, established persistent infections both in undifferentiated cells and in enterocytes. Thus, viral determinants selected between day 36 and 136 conferred on VDPV mutants the capacity to infect intestinal cells persistently. The percentage of persistently VDPV-infected cultures was higher in enterocytes than in undifferentiated cells, implicating cellular determinants involved in the differentiation of enterocytes in persistent VDPV infections. The establishment of persistent infections in enterocytes was not due to poor replication of VDPVs in these cells, but was associated with reduced viral adsorption to the cell surface

  20. Mutant with diphtheria toxin receptor and acidification function but defective in entry of toxin

    International Nuclear Information System (INIS)

    Kohno, Kenji; Hayes, H.; Mekada, Eisuke; Uchida, Tsuyoshi

    1987-01-01

    A mutant of Chinese hamster ovary cells, GE1, that is highly resistant to diphtheria toxin was isolated. The mutant contains 50% ADP-ribosylatable elongation factor 2, but its protein synthesis was not inhibited by the toxin even at concentrations above 100 μg/ml. 125 I-labeled diphtheria toxin was associated with GE1 cells as well as with the parent cells but did not block protein synthesis of GE1 cells even when the cells were exposed to low pH in the presence or absence of NH 4 Cl. The infections of GE1 cells and the parent cells by vesicular stomatitis virus were similar. GE1 cells were cross-resistant to Pseudomonas aeruginosa exotoxin A and so were about 1,000 times more resistant to this toxin than the parent cells. Hybrids of GE1 cells and the parent cells or mutant cells lacking a functional receptor were more sensitive to diphtheria toxin than GE1 cells. These results suggest that entry of diphtheria toxin into cells requires a cellular factor(s) in addition to those involved in receptor function and acidification of endosomes and that GE1 cells do not express this cellular factor. This character is recessive in GE1 cells

  1. Natural history of acute and chronic hepatitis B: The role of HBV genotypes and mutants.

    Science.gov (United States)

    Lin, Chih-Lin; Kao, Jia-Horng

    2017-06-01

    Molecular epidemiologic studies reveal remarkable differences in the geographical distribution of hepatitis B virus (HBV) genotypes. The frequency of mutants among HBV genotypes also varies. The role of HBV genotypes/mutants in the pathogenesis of HBV infection and natural history of HBV infection has been extensively investigated. The distribution of HBV genotypes in acute hepatitis B patients reflects the predominant genotypes in a given geographic area. In chronic hepatitis B patients, genotype C and D have a higher frequency of basal core promoter A1762T/G1764A mutations than genotype A and B. HBV genotypes C, D and F carry a higher lifetime risk of cirrhosis and HCC development than genotype A and B. HBV pre-S/S gene mutations were associated with immune escape of hepatitis B immunoglobulin or vaccine-induced immunity. Mutations in the pre-S, core promoter and X regions correlate with an increased risk of cirrhosis and HCC. In summary, HBV genotypes and mutants are associated with the disease progression and long-term outcome of HBV infection. They may serve as viral genetic markers for risk stratification of chronic hepatitis B patients in clinical practice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Molecular Basis Underlying Leaf Variegation of a Moth Orchid Mutant (Phalaenopsis aphrodite subsp. formosana

    Directory of Open Access Journals (Sweden)

    Chi-Chu Tsai

    2017-07-01

    Full Text Available Leaf variegation is often the focus of plant breeding. Here, we studied a variegated mutant of Phalaenopsis aphrodite subsp. formosana, which is usually used as a parent of horticultural breeding, to understand its anatomic and genetic regulatory mechanisms in variegation. Chloroplasts with well-organized thylakoids and starch grains were found only in the mesophyll cells of green sectors but not of yellow sectors, confirming that the variegation belongs to the chlorophyll type. The two-dimensional electrophoresis and LC/MS/MS also reveal differential expressions of PsbP and PsbO between the green and yellow leaf sectors. Full-length cDNA sequencing revealed that mutant transcripts were caused by intron retention. When conditioning on the total RNA expression, we found that the functional transcript of PsbO and mutant transcript of PsbP are higher expressed in the yellow sector than in the green sector, suggesting that the post-transcriptional regulation of PsbO and PsbP differentiates the performance between green and yellow sectors. Because PsbP plays an important role in the stability of thylakoid folding, we suggest that the negative regulation of PsbP may inhibit thylakoid development in the yellow sectors. This causes chlorophyll deficiency in the yellow sectors and results in leaf variegation. We also provide evidence of the link of virus CymMV and the formation of variegation according to the differential expression of CymMV between green and yellow sectors.

  3. Mutation of neutralizing/antibody-dependent enhancing epitope on spike protein and 7b gene of feline infectious peritonitis virus: influences of viral replication in monocytes/macrophages and virulence in cats.

    Science.gov (United States)

    Takano, Tomomi; Tomiyama, Yoshika; Katoh, Yasuichiroh; Nakamura, Michiyo; Satoh, Ryoichi; Hohdatsu, Tsutomu

    2011-03-01

    We previously prepared neutralizing monoclonal antibody (MAb)-resistant (mar) mutant viruses using a laboratory strain feline infectious peritonitis virus (FIPV) 79-1146 (Kida et al., 1999). Mar mutant viruses are mutated several amino acids of the neutralizing epitope of Spike protein, compared with the parent strain, FIPV 79-1146. We clarified that MAb used to prepare mar mutant viruses also lost its activity to enhance homologous mar mutant viruses, strongly suggesting that neutralizing and antibody-dependent enhancing epitopes are present in the same region in the strain FIPV 79-1146. We also discovered that amino acid mutation in the neutralizing epitope reduced viral replication in monocytes/macrophages. We also demonstrated that the mutation or deletion of two nucleotides in 7b gene abrogate the virulence of strain FIPV 79-1146. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. The public health impact of avian influenza viruses.

    Science.gov (United States)

    Katz, J M; Veguilla, V; Belser, J A; Maines, T R; Van Hoeven, N; Pappas, C; Hancock, K; Tumpey, T M

    2009-04-01

    Influenza viruses with novel hemagglutinin and 1 or more accompanying genes derived from avian influenza viruses sporadically emerge in humans and have the potential to result in a pandemic if the virus causes disease and spreads efficiently in a population that lacks immunity to the novel hemagglutinin. Since 1997, multiple avian influenza virus subtypes have been transmitted directly from domestic poultry to humans and have caused a spectrum of human disease, from asymptomatic to severe and fatal. To assess the pandemic risk that avian influenza viruses pose, we have used multiple strategies to better understand the capacity of avian viruses to infect, cause disease, and transmit among mammals, including humans. Seroepidemiologic studies that evaluate the frequency and risk of human infection with avian influenza viruses in populations with exposure to domestic or wild birds can provide a better understanding of the pandemic potential of avian influenza subtypes. Investigations conducted in Hong Kong following the first H5N1 outbreak in humans in 1997 determined that exposure to poultry in live bird markets was a key risk factor for human disease. Among poultry workers, butchering and exposure to sick poultry were risk factors for antibody to H5 virus, which provided evidence for infection. A second risk assessment tool, the ferret, can be used to evaluate the level of virulence and potential for host-to-host transmission of avian influenza viruses in this naturally susceptible host. Avian viruses isolated from humans exhibit a level of virulence and transmissibility in ferrets that generally reflects that seen in humans. The ferret model thus provides a means to monitor emerging avian influenza viruses for pandemic risk, as well as to evaluate laboratory-generated reassortants and mutants to better understand the molecular basis of influenza virus transmissibility. Taken together, such studies provide valuable information with which we can assess the public

  5. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil

    2007-01-01

    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  6. Radiation induced desynaptic mutants in barley

    International Nuclear Information System (INIS)

    Srivastava, H.M.

    1974-01-01

    Spontaneous occurrence of asynapsis and desynapsis has been frequently reported in a number of crop plants (Beadle 1930, 1933; Beasley and Brown 1942; Li et al. 1945; Magoon et al. 1961; Miller 1963) and other angiospermic texa (Calarier 1955; Chennaveraiah and Krisnappa 1968; Ehrenberg 1949; Johnson 1941, 1944; Roy and Jha 1958). However, there are only a few reports of induced asynapsis or desynapsis (Gottschalk and Baquar 1971; Martini and Bozzini 1966). The present paper deals with the morphology and meiotic behavior of gamma-ray induced barley mutants showing high degree of desynapsis resulting in partial to complete sterility. (author)

  7. Tolerance and immunity in mice infected with herpes simplex virus: simultaneous induction of protective immunity and tolerance to delayed-type hypersensitivity.

    Science.gov (United States)

    Nash, A A; Gell, P G; Wildy, P

    1981-05-01

    Unresponsiveness to delayed type hypersensitivity was induced in mice following an intravenous injection of herpes simplex virus. The principal tolerogens used were thymidine kinase-deficient virus mutants which grow poorly in vivo; u.v.-inactivated and to a lesser extent formalin-inactivated virus were also tolerogenic. The tolerance induced was specific for the virus type. Despite the tolerance to delayed hypersensitivity, anti-viral immunity is present as determined by the rapid inactivation of infectious virus. The mechanism of tolerance to herpes virus and the importance of these observations for the pathogenesis of viral disease is discussed.

  8. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Science.gov (United States)

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

    2017-01-01

    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  9. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    International Nuclear Information System (INIS)

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

    2010-01-01

    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  10. Identification and characterization of the pseudorabies virus UL43 protein

    International Nuclear Information System (INIS)

    Klupp, Barbara G.; Altenschmidt, Jan; Granzow, Harald; Fuchs, Walter; Mettenleiter, Thomas C.

    2005-01-01

    Among the least characterized herpesvirus membrane proteins are the homologs of UL43 of herpes simplex virus 1 (HSV-1). To identify and characterize the UL43 protein of pseudorabies virus (PrV), part of the open reading frame was expressed in Escherichia coli and used for immunization of a rabbit. The antiserum recognized in Western blots a 34-kDa protein in lysates of PrV infected cells and purified virions, demonstrating that the UL43 protein is a virion component. In indirect immunofluorescence analysis, the antiserum labeled vesicular structures in PrV infected cells which also contained glycoprotein B. To functionally analyze UL43, a deletion mutant was constructed lacking amino acids 23-332 of the 373aa protein. This mutant was only slightly impaired in replication as assayed by one-step growth kinetics, measurement of plaque sizes, and electron microscopy. Interestingly, the PrV UL43 protein was able to inhibit fusion induced by PrV glycoproteins in a transient expression-fusion assay to a similar extent as gM. Double mutant viruses lacking, in addition to UL43, the multiply membrane spanning glycoproteins K or M did not show a phenotype beyond that observed in the gK and gM single deletion mutants

  11. Antibody escape kinetics of equine infectious anemia virus infection of horses.

    Science.gov (United States)

    Schwartz, Elissa J; Nanda, Seema; Mealey, Robert H

    2015-07-01

    Lentivirus escape from neutralizing antibodies (NAbs) is not well understood. In this work, we quantified antibody escape of a lentivirus, using antibody escape data from horses infected with equine infectious anemia virus. We calculated antibody blocking rates of wild-type virus, fitness costs of mutant virus, and growth rates of both viruses. These quantitative kinetic estimates of antibody escape are important for understanding lentiviral control by antibody neutralization and in developing NAb-eliciting vaccine strategies. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Identification of conserved amino acids in the herpes simplex virus type 1 UL8 protein required for DNA synthesis and UL52 primase interaction in the virus replisome.

    Science.gov (United States)

    Muylaert, Isabella; Zhao, Zhiyuan; Andersson, Torbjörn; Elias, Per

    2012-09-28

    We have used oriS-dependent transient replication assays to search for species-specific interactions within the herpes simplex virus replisome. Hybrid replisomes derived from herpes simplex virus type 1 (HSV-1) and equine herpesvirus type 1 (EHV-1) failed to support DNA replication in cells. Moreover, the replisomes showed a preference for their cognate origin of replication. The results demonstrate that the herpesvirus replisome behaves as a molecular machine relying on functionally important interactions. We then searched for functional interactions in the replisome context by subjecting HSV-1 UL8 protein to extensive mutagenesis. 52 mutants were made by replacing single or clustered charged amino acids with alanines. Four mutants showed severe replication defects. Mutant A23 exhibited a lethal phenotype, and mutants A49, A52 and A53 had temperature-sensitive phenotypes. Mutants A49 and A53 did not interact with UL52 primase as determined by co-immunoprecipitation experiments. Using GFP-tagged UL8, we demonstrate that all mutants were unable to support formation of ICP8-containing nuclear replication foci. Extended mutagenesis suggested that a highly conserved motif corresponding to mutant A49 serves an important role for establishing a physical contact between UL8 and UL52. The replication-defective mutations affected conserved amino acids, and similar phenotypes were observed when the corresponding mutations were introduced into EHV-1 UL8.

  13. E4orf1 Limits the Oncolytic Potential of the E1B-55K Deletion Mutant Adenovirus▿

    Science.gov (United States)

    Thomas, Michael A.; Broughton, Robin S.; Goodrum, Felicia D.; Ornelles, David A.

    2009-01-01

    Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G1 phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G1 restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3′-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function. PMID:19129452

  14. E4orf1 limits the oncolytic potential of the E1B-55K deletion mutant adenovirus.

    Science.gov (United States)

    Thomas, Michael A; Broughton, Robin S; Goodrum, Felicia D; Ornelles, David A

    2009-03-01

    Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G(1) phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G(1) restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3'-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function.

  15. Induction of drought tolerant mutants of rice

    International Nuclear Information System (INIS)

    El-Hissewy, A.A.; Abd Allah, A.

    2001-01-01

    The ultimate goal of crop breeding is to develop varieties with a high yield potential and desirable agronomic characteristics. In Egypt, the most important qualities sought by breeders have been high yield potential, resistance to major diseases and insects, and improved grain and eating quality. However, breeding efforts should concentrate on varieties with the potential to minimize yield losses under unfavorable conditions such as drought, and to maximize yields when conditions are favorable. Rice (Oryza sativa L.) in Egypt is completely irrigated and a significant portion of the rice cultivated area is subject to water deficit resulting from an inadequate or insufficient irrigation supply. Drought tolerance is a complex trait in that it results from the interaction of histological and physiological characters of plant with environmental factors, both above-ground and under-ground. Accordingly, root characters are closely related to drought tolerance. Little attention has been paid in Egyptian breeding programs to root characters and their relation to shoot characters. Furthermore, induced mutations are considered as one of the most important methods to induce useful mutants, especially with improved root characters, to overcome the drought problem. The present investigation aimed to study the effect of different doses of gamma rays on several characters of three Egyptian rice varieties, i.e. 'Giza 171', 'Giza 175' and 'Giza 176' and to induce one or more mutants possessing drought tolerance

  16. Indy mutants: live long and prosper

    Directory of Open Access Journals (Sweden)

    Stewart eFrankel

    2012-02-01

    Full Text Available Indy encodes the fly homologue of a mammalian transporter of di and tricarboxylatecomponents of the Krebs cycle. Reduced expression of fly Indy or two of the C. elegansIndy homologs leads to an increase in life span. Fly and worm tissues that play key roles inintermediary metabolism are also the places where Indy genes are expressed. One of themouse homologs of Indy (mIndy is mainly expressed in the liver. It has been hypothesizedthat decreased INDY activity creates a state similar to caloric restriction (CR. Thishypothesis is supported by the physiological similarities between Indy mutant flies on highcalorie food and control flies on CR, such as increased physical activity and decreases inweight, egg production, triglyceride levels, starvation resistance, and insulin signaling. Inaddition, Indy mutant flies undergo changes in mitochondrial biogenesis also observed inCR animals. Recent findings with mIndy knockout mice support and extend the findingsfrom flies. mIndy-/- mice display an increase in hepatic mitochondrial biogenesis, lipidoxidation and decreased hepatic lipogenesis. When mIndy-/- mice are fed high calorie foodthey are protected from adiposity and insulin resistance. These findings point to INDY as apotential drug target for the treatment of metabolic syndrome, type 2 diabetes and obesity.

  17. Flower morphology of Dendrobium Sonia mutants

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Azhar Mohamad; Affrida Abu Hassan; Zaiton Ahmad; Mohd Nazir Basiran

    2010-01-01

    Dendrobium Sonia is a commercial hybrid which is popular as cut flower and potted plant in Malaysia. Variability in flower is important for new variety to generate more demands and choices in selection. Mutation induction is a tool in creating variability for new flower color and shape. In vitro cultures of protocorm-like bodies (PLBs) were exposed to gamma ray at dose 35 Gy. Phenotypic characteristics of the flower were observed at fully bloomed flower with emphasis on shape and color. Approximately 2000 regenerated irradiated plants were observed and after subsequent flowering, 100 plants were finally selected for further evaluation. Most of the color and shape changes are expressed in different combinations of petal, sepal and lip of the flower. In this work, 11 stable mutants were found different at flower phenotype as compared to control. Amongst these, four mutant varieties with commercial potential has been named as Dendrobium 'SoniaKeenaOval', Dendrobium 'SoniaKeenaRadiant', Dendrobium 'SoniaKeenaHiengDing' and Dendrobium 'Sonia KeenaAhmadSobri'. In this paper, variations in flower morphology and flower color were discussed, giving emphasis on variations in flower petal shape. (author)

  18. High yielding rice mutants for West Bengal

    International Nuclear Information System (INIS)

    Debnath, A.R.; Sen, S.

    1980-01-01

    Four high yielding mutants with specific genetic corrections of the simply inherited characters were developed from IR-8 through X-irradiation. Recurrent selections of the promising isolates were made under diverse agro-climatic conditions in Winter and Summer seasons of West Bengal. The isolates CNM 6 and CNM 25 belonging to early maturity group and CNM 20 and CNM 31, to mid-early maturity group were finally selected at X 5 generation on the basis of their resistance qualities, maturity period and grain yield. They were evaluated upto X 10 qeneration at multi-locations as Pre-release and Minikit Varieties at State level. They were also placed at the National Screening Nursery (NSN) for screening against multiple diseases and pests at the National level. CNM 6 is reported to be promising in IRTP nurseries. It is reported that CNM 25 (IET 5646) ranked 2nd on the basis of average grain yield, CNM 20 (IET 5937) and CNM 31 (IET 5936) were resistant to diseases and with yield comparable to Jaya. These four productive mutants of superior types are widely accepted. CNM 6 is recommended for cultivation in Bankura and Birbhum districts and CNM 25 and CNM 31 in the different agro-climatic zones of West Bengal. (author)

  19. Allosteric Mutant IDH1 Inhibitors Reveal Mechanisms for IDH1 Mutant and Isoform Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xiaoling; Baird, Daniel; Bowen, Kimberly; Capka, Vladimir; Chen, Jinyun; Chenail, Gregg; Cho, YoungShin; Dooley, Julia; Farsidjani, Ali; Fortin, Pascal; Kohls, Darcy; Kulathila, Raviraj; Lin, Fallon; McKay, Daniel; Rodrigues, Lindsey; Sage, David; Touré, B. Barry; van der Plas, Simon; Wright, Kirk; Xu, Ming; Yin, Hong; Levell, Julian; Pagliarini, Raymond A. (Novartis)

    2017-03-01

    Oncogenic IDH1 and IDH2 mutations contribute to cancer via production of R-2-hydroxyglutarate (2-HG). Here, we characterize two structurally distinct mutant- and isoform-selective IDH1 inhibitors that inhibit 2-HG production. Both bind to an allosteric pocket on IDH1, yet shape it differently, highlighting the plasticity of this site. Oncogenic IDH1R132H mutation destabilizes an IDH1 “regulatory segment,” which otherwise restricts compound access to the allosteric pocket. Regulatory segment destabilization in wild-type IDH1 promotes inhibitor binding, suggesting that destabilization is critical for mutant selectivity. We also report crystal structures of oncogenic IDH2 mutant isoforms, highlighting the fact that the analogous segment of IDH2 is not similarly destabilized. This intrinsic stability of IDH2 may contribute to observed inhibitor IDH1 isoform selectivity. Moreover, discrete residues in the IDH1 allosteric pocket that differ from IDH2 may also guide IDH1 isoform selectivity. These data provide a deeper understanding of how IDH1 inhibitors achieve mutant and isoform selectivity.

  20. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  1. Characterization of a Weak Allele of Zebrafish cloche Mutant

    Science.gov (United States)

    Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

    2011-01-01

    Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

  2. Exploring the mechanism of zanamivir resistance in a neuraminidase mutant: a molecular dynamics study.

    Directory of Open Access Journals (Sweden)

    Nanyu Han

    Full Text Available It is critical to understand the molecular basis of the drug resistance of influenza viruses to efficiently treat this infectious disease. Recently, H1N1 strains of influenza A carrying a mutation of Q136K in neuraminidase were found. The new strain showed a strong Zanamivir neutralization effect. In this study, normal molecular dynamics simulations and metadynamics simulations were employed to explore the mechanism of Zanamivir resistance. The wild-type neuraminidase contained a 3(10 helix before the 150 loop, and there was interaction between the 150 and 430 loops. However, the helix and the interaction between the two loops were disturbed in the mutant protein due to interaction between K136 and nearby residues. Hydrogen-bond network analysis showed weakened interaction between the Zanamivir drug and E276/D151 on account of the electrostatic interaction between K136 and D151. Metadynamics simulations showed that the free energy landscape was different in the mutant than in the wild-type neuraminidase. Conformation with the global minimum of free energy for the mutant protein was different from the wild-type conformation. While the drug fit completely into the active site of the wild-type neuraminidase, it did not match the active site of the mutant variant. This study indicates that the altered hydrogen-bond network and the deformation of the 150 loop are the key factors in development of Zanamivir resistance. Furthermore, the Q136K mutation has a variable effect on conformation of different N1 variants, with conformation of the 1918 N1 variant being more profoundly affected than that of the other N1 variants studied in this paper. This observation warrants further experimental investigation.

  3. Influenza (Flu) Viruses

    Science.gov (United States)

    ... Types Seasonal Avian Swine Variant Pandemic Other Influenza (Flu) Viruses Language: English (US) Español Recommend on Facebook ... influenza circulate and cause illness. More Information about Flu Viruses Types of Influenza Viruses Influenza A and ...

  4. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  5. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  6. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  7. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  8. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  9. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  10. Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector.

    Science.gov (United States)

    Doumayrou, Juliette; Sheber, Melissa; Bonning, Bryony C; Miller, W Allen

    2016-11-18

    Understanding the molecular mechanisms involved in plant virus-vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP) are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus , Luteoviridae ) and Pea enation mosaic virus 2 (PEMV2, Umbravirus , Tombusviridae ) are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum , and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum . Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

  11. Progress toward an enhanced vaccine: Eight marked attenuated viruses to porcine reproductive and respiratory disease virus.

    Science.gov (United States)

    Spear, Allyn; Wang, Feng-Xue; Kappes, Matthew A; Das, Phani B; Faaberg, Kay S

    2018-03-01

    Recombinant viruses of strain Ingelvac® PRRS porcine reproductive and respiratory syndrome virus (PRRSV) modified live virus vaccine were produced with two individual small in-frame deletions in nonstructural protein 2 (nsp2; Δ23 and Δ87) and also the same deletions supplanted with foreign tags (Δ23-V5, Δ23-FLAG, Δ23-S, Δ87-V5, Δ87-FLAG, Δ87-S). The viruses, but one (Δ87-FLAG), were stable for 10 passages and showed minimal effects on in vitro growth. Northern hybridization showed that the Δ23-tagged probe detected intracellular viral genome RNA as well as shorter RNAs that may represent heteroclite species, while the Δ87-tagged probe detected predominantly only genome length RNAs. When the tagged viruses were used to probe nsp2 protein in infected cells, perinuclear localization similar to native nsp2 was seen. Dual infection of Δ23-S and Δ87-S viruses allowed some discrimination of individual tagged nsp2 protein, facilitating future research. The mutants could potentially also be used to differentiate infected from vaccinated animals. Published by Elsevier Inc.

  12. Caveolin-1 interacts with the Gag precursor of murine leukaemia virus and modulates virus production

    Directory of Open Access Journals (Sweden)

    Koester Mario

    2006-09-01

    Full Text Available Abstract Background Retroviral Gag determines virus assembly at the plasma membrane and the formation of virus-like particles in intracellular multivesicular bodies. Thereby, retroviruses exploit by interaction with cellular partners the cellular machineries for vesicular transport in various ways. Results The retroviral Gag precursor protein drives assembly of murine leukaemia viruses (MLV at the plasma membrane (PM and the formation of virus like particles in multivesicular bodies (MVBs. In our study we show that caveolin-1 (Cav-1, a multifunctional membrane-associated protein, co-localizes with Gag in a punctate pattern at the PM of infected NIH 3T3 cells. We provide evidence that Cav-1 interacts with the matrix protein (MA of the Gag precursor. This interaction is mediated by a Cav-1 binding domain (CBD within the N-terminus of MA. Interestingly, the CBD motif identified within MA is highly conserved among most other γ-retroviruses. Furthermore, Cav-1 is incorporated into MLV released from NIH 3T3 cells. Overexpression of a GFP fusion protein containing the putative CBD of the retroviral MA resulted in a considerable decrease in production of infectious retrovirus. Moreover, expression of a dominant-negative Cav-1 mutant affected retroviral titres significantly. Conclusion This study demonstrates that Cav-1 interacts with MLV Gag, co-localizes with Gag at the PM and affects the production of infectious virus. The results strongly suggest a role for Cav-1 in the process of virus assembly.

  13. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  14. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  15. SAT2 Foot-and-Mouth Disease Virus Structurally Modified for Increased Thermostability.

    Science.gov (United States)

    Scott, Katherine A; Kotecha, Abhay; Seago, Julian; Ren, Jingshan; Fry, Elizabeth E; Stuart, David I; Charleston, Bryan; Maree, Francois F

    2017-05-15

    Foot-and-mouth disease virus (FMDV), particularly strains of the O and SAT serotypes, is notoriously unstable. Consequently, vaccines derived from heat-labile SAT viruses have been linked to the induction of immunity with a poor duration and hence require more frequent vaccinations to ensure protection. In silico calculations predicted residue substitutions that would increase interactions at the interpentamer interface, supporting increased stability. We assessed the stability of the 18 recombinant mutant viruses in regard to their growth kinetics, antigenicity, plaque morphology, genetic stability, and temperature, ionic, and pH stability by using Thermofluor and inactivation assays in order to evaluate potential SAT2 vaccine candidates with improved stability. The most stable mutant for temperature and pH stability was the S2093Y single mutant, while other promising mutants were the E3198A, L2094V, and S2093H single mutants and the F2062Y-H2087M-H3143V triple mutant. Although the S2093Y mutant had the greatest stability, it exhibited smaller plaques, a reduced growth rate, a change in monoclonal antibody footprint, and poor genetic stability properties compared to those of the wild-type virus. However, these factors affecting production can be overcome. The addition of 1 M NaCl was found to further increase the stability of the SAT2 panel of viruses. The S2093Y and S2093H mutants were selected for future use in stabilizing SAT2 vaccines. IMPORTANCE Foot-and-mouth disease virus (FMDV) causes a highly contagious acute vesicular disease in cloven-hoofed livestock and wildlife. The control of the disease by vaccination is essential, especially at livestock-wildlife interfaces. The instability of some serotypes, such as SAT2, affects the quality of vaccines and therefore the duration of immunity. We have shown that we can improve the stability of SAT2 viruses by mutating residues at the capsid interface through predictive modeling. This is an important finding for

  16. Restoration of glycoprotein Erns dimerization via pseudoreversion partially restores virulence of classical swine fever virus.

    Science.gov (United States)

    Tucakov, Anna Katharina; Yavuz, Sabine; Schürmann, Eva-Maria; Mischler, Manjula; Klingebeil, Anne; Meyers, Gregor

    2018-01-01

    The classical swine fever virus (CSFV) represents one of the most important pathogens of swine. The CSFV glycoprotein E rns is an essential structural protein and an important virulence factor. The latter is dependent on the RNase activity of this envelope protein and, most likely, its secretion from the infected cell. A further important feature with regard to its function as a virulence factor is the formation of disulfide-linked E rns homodimers that are found in virus-infected cells and virions. Mutant CSFV lacking cysteine (Cys) 171, the residue responsible for intermolecular disulfide bond formation, were found to be attenuated in pigs (Tews BA, Schürmann EM, Meyers G. J Virol 2009;83:4823-4834). In the course of an animal experiment with such a dimerization-negative CSFV mutant, viruses were reisolated from pigs that contained a mutation of serine (Ser) 209 to Cys. This mutation restored the ability to form disulphide-linked E rns homodimers. In transient expression studies E rns mutants carrying the S209C change were found to form homodimers with about wt efficiency. Also the secretion level of the mutated proteins was equivalent to that of wt E rns . Virus mutants containing the Cys171Ser/Ser209Cys configuration exhibited wt growth rates and increased virulence when compared with the Cys171Ser mutant. These results provide further support for the connection between CSFV virulence and E rns dimerization.

  17. Mutants of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity

    International Nuclear Information System (INIS)

    Upchurch, R.G.; Walker, D.C.; Rollins, J.A.; Ehrenshaft, M.; Daub, M.E.

    1991-01-01

    The authors have obtained spontaneous and UV-induced stable mutants, altered in the synthesis of cercosporin, of the fungal soybean pathogen Cercospora kikuchii. The mutants were isolated on the basis of colony color on minimal medium. The UV-induced mutants accumulated, at most, 2% of wild-type cercosporin levels on all media tested. In contrast, cercosporin accumulation by the spontaneous mutants was strongly medium regulated, occurring only on potato dextrose medium but at concentrations comparable to those produced by the wild-type strain. UV-induced mutants unable to synthesize cercosporin on any medium were unable to incite lesions when inoculated onto the soybean host. Cercosporin was reproducibly isolated from all inoculated leaves showing lesions. Although cercosporin involvement in disease has been indirectly suggested by many previous studies, this is the first report in which mutants blocked in cercosporin synthesis have been used to demonstrate that cercosporin is a crucial pathogenicity factor for this fungal genus

  18. Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard

    International Nuclear Information System (INIS)

    Mitra, J.; Chaudhari, K.L.

    1974-01-01

    Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)

  19. PET imaging of HSV1-tk mutants with acquired specificity toward pyrimidine- and acycloguanosine-based radiotracers

    Energy Technology Data Exchange (ETDEWEB)

    Likar, Yury; Dobrenkov, Konstantin; Olszewska, Malgorzata; Shenker, Larissa; Hricak, Hedvig; Ponomarev, Vladimir [Memorial Sloan-Kettering Cancer Center, Molecular Imaging Laboratory, Department of Radiology, New York, NY (United States); Cai, Shangde [Memorial Sloan-Kettering Cancer Center, Radiochemistry/Cyclotron Core Facility, New York, NY (United States)

    2009-08-15

    The aim of this study was to create an alternative mutant of the herpes simplex virus type 1 thymidine kinase (HSV1-tk) reporter gene with reduced phosphorylation capacity for acycloguanosine derivatives, but not pyrimidine-based compounds that will allow for successful PET imaging. A new mutant of HSV1-tk reporter gene, suitable for PET imaging using pyrimidine-based radiotracers, was developed. The HSV1-tk mutant contains an arginine-to-glutamine substitution at position 176 (HSV1-R176Qtk) of the nucleoside binding region of the enzyme. The mutant-gene product showed favorable enzymatic characteristics toward pyrimidine-based nucleosides, while exhibiting reduced activity with acycloguanosine derivatives. In order to enhance HSV1-R176Qtk reporter activity with pyrimidine-based radiotracers, we introduced the R176Q substitution into the more active HSV1-sr39tk mutant. U87 human glioma cells transduced with the HSV1-R176Qsr39tk double mutant reporter gene showed high {sup 3}H-FEAU pyrimidine nucleoside and low {sup 3}H-penciclovir acycloguanosine analog uptake in vitro. PET imaging also demonstrated high {sup 18}F-FEAU and low {sup 18}F-FHBG accumulation in HSV1-R176Qsr39tk+ xenografts. The feasibility of imaging two independent nucleoside-specific HSV1-tk mutants in the same animal with PET was demonstrated. Two opposite xenografts expressing the HSV1-R176Qsr39tk reporter gene and the previously described acycloguanosine-specific mutant of HSV1-tk, HSV1-A167Ysr39tk reporter gene, were imaged using a short-lived pyrimidine-based {sup 18}F-FEAU and an acycloguanosine-based {sup 18}F-FHBG radiotracer, respectively, administered on 2 consecutive days. We conclude that in combination with acycloguanosine-specific HSV1-A167Ysr39tk reporter gene, a HSV1-tk mutant containing the R176Q substitution could be used for PET imaging of two different cell populations or concurrent molecular biological processes in the same living subject. (orig.)

  20. Some mutants in maize obtained by irradiation with thermal neutrons

    International Nuclear Information System (INIS)

    Diaconu, P.

    1993-01-01

    Irradiation was carried out at the Bucharest Institute of Atomic Physics and the National Laboratory Brookhaven, USA. A description is given of 22 genic mutants affecting leaf color, plant size, and branching capacity. Characteristics related to pollen fertility and the vegetative period were affected in all the mutants. Improvement of pollen fertility was attempted over four generations without success. The maize mutants obtained by irradiation may be considered as being without practical significance. (author). 7 figs., 1 tab. 11 ref

  1. Chemotaxis-defective mutants of the nematode Caenorhabditis elegans.

    Science.gov (United States)

    Dusenbery, D B; Sheridan, R E; Russell, R L

    1975-06-01

    The technique of countercurrent separation has been used to isolate 17 independent chemotaxis-defective mutants of the nematode Caenorhabditis elegans. The mutants, selected to be relatively insensitive to the normally attractive salt NaCl, show varying degrees of residual sensitivity; some are actually weakly repelled by NaCl. The mutants are due to single gene defects, are autosomal and recessive, and identify at least five complementation groups.

  2. Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

    International Nuclear Information System (INIS)

    Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

    2006-01-01

    The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

  3. Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants

    OpenAIRE

    Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.

    2010-01-01

    Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic ...

  4. Isolation, characterization, and genetic complementation of a cellular mutant resistant to retroviral infection

    Science.gov (United States)

    Agarwal, Sumit; Harada, Josephine; Schreifels, Jeffrey; Lech, Patrycja; Nikolai, Bryan; Yamaguchi, Tomoyuki; Chanda, Sumit K.; Somia, Nikunj V.

    2006-01-01

    By using a genetic screen, we have isolated a mammalian cell line that is resistant to infection by retroviruses that are derived from the murine leukemia virus, human immunodeficiency virus type 1, and feline immunodeficiency virus. We demonstrate that the cell line is genetically recessive for the resistance, and hence it is lacking a factor enabling infection by retroviruses. The block to infection is early in the life cycle, at the poorly understood uncoating stage. We implicate the proteasome at uncoating by completely rescuing the resistant phenotype with the proteasomal inhibitor MG-132. We further report on the complementation cloning of a gene (MRI, modulator of retrovirus infection) that can also act to reverse the inhibition of infection in the mutant cell line. These data implicate a role for the proteasome during uncoating, and they suggest that MRI is a regulator of this activity. Finally, we reconcile our findings and other published data to suggest a model for the involvement of the proteasome in the early phase of the retroviral life cycle. PMID:17043244

  5. Studies on mutant breeding of Hibiscus syriacus

    International Nuclear Information System (INIS)

    Song, Hi Sup; Kim, Jin Kyu; Lee, Ki Un; Kim, Young Taik.

    1997-01-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has such a characteristic of self-incompatibility that all the plant exist as natural hybrids and have heterogeneous genes. Many domestic 91 varieties of Hibiscus syriacus were collected. Radiosensitivity of H. Syriacus irradiated with γ-ray was investigated in plant cuttings. The plant height was reduced by 45% in 5KR irradiated group, compared to control group. The radiation dose of 5KR could be recommended for mutation breeding of Hibiscus cuttings. Radiosensitivity of γ-ray irradiated Hibiscus seed were investigated. The germination rate, survival rate and plant height was better in the 4KR irradiation plot than control. The radiation dose of 10∼12KR are recommended for mutation breeding of Hibiscus. Promising mutant lines were selected form the varieties of Hwarang, Wolsan no. 176, Ilpyondansim, Emille, Hanol, Yongkwang, Saeyongkwang, Chungmu, Imjinhong, Arang, Hungdansim-1 and Hongdansim-2. (author). 66 refs., 16 tabs., 13 figs

  6. Google: a narrativa de uma marca mutante

    Directory of Open Access Journals (Sweden)

    Elizete de Azevedo Kreutz

    2010-01-01

    Full Text Available As marcas mutantes já fazem parte de nossa realidade, embora ainda não totalmente percebidas e/ou aceitas como tal. O presente artigo busca refletir sobre a relevância dessas novas estratégias de comunicação e branding, identificando suas principais características. Para isso, utilizamos o método de estudo de caso, o Google, ancorado nos métodos de pesquisa bibliográfica e de internet. A escolha foi intencional, posto que a organização é referência em sua categoria, mecanismo de busca, e reflete essa estratégia comunicacional contemporânea. Como resultado, as informações obtidas nos possibilitam compreender essa tendência de comportamento de marca que busca a interação com seus públicos.

  7. Studies on mutant breeding of Hibiscus syriacus

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hi Sup; Kim, Jin Kyu; Lee, Ki Un; Kim, Young Taik

    1997-01-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has such a characteristic of self-incompatibility that all the plant exist as natural hybrids and have heterogeneous genes. Many domestic 91 varieties of Hibiscus syriacus were collected. Radiosensitivity of H. Syriacus irradiated with {gamma}-ray was investigated in plant cuttings. The plant height was reduced by 45% in 5KR irradiated group, compared to control group. The radiation dose of 5KR could be recommended for mutation breeding of Hibiscus cuttings. Radiosensitivity of {gamma}-ray irradiated Hibiscus seed were investigated. The germination rate, survival rate and plant height was better in the 4KR irradiation plot than control. The radiation dose of 10{approx}12KR are recommended for mutation breeding of Hibiscus. Promising mutant lines were selected form the varieties of Hwarang, Wolsan no. 176, Ilpyondansim, Emille, Hanol, Yongkwang, Saeyongkwang, Chungmu, Imjinhong, Arang, Hungdansim-1 and Hongdansim-2. (author). 66 refs., 16 tabs., 13 figs.

  8. Recombination-deficient mutants of Bacillus subtilis

    International Nuclear Information System (INIS)

    Sadaie, Y.; Kada, T.

    1976-01-01

    Two mutant strains of Bacillus subtilis Marburg, NIG43 and NIG45, were isolated. They showed high sensitivities to gamma rays, ultraviolet light (uv), and chemicals. Deficiencies in genetic recombination of these two mutants were shown by the experiments on their capacity in transformation, SPO2 transfection, and PBS1 phage transduction, as well as on their radiation and drug sensitivities and their Hcr + capacity for uv-exposed phage M2. Some of these characteristics were compared with those of the known strains possessing the recA1 or recB2 alleles. Mapping studies revealed that the mutation rec-43 of strain NIG43 lies in the region of chromosome replication origin. The order was purA dna-8132 rec-43. Another mutation, rec-45, of strain NIG45 was found to be tightly linked to recA1. The mutation rec-43 reduced mainly the frequency of PBS1 transduction. On the other hand, the mutation rec-45 reduced the frequency of recombination involved both in transformation and PBS1 tranduction. The mutation rec-43 of strain NIG43 is conditional, but rec-45 of strain NIG45 is not. The uv impairment in cellular survival of strain NIG43 was gradually reverted at higher salt or sucrose concentrations, suggesting cellular possession of a mutated gene product whose function is conditional. In contrast to several other recombination-deficient strains, SPO2 lysogens of strains NIG43 and NIG45 were not inducible, indicating involvement of rec-43 + or rec-45 + gene product in the development of SPO2 prophage to a vegetative form. The uv-induced deoxyribonucleic acid degradation in vegetative cells was higher in rec-43 and rec-45 strains

  9. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Zayats, O.M.

    2001-01-01

    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

  10. Infection and transmission of Rift Valley fever viruses lacking the NSs and/or NSm genes in mosquitoes: potential role for NSm in mosquito infection.

    Science.gov (United States)

    Crabtree, Mary B; Kent Crockett, Rebekah J; Bird, Brian H; Nichol, Stuart T; Erickson, Bobbie Rae; Biggerstaff, Brad J; Horiuchi, Kalanthe; Miller, Barry R

    2012-01-01

    Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes.

  11. Infection and transmission of Rift Valley fever viruses lacking the NSs and/or NSm genes in mosquitoes: potential role for NSm in mosquito infection.

    Directory of Open Access Journals (Sweden)

    Mary B Crabtree

    Full Text Available BACKGROUND: Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. METHODOLOGY AND PRINCIPAL FINDINGS: Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. CONCLUSIONS/SIGNIFICANCE: In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes.

  12. Isoenzymes performance of some rice varieties and their mutants

    International Nuclear Information System (INIS)

    Winarno, Ermin; Suliwarno, Ambyah; Ismachin, M.

    1992-01-01

    Isoenzymes performance of some rice varieties and their mutants. Genetics studies on alcohol dehydrogenase, malic enzyme, peroxidase, acid phosphase, and aminopeptidase isoenzymes were carried out on several groups of rice varieties and their mutant lines. The first groups consisted of Atomita I, Pelita I/1, A227/5, Mudgo, TN-1, and IR-26. The second group was Cisadane variety and its five mutants, namely OBS 18, OBS 208, OBS 297, OBS 306, and OBS 330. The third group was mutants line 627-10-3 and its mutants, namely 1063, 1066, 1067, 1076, and 1090. Isoenzymes extracts of the rice leaves were fractionated using polyacrylamide gel disc electrophoresis. The pattern of acid phosphate isoenzyme shows the specific character of rice mutants susceptible to brown plant hopper biotype 1. The gene(s) controlling malic enzyme in Cisadane's mutants is (are) estimated more resistant toward gamma irradiation than gene(s) responsible for controlling the other enzymes. Generally, the isoenzymes zymograms show that gene(s) controlling the mutants enzyme have undergone mutation. This case is shown by the changes of Rm value, as well as the amount and intensity of mutants bands. (authors). 7 refs., 7 figs

  13. Agronomic performance of old soybean variety 'Altona' derived mutants

    International Nuclear Information System (INIS)

    Hodosne, K.G.; Heszky, L.E.

    2001-01-01

    An induced mutation program has been initiated at the Department of Genetics and Plant Breeding to develop early maturing cultivars with good yielding capacity. Some new mutants have been produced by irradiation of variety Altona with 60 Co gamma rays. Ten years of breeding resulted in two new mutant varieties named 'Noventa' and 'Gate 511'. The present study deals with agronomic performance of these mutants. Registered soybean varieties Altona and 'McCall' as well as Altona derived mutants (Gate 511 and Noventa) have been compared

  14. Seed protein and nitrogen fixation in chickpea mutant variety Hyprosola

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, H E; Gibson, A H; Oram, R N [CSIRO, Division of Plant Industry, Canberra ACT (Australia); Shaikh, M A.Q. [Bangladesh Institute of Nuclear Agriculture, Mymensingh (Bangladesh)

    1989-01-01

    Full text: 'Hyprosola' is a high yielding, high protein mutant cultivar obtained after gamma irradiation from the variety 'Faridpur-1'. The mutant yields 45 % more protein per unit area. The essential amino acid index is unchanged. It is likely that the high nutritional value in 'Hyprosola' seed protein arises from an increase in the albumin:globulin ratio. Nitrogen fixation rates of the mutant during the first 7 weeks of growth were found to be similar to 'Faridpur-1'. Under field conditions, the mutant may be able to nodulate more rapidly and more extensively than the parent variety. (author)

  15. Morphological and physiological investigations on mutants of Fusarium monoliforme IM

    International Nuclear Information System (INIS)

    Gancheva, V.

    1996-01-01

    High-producing mutants of Fusarium moniliforme IM are obtained as a result of gamma irradiation. The cultural characteristics of mutant strains 3284, 3211 and 76 following incubation of the producers for 14 days on potato-glucose agar are described. The colour of the aerial and substrate mycelium and the ability of the mutant strains to form conidiae and pigments are discussed in detail. The differences in the ability of mutants to assimilate different carbon and nitrogen sources are of specific importance for modelling nutrient media for submerged cultivation of F. moniliforme. 2 tabs., 2 figs. 7 refs

  16. Herpes Simplex Virus Type 1 Glycoprotein B Requires a Cysteine Residue at Position 633 for Folding, Processing, and Incorporation into Mature Infectious Virus Particles

    Science.gov (United States)

    Laquerre, Sylvie; Anderson, Dina B.; Argnani, Rafaela; Glorioso, Joseph C.

    1998-01-01

    Herpes simplex virus type 1 (HSV-1) glycoprotein B (gB) resides in the virus envelope in an oligomeric form and plays an essential role in virus entry into susceptible host cells. The oligomerizing domain is a movable element consisting of amino acids 626 to 653 in the gB external domain. This domain contains a single cysteine residue at position 633 (Cys-633) that is predicted to form an intramolecular disulfide bridge with Cys-596. In this study, we examined gB oligomerization, processing, and incorporation into mature virus during infection by two mutant viruses in which either the gB Cys-633 [KgB(C633S)] or both Cys-633 and Cys-596 [KgB(C596S/C633S)] residues were mutated to serine. The result of immunofluorescence studies and analyses of released virus particles showed that the mutant gB molecules were not transported to the cell surface or incorporated into mature virus envelopes and thus infectious virus was not produced. Immunoprecipitation studies revealed that the mutant gB molecules were in an oligomeric configuration and that these mutants produced hetero-oligomers with a truncated form of gB consisting of residues 1 to 43 and 595 to 904, the latter containing the oligomerization domain. Pulse-chase experiments in combination with endoglycosidase H treatment determined that the mutant molecules were improperly processed, having been retained in the endoplasmic reticulum (ER). Coimmunoprecipitation experiments revealed that the cysteine mutations resulted in gB misfolding and retention by the molecular chaperones calnexin, calreticulin, and Grp78 in the ER. The altered conformation of the gB mutant glycoproteins was directly detected by a reduction in monoclonal antibody recognition of two previously defined distinct antigenic sites located within residues 381 to 441 and 595 to 737. The misfolded molecules were not transported to the cell surface as hetero-oligomers with wild-type gB, suggesting that the conformational change could not be corrected by

  17. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.

    2000-01-01

    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  18. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    Science.gov (United States)

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

    2011-01-01

    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  19. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

    2015-01-01

    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  20. Characterizing Functional Domains for TIM-Mediated Enveloped Virus Entry

    Science.gov (United States)

    Moller-Tank, Sven; Albritton, Lorraine M.; Rennert, Paul D.

    2014-01-01

    ABSTRACT T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members were recently identified as phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance entry of Ebola virus (EBOV) and other viruses by binding PtdSer on the viral envelope, concentrating virus on the cell surface, and promoting subsequent internalization. The PtdSer-binding activity of the immunoglobulin-like variable (IgV) domain is essential for both virus binding and internalization by TIM-1. However, TIM-3, whose IgV domain also binds PtdSer, does not effectively enhance virus entry, indicating that other domains of TIM proteins are functionally important. Here, we investigate the domains supporting enhancement of enveloped virus entry, thereby defining the features necessary for a functional PVEER. Using a variety of chimeras and deletion mutants, we found that in addition to a functional PtdSer-binding domain PVEERs require a stalk domain of sufficient length, containing sequences that promote an extended structure. Neither the cytoplasmic nor the transmembrane domain of TIM-1 is essential for enhancing virus entry, provided the protein is still plasma membrane bound. Based on these defined characteristics, we generated a mimic lacking TIM sequences and composed of annexin V, the mucin-like domain of α-dystroglycan, and a glycophosphatidylinositol anchor that functioned as a PVEER to enhance transduction of virions displaying Ebola, Chikungunya, Ross River, or Sindbis virus glycoproteins. This identification of the key features necessary for PtdSer-mediated enhancement of virus entry provides a basis for more effective recognition of unknown PVEERs. IMPORTANCE T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members are recently identified phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance virus entry by binding the phospholipid, PtdSer, present on the viral