Adaptive local surface refinement based on LR NURBS and its application to contact
Zimmermann, Christopher; Sauer, Roger A.
2017-12-01
A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.
WWER-440 control assembly local power peaking investigation on LR-0 reactor
International Nuclear Information System (INIS)
Mikus, J.
2002-01-01
This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)
Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao
2012-10-01
• The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Low rank alternating direction method of multipliers reconstruction for MR fingerprinting.
Assländer, Jakob; Cloos, Martijn A; Knoll, Florian; Sodickson, Daniel K; Hennig, Jürgen; Lattanzi, Riccardo
2018-01-01
The proposed reconstruction framework addresses the reconstruction accuracy, noise propagation and computation time for magnetic resonance fingerprinting. Based on a singular value decomposition of the signal evolution, magnetic resonance fingerprinting is formulated as a low rank (LR) inverse problem in which one image is reconstructed for each singular value under consideration. This LR approximation of the signal evolution reduces the computational burden by reducing the number of Fourier transformations. Also, the LR approximation improves the conditioning of the problem, which is further improved by extending the LR inverse problem to an augmented Lagrangian that is solved by the alternating direction method of multipliers. The root mean square error and the noise propagation are analyzed in simulations. For verification, in vivo examples are provided. The proposed LR alternating direction method of multipliers approach shows a reduced root mean square error compared to the original fingerprinting reconstruction, to a LR approximation alone and to an alternating direction method of multipliers approach without a LR approximation. Incorporating sensitivity encoding allows for further artifact reduction. The proposed reconstruction provides robust convergence, reduced computational burden and improved image quality compared to other magnetic resonance fingerprinting reconstruction approaches evaluated in this study. Magn Reson Med 79:83-96, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.
Energy Technology Data Exchange (ETDEWEB)
Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.
2016-11-01
Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)
Single Image Super-Resolution Using Global Regression Based on Multiple Local Linear Mappings.
Choi, Jae-Seok; Kim, Munchurl
2017-03-01
Super-resolution (SR) has become more vital, because of its capability to generate high-quality ultra-high definition (UHD) high-resolution (HR) images from low-resolution (LR) input images. Conventional SR methods entail high computational complexity, which makes them difficult to be implemented for up-scaling of full-high-definition input images into UHD-resolution images. Nevertheless, our previous super-interpolation (SI) method showed a good compromise between Peak-Signal-to-Noise Ratio (PSNR) performances and computational complexity. However, since SI only utilizes simple linear mappings, it may fail to precisely reconstruct HR patches with complex texture. In this paper, we present a novel SR method, which inherits the large-to-small patch conversion scheme from SI but uses global regression based on local linear mappings (GLM). Thus, our new SR method is called GLM-SI. In GLM-SI, each LR input patch is divided into 25 overlapped subpatches. Next, based on the local properties of these subpatches, 25 different local linear mappings are applied to the current LR input patch to generate 25 HR patch candidates, which are then regressed into one final HR patch using a global regressor. The local linear mappings are learned cluster-wise in our off-line training phase. The main contribution of this paper is as follows: Previously, linear-mapping-based conventional SR methods, including SI only used one simple yet coarse linear mapping to each patch to reconstruct its HR version. On the contrary, for each LR input patch, our GLM-SI is the first to apply a combination of multiple local linear mappings, where each local linear mapping is found according to local properties of the current LR patch. Therefore, it can better approximate nonlinear LR-to-HR mappings for HR patches with complex texture. Experiment results show that the proposed GLM-SI method outperforms most of the state-of-the-art methods, and shows comparable PSNR performance with much lower
Microcystin-LR Induced Immunotoxicity in Mammals
Directory of Open Access Journals (Sweden)
Yaqoob Lone
2016-01-01
Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.
Jiang, Junjun; Hu, Ruimin; Han, Zhen; Wang, Zhongyuan; Chen, Jun
2013-10-01
Face superresolution (SR), or face hallucination, refers to the technique of generating a high-resolution (HR) face image from a low-resolution (LR) one with the help of a set of training examples. It aims at transcending the limitations of electronic imaging systems. Applications of face SR include video surveillance, in which the individual of interest is often far from cameras. A two-step method is proposed to infer a high-quality and HR face image from a low-quality and LR observation. First, we establish the nonlinear relationship between LR face images and HR ones, according to radial basis function and partial least squares (RBF-PLS) regression, to transform the LR face into the global face space. Then, a locality-induced sparse representation (LiSR) approach is presented to enhance the local facial details once all the global faces for each LR training face are constructed. A comparison of some state-of-the-art SR methods shows the superiority of the proposed two-step approach, RBF-PLS global face regression followed by LiSR-based local patch reconstruction. Experiments also demonstrate the effectiveness under both simulation conditions and some real conditions.
Do Local Elites Capture Natural Disaster Reconstruction Funds?
Yoshito Takasaki
2009-01-01
This paper examines the allocation of natural disaster reconstruction funds among cyclone victims in rural Fiji. During post-emergency periods, when good information about cyclone damage is available, do local elites, a powerful minority, capture housing construction materials? With effective targeting in both receipt and the amount received, local elites do not capture larger benefits. More severely affected victims are not early recipients, though, because the supply of reconstruction funds...
Solving LR Conflicts Through Context Aware Scanning
Leon, C. Rodriguez; Forte, L. Garcia
2011-09-01
This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.
Cone-beam local reconstruction based on a Radon inversion transformation
International Nuclear Information System (INIS)
Wang Xian-Chao; Yan Bin; Li Lei; Hu Guo-En
2012-01-01
The local reconstruction from truncated projection data is one area of interest in image reconstruction for computed tomography (CT), which creates the possibility for dose reduction. In this paper, a filtered-backprojection (FBP) algorithm based on the Radon inversion transform is presented to deal with the three-dimensional (3D) local reconstruction in the circular geometry. The algorithm achieves the data filtering in two steps. The first step is the derivative of projections, which acts locally on the data and can thus be carried out accurately even in the presence of data truncation. The second step is the nonlocal Hilbert filtering. The numerical simulations and the real data reconstructions have been conducted to validate the new reconstruction algorithm. Compared with the approximate truncation resistant algorithm for computed tomography (ATRACT), not only it has a comparable ability to restrain truncation artifacts, but also its reconstruction efficiency is improved. It is about twice as fast as that of the ATRACT. Therefore, this work provides a simple and efficient approach for the approximate reconstruction from truncated projections in the circular cone-beam CT
Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells
International Nuclear Information System (INIS)
Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi
2006-01-01
Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration
W.H.L.M. Pijls (Wim)
1993-01-01
textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.
International Nuclear Information System (INIS)
Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł
2016-01-01
To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not
International Nuclear Information System (INIS)
Mehrad, Vahid; Xue, Deyi; Gu, Peihua
2013-01-01
Inspection of a manufactured freeform surface can be conducted by building its surface model and comparing this manufactured surface model with the ideal design surface model and its tolerance requirement. The manufactured freeform surface model is usually achieved by obtaining measurement points on the manufactured surface, transforming these measurement points from the measurement coordinate system to the design coordinate system through localization, and reconstructing the surface model using the localized measurement points. In this research, a method was developed to estimate the locations and their variances of any selected points on the reconstructed freeform surface considering different sources of uncertainties in measurement, localization and surface reconstruction processes. In this method, first locations and variances of the localized measurement points are calculated considering uncertainties of the measurement points and uncertainties introduced in the localization processes. Then locations and variances of points on the reconstructed freeform surface are obtained considering uncertainties of the localized measurement points and uncertainties introduced in the freeform surface reconstruction process. Two case studies were developed to demonstrate how these three different uncertainty sources influence the quality of the reconstructed freeform curve and freeform surface in inspection. (paper)
Medial canthal reconstruction with multiple local flaps
Directory of Open Access Journals (Sweden)
Akihiro Ogino
2018-03-01
Conclusion: This method is somewhat complicated compared to reconstruction with a single flap, but it is a combination of standard local flaps and is a simple reconstructive procedure. By adding additional resection, the suture line is consistent with the border of the facial unit, so postoperative scarring is inconspicuous. This technique is aesthetically useful because of the continuity of colour and texture resulting from the use of adjacent flaps.
Kumar, Manoj; Srivastava, Sheela
2010-10-01
Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.
LR: Compact connectivity representation for triangle meshes
Energy Technology Data Exchange (ETDEWEB)
Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J
2011-01-28
We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.
Digital holographic reconstruction detection of localized corrosion arising from scratches
Directory of Open Access Journals (Sweden)
LIANG WANG
2010-04-01
Full Text Available In this study, electrochemical methods and the digital holographic reconstruction technique were combined to detect the localized scratch-induced corrosion process of Alloy 690 in 0.50 mol dm-3 H2SO4 containing 0.10 mol dm-3 NaCl. The numerical reconstruction method has been proved to be an effective technique to detect changes of solution concentration. One can obtain direct information from the reconstructed images and capture subtle more revealing changes. It provides a method to detect localized corrosion arising from scratches.
Energy Technology Data Exchange (ETDEWEB)
Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)
2016-12-15
To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not
LRSYS, PASCAL LR(1) Parser Generator System
International Nuclear Information System (INIS)
O'Hair, K.
1991-01-01
Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)
Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor
2013-11-01
This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.
Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor
2015-06-01
Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.
Function reconstruction from noisy local averages
International Nuclear Information System (INIS)
Chen Yu; Huang Jianguo; Han Weimin
2008-01-01
A regularization method is proposed for the function reconstruction from noisy local averages in any dimension. Error bounds for the approximate solution in L 2 -norm are derived. A number of numerical examples are provided to show computational performance of the method, with the regularization parameters selected by different strategies
Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia
2018-06-01
A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson
Kumar, Manoj; Srivastava, Sheela
2011-06-01
Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Approximate Solution of LR Fuzzy Sylvester Matrix Equations
Directory of Open Access Journals (Sweden)
Xiaobin Guo
2013-01-01
Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.
Linking local retention, self-recruitment, and persistence in marine metapopulations
Lett, Christophe
2015-08-01
Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.
Extra Facial Landmark Localization via Global Shape Reconstruction
Directory of Open Access Journals (Sweden)
Shuqiu Tan
2017-01-01
Full Text Available Localizing facial landmarks is a popular topic in the field of face analysis. However, problems arose in practical applications such as handling pose variations and partial occlusions while maintaining moderate training model size and computational efficiency still challenges current solutions. In this paper, we present a global shape reconstruction method for locating extra facial landmarks comparing to facial landmarks used in the training phase. In the proposed method, the reduced configuration of facial landmarks is first decomposed into corresponding sparse coefficients. Then explicit face shape correlations are exploited to regress between sparse coefficients of different facial landmark configurations. Finally extra facial landmarks are reconstructed by combining the pretrained shape dictionary and the approximation of sparse coefficients. By applying the proposed method, both the training time and the model size of a class of methods which stack local evidences as an appearance descriptor can be scaled down with only a minor compromise in detection accuracy. Extensive experiments prove that the proposed method is feasible and is able to reconstruct extra facial landmarks even under very asymmetrical face poses.
Accident dynamics of LR-0 reactor
International Nuclear Information System (INIS)
Vorisek, M.; Tinka, I.
1981-01-01
The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)
Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model
International Nuclear Information System (INIS)
Zeller, P.; Clement, M.; Fessard, V.
2011-01-01
Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.
The hydration enthalpies of Md3+ and Lr3+
International Nuclear Information System (INIS)
Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.
1987-10-01
Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)
International Nuclear Information System (INIS)
Karadayi, H.R.
1982-01-01
An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)
Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity
Energy Technology Data Exchange (ETDEWEB)
Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others
2015-08-15
Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.
Directory of Open Access Journals (Sweden)
Chong Fan
2017-02-01
Full Text Available To solve the problem on inaccuracy when estimating the point spread function (PSF of the ideal original image in traditional projection onto convex set (POCS super-resolution (SR reconstruction, this paper presents an improved POCS SR algorithm based on PSF estimation of low-resolution (LR remote sensing images. The proposed algorithm can improve the spatial resolution of the image and benefit agricultural crop visual interpolation. The PSF of the highresolution (HR image is unknown in reality. Therefore, analysis of the relationship between the PSF of the HR image and the PSF of the LR image is important to estimate the PSF of the HR image by using multiple LR images. In this study, the linear relationship between the PSFs of the HR and LR images can be proven. In addition, the novel slant knife-edge method is employed, which can improve the accuracy of the PSF estimation of LR images. Finally, the proposed method is applied to reconstruct airborne digital sensor 40 (ADS40 three-line array images and the overlapped areas of two adjacent GF-2 images by embedding the estimated PSF of the HR image to the original POCS SR algorithm. Experimental results show that the proposed method yields higher quality of reconstructed images than that produced by the blind SR method and the bicubic interpolation method.
Oncologic outcome after local recurrence of chondrosarcoma: Analysis of prognostic factors.
Kim, Han-Soo; Bindiganavile, Srimanth S; Han, Ilkyu
2015-06-01
Literature on outcome after local recurrence (LR) in chondrosarcoma is scarce and better appreciation of prognostic factors is needed. (1) To evaluate post-LR oncologic outcomes of disease-specific survival and subsequent LR and (2) to identify prognostic factors for post-LR oncologic outcomes. Review of 28 patients with locally recurrent chondrosarcoma from the original cohort of 150 patients, who were treated surgically with or without adjuvants between 1982 and 2011, was performed. Mean age was 46 years (range, 21-73) which included 20 males and 8 females with mean follow up of 8.4 ± 7.5 years (range, 1.2-31.0). Post-LR survival at 5 years was 58.6 ± 10.3%. Age greater than 50 years (P = 0.011) and LR occurring within 1 year of primary surgery (P = 0.011) independently predicted poor survival. Seven patients suffered subsequent LR, which was significantly affected by surgical margin for LR (P = 0.038). Long-term survival of locally recurrent chondrosarcoma is achievable in a substantial number of patients. Older age at onset of LR and shorter interval from primary surgery to LR identifies high risk patients for poor post-LR survival while, wide surgical margins at LR surgery reduces the risk of subsequent LR. © 2015 Wiley Periodicals, Inc.
Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...
Lett, Christophe
2016-01-01
Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.
Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...
African Journals Online (AJOL)
Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...
Monitoring of microcystin-LR in Luvuvhu River catchment ...
African Journals Online (AJOL)
The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...
Linking local retention, self-recruitment, and persistence in marine metapopulations
Lett, Christophe; Nguyen-Huu, Tri; Cuif, Marion; Saenz Agudelo, Pablo; Kaplan, David M.
2015-01-01
Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR
Laboratory studies of dissolved radiolabelled microcystin-LR in lake water
DEFF Research Database (Denmark)
Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A
2003-01-01
The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....
Salient points in reconstruction of nasal skin after tumor ablation with local flaps
Directory of Open Access Journals (Sweden)
Ali Ebrahimi
2016-01-01
Full Text Available Objective: A variety of nasal skin reconstruction methods are available to meet the esthetic patient's needs. In this article, we review some of modifications of these procedures and share our experience in reconstruction of different parts of the nasal skin following skin tumor ablation. Patients and Methods : From January 2010 to January 2014, 171 patients underwent nasal skin reconstruction after excising cancerous lesions of the involved nasal skin. The patient's history, pre- and post-operation photographs, and the surgery data were collected and assessed. Demographic data related to the type of cancer, defect size and location, type of reconstruction were collected. Results: A variety of local flaps were used based on location and defect features. Nearly all flaps healed primarily without postsurgical significant complications. Conclusion: According to the results and the outcomes of the operations, we concluded that a certain flaps are more effective than others in nasal skin reconstruction. Local flap reconstruction of the nose has good esthetic result with low complication rate.
Assessment of co-seismic landslide susceptibility using LR and ...
Indian Academy of Sciences (India)
Suchita Shrestha
2018-03-28
Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Microcystin-LR equivalent concentrations in fish tissue during a ...
African Journals Online (AJOL)
The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...
International Nuclear Information System (INIS)
Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan
2016-01-01
Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)
2016-09-05
Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.
Ni, Fenbiao; Cavazos, Tereza; Hughes, Malcolm K.; Comrie, Andrew C.; Funkhouser, Gary
2002-11-01
A 1000 year reconstruction of cool-season (November-April) precipitation was developed for each climate division in Arizona and New Mexico from a network of 19 tree-ring chronologies in the southwestern USA. Linear regression (LR) and artificial neural network (NN) models were used to identify the cool-season precipitation signal in tree rings. Using 1931-88 records, the stepwise LR model was cross-validated with a leave-one-out procedure and the NN was validated with a bootstrap technique. The final models were also independently validated using the 1896-1930 precipitation data. In most of the climate divisions, both techniques can successfully reconstruct dry and normal years, and the NN seems to capture large precipitation events and more variability better than the LR. In the 1000 year reconstructions the NN also produces more distinctive wet events and more variability, whereas the LR produces more distinctive dry events. The 1000 year reconstructed precipitation from the two models shows several sustained dry and wet periods comparable to the 1950s drought (e.g. 16th century mega drought) and to the post-1976 wet period (e.g. 1330s, 1610s). The impact of extreme periods on the environment may be stronger during sudden reversals from dry to wet, which were not uncommon throughout the millennium, such as the 1610s wet interval that followed the 16th century mega drought. The instrumental records suggest that strong dry to wet precipitation reversals in the past 1000 years might be linked to strong shifts from cold to warm El Niño-southern oscillation events and from a negative to positive Pacific decadal oscillation.
Fast approach to evaluate MAP reconstruction for lesion detection and localization
International Nuclear Information System (INIS)
Qi, Jinyi; Huesman, Ronald H.
2004-01-01
Lesion detection is an important task in emission tomography. Localization ROC (LROC) studies are often used to analyze the lesion detection and localization performance. Most researchers rely on Monte Carlo reconstruction samples to obtain LROC curves, which can be very time-consuming for iterative algorithms. In this paper we develop a fast approach to obtain LROC curves that does not require Monte Carlo reconstructions. We use a channelized Hotelling observer model to search for lesions, and the results can be easily extended to other numerical observers. We theoretically analyzed the mean and covariance of the observer output. Assuming the observer outputs are multivariate Gaussian random variables, an LROC curve can be directly generated by integrating the conditional probability density functions. The high-dimensional integrals are calculated using a Monte Carlo method. The proposed approach is very fast because no iterative reconstruction is involved. Computer simulations show that the results of the proposed method match well with those obtained using the tradition LROC analysis
Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.
Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren
2013-03-01
Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.
From local pixel structure to global image super-resolution: a new face hallucination framework.
Hu, Yu; Lam, Kin-Man; Qiu, Guoping; Shen, Tingzhi
2011-02-01
We have developed a new face hallucination framework termed from local pixel structure to global image super-resolution (LPS-GIS). Based on the assumption that two similar face images should have similar local pixel structures, the new framework first uses the input low-resolution (LR) face image to search a face database for similar example high-resolution (HR) faces in order to learn the local pixel structures for the target HR face. It then uses the input LR face and the learned pixel structures as priors to estimate the target HR face. We present a three-step implementation procedure for the framework. Step 1 searches the database for K example faces that are the most similar to the input, and then warps the K example images to the input using optical flow. Step 2 uses the warped HR version of the K example faces to learn the local pixel structures for the target HR face. An effective method for learning local pixel structures from an individual face, and an adaptive procedure for fusing the local pixel structures of different example faces to reduce the influence of warping errors, have been developed. Step 3 estimates the target HR face by solving a constrained optimization problem by means of an iterative procedure. Experimental results show that our new method can provide good performances for face hallucination, both in terms of reconstruction error and visual quality; and that it is competitive with existing state-of-the-art methods.
International Nuclear Information System (INIS)
Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu
2012-01-01
Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.
Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu
2012-05-15
Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.
Homotopic non-local regularized reconstruction from sparse positron emission tomography measurements
International Nuclear Information System (INIS)
Wong, Alexander; Liu, Chenyi; Wang, Xiao Yu; Fieguth, Paul; Bie, Hongxia
2015-01-01
Positron emission tomography scanners collect measurements of a patient’s in vivo radiotracer distribution. The system detects pairs of gamma rays emitted indirectly by a positron-emitting radionuclide (tracer), which is introduced into the body on a biologically active molecule, and the tomograms must be reconstructed from projections. The reconstruction of tomograms from the acquired PET data is an inverse problem that requires regularization. The use of tightly packed discrete detector rings, although improves signal-to-noise ratio, are often associated with high costs of positron emission tomography systems. Thus a sparse reconstruction, which would be capable of overcoming the noise effect while allowing for a reduced number of detectors, would have a great deal to offer. In this study, we introduce and investigate the potential of a homotopic non-local regularization reconstruction framework for effectively reconstructing positron emission tomograms from such sparse measurements. Results obtained using the proposed approach are compared with traditional filtered back-projection as well as expectation maximization reconstruction with total variation regularization. A new reconstruction method was developed for the purpose of improving the quality of positron emission tomography reconstruction from sparse measurements. We illustrate that promising reconstruction performance can be achieved for the proposed approach even at low sampling fractions, which allows for the use of significantly fewer detectors and have the potential to reduce scanner costs
Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat
2015-10-01
The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)
2012-05-15
Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.
Reconstructing the metric of the local Universe from number counts observations
Energy Technology Data Exchange (ETDEWEB)
Vallejo, Sergio Andres [ICRANet, Piazza della Repubblica 10, I-65122 Pescara (Italy); Romano, Antonio Enea, E-mail: antonio.enea.romano@cern.ch [Theoretical Physics Department, CERN, CH-1211 Geneva 23 (Switzerland)
2017-10-01
Number counts observations available with new surveys such as the Euclid mission will be an important source of information about the metric of the Universe. We compute the low red-shift expansion for the energy density and the density contrast using an exact spherically symmetric solution in presence of a cosmological constant. At low red-shift the expansion is more precise than linear perturbation theory prediction. We then use the local expansion to reconstruct the metric from the monopole of the density contrast. We test the inversion method using numerical calculations and find a good agreement within the regime of validity of the red-shift expansion. The method could be applied to observational data to reconstruct the metric of the local Universe with a level of precision higher than the one achievable using perturbation theory.
Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells
Directory of Open Access Journals (Sweden)
Kai Shen
2011-07-01
Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.
Directory of Open Access Journals (Sweden)
Sérgio João de Luca
2010-03-01
Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.
The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.
Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans
2017-11-01
The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Reconstruction of Nasal Skin Cancer Defects with Local Flaps
Directory of Open Access Journals (Sweden)
A. C. Salgarelli
2011-01-01
Full Text Available Reconstruction of nasal defects must preserve the integrity of complex facial functions and expressions, as well as facial symmetry and a pleasing aesthetic outcome. The reconstructive modality of choice will depend largely on the location, size, and depth of the surgical defect. Individualized therapy is the best course, and numerous flaps have been designed to provide coverage of a variety of nasal-specific defects. We describe our experience in the aesthetic reconstruction of nasal skin defects following oncological surgery. The use of different local flaps for nasal skin cancer defects is reported in 286 patients. Complications in this series were one partial flap dehiscence that healed by secondary intention, two forehead flaps, and one bilobed flap with minimal rim necrosis that resulted in an irregular scar requiring revision. Aesthetic results were deemed satisfactory by all patients and the operating surgeons. The color and texture matches were aesthetically good, and the nasal contour was distinct in all patients. All scars were inconspicuous and symmetrical. No patient had tenting or a flat nose.
Reconstruction of Nasal Skin Cancer Defects with Local Flaps
International Nuclear Information System (INIS)
Salgarelli, A. C.; Bellini, P.; Multinu, A.; Consolo, U.; Magnoni, C.; Francomano, M.; Fantini, F.; Seidenari, S.
2011-01-01
Reconstruction of nasal defects must preserve the integrity of complex facial functions and expressions, as well as facial symmetry and a pleasing aesthetic outcome. The reconstructive modality of choice will depend largely on the location, size, and depth of the surgical defect. Individualized therapy is the best course, and numerous flaps have been designed to provide coverage of a variety of nasal-specific defects. We describe our experience in the aesthetic reconstruction of nasal skin defects following oncological surgery. The use of different local flaps for nasal skin cancer defects is reported in 286 patients. Complications in this series were one partial flap dehiscence that healed by secondary intention, two forehead flaps, and one bilobed flap with minimal rim necrosis that resulted in an irregular scar requiring revision. Aesthetic results were deemed satisfactory by all patients and the operating surgeons. The color and texture matches were aesthetically good, and the nasal contour was distinct in all patients. All scars were inconspicuous and symmetrical. No patient had tenting or a flat nose.
Microcystin-LR in surface water of Ponjavica river
Directory of Open Access Journals (Sweden)
Natić Dejan
2012-01-01
Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of
LOCALLY REFINED SPLINES REPRESENTATION FOR GEOSPATIAL BIG DATA
Directory of Open Access Journals (Sweden)
T. Dokken
2015-08-01
Full Text Available When viewed from distance, large parts of the topography of landmasses and the bathymetry of the sea and ocean floor can be regarded as a smooth background with local features. Consequently a digital elevation model combining a compact smooth representation of the background with locally added features has the potential of providing a compact and accurate representation for topography and bathymetry. The recent introduction of Locally Refined B-Splines (LR B-splines allows the granularity of spline representations to be locally adapted to the complexity of the smooth shape approximated. This allows few degrees of freedom to be used in areas with little variation, while adding extra degrees of freedom in areas in need of more modelling flexibility. In the EU fp7 Integrating Project IQmulus we exploit LR B-splines for approximating large point clouds representing bathymetry of the smooth sea and ocean floor. A drastic reduction is demonstrated in the bulk of the data representation compared to the size of input point clouds. The representation is very well suited for exploiting the power of GPUs for visualization as the spline format is transferred to the GPU and the triangulation needed for the visualization is generated on the GPU according to the viewing parameters. The LR B-splines are interoperable with other elevation model representations such as LIDAR data, raster representations and triangulated irregular networks as these can be used as input to the LR B-spline approximation algorithms. Output to these formats can be generated from the LR B-spline applications according to the resolution criteria required. The spline models are well suited for change detection as new sensor data can efficiently be compared to the compact LR B-spline representation.
2012-01-01
visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in
Directory of Open Access Journals (Sweden)
Xin Sui
Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.
LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells
Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay
2014-01-01
Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331
Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli
2017-06-01
A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.
Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.
Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup
2017-06-01
Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.
Kuo, Pao-Jen; Wu, Shao-Chun; Chien, Peng-Chen; Chang, Shu-Shya; Rau, Cheng-Shyuan; Tai, Hsueh-Ling; Peng, Shu-Hui; Lin, Yi-Chun; Chen, Yi-Chun; Hsieh, Hsiao-Yun; Hsieh, Ching-Hua
2018-03-02
The aim of this study was to develop an effective surgical site infection (SSI) prediction model in patients receiving free-flap reconstruction after surgery for head and neck cancer using artificial neural network (ANN), and to compare its predictive power with that of conventional logistic regression (LR). There were 1,836 patients with 1,854 free-flap reconstructions and 438 postoperative SSIs in the dataset for analysis. They were randomly assigned tin ratio of 7:3 into a training set and a test set. Based on comprehensive characteristics of patients and diseases in the absence or presence of operative data, prediction of SSI was performed at two time points (pre-operatively and post-operatively) with a feed-forward ANN and the LR models. In addition to the calculated accuracy, sensitivity, and specificity, the predictive performance of ANN and LR were assessed based on area under the curve (AUC) measures of receiver operator characteristic curves and Brier score. ANN had a significantly higher AUC (0.892) of post-operative prediction and AUC (0.808) of pre-operative prediction than LR (both P <0.0001). In addition, there was significant higher AUC of post-operative prediction than pre-operative prediction by ANN (p<0.0001). With the highest AUC and the lowest Brier score (0.090), the post-operative prediction by ANN had the highest overall predictive performance. The post-operative prediction by ANN had the highest overall performance in predicting SSI after free-flap reconstruction in patients receiving surgery for head and neck cancer.
Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain
International Nuclear Information System (INIS)
Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi
2010-01-01
LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained
Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu
2016-06-01
Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.
Detoxification of microcystin-LR in water by Portulaca oleracea cv.
Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong
2014-03-01
Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Lifescience Database Archive (English)
Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai
Some investigations and use of LR-115 track detectors for radon measurements
Amrani, D
2001-01-01
Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.
Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua
2016-03-05
A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Liqiang Liu
2014-08-01
Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.
International Nuclear Information System (INIS)
Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu
2014-01-01
Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition
International Nuclear Information System (INIS)
Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping
2016-01-01
Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.
Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat
International Nuclear Information System (INIS)
Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.
1998-01-01
Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)
International Nuclear Information System (INIS)
Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine
2016-01-01
Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the
Energy Technology Data Exchange (ETDEWEB)
Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)
2016-01-15
Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration
Quality assurance for environmental radon measurements by LR115 nuclear track detectors
Energy Technology Data Exchange (ETDEWEB)
Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)
2007-06-15
Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.
Quality assurance for environmental radon measurements by LR115 nuclear track detectors
International Nuclear Information System (INIS)
Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.
2007-01-01
Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied
Simultaneous motion estimation and image reconstruction (SMEIR) for 4D cone-beam CT
International Nuclear Information System (INIS)
Wang, Jing; Gu, Xuejun
2013-01-01
-blurring artifacts are present, leading to a 24.4% relative reconstruction error in the NACT phantom. View aliasing artifacts are present in 4D-CBCT reconstructed by FDK from 20 projections, with a relative error of 32.1%. When total variation minimization is used to reconstruct 4D-CBCT, the relative error is 18.9%. Image quality of 4D-CBCT is substantially improved by using the SMEIR algorithm and relative error is reduced to 7.6%. The maximum error (MaxE) of tumor motion determined from the DVF obtained by demons registration on a FDK-reconstructed 4D-CBCT is 3.0, 2.3, and 7.1 mm along left–right (L-R), anterior–posterior (A-P), and superior–inferior (S-I) directions, respectively. From the DVF obtained by demons registration on 4D-CBCT reconstructed by total variation minimization, the MaxE of tumor motion is reduced to 1.5, 0.5, and 5.5 mm along L-R, A-P, and S-I directions. From the DVF estimated by SMEIR algorithm, the MaxE of tumor motion is further reduced to 0.8, 0.4, and 1.5 mm along L-R, A-P, and S-I directions, respectively.Conclusions: The proposed SMEIR algorithm is able to estimate a motion model and reconstruct motion-compensated 4D-CBCT. The SMEIR algorithm improves image reconstruction accuracy of 4D-CBCT and tumor motion trajectory estimation accuracy as compared to conventional sequential 4D-CBCT reconstruction and motion estimation
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate
Energy Technology Data Exchange (ETDEWEB)
Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental
2013-02-15
In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)
Energy Technology Data Exchange (ETDEWEB)
Schütz, Martin, E-mail: martin.schuetz@chemie.uni-regensburg.de [Institute of Physical and Theoretical Chemistry, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg (Germany)
2015-06-07
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2).
Schütz, Martin
2015-06-07
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)
International Nuclear Information System (INIS)
Schütz, Martin
2015-01-01
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a
Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).
Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang
2018-05-10
Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao
2016-01-01
Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic
An analysis of the 'costs and effectiveness' of post-mastectomy local-regional radiation therapy
International Nuclear Information System (INIS)
Marks, L.B.; Prosnitz, L.R.; Hardenbergh, P.H.; Winer, E.T.
1997-01-01
Purpose: To estimate the 'cost/effectiveness' ratio for post-mastectomy local-regional radiation therapy (LR-XRT) for patients with breast cancer. As the risk of local-regional recurrence (LRR) is related to the number of positive axillary lymph nodes, the cost/effectiveness ratio of LR-XRT was assessed for a variable number of positive axillary nodes. For overall survival (OS), the cost per additional life-year is estimated as a function of follow-up duration. Methods/Assumptions: Literature data indicate that the risk of LRR is related to the number of positive axillary nodes (e.g. Fowble, Kuske). For example, the LRR rate is ∼10% for patients with negative nodes, increasing to ∼40% for patients with ≥4 positive nodes. Such data are used to linearly relate the number of positive nodes with the risk of LRR. Additional assumptions include: RT reduces the risk of LRR by 67%; local recurrences are treated with exision/biopsy, LR-XRT and systemic chemotherapy; half of the local recurrences are controlled locally and half will require additional salvage treatment with surgery or chemotherapy. The 5, 10 and 15 yr improvements in OS provided by LR-XRT are estimated to be 3, 7, and 10%, respectively, based on the literature (Overgaard, Ragaz, Klefstrom, Rutqvist). For each year following LR-XRT, the accrued life-years gained are estimated from the published survival curves. Professional and technical charges are used as a surrogate for costs, as follows (in thousands): LR-XRT-15; evaluation of recurrence-2; biopsy plus pathology-1; resection plus pathology-7, chemotherapy-10. Results: The cost per LRR prevented with the addition of routine post-mastectomy LR-XRT is shown, as a function of the number of positive axillary nodes. The cost per additional life-year gained with LR-XRT, as a function of follow-up duration, is shown. With increasing follow-up, the cost per life-year gained decreases as the additional life-years accrue. Conclusions: The cost per LRR
Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D
2018-06-01
To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88
Local System Matrix Compression for Efficient Reconstruction in Magnetic Particle Imaging
Directory of Open Access Journals (Sweden)
T. Knopp
2015-01-01
Full Text Available Magnetic particle imaging (MPI is a quantitative method for determining the spatial distribution of magnetic nanoparticles, which can be used as tracers for cardiovascular imaging. For reconstructing a spatial map of the particle distribution, the system matrix describing the magnetic particle imaging equation has to be known. Due to the complex dynamic behavior of the magnetic particles, the system matrix is commonly measured in a calibration procedure. In order to speed up the reconstruction process, recently, a matrix compression technique has been proposed that makes use of a basis transformation in order to compress the MPI system matrix. By thresholding the resulting matrix and storing the remaining entries in compressed row storage format, only a fraction of the data has to be processed when reconstructing the particle distribution. In the present work, it is shown that the image quality of the algorithm can be considerably improved by using a local threshold for each matrix row instead of a global threshold for the entire system matrix.
On tests of local realism by CP-violation parameters of K0 mesons
International Nuclear Information System (INIS)
Genovese, M.
2005-01-01
Recently various papers have proposed to test local realism (LR) by considering electroweak CP-violation parameters values in neutral pseudoscalar meson systems. Considering the large interest for a conclusive test of LR and the experimental accessibility to these tests, in this paper we critically consider these results showing how they, albeit that they are very interesting, require anyway additional assumptions and therefore cannot be considered conclusive tests of LR. (orig.)
Inhibition of Microcystis aeruginosa and microcystin- LR with one ...
African Journals Online (AJOL)
Yomi
2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.
2011-09-30
...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...
Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana
2016-05-01
Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.
International Nuclear Information System (INIS)
Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun
2004-01-01
Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses
Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing
2016-12-01
A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai
A further study of the (CR-LR) difference technique for retrospective radon exposure assessment
International Nuclear Information System (INIS)
Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.
2006-01-01
The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical
Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei
2017-07-01
In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei
2018-02-01
The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.
Iwahira, Yoshiko
2017-01-01
Background: Nipple–areolar reconstruction is the final step in breast reconstruction. Reconstruction using local flaps and tattooing is useful in cases of bilateral reconstruction, a small nipple–areolar complex (NAC) as the donor site, and avoiding disturbance of the normal side and other body parts. However, this method can cause projection loss and color fading of the nipple. Moreover, the breast mound is reconstructed with an implant. Methods: We performed nipple–areolar reconstruction of 90 nipples using clover-designed flaps oriented at 120 degrees and tattooing after breast silicone implantation in 64 women. The tattoo was designed before flap operation and stained darker. Following donor site closure, a dermal flap was made as a bridge for nipple support. The nipple space was separated by the dermal flap from the breast mound and was filled with subcutaneous tissue. The size of the reconstructed nipple projection was measured postoperatively and 1 year later. The projection maintenance rate was calculated. Results: The heights of the nipple projection were 11.3 ± 1.8 mm (95% confidence interval [CI]: 10.9–11.7) just after the operation and 6.09 ± 2.4 mm (95% CI: 5.6–6.6) 1 year later. The actual range of nipple projection between these 2 heights was 5.2 ± 2.4 mm (95% CI: 4.7–5.7). The maintenance rate of the reconstructed nipple projection after 12 months was 54.1 ± 20.9 (95% CI: 49.7–58.5). The nipple color was maintained for over a year. Conclusions: Our nipple–areolar reconstruction technique could maintain the projection and color of the reconstructed nipple for a long period. Good outcomes were obtained in this implant-based breast reconstruction. PMID:28507843
Directory of Open Access Journals (Sweden)
Jinlin Jiang
Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.
Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing
2013-01-01
Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844
González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo
2017-10-01
This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.
International Nuclear Information System (INIS)
Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.
2017-01-01
Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.
Low-priced, time-saving, reliable and stable LR-115 counting system
International Nuclear Information System (INIS)
Tchorz-Trzeciakiewicz, D.E.
2015-01-01
Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate
Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites
International Nuclear Information System (INIS)
Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.
1996-01-01
The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites
Post-disaster housing reconstruction: Perspectives of the NGO and local authorities on delay issues
Khalid, Khairin Norhashidah; Nifa, Faizatul Akmar Abdul; Ismail, Risyawati Mohamed; Lin, Chong Khai
2016-08-01
Post disaster reconstruction is complex, dynamic and chaotic in nature and as such represents many challenges because it is unlike normal construction. However, the time scale of reconstruction is shorter than the normal construction, but it often deals with uncertainties and the scale of the construction activities required is relatively high. After a disaster impacts a country, many governments, institutions and aid organizations cooperate and involved with the reconstruction process. This is seen as a tool for applying policies and programs designed to remedy the weakness in developmental policies, infrastructure and institutional arrangements. This paper reports a part of an on-going research on post-disaster housing reconstruction in Malaysia. An extensive literature review and pilot interviews were undertaken to establish the factors that contribute to the delay in post-disaster reconstruction project. Accordingly, this paper takes the perspective of recovery from non-government organization (NGO) and local authorities which act as providers of social services, builders of infrastructure, regulators of economic activity and managers of the natural environment. As a result, it is important on how those decisions are made, who is involved in the decision-making, and what are the consequences of this decision.
International Nuclear Information System (INIS)
Qi Zhihua; Chen Guanghong
2007-01-01
Recently, x-ray differential phase contrast computed tomography (DPC-CT) has been experimentally implemented using a conventional source combined with several gratings. Images were reconstructed using a parallel-beam reconstruction formula. However, parallel-beam reconstruction formulae are not directly applicable for a large image object where the parallel-beam approximation fails. In this note, we present a new image reconstruction formula for fan-beam DPC-CT. There are two major features in this algorithm: (1) it enables the reconstruction of a local region of interest (ROI) using data acquired from an angular interval shorter than 180 0 + fan angle and (2) it still preserves the filtered backprojection structure. Numerical simulations have been conducted to validate the image reconstruction algorithm. (note)
LALR(1) : LL(1) = LR(0) : LL(0)
Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.
1992-01-01
It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily
Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao
2016-01-01
Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment
Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin
2018-04-30
Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple
Local self-similarity descriptor for point-of-interest reconstruction of real-world scenes
International Nuclear Information System (INIS)
Gao, Xianglu; Wan, Weibing; Zhao, Qunfei; Zhang, Xianmin
2015-01-01
Scene reconstruction is utilized commonly in close-range photogrammetry, with diverse applications in fields such as industry, biology, and aerospace industries. Presented surfaces or wireframe three-dimensional (3D) model reconstruction applications are either too complex or too inflexible to accommodate various types of real-world scenes, however. This paper proposes an algorithm for acquiring point-of-interest (referred to throughout the study as POI) coordinates in 3D space, based on multi-view geometry and a local self-similarity descriptor. After reconstructing several POIs specified by a user, a concise and flexible target object measurement method, which obtains the distance between POIs, is described in detail. The proposed technique is able to measure targets with high accuracy even in the presence of obstacles and non-Lambertian surfaces. The method is so flexible that target objects can be measured with a handheld digital camera. Experimental results further demonstrate the effectiveness of the algorithm. (paper)
Radon concentrations in some Egyptian dwellings using LR 115 detectors
International Nuclear Information System (INIS)
Hussein, A.S.
2007-01-01
Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65
Lee, K; Kim, M; Kim, K
2018-05-11
Skin surface evaluation has been studied using various imaging techniques. However, all these studies had limited impact because they were performed using visual exam only. To improve on this scenario with haptic feedback, we propose 3D reconstruction of the skin surface using a single image. Unlike extant 3D skin surface reconstruction algorithms, we utilize the local texture and global curvature regions, combining the results for reconstruction. The first entails the reconstruction of global curvature, achieved by bilateral filtering that removes noise on the surface while maintaining the edge (ie, furrow) to obtain the overall curvature. The second entails the reconstruction of local texture, representing the fine wrinkles of the skin, using an advanced form of bilateral filtering. The final image is then composed by merging the two reconstructed images. We tested the curvature reconstruction part by comparing the resulting curvatures with measured values from real phantom objects while local texture reconstruction was verified by measuring skin surface roughness. Then, we showed the reconstructed result of our proposed algorithm via the reconstruction of various real skin surfaces. The experimental results demonstrate that our approach is a promising technology to reconstruct an accurate skin surface with a single skin image. We proposed 3D skin surface reconstruction using only a single camera. We highlighted the utility of global curvature, which has not been considered important in the past. Thus, we proposed a new method for 3D reconstruction that can be used for 3D haptic palpation, dividing the concepts of local and global regions. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Valentina Kubale
2016-07-01
Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.
Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.
Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S
2014-04-01
We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.
Partial breast irradiation as second conservative treatment for local breast cancer recurrence
International Nuclear Information System (INIS)
Hannoun-Levi, Jean-Michel; Houvenaeghel, Gilles; Ellis, Steve; Teissier, Eric; Alzieu, Claude; Lallement, Michel; Cowen, Didier
2004-01-01
Purpose: Mastectomy is the treatment of reference for local relapse after breast cancer (BC). The aim of this study was to document the feasibility and the results of associating lumpectomy with partial breast irradiation by interstitial brachytherapy (IB) as local treatment for an isolated ipsilateral BC local recurrence (LR). Methods and materials: Between 1975 and 1996 at Marseille and Nice Cancer Institutes, 4026 patients received lumpectomy and radiotherapy (RT) (50-80 Gy) for a localized breast cancer of which 473 presented a LR. Among these patients, 69 (14.6%) received a second lumpectomy followed by IB, which delivered 30 Gy (Nice, n = 24) or 45-50 Gy (Marseille, n = 45) with 3 to 8 192 Ir wires in 1 or 2 planes on the 85% isodose. Results: Median age at LR was 58.2 years, median follow-up since primary BC was 10 years, and median follow-up after the second conservative treatment was 50.2 months (range, 2-139 months). Immediate tolerance was good in all cases. Grade 2 to 3 long-term complications (LTC) according to IB dose were 0%, 28%, and 32%, respectively, for 30 Gy, 45 to 46 Gy, and 50 Gy (p 0.01). Grade 2 to 3 LTC according to total dose were 4% and 30%, respectively, for total doses (initial RT plus IB) ≤ 100 Gy or >100 Gy (p = 0.008). Logistic regression showed that the only factor associated with Grade 2 to 3 complications was higher IB doses (p = 0.01). We noted 11 second LRs (LR2), 10 distant metastases (DM), and 5 specific deaths. LR2 occurred either in the tumor bed (50.8%) or close to the tumor bed (34.3%) or in another quadrant (14.9%). Kaplan-Meier 5-year freedom from (FF) LR2 (FFLR2), FFDM, and DFS were 77.4%, 86.7%, and 68.9%, respectively. Overall 5-year survival (OS) was 91.8%. Univariate analysis showed the following factors associated with a higher FFLR2: (1) number of wires used for IB (3-4 vs. 5-8 wires, p = 0.006), (2) IB doses (30-45 Gy vs. 46-60 Gy, p = 0.05), (3) number of planes (1 vs. 2, p = 0.05), (4) interval between
International Nuclear Information System (INIS)
Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing
2013-01-01
Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate
International Nuclear Information System (INIS)
Beltran, Chris; Herman, Michael G.; Davis, Brian J.
2008-01-01
Purpose: To determine planning target volume (PTV) margins for prostate radiotherapy based on the internal margin (IM) (intrafractional motion) and the setup margin (SM) (interfractional motion) for four daily localization methods: skin marks (tattoo), pelvic bony anatomy (bone), intraprostatic gold seeds using a 5-mm action threshold, and using no threshold. Methods and Materials: Forty prostate cancer patients were treated with external radiotherapy according to an online localization protocol using four intraprostatic gold seeds and electronic portal images (EPIs). Daily localization and treatment EPIs were obtained. These data allowed inter- and intrafractional analysis of prostate motion. The SM for the four daily localization methods and the IM were determined. Results: A total of 1532 fractions were analyzed. Tattoo localization requires a SM of 6.8 mm left-right (LR), 7.2 mm inferior-superior (IS), and 9.8 mm anterior-posterior (AP). Bone localization requires 3.1, 8.9, and 10.7 mm, respectively. The 5-mm threshold localization requires 4.0, 3.9, and 3.7 mm. No threshold localization requires 3.4, 3.2, and 3.2 mm. The intrafractional prostate motion requires an IM of 2.4 mm LR, 3.4 mm IS and AP. The PTV margin using the 5-mm threshold, including interobserver uncertainty, IM, and SM, is 4.8 mm LR, 5.4 mm IS, and 5.2 mm AP. Conclusions: Localization based on EPI with implanted gold seeds allows a large PTV margin reduction when compared with tattoo localization. Except for the LR direction, bony anatomy localization does not decrease the margins compared with tattoo localization. Intrafractional prostate motion is a limiting factor on margin reduction
A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...
International Nuclear Information System (INIS)
Galper, Sharon; Blood, Emily; Gelman, Rebecca; Abner, Anthony; Recht, Abram; Kohli, Anita; Wong, Julia S.; Smith, Darrell; Bellon, Jennifer; Connolly, James; Schnitt, Stuart; Winer, Eric; Silver, Barbara B.A.; Harris, Jay R.
2005-01-01
Purpose: To determine the long-term prognosis of patients who develop a local recurrence (LR) after conservative surgery (CS) and radiation therapy (RT) for early-stage invasive breast cancer. Methods and materials: Between 1970 and 1987, 2102 patients with clinical Stage I-II breast cancer were treated with CS+RT. LR was defined as any recurrence within the ipsilateral breast with or without simultaneous regional nodal or distant metastasis. Patients were at risk for a LR until the first of distant metastases, second nonbreast malignancy, or death (DF/S/D). The final study population comprised 341 patients with LR. The median time to LR was 72 months. The median follow-up time after LR was 85 months. A proportional hazards model of time from LR to DF/S/D was done to investigate the influence of factors at initial diagnosis and at LR on subsequent outcome. Results: The actuarial freedom from DF/S/D 5 years after LR was 65% and the survival was 81%. Variables significantly associated with time to DF/S/D were: LR histology (invasive vs. ductal carcinoma in situ, hazard ratio [HR] = 4.1, p 5 years, HR = 2.6, p 5 years, HR = 1.8, p = 0.006); and age at initial diagnosis (≥60 vs. < 60, HR = 1.6, p = 0.01). Conclusions: Many patients with LR after CS+RT have prolonged distant disease-free survival, particularly those able to be treated with mastectomy. Patients with a noninvasive LR, longer interval to LR, or age <60 had a longer time to distant failure, second malignancy, or death than other patients
Perez-Alday, Erick A; Thomas, Jason A; Kabir, Muammar; Sedaghat, Golriz; Rogovoy, Nichole; van Dam, Eelco; van Dam, Peter; Woodward, William; Fuss, Cristina; Ferencik, Maros; Tereshchenko, Larisa G
We conducted a prospective clinical study (n=14; 29% female) to assess the accuracy of a three-dimensional (3D) photography-based method of torso geometry reconstruction and body surface electrodes localization. The position of 74 body surface electrocardiographic (ECG) electrodes (diameter 5mm) was defined by two methods: 3D photography, and CT (marker diameter 2mm) or MRI (marker size 10×20mm) imaging. Bland-Altman analysis showed good agreement in X (bias -2.5 [95% limits of agreement (LoA) -19.5 to 14.3] mm), Y (bias -0.1 [95% LoA -14.1 to 13.9] mm), and Z coordinates (bias -0.8 [95% LoA -15.6 to 14.2] mm), as defined by the CT/MRI imaging, and 3D photography. The average Hausdorff distance between the two torso geometry reconstructions was 11.17±3.05mm. Thus, accurate torso geometry reconstruction using 3D photography is feasible. Body surface ECG electrodes coordinates as defined by the CT/MRI imaging, and 3D photography, are in good agreement. Copyright © 2017 Elsevier Inc. All rights reserved.
Radon concentrations in some Egyptian dwellings using LR 115 detectors
Energy Technology Data Exchange (ETDEWEB)
Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)
2007-06-15
Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.
Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A
2013-11-15
Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the
Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis
2011-10-01
A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.
Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun
2017-06-05
A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.
Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup
2017-01-01
The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L
A Super-resolution Reconstruction Algorithm for Surveillance Video
Directory of Open Access Journals (Sweden)
Jian Shao
2017-01-01
Full Text Available Recent technological developments have resulted in surveillance video becoming a primary method of preserving public security. Many city crimes are observed in surveillance video. The most abundant evidence collected by the police is also acquired through surveillance video sources. Surveillance video footage offers very strong support for solving criminal cases, therefore, creating an effective policy, and applying useful methods to the retrieval of additional evidence is becoming increasingly important. However, surveillance video has had its failings, namely, video footage being captured in low resolution (LR and bad visual quality. In this paper, we discuss the characteristics of surveillance video and describe the manual feature registration – maximum a posteriori – projection onto convex sets to develop a super-resolution reconstruction method, which improves the quality of surveillance video. From this method, we can make optimal use of information contained in the LR video image, but we can also control the image edge clearly as well as the convergence of the algorithm. Finally, we make a suggestion on how to adjust the algorithm adaptability by analyzing the prior information of target image.
The calibration of the solid state nuclear track detector LR 115 for radon measurements
Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W
1999-01-01
An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)
2013-10-01
Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.
Lee, Kyung Suk; Kim, Jun Oh; Kim, Nam Gyun; Lee, Yoon Jung; Park, Young Ji; Kim, Jun Sik
2017-12-01
Surgery for reconstruction of defects after surgery should be performed selectively and the many points must be considered. The authors conducted this study to compare the local flap and skin graft by facial location in the reconstruction after resection of facial skin cancer. The authors performed the study in patients that had received treatment in Department of Plastic Surgery, Gyeongsang National University. The cases were analyzed according to the reconstruction methods for the defects after surgery, sex, age, tumor site, and tumor size. Additionally, the authors compared differences of aesthetic satisfaction (out of 5 points) of patients in the local flap and skin graft by facial location after resection of facial skin cancer by dividing the face into eight areas. A total of 153 cases were confirmed. The most common facial skin cancer was basal cell carcinoma (56.8%, 87 cases), followed by squamous cell carcinoma (37.2%, 57 cases) and bowen's disease (5.8%, 9 cases). The most common reconstruction method was local flap 119 cases (77.7%), followed by skin graft 34 cases (22.3%). 86 patients answered the questionnaire and mean satisfaction of the local flap and skin graft were 4.3 and 3.5 ( p =0.04), respectively, indicating that satisfaction of local flap was significantly high. When comparing satisfaction of patients according to results, local flap shows excellent effects in functional and cosmetic aspects would be able to provide excellent results rather than using a skin graft with poor touch and tone compared to the surrounding normal skin.
Diagnostics on LALR(k) conflicts based on a method for LR(k) testing
DEFF Research Database (Denmark)
Kristensen, Bent Bruun; Madsen, Ole Lehrmann
1981-01-01
A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...
Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...
First successful ionization of Lr (Z = 103) by a surface-ionization technique
Energy Technology Data Exchange (ETDEWEB)
Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)
2013-02-15
We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.
Sue, Gloria R; Lee, Gordon K
2018-05-01
Mastectomy skin necrosis is a significant problem after breast reconstruction. We sought to perform a comparative analysis on this complication between patients undergoing autologous breast reconstruction and patients undergoing 2-stage expander implant breast reconstruction. A retrospective review was performed on consecutive patients undergoing autologous breast reconstruction or 2-stage expander implant breast reconstruction by the senior author from 2006 through 2015. Patient demographic factors including age, body mass index, history of diabetes, history of smoking, and history of radiation to the breast were collected. Our primary outcome measure was mastectomy skin necrosis. Fisher exact test was used for statistical analysis between the 2 patient cohorts. The treatment patterns of mastectomy skin necrosis were then analyzed. We identified 204 patients who underwent autologous breast reconstruction and 293 patients who underwent 2-stage expander implant breast reconstruction. Patients undergoing autologous breast reconstruction were older, heavier, more likely to have diabetes, and more likely to have had prior radiation to the breast compared with patients undergoing implant-based reconstruction. The incidence of mastectomy skin necrosis was 30.4% of patients in the autologous group compared with only 10.6% of patients in the tissue expander group (P care in the autologous group, only 3.2% were treated with local wound care in the tissue expander group (P skin necrosis is significantly more likely to occur after autologous breast reconstruction compared with 2-stage expander implant-based breast reconstruction. Patients with autologous reconstructions are more readily treated with local wound care compared with patients with tissue expanders, who tended to require operative treatment of this complication. Patients considering breast reconstruction should be counseled appropriately regarding the differences in incidence and management of mastectomy skin
Localized Edge Vibrations and Edge Reconstruction by Joule Heating in Graphene Nanostructures
DEFF Research Database (Denmark)
Engelund, Mads; Fürst, Joachim Alexander; Jauho, Antti-Pekka
2010-01-01
Control of the edge topology of graphene nanostructures is critical to graphene-based electronics. A means of producing atomically smooth zigzag edges using electronic current has recently been demonstrated in experiments [Jia et al., Science 323, 1701 (2009)]. We develop a microscopic theory...... for current-induced edge reconstruction using density functional theory. Our calculations provide evidence for localized vibrations at edge interfaces involving unpassivated armchair edges. We demonstrate that these vibrations couple to the current, estimate their excitation by Joule heating, and argue...
Petz recovery versus matrix reconstruction
Holzäpfel, Milan; Cramer, Marcus; Datta, Nilanjana; Plenio, Martin B.
2018-04-01
The reconstruction of the state of a multipartite quantum mechanical system represents a fundamental task in quantum information science. At its most basic, it concerns a state of a bipartite quantum system whose subsystems are subjected to local operations. We compare two different methods for obtaining the original state from the state resulting from the action of these operations. The first method involves quantum operations called Petz recovery maps, acting locally on the two subsystems. The second method is called matrix (or state) reconstruction and involves local, linear maps that are not necessarily completely positive. Moreover, we compare the quantities on which the maps employed in the two methods depend. We show that any state that admits Petz recovery also admits state reconstruction. However, the latter is successful for a strictly larger set of states. We also compare these methods in the context of a finite spin chain. Here, the state of a finite spin chain is reconstructed from the reduced states of a few neighbouring spins. In this setting, state reconstruction is the same as the matrix product operator reconstruction proposed by Baumgratz et al. [Phys. Rev. Lett. 111, 020401 (2013)]. Finally, we generalize both these methods so that they employ long-range measurements instead of relying solely on short-range correlations embodied in such local reduced states. Long-range measurements enable the reconstruction of states which cannot be reconstructed from measurements of local few-body observables alone and hereby we improve existing methods for quantum state tomography of quantum many-body systems.
Matsui, Fumihiko; Matsushita, Tomohiro; Daimon, Hiroshi
2018-06-01
The local atomic structure around a specific element atom can be recorded as a photoelectron diffraction pattern. Forward focusing peaks and diffraction rings around them indicate the directions and distances from the photoelectron emitting atom to the surrounding atoms. The state-of-the-art holography reconstruction algorithm enables us to image the local atomic arrangement around the excited atom in a real space. By using circularly polarized light as an excitation source, the angular momentum transfer from the light to the photoelectron induces parallax shifts in these diffraction patterns. As a result, stereographic images of atomic arrangements are obtained. These diffraction patterns can be used as atomic-site-resolved probes for local electronic structure investigation in combination with spectroscopy techniques. Direct three-dimensional atomic structure visualization and site-specific electronic property analysis methods are reviewed. Furthermore, circular dichroism was also found in valence photoelectron and Auger electron diffraction patterns. The investigation of these new phenomena provides hints for the development of new techniques for local structure probing.
Directory of Open Access Journals (Sweden)
Mawethu P. Bilibana
2016-11-01
Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.
SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?
Directory of Open Access Journals (Sweden)
Carol P. S. Lam
2015-01-01
Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.
International Nuclear Information System (INIS)
Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong
2004-01-01
A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes
International Nuclear Information System (INIS)
Li Yong; Liang Bin; Zou Xin-Ye; Cheng Jian-Chun
2012-01-01
Broadband acoustic transmission enhancement (ATE) is realized for a periodically structured stiff plate without any opening that is conventionally thought to be only capable of supporting narrowband ATE, by introducing locally resonant (LR) elements. This exotic phenomenon is interpreted by analyzing the vibration pattern of the structure-induced LR modes, and is well modeled by a simple 'spring-mass' system which reveals the contribution of the LR effect to the important broadband performance. Our findings should help to better understand the physical mechanism of ATE and may have potential impact on ultrasonic applications such as broadband acoustic filters or compact acoustic devices in subwavelength scale
太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures
Institute of Scientific and Technical Information of China (English)
王文琴; 张永臣; 贾红玲
2013-01-01
目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3
Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M
2007-12-26
Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.
Estimating local noise power spectrum from a few FBP-reconstructed CT scans
Energy Technology Data Exchange (ETDEWEB)
Zeng, Rongping, E-mail: rongping.zeng@fda.hhs.gov; Gavrielides, Marios A.; Petrick, Nicholas; Sahiner, Berkman; Li, Qin; Myers, Kyle J. [Division of Imaging, Diagnostics, and Software Reliability, Office of Science and Engineering Laboratories, CDRH, FDA, Silver Spring, Maryland 20993 (United States)
2016-01-15
Purpose: Traditional ways to estimate 2D CT noise power spectrum (NPS) involve an ensemble average of the power spectrums of many noisy scans. When only a few scans are available, regions of interest are often extracted from different locations to obtain sufficient samples to estimate the NPS. Using image samples from different locations ignores the nonstationarity of CT noise and thus cannot accurately characterize its local properties. The purpose of this work is to develop a method to estimate local NPS using only a few fan-beam CT scans. Methods: As a result of FBP reconstruction, the CT NPS has the same radial profile shape for all projection angles, with the magnitude varying with the noise level in the raw data measurement. This allows a 2D CT NPS to be factored into products of a 1D angular and a 1D radial function in polar coordinates. The polar separability of CT NPS greatly reduces the data requirement for estimating the NPS. The authors use this property and derive a radial NPS estimation method: in brief, the radial profile shape is estimated from a traditional NPS based on image samples extracted at multiple locations. The amplitudes are estimated by fitting the traditional local NPS to the estimated radial profile shape. The estimated radial profile shape and amplitudes are then combined to form a final estimate of the local NPS. We evaluate the accuracy of the radial NPS method and compared it to traditional NPS methods in terms of normalized mean squared error (NMSE) and signal detectability index. Results: For both simulated and real CT data sets, the local NPS estimated with no more than six scans using the radial NPS method was very close to the reference NPS, according to the metrics of NMSE and detectability index. Even with only two scans, the radial NPS method was able to achieve a fairly good accuracy. Compared to those estimated using traditional NPS methods, the accuracy improvement was substantial when a few scans were available
International Nuclear Information System (INIS)
Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.
2012-01-01
Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.
Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine
Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...
Directory of Open Access Journals (Sweden)
Jing Li
2018-01-01
Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.
Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS
Directory of Open Access Journals (Sweden)
Gaodao Liang
2011-01-01
Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.
LR1: a candidate RNA virus of Leishmania.
Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K
1988-01-01
Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...
Identification of Patients at Very Low Risk of Local Recurrence After Breast-Conserving Surgery
Energy Technology Data Exchange (ETDEWEB)
Smith, Sally L., E-mail: ssmith11@bccancer.bc.ca [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Truong, Pauline T. [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Lu, Linghong; Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, Victoria, British Columbia (Canada); Olivotto, Ivo A. [Division of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary, Calgary, Alberta (Canada)
2014-07-01
Purpose: To identify clinical and pathological factors that identify groups of women with stage I breast cancer with a 5-year risk of local recurrence (LR) ≤1.5% after breast-conserving therapy (BCS) plus whole-breast radiation therapy (RT). Methods and Materials: Study subjects were 5974 patients ≥50 years of age whose cancer was diagnosed between 1989 and 2006, and were referred with pT1 pN0 invasive breast cancer treated with BCS and RT. Cases of 5- and 10-year LR were examined using Kaplan-Meier methods. Recursive partitioning analysis was performed in patients treated with and without endocrine therapy to identify combinations of factors associated with a 5-year LR risk ≤1.5%. Results: The median follow-up was 8.61 years. Median age was 63 years of age (range, 50 to 91). Overall 5-year LR was 1.5% (95% confidence interval [CI], 1.2%-1.9%) and 10-year LR was 3.4% (95% CI, 2.8%-4.0%). Of 2830 patients treated with endocrine therapy, patient subsets identified with 5-year LR ≤1.5% included patients with grade 1 histology (n=1038; LR, 0.2%; 95% CI, 0%-0.5%) or grade 2 histology plus ≥60 years of age (n=843; LR, 0.5%; 95% CI, 0%-1.0%). Ten-year LR for these groups were 0.8% (95% CI, 0.1%-1.6%) and 0.9% (95% CI, 0.2%-1.6%), respectively. Of 3144 patients treated without endocrine therapy, patients with grade 1 histology plus clear margins had 5-year LR ≤1.5% (n=821; LR, 0.6%; 95% CI, 0.1%-1.2%). Ten-year LR for this group was 2.2% (95% CI, 1.0%-3.4%). Conclusions: Histologic grade, age, margin status, and use of endocrine therapy identified 45% of a population-based cohort of female patients over age 50 with stage I breast cancer with a 5-year LR risk ≤1.5% after BCS plus RT. Prospective study is needed to evaluate the safety of omitting RT in patients with such a low risk of LR.
Bulk etch rate of LR-115 cellulose nitrate film
International Nuclear Information System (INIS)
Harris, M.J.; Schlenker, R.A.
1977-01-01
Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector
WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor
International Nuclear Information System (INIS)
Josek, R.; Hudec, F.; Rypar, V.
2006-01-01
One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H
2017-11-01
Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.
Experimental study on the aging process of the LR 115 cellulose nitrate radon detector
International Nuclear Information System (INIS)
Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.
2001-01-01
An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the
Iyer, Rajiv R; Wu, Adela; Macmillan, Alexandra; Musavi, Leila; Cho, Regina; Lopez, Joseph; Jallo, George I; Dorafshar, Amir H; Ahn, Edward S
2018-01-01
Cranial vault remodeling surgery for craniosynostosis carries the potential risk of dural venous sinus injury given the extensive bony exposure. Identification of the dural venous sinuses can be challenging in patients with craniosynostosis given the lack of accurate surface-localizing landmarks. Computer-aided design and manufacturing (CAD/CAM) has allowed surgeons to pre-operatively plan these complex procedures in an effort to increase reconstructive efficiency. An added benefit of this technology is the ability to intraoperatively map the dural venous sinuses based on pre-operative imaging. We utilized CAD/CAM technology to intraoperatively map the dural venous sinuses for patients undergoing reconstructive surgery for craniosynostosis in an effort to prevent sinus injury, increase operative efficiency, and enhance patient safety. Here, we describe our experience utilizing this intraoperative technology in pediatric patients with craniosynostosis. We retrospectively reviewed the charts of children undergoing reconstructive surgery for craniosynostosis using CAD/CAM surgical planning guides at our institution between 2012 and 2016. Data collected included the following: age, gender, type of craniosynostosis, estimated blood loss, sagittal sinus deviation from the sagittal suture, peri-operative outcomes, and hospital length of stay. Thirty-two patients underwent reconstructive cranial surgery for craniosynostosis, with a median age of 11 months (range, 7-160). Types of synostosis included metopic (6), unicoronal (6), sagittal (15), lambdoid (1), and multiple suture (4). Sagittal sinus deviation from the sagittal suture was maximal in unicoronal synostosis patients (10.2 ± 0.9 mm). All patients tolerated surgery well, and there were no occurrences of sagittal sinus, transverse sinus, or torcular injury. The use of CAD/CAM technology allows for accurate intraoperative dural venous sinus localization during reconstructive surgery for craniosynostosis and
MO-DE-207A-11: Sparse-View CT Reconstruction Via a Novel Non-Local Means Method
International Nuclear Information System (INIS)
Chen, Z; Qi, H; Wu, S; Xu, Y; Zhou, L
2016-01-01
Purpose: Sparse-view computed tomography (CT) reconstruction is an effective strategy to reduce the radiation dose delivered to patients. Due to its insufficiency of measurements, traditional non-local means (NLM) based reconstruction methods often lead to over-smoothness in image edges. To address this problem, an adaptive NLM reconstruction method based on rotational invariance (RIANLM) is proposed. Methods: The method consists of four steps: 1) Initializing parameters; 2) Algebraic reconstruction technique (ART) reconstruction using raw projection data; 3) Positivity constraint of the image reconstructed by ART; 4) Update reconstructed image by using RIANLM filtering. In RIANLM, a novel similarity metric that is rotational invariance is proposed and used to calculate the distance between two patches. In this way, any patch with similar structure but different orientation to the reference patch would win a relatively large weight to avoid over-smoothed image. Moreover, the parameter h in RIANLM which controls the decay of the weights is adaptive to avoid over-smoothness, while it in NLM is not adaptive during the whole reconstruction process. The proposed method is named as ART-RIANLM and validated on Shepp-Logan phantom and clinical projection data. Results: In our experiments, the searching neighborhood size is set to 15 by 15 and the similarity window is set to 3 by 3. For the simulated case with a resolution of 256 by 256 Shepp-Logan phantom, the ART-RIANLM produces higher SNR (35.38dB<24.00dB) and lower MAE (0.0006<0.0023) reconstructed image than ART-NLM. The visual inspection demonstrated that the proposed method could suppress artifacts or noises more effectively and preserve image edges better. Similar results were found for clinical data case. Conclusion: A novel ART-RIANLM method for sparse-view CT reconstruction is presented with superior image. Compared to the conventional ART-NLM method, the SNR and MAE from ART-RIANLM increases 47% and decreases 74
Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.
He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei
2015-01-01
A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.
Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk
2017-10-01
The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] + = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] + = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] + = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)
2012-04-15
Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.
Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko
2018-06-01
The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.
Chan, Mark; Chiang, Chi Leung; Lee, Venus; Cheung, Steven; Leung, Ronnie; Wong, Matthew; Lee, Frankle; Blanck, Oliver
2017-01-01
Aim of this study was to comparatively evaluate the accuracy of respiration-correlated (4D) and uncorrelated (3D) cone beam computed tomography (CBCT) in localizing lipiodolized hepatocellular carcinomas during stereotactic body radiotherapy (SBRT). 4D-CBCT scans of eighteen HCCs were acquired during free-breathing SBRT following trans-arterial chemo-embolization (TACE) with lipiodol. Approximately 1320 x-ray projections per 4D-CBCT were collected and phase-sorted into ten bins. A 4D registration workflow was followed to register the reconstructed time-weighted average CBCT with the planning mid-ventilation (MidV) CT by an initial bone registration of the vertebrae and then tissue registration of the lipiodol. For comparison, projections of each 4D-CBCT were combined to synthesize 3D-CBCT without phase-sorting. Using the lipiodolized tumor, uncertainties of the treatment setup estimated from the absolute and relative lipiodol position to bone were analyzed separately for 4D- and 3D-CBCT. Qualitatively, 3D-CBCT showed better lipiodol contrast than 4D-CBCT primarily because of a tenfold increase of projections used for reconstruction. Motion artifact was observed to subside in 4D-CBCT compared to 3D-CBCT. Group mean, systematic and random errors estimated from 4D- and 3D-CBCT agreed to within 1 mm in the cranio-caudal (CC) and 0.5 mm in the anterior-posterior (AP) and left-right (LR) directions. Systematic and random errors are largest in the CC direction, amounting to 4.7 mm and 3.7 mm from 3D-CBCT and 5.6 mm and 3.8 mm from 4D-CBCT, respectively. Safety margin calculated from 3D-CBCT and 4D-CBCT differed by 2.1, 0.1 and 0.0 mm in the CC, AP, and LR directions. 3D-CBCT is an adequate alternative to 4D-CBCT when lipoid is used for localizing HCC during free-breathing SBRT. Similar margins are anticipated with 3D- and 4D-CBCT.
Takahashi, Hideo; Akyuz, Muhammet; Aksoy, Erol; Karabulut, Koray; Berber, Eren
2017-06-01
The aims of this study were to determine the incidence of Local recurrence (LR) in patients at long-term follow-up after laparoscopic RFA (LRFA) and also to determine the risk factors for LR from a contemporary series. Patients undergoing LRFA between 2005 and 2014 by a single surgeon were reviewed. Demographic and perioperative data were analyzed from a prospective database. LRFA was performed on 316 patients with 901 lesions. Median follow-up was 25 months, with 76% of whom completed at least one year of follow-up. The LR rate was 18.4%. The LR in patients followed for less than 12 months was 13.8%, 20.3% for 12 months, and 19.7% for 18 months (P = 0.02). One-fourth of the LRs developed after the 1st year. Morbidity was 8.9% and mortality 0.3%. Tumor type, size, ablation margin, and surgeon experience affected LR, with tumor type, size, and ablation margin being independent. This study shows that 14% of malignant liver tumors will develop LR within a year after LRFA. Additional 4% of the lesions will demonstrate recurrence within 1 cm of the ablation zone, mostly as part of a multifocal recurrence. Ablation margin is the only parameter that the surgeon can manipulate to decrease LR. © 2017 Wiley Periodicals, Inc.
Haraksim, Rudolf; Meuwly, Didier
2013-01-01
This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated
Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...
African Journals Online (AJOL)
Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...
Are the paleoclimatic reconstructions based on mammals biased by the local landscape?
Garcia-Alix, Antonio
2017-04-01
The paleoclimatic reconstructions deduced from mammal associations might have been biased by the complex local effect of the landscape. This effect is especially important in tectonically active regions where important landscape changes occurred in short-time periods. In this abstract, I present a coupled paleoenvironmental approach 1) using the ecological requirement of the faunal associations, and 2) using isotopic analyses in both sediments and small mammal teeth in order to discern between climate and landscape effects. Southern Iberian Peninsula was a tectonically active area during the late Miocene and Pliocene, and the environmental and humidity data deduced from the faunal associations agree with the sedimentary evolution of the basin. However, these humidity trends are usually opposite to the humidity reconstruction deduced from the carbon isotopic data in rodent teeth and from the isotopic composition of the sediments (C and O), which are scarcely influenced by the landscape. So, changes in the landscape, probably boosted by tectonics, gave rise to the development of endorheic and/or exorheic systems in the areas and conditioned the extension of these systems, affecting taxa with high dependence on humidity. Similar outcomes have been observed in early-middle Miocene records from north Spain. In those cases, the response of small mammal associations to abrupt climate changes might have been also buffered by the landscape. On the other hand, records where there was no important landscape changes, such as those from an early- middle Miocene coastal area of eastern Spain, do not show that disagreement in the humidity and environmental reconstructions following both methods.
alpha-particle radioactivity from LR 115 by two methods of analysis
Azkour, K; Adloff, J C; Pape, A
1999-01-01
LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.
WWER safety investigations on LR-0 reactor
International Nuclear Information System (INIS)
Mikus, J.
2001-01-01
A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001
Tools to Perform Local Dense 3D Reconstruction of Shallow Water Seabed.
Avanthey, Loïca; Beaudoin, Laurent; Gademer, Antoine; Roux, Michel
2016-05-17
Tasks such as distinguishing or identifying individual objects of interest require the production of dense local clouds at the scale of these individual objects of interest. Due to the physical and dynamic properties of an underwater environment, the usual dense matching algorithms must be rethought in order to be adaptive. These properties also imply that the scene must be observed at close range. Classic robotized acquisition systems are oversized for local studies in shallow water while the systematic acquisition of data is not guaranteed with divers. We address these two major issues through a multidisciplinary approach. To efficiently acquire on-demand stereoscopic pairs using simple logistics in small areas of shallow water, we devised an agile light-weight dedicated system which is easy to reproduce. To densely match two views in a reliable way, we devised a reconstruction algorithm that automatically accounts for the dynamics, variability and light absorption of the underwater environment. Field experiments in the Mediterranean Sea were used to assess the results.
Directory of Open Access Journals (Sweden)
Matteo Clemente
2017-11-01
Full Text Available The present study deals with the topic of post-seismic reconstruction focusing on landscape and social issues. Sustainable reconstruction requires a connection between the physical context of a given territory and the immaterial (historical, cultural, productive values that constitute the place’s identity. In this perspective, those places that have been destroyed by severe earthquakes or other disasters could be labelled as “interrupted landscapes”, meaning a drastic break in the individual stories attaching the people to their own territory, as well as an abrupt alteration of the continuous process by which people attribute a sense to their own territory. The study discusses selected cases of post-earthquake reconstruction in Italy, providing an overview of different visions for development of the new towns, that oscillate between two contrasting approaches: the “new town” model, implying the construction of a new town off-site and the “in loco” model. Looking for the reasons for failures of the new town model reconstruction, the study also debates the social dimension of urban landscapes, reflecting upon the notion of ‘collective identity’ connecting place attachment to cultural heritage. These issues were finally considered when defining strategic guidelines for sustainable urban reconstruction promoting place identity and preserving the intimate characteristics of the affected landscapes. Governance actions were defined along with sustainability strategies based on the investigated case studies, outlining a series of best practices that may promote the permanent involvement of local communities.
International Nuclear Information System (INIS)
Jebsen, Nina L.; Engellau, Jacob; Engström, Katarina; Bauer, Henrik C.; Monge, Odd R.; Muren, Ludvig P.; Eide, Geir E.; Trovik, Clement S.; Bruland, Øyvind S.
2013-01-01
Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma
Energy Technology Data Exchange (ETDEWEB)
Jebsen, Nina L., E-mail: nina.louise.jebsen@helse-bergen.no [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Engellau, Jacob [Department of Oncology, Skåne University Hospital, Lund (Sweden); Engström, Katarina [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Bauer, Henrik C. [Department of Molecular Medicine and Surgery, Section for Orthopaedics and Sports Medicine, Karolinska University Hospital, Karolinska Institute, Stockholm (Sweden); Monge, Odd R. [Department of Oncology, Haukeland University Hospital, Bergen (Norway); Muren, Ludvig P. [Department of Physics and Technology, University of Bergen, Bergen (Norway); Department of Medical Physics, Aarhus University and Aarhus University Hospital, Aarhus (Denmark); Eide, Geir E. [Centre for Clinical Research, Haukeland University Hospital, Bergen (Norway); Department of Public Health and Primary Health Care, University of Bergen, Bergen (Norway); Trovik, Clement S. [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Bruland, Øyvind S. [Department of Oncology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway)
2013-08-01
Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma.
Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor
2015-02-01
The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In
Aberrant patterns of local and long-range functional connectivity densities in schizophrenia.
Liu, Chuanxin; Zhang, Wei; Chen, Guangdong; Tian, Hongjun; Li, Jie; Qu, Hongru; Cheng, Langlang; Zhu, Jingjing; Zhuo, Chuanjun
2017-07-18
Schizophrenia is a disorder of brain dysconnectivity, and both the connection strength and connection number are disrupted in patients with schizophrenia. The functional connectivity density (FCD) can reflect alterations in the connection number. Alterations in the global FCD (gFCD) in schizophrenia were previously demonstrated; however, alterations in two other indices of the pathological characteristics of the brain, local FCD (lFCD) and long-range FCD (lrFCD), have not been revealed. To investigate lFCD and lrFCD alterations in patients with schizophrenia, 95 patients and 93 matched healthy controls were examined using structural and resting-state functional magnetic resonance imaging scanning. lFCD and lrFCD were measured using FCD mapping, and differences were identified using a two-sample t-test in a voxel-wise manner, with age and gender considered to increase variability. Multiple comparisons were performed using a false discovery rate method with a corrected threshold of Pschizophrenia is a disorder of brain dysconnectivity, particularly affecting the local functional connectivity network, and support the hypothesis that schizophrenia is associated with a widespread cortical functional connectivity/activity deficit, with hyper- and/or hypo-connectivity/activity coexisting in some cortical or subcortical regions.
van Dam, Peter M; Gordon, Jeffrey P; Laks, Michael M; Boyle, Noel G
2015-01-01
Non-invasive electrocardiographic imaging (ECGI) of the cardiac muscle can help the pre-procedure planning of the ablation of ventricular arrhythmias by reducing the time to localize the origin. Our non-invasive ECGI system, the cardiac isochrone positioning system (CIPS), requires non-intersecting meshes of the heart, lungs and torso. However, software to reconstruct the meshes of the heart, lungs and torso with the capability to check and prevent these intersections is currently lacking. Consequently the reconstruction of a patient specific model with realistic atrial and ventricular wall thickness and incorporating blood cavities, lungs and torso usually requires additional several days of manual work. Therefore new software was developed that checks and prevents any intersections, and thus enables the use of accurate reconstructed anatomical models within CIPS. In this preliminary study we investigated the accuracy of the created patient specific anatomical models from MRI or CT. During the manual segmentation of the MRI data the boundaries of the relevant tissues are determined. The resulting contour lines are used to automatically morph reference meshes of the heart, lungs or torso to match the boundaries of the morphed tissue. Five patients were included in the study; models of the heart, lungs and torso were reconstructed from standard cardiac MRI images. The accuracy was determined by computing the distance between the segmentation contours and the morphed meshes. The average accuracy of the reconstructed cardiac geometry was within 2mm with respect to the manual segmentation contours on the MRI images. Derived wall volumes and left ventricular wall thickness were within the range reported in literature. For each reconstructed heart model the anatomical heart axis was computed using the automatically determined anatomical landmarks of the left apex and the mitral valve. The accuracy of the reconstructed heart models was well within the accuracy of the used
Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong
2018-03-01
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.
Lai, Dakun; Sun, Jian; Li, Yigang; He, Bin
2013-06-01
As radio frequency (RF) catheter ablation becomes increasingly prevalent in the management of ventricular arrhythmia in patients, an accurate and rapid determination of the arrhythmogenic site is of important clinical interest. The aim of this study was to test the hypothesis that the inversely reconstructed ventricular endocardial current density distribution from body surface potential maps (BSPMs) can localize the regions critical for maintenance of a ventricular ectopic activity. Patients with isolated and monomorphic premature ventricular contractions (PVCs) were investigated by noninvasive BSPMs and subsequent invasive catheter mapping and ablation. Equivalent current density (CD) reconstruction (CDR) during symptomatic PVCs was obtained on the endocardial ventricular surface in six patients (four men, two women, years 23-77), and the origin of the spontaneous ectopic activity was localized at the location of the maximum CD value. Compared with the last (successful) ablation site (LAS), the mean and standard deviation of localization error of the CDR approach were 13.8 and 1.3 mm, respectively. In comparison, the distance between the LASs and the estimated locations of an equivalent single moving dipole in the heart was 25.5 ± 5.5 mm. The obtained CD distribution of activated sources extending from the catheter ablation site also showed a high consistency with the invasively recorded electroanatomical maps. The noninvasively reconstructed endocardial CD distribution is suitable to predict a region of interest containing or close to arrhythmia source, which may have the potential to guide RF catheter ablation.
Energy Technology Data Exchange (ETDEWEB)
Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)
2017-02-15
Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:
International Nuclear Information System (INIS)
Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.
2017-01-01
Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:
Energy Technology Data Exchange (ETDEWEB)
Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Liu, Yuan [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Biostatistics and Bioinformatics Shared Resource, Emory University, Atlanta, Georgia (United States); Okwan-Duodu, Derrick [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Flowers, Christopher R. [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Medical Oncology, Emory University, Atlanta, Georgia (United States); Khan, Mohammad K., E-mail: drkhurram2000@gmail.com [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States)
2015-05-01
Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy.
International Nuclear Information System (INIS)
Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng; Liu, Yuan; Okwan-Duodu, Derrick; Flowers, Christopher R.; Khan, Mohammad K.
2015-01-01
Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy
Kumar, V.; Melet, A.; Meyssignac, B.; Ganachaud, A.; Kessler, W. S.; Singh, A.; Aucan, J.
2018-02-01
Rising sea levels are a critical concern in small island nations. The problem is especially serious in the western south Pacific, where the total sea level rise over the last 60 years has been up to 3 times the global average. In this study, we aim at reconstructing sea levels at selected sites in the region (Suva, Lautoka—Fiji, and Nouméa—New Caledonia) as a multilinear regression (MLR) of atmospheric and oceanic variables. We focus on sea level variability at interannual-to-interdecadal time scales, and trend over the 1988-2014 period. Local sea levels are first expressed as a sum of steric and mass changes. Then a dynamical approach is used based on wind stress curl as a proxy for the thermosteric component, as wind stress curl anomalies can modulate the thermocline depth and resultant sea levels via Rossby wave propagation. Statistically significant predictors among wind stress curl, halosteric sea level, zonal/meridional wind stress components, and sea surface temperature are used to construct a MLR model simulating local sea levels. Although we are focusing on the local scale, the global mean sea level needs to be adjusted for. Our reconstructions provide insights on key drivers of sea level variability at the selected sites, showing that while local dynamics and the global signal modulate sea level to a given extent, most of the variance is driven by regional factors. On average, the MLR model is able to reproduce 82% of the variance in island sea level, and could be used to derive local sea level projections via downscaling of climate models.
International Nuclear Information System (INIS)
Murari, A; Peluso, E; Gaudio, P; Gelfusa, M; Maviglia, F; Hawkes, N
2012-01-01
The configuration of magnetic fields is an essential ingredient of tokamak physics. In modern day devices, the magnetic topology is normally derived from equilibrium codes, which solve the Grad–Shafranov equation with constraints imposed by the available measurements. On JET, the main code used for this purpose is EFIT and the more commonly used diagnostics are external pick-up coils. Both the code and the measurements present worse performance during edge localized modes (ELMs). To quantify this aspect, various statistical indicators, based on the values of the residuals and their probability distribution, are defined and calculated. They all show that the quality of EFIT reconstructions is clearly better in the absence of ELMs. To investigate the possible causes of the detrimental effects of ELMs on the reconstruction, the pick-up coils are characterized individually and both the spatial distribution and time behaviour of their residuals are analysed in detail. The coils with a faster time response are the ones reproduced less well by EFIT. The constraints of current and pressure at the separatrix are also varied but the effects of such modifications do not result in decisive improvements in the quality of the reconstructions. The interpretation of this experimental evidence is not absolutely compelling but strongly indicative of deficiencies in the physics model on which the JET reconstruction code is based. (paper)
Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...
African Journals Online (AJOL)
Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...
Tools to Perform Local Dense 3D Reconstruction of Shallow Water Seabed
Directory of Open Access Journals (Sweden)
Loïca Avanthey
2016-05-01
Full Text Available Tasks such as distinguishing or identifying individual objects of interest require the production of dense local clouds at the scale of these individual objects of interest. Due to the physical and dynamic properties of an underwater environment, the usual dense matching algorithms must be rethought in order to be adaptive. These properties also imply that the scene must be observed at close range. Classic robotized acquisition systems are oversized for local studies in shallow water while the systematic acquisition of data is not guaranteed with divers. We address these two major issues through a multidisciplinary approach. To efficiently acquire on-demand stereoscopic pairs using simple logistics in small areas of shallow water, we devised an agile light-weight dedicated system which is easy to reproduce. To densely match two views in a reliable way, we devised a reconstruction algorithm that automatically accounts for the dynamics, variability and light absorption of the underwater environment. Field experiments in the Mediterranean Sea were used to assess the results.
Li, Ruijiang; Jia, Xun; Lewis, John H; Gu, Xuejun; Folkerts, Michael; Men, Chunhua; Jiang, Steve B
2010-06-01
To develop an algorithm for real-time volumetric image reconstruction and 3D tumor localization based on a single x-ray projection image for lung cancer radiotherapy. Given a set of volumetric images of a patient at N breathing phases as the training data, deformable image registration was performed between a reference phase and the other N-1 phases, resulting in N-1 deformation vector fields (DVFs). These DVFs can be represented efficiently by a few eigenvectors and coefficients obtained from principal component analysis (PCA). By varying the PCA coefficients, new DVFs can be generated, which, when applied on the reference image, lead to new volumetric images. A volumetric image can then be reconstructed from a single projection image by optimizing the PCA coefficients such that its computed projection matches the measured one. The 3D location of the tumor can be derived by applying the inverted DVF on its position in the reference image. The algorithm was implemented on graphics processing units (GPUs) to achieve real-time efficiency. The training data were generated using a realistic and dynamic mathematical phantom with ten breathing phases. The testing data were 360 cone beam projections corresponding to one gantry rotation, simulated using the same phantom with a 50% increase in breathing amplitude. The average relative image intensity error of the reconstructed volumetric images is 6.9% +/- 2.4%. The average 3D tumor localization error is 0.8 +/- 0.5 mm. On an NVIDIA Tesla C1060 GPU card, the average computation time for reconstructing a volumetric image from each projection is 0.24 s (range: 0.17 and 0.35 s). The authors have shown the feasibility of reconstructing volumetric images and localizing tumor positions in 3D in near real-time from a single x-ray image.
International Nuclear Information System (INIS)
Vaegler, Sven; Sauer, Otto; Stsepankou, Dzmitry; Hesser, Juergen
2015-01-01
The reduction of dose in cone beam computer tomography (CBCT) arises from the decrease of the tube current for each projection as well as from the reduction of the number of projections. In order to maintain good image quality, sophisticated image reconstruction techniques are required. The Prior Image Constrained Compressed Sensing (PICCS) incorporates prior images into the reconstruction algorithm and outperforms the widespread used Feldkamp-Davis-Kress-algorithm (FDK) when the number of projections is reduced. However, prior images that contain major variations are not appropriately considered so far in PICCS. We therefore propose the partial-PICCS (pPICCS) algorithm. This framework is a problem-specific extension of PICCS and enables the incorporation of the reliability of the prior images additionally. We assumed that the prior images are composed of areas with large and small deviations. Accordingly, a weighting matrix considered the assigned areas in the objective function. We applied our algorithm to the problem of image reconstruction from few views by simulations with a computer phantom as well as on clinical CBCT projections from a head-and-neck case. All prior images contained large local variations. The reconstructed images were compared to the reconstruction results by the FDK-algorithm, by Compressed Sensing (CS) and by PICCS. To show the gain of image quality we compared image details with the reference image and used quantitative metrics (root-mean-square error (RMSE), contrast-to-noise-ratio (CNR)). The pPICCS reconstruction framework yield images with substantially improved quality even when the number of projections was very small. The images contained less streaking, blurring and inaccurately reconstructed structures compared to the images reconstructed by FDK, CS and conventional PICCS. The increased image quality is also reflected in large RMSE differences. We proposed a modification of the original PICCS algorithm. The pPICCS algorithm
Locally Advanced Cheek Carcinoma; Radical Surgery and Reconstruction of Though and Through Defects
International Nuclear Information System (INIS)
Denewer, A.T.; Steet, A.E.; Mohamed, O.H.; Aly, O.F.
2006-01-01
Background: Squamous cell carcinoma of the cheek is a locoregionally aggressive tumor. Radical resection may be curative in cases of large tumor without distant metastases. We reviewed forty eight consecutive cases of Sq.c.c. of the oral cavity to evaluate the feasibility and efficacy of the reconstructive method. Patients and Methods: Forty eight cases of invasive Sq.c.c. affecting the cheek performed in Mansoura University, Surgical Oncology Department. From November 2001 to October 2004 were included. Twenty cafes presented primarily, and 28 were relapsing after previous surgery or radiotherapy. Tumors of T 3 and T 4 size were included. Radical excision with adequate safety margin followed by reconstruction was done in the same setting using: A- Double layered pectorals major flap (n=30). B- Pectorals major flap for external surface and tongue flap for mucosal lining (n=10). C- Pectorals major flap plus free Latissmus dorsi flap (n=3). D- Latissmus dorsi flap plus tongue flap (n=5). Results: Nine cases (18.7%) had local and distant relapse after a median follow up period of 36 months. However, total flap loss was not encountered. There were partial loss of three tongue flaps, seven pectorals flaps corrected with debridement and re approximation. Two patients had oral incompetence. Orocutaneous salivary fistula persistent more than three weeks occurred in eight patients. Functional outcome in terms of oral competence, sensibility, chewing movements was satisfactory in all but three cases. In Conclusion: Radical resection of extensive cheek carcinoma and reconstruction using pedicled flaps is an effective, economic and reliable method for oncologic and functional purposes
Directory of Open Access Journals (Sweden)
Sharma Ramesh
2006-01-01
Full Text Available We present our experience with the use of local fasciocutaneous V-Y advancement flaps in the reconstruction of 10 axillae in 6 patients for large defects following wide excision of long-standing Hidradenitis suppurativa of the axilla. The defects were closed with local V-Y subcutaneous island flaps. A single flap from the chest wall was sufficient for moderate defects. However, for larger defects, an additional flap was taken from the medial side of the ipsilateral arm. The donor defects could be closed primarily in all the patients. The local areas of the lateral chest wall and the medial side of the arm have a plentiful supply of cutaneous perforators and the flaps can be designed in a V-Y fashion without resorting to preoperative marking of the perforator. The flaps were freed sufficiently to allow adequate movement for closure of the defects. Although no attempt was made to identify the perforators specifically, many perforators were seen entering the flap. Some perforators can be safely divided to increase reach of the flap. All the flaps survived completely. A follow up of 2.5 years is presented.
Siuly; Li, Yan; Paul Wen, Peng
2014-03-01
Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Wang, Xinhong; Chen, Si; Chen, Xinming; Zhang, Cuicui; Liang, Xueyi
2016-02-01
Oral squamous cell carcinoma (OSCC) is characterized by a high rate of local recurrence (LR) even when the surgical margins are considered histopathologically 'normal'. The aim of our study was to determine the relationship between early tumor-related markers detected in histologically normal margins (HNM) and LR as well as disease-free survival in OSCC. The loss of heterozygosity (LOH) of markers on 9p21 (D9s1747, RPS6, D9s162) and 17p13 (TP53) and the immunostaining results of the corresponding mutant P53, P14, P15, and P16 proteins were assessed and correlated with LR and disease-free survival in 71 OSCC patients who had HNM. Fifteen of 71 patients with HNM developed LR. The presence of the following molecular markers in surgical margins was significantly correlated with the development of LR: LOH on chromosome 9p21 (D9s1747 + RPS6 + D9s162), any LOH, P16, and P53 (chi-square test, P tumor-related markers in histologically 'normal' resection margins may be a useful method for assessing LR in OSCC patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mental health risks in the local workforce engaged in disaster relief and reconstruction.
Wang, Xiao L; Chan, Cecilia L W; Shi, Zhan B; Wang, Bin
2013-02-01
To build a sustainable workforce for long-term disaster relief and reconstruction, more effort must be made to promote local relief workers' mental health. We conducted 25 semistructured interviews with local relief officials 10 months after the 2008 earthquake in China to investigate the stress and coping experiences in their personal lives as survivors. We conducted thematic analysis of interview transcripts. Traumatic bereavement and grief, housing and financial difficulties, and work-family conflict were the three main sources of stress in the respondents' personal lives. The coping themes were finding meaning and purpose in life through relief work, colleagues' support and understanding, suppression or avoidance of grief, appreciation for life, hardiness, optimism, letting nature take its course, and making up for loss. We suggest that relief work has a double-edged-sword effect on workers' coping abilities. We discuss the implications of this effect for work-life balance measures and trauma and grief counseling services.
Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina
Directory of Open Access Journals (Sweden)
Lorena Rosso
2014-04-01
Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.
Neutron flux characterization using Lr-115 NTD and binary glass metal as converter
International Nuclear Information System (INIS)
Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.
2010-01-01
The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)
Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)
Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A
1999-01-01
Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.
Directory of Open Access Journals (Sweden)
Ellen Cristine Giese
2015-06-01
Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698
International Nuclear Information System (INIS)
Clement, G.; Delvecchio, D.J.; Sazawal, V.
1997-01-01
The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement
Park, Jun Seok; Sakai, Yoshiharu; Simon, NG Siu Man; Law, Wai Lun; Kim, Hyeong Rok; Oh, Jae Hwan; Shan, Hester Cheung Yui; Kwak, Sang Gyu; Choi, Gyu-Seog
2016-01-01
Abstract Controversy remains regarding whether preoperative chemoradiation protocol should be applied uniformly to all rectal cancer patients regardless of tumor height. This pooled analysis was designed to evaluate whether preoperative chemoradiation can be safely omitted in higher rectal cancer. An international consortium of 7 institutions was established. A review of the database that was collected from January 2004 to May 2008 identified a series of 2102 patients with stage II/III rectal or sigmoid cancer (control arm) without concurrent chemoradiation. Data regarding patient demographics, recurrence pattern, and oncological outcomes were analyzed. The primary end point was the 5-year local recurrence rate. The local relapse rate of the sigmoid colon cancer (SC) and upper rectal cancer (UR) cohorts was significantly lower than that of the mid/low rectal cancer group (M-LR), with 5-year estimates of 2.5% for the SC group, 3.5% for the UR group, and 11.1% for the M-LR group, respectively. A multivariate analysis showed that tumor depth, nodal metastasis, venous invasion, and lower tumor level were strongly associated with local recurrence. The cumulative incidence rate of local failure was 90.6%, 92.5%, and 94.4% for tumors located within 5, 7, and 9 cm from the anal verge, respectively. Routine use of preoperative chemoradiation for stage II/III rectal tumors located more than 8 to 9 cm above the anal verge would be excessive. The integration of a more individualized approach focused on systemic control is warranted to improve survival in patients with upper rectal cancer. PMID:27258487
Energy Technology Data Exchange (ETDEWEB)
Jung, Jin Hee; Kim, Ah Yong; Kim, Hye Jin; Yook, Jeong Hwan; Yu, Eun Sil; Jang, Yoon Jin; Park, Seong Ho; Shin, Yong Moon; Ha, Hyun Kwon [Asan Medical Center, Seoul (Korea, Republic of)
2010-01-15
To evaluate the diagnostic value of oblique coronal reconstructed CT images to determine the local invasion of advanced gastric cancer (AGC). Thirty-four consecutive patients, who were suspected to have locally invasive advanced gastric cancer (more than T3 stage) on a preoperative MDCT scan and underwent a diagnostic or curative laparotomy, were enrolled in this study. Two reviewers performed an independent blind review of three series of MDCT images in random order; axial (AXI), conventional coronal (CCI), and oblique coronal (OCI) (parallel to long axis of gastric body and pancreas) images. In assessing the local invasion, the reader's confidence for the local invasion of AGC was graded using a five point scale (1 = definitely negative, 5 = definitely positive: T4). With surgical findings and histopathological proofs as reference standards, the diagnostic performance of the three different plans of CT images was employed for the verification of local invasion of AGC on a preoperative CT scan using the receiver operating characteristic (ROC) method. Agreements between the two reviewers were analyzed using weighted kappa statistics. Results: In 19 out of 34 patients, local invasion was confirmed surgically or histopathologically (13 pancreas invasion, 6 liver invasion, 4 major vascular invasion, 3 colon and mesocolon invasion, and 2 spleen invasion). The diagnostic performance of OCI was superior to AXI or CCI in the local invasion of AGC. The differences in the area under the curve of AXI (0.770 {+-} 0.087, 0.700 {+-} 0.094), CCI (0.884 {+-} 0.058, 0.958 {+-} 0.038), and OCI (0.954 {+-} 0.050, 0.956 {+-} 0.049), were statistically significant for both reviewers. Inter-observer agreement was excellent for OCI ({kappa}= .973), which was greater than CCI (({kappa}= .839), and AXI (({kappa}= .763). On a CT scan, OCI might be a useful imaging technique in evaluating locally invasive advanced gastric cancer.
Ravì, Daniele; Szczotka, Agnieszka Barbara; Shakir, Dzhoshkun Ismail; Pereira, Stephen P; Vercauteren, Tom
2018-06-01
Probe-based confocal laser endomicroscopy (pCLE) is a recent imaging modality that allows performing in vivo optical biopsies. The design of pCLE hardware, and its reliance on an optical fibre bundle, fundamentally limits the image quality with a few tens of thousands fibres, each acting as the equivalent of a single-pixel detector, assembled into a single fibre bundle. Video registration techniques can be used to estimate high-resolution (HR) images by exploiting the temporal information contained in a sequence of low-resolution (LR) images. However, the alignment of LR frames, required for the fusion, is computationally demanding and prone to artefacts. In this work, we propose a novel synthetic data generation approach to train exemplar-based Deep Neural Networks (DNNs). HR pCLE images with enhanced quality are recovered by the models trained on pairs of estimated HR images (generated by the video registration algorithm) and realistic synthetic LR images. Performance of three different state-of-the-art DNNs techniques were analysed on a Smart Atlas database of 8806 images from 238 pCLE video sequences. The results were validated through an extensive image quality assessment that takes into account different quality scores, including a Mean Opinion Score (MOS). Results indicate that the proposed solution produces an effective improvement in the quality of the obtained reconstructed image. The proposed training strategy and associated DNNs allows us to perform convincing super-resolution of pCLE images.
Directory of Open Access Journals (Sweden)
Ingrida Zurlytè
2007-09-01
Full Text Available Background: Introduction of health impact assessment (HIA as a national legal requirement for planned economic activity projects in 2002 and the further development of related procedures and methodological requirements has boosted the number of HIAs carried out both as an integrated part of environmental impact assessment (EIA procedures as well as an independent activity. Most of HIAs have been conduct for local projects. The HIA for the reconstruction of the southern section of the railroads in Klaip da National Seaport is one of the local HIAs in Lithuania carried out as an independent procedure. Methods: The HIA for the reconstruction of the southern section of the railroads in Klaipda National Seaport was carried out following the national legal procedure for the cases not foreseen in the Law on Environmental Impact Assessment of Planned Economic Activity and the national HIA methodological regulations. The HIA included a literature review, analysis of related technical documentation, data on existing and estimated air pollution and environmental noise levels and possible health consequences, analysis of local demographic and health statistics; interviews with the residents living in proximity of the planned activity, analysis of public complaints on existing activities at Klaip da National Seaport, site visit and round table discussions with the proponent of the planned activity, planning company and representatives of the public health authority. The standard or intermediate type of perspective HIA was applied. Results: The HIA report has pointed out noise, vibration, ambient air pollution, psychological factors as related to possible negative impact on health of residents living in the mostly exposed locations. Interviews with inhabitants living in proximity of the planned activity have shown that majority of them knew nothing about the reconstruction plans. Recommendations were provided in the report how to minimise
Gayou, Olivier; Miften, Moyed
2008-02-01
The online image-guided localization data from 696 ultrasound (US), 598 mega-voltage cone-beam computed tomography (MV-CBCT), and 393 seed markers (SMs) couch alignments for patients undergoing intensity modulation radiotherapy of the prostate were analyzed. Daily US, MV-CBCT and SM images were acquired for 19, 17 and 12 patients, respectively, after each patient was immobilized in a vacuum cradle and setup to skin markers as the center of mass. The couch shifts applied in the lateral (left-right/LR), vertical (anterior-posterior/AP), and longitudinal (superior-inferior/SI) directions, along with the magnitude of the three-dimensional (3D) shift vector, were analyzed and compared for all three methods. The percentage of shifts larger than 5 mm in all directions was also compared. Clinical target volume-planning target volume (CTV-to-PTV) expansion margins were estimated based on the localization data with US, CB, and SM image guidance. Results show the US data have greater variability. Systematic and random shifts were -1.2 +/- 6.8 mm (LR), -2.8 +/- 5.1 mm (SI) and -1.0 +/- 5.9 mm (AP) for US, 1.0 +/- 3.9 mm (LR), -1.3 +/- 2.5 mm (SI) and -0.3 +/- 3.9 mm (AP) for CB, and -1.0 +/- 3.4 mm (LR), 0.0 +/- 3.4 mm (SI) and 0.5 +/- 4.1 mm (AP) for SM. The mean 3D shift distance was larger using US (8.8 +/- 6.2 mm) compared to CB and SM (5.3 +/- 3.4 mm and 5.2 +/- 3.7 mm, respectively). The percentage of US shifts larger than 5 mm were 34%, 31%, and 38% in the LR, SI, and AP directions, respectively, compared to 18%, 6%, and 16% for CB and 14%, 10%, and 20% for SM. MV-CBCT and SM localization data suggest a different distribution of prostate center-of-mass shifts with smaller variability, compared to US. The online MV-CBCT and SM image-guidance data show that for treatments that do not include daily prostate localization, one can use a CTV-to-PTV margin that is 4 mm smaller than the one suggested by US data, hence allowing more rectum and bladder sparing and potentially
International Nuclear Information System (INIS)
Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam
2010-01-01
Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.
Energy Technology Data Exchange (ETDEWEB)
Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)
2010-03-15
Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.
Craniofacial Reconstruction Evaluation by Geodesic Network
Zhao, Junli; Liu, Cuiting; Wu, Zhongke; Duan, Fuqing; Wang, Kang; Jia, Taorui; Liu, Quansheng
2014-01-01
Craniofacial reconstruction is to estimate an individual’s face model from its skull. It has a widespread application in forensic medicine, archeology, medical cosmetic surgery, and so forth. However, little attention is paid to the evaluation of craniofacial reconstruction. This paper proposes an objective method to evaluate globally and locally the reconstructed craniofacial faces based on the geodesic network. Firstly, the geodesic networks of the reconstructed craniofacial face and the or...
Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong
2016-01-01
This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.
Absolute Transition Rates in {sup 188}lr
Energy Technology Data Exchange (ETDEWEB)
Malmskog, S G; Berg, V
1969-09-15
Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.
RECONSTRUCTING THE INITIAL DENSITY FIELD OF THE LOCAL UNIVERSE: METHODS AND TESTS WITH MOCK CATALOGS
International Nuclear Information System (INIS)
Wang Huiyuan; Mo, H. J.; Yang Xiaohu; Van den Bosch, Frank C.
2013-01-01
Our research objective in this paper is to reconstruct an initial linear density field, which follows the multivariate Gaussian distribution with variances given by the linear power spectrum of the current cold dark matter model and evolves through gravitational instabilities to the present-day density field in the local universe. For this purpose, we develop a Hamiltonian Markov Chain Monte Carlo method to obtain the linear density field from a posterior probability function that consists of two components: a prior of a Gaussian density field with a given linear spectrum and a likelihood term that is given by the current density field. The present-day density field can be reconstructed from galaxy groups using the method developed in Wang et al. Using a realistic mock Sloan Digital Sky Survey DR7, obtained by populating dark matter halos in the Millennium simulation (MS) with galaxies, we show that our method can effectively and accurately recover both the amplitudes and phases of the initial, linear density field. To examine the accuracy of our method, we use N-body simulations to evolve these reconstructed initial conditions to the present day. The resimulated density field thus obtained accurately matches the original density field of the MS in the density range 0.3∼ –1 , much smaller than the translinear scale, which corresponds to a wavenumber of ∼0.15 h Mpc –1
Active learning for semi-supervised clustering based on locally linear propagation reconstruction.
Chang, Chin-Chun; Lin, Po-Yi
2015-03-01
The success of semi-supervised clustering relies on the effectiveness of side information. To get effective side information, a new active learner learning pairwise constraints known as must-link and cannot-link constraints is proposed in this paper. Three novel techniques are developed for learning effective pairwise constraints. The first technique is used to identify samples less important to cluster structures. This technique makes use of a kernel version of locally linear embedding for manifold learning. Samples neither important to locally linear propagation reconstructions of other samples nor on flat patches in the learned manifold are regarded as unimportant samples. The second is a novel criterion for query selection. This criterion considers not only the importance of a sample to expanding the space coverage of the learned samples but also the expected number of queries needed to learn the sample. To facilitate semi-supervised clustering, the third technique yields inferred must-links for passing information about flat patches in the learned manifold to semi-supervised clustering algorithms. Experimental results have shown that the learned pairwise constraints can capture the underlying cluster structures and proven the feasibility of the proposed approach. Copyright © 2014 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Zektzer, Roy; Desiatov, Boris; Mazurski, Noa
2015-01-01
We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...
Directory of Open Access Journals (Sweden)
Beant Singh Gill
2015-05-01
Full Text Available Purpose: Locally-recurrent non-small cell lung cancer (LR-NSCLC remains challenging treat, particularly in patients having received prior radiotherapy. Heterogeneous populations and varied treatment intent in existing literature result in significant limitations in evaluating efficacy of lung re-irradiation. In order to better establish the impact of re-irradiation in patients with LR-NSCLC following high-dose radiotherapy, we report outcomes for patients treated with prior sublobar resection and brachytherapy that subsequently underwent stereotactic body radiotherapy (SBRT.Methods: A retrospective review of patients initially treated with sublobar resection and I125 vicryl mesh brachytherapy, who later developed LR-NSCLC along the suture line, was performed. Patients received salvage SBRT with curative intent. Dose and fractionation was based on tumor location and size, with a median prescription dose of 48 Gy in 4 fractions (range 20-60 Gy in 1-4 fractions.Results: Thirteen consecutive patients were identified with median follow-up of 2.1 years (range 0.7-5.6 years. Two in-field local failures occurred at 7.5 and 11.1 months, resulting in 2-year local control of 83.9% (95% CI 63.5-100.0%. Two-year disease-free survival and overall survival estimates were 38.5% (95% CI 0.0-65.0% and 65.8% (95% CI, 38.2-93.4%. Four patients (31% remained disease-free at last follow-up. All but one patient who experienced disease recurrence developed isolated or synchronous distant metastases. Only one patient (7.7% developed grade ≥3 toxicity, consisting of grade 3 esophageal stricture following a centrally located recurrence previously treated with radiofrequency ablation.Conclusion: Despite high local radiation doses delivered to lung parenchyma previously with I125 brachytherapy, re-irradiation with SBRT for LR-NSCLC results in excellent local control with limited morbidity, allowing for potential disease cure in a subset of patients.
Direct determination of bulk etching rate for LR-115-II solid state ...
Indian Academy of Sciences (India)
The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...
Curran, Sabrina C; Haile-Selassie, Yohannes
2016-07-01
Woranso-Mille is a paleoanthropological site in Ethiopia sampling an important and under-represented time period in human evolution (3.8-3.6 million years ago). Specimens of cf. Australopithecus anamensis, Australopithecus afarensis, and the recently named Australopithecus deyiremeda have been recovered from this site. Using multiple habitat proxies, this study provides a paleoecological reconstruction of two fossiliferous collection areas from Woranso-Mille, Aralee Issie (ARI) and Mesgid Dora (MSD). Previous reconstructions based on faunal assemblages have pointed, due to the presence of aepycerotins, alcelaphins, and proboscideans, to the existence of open habitats as well as more closed ones, based on the occurrence of cercopithecids, giraffids, and traglephins. Results from community structure analysis (proportions of locomotor and dietary adaptations) at ARI and MSD indicated a predominance of open habitats, such as shrublands. Mesowear analysis revealed that ungulates of all dietary types (grazers, leaf and fruit browsers, and mixed feeders) were present in nearly equal proportions. Ecomorphological analyses using linear measurements of the astragalus and phalanges indicated that bovids utilizing locomotor behaviors associated with all habitat types were present, though the intermediate-cover habitat bovids were best represented in the sample (Heavy cover at ARI and Light cover at MSD). Together, these results suggest that the ARI and MSD localities were heterogeneous habitats (mosaics), likely with densely vegetated areas along a paleo-river and more open regions (woodlands, grasslands) available away from the river. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hamaji, Masatsugu; Chen, Fengshi; Matsuo, Yukinori; Ueki, Nami; Hiraoka, Masahiro; Date, Hiroshi
2015-11-01
Many efforts have been made to detect local relapse (LR) in the follow-up after stereotactic body radiotherapy (SBRT) for non-small-cell lung cancer (NSCLC) although limited data are available on its treatment and prognosis. We aimed to characterize treatment options and clarify long-term outcomes of isolated LR after SBRT for patients with clinical stage I NSCLC. We reviewed our institutional database in search of patients with isolated LR after SBRT for clinical stage I NSCLC at our institution between 1999 and 2013. Patient characteristics were compared with Mann-Whitney U test, χ2 test, or Fisher's exact test as appropriate. Survival outcomes were estimated with Kaplan-Meier method. Potential prognostic factors were investigated using Cox proportional hazard model. Of 308 patients undergoing SBRT for clinical stage I NSCLC, 49 patients were identified to have isolated LR. Twelve patients underwent salvage surgery, none underwent radiotherapy, and eight patients received chemotherapy, whereas 29 patients received best supportive care. No patient characteristic except operability was significantly related with patient selection for LR treatments. Five-year overall survival (OS) rate of the whole cohort was 47.9% from SBRT and 25.7% from LR. Salvage surgery was associated with improved OS after LR (p = 0.014), and 5-year OS for patients undergoing salvage surgery was 79.5% from LR. It was confirmed that our patient selection for salvage surgery for isolated LR was associated with favorable survival outcomes. Operability based on multidisciplinary conferences, rather than measurable patient characteristics, is essential for appropriate patient selection for salvage surgery.
Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity
Directory of Open Access Journals (Sweden)
Jaiok Roh
2011-01-01
Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.
International Nuclear Information System (INIS)
Lupe, Krystine; Truong, Pauline T.; Alexander, Cheryl; Lesperance, Mary; Speers, Caroline; Tyldesley, Scott
2011-01-01
Purpose: (1) To examine the effect of surgical margin status on local recurrence (LR) and survival following breast-conserving therapy; (2) To identify subsets with close or positive margins with high LR risk despite whole breast radiotherapy (RT) plus boost. Methods and Materials: Subjects were 2,264 women with pT1–3, any N, M0 invasive breast cancer, treated with breast-conserving surgery and whole breast ± boost RT. Five-year Kaplan-Meier (KM) LR, breast cancer–specific and overall survival (BCSS and OS) were compared between cohorts with negative (n = 1,980), close (n = 222), and positive (n = 62) margins. LR rates were analyzed according to clinicopathologic characteristics. Multivariable Cox regression modeling and matched analysis of close/positive margin cases and negative margin controls were performed. Results: Median follow-up was 5.2 years. Boost RT was used in 92% of patients with close or positive margins. Five-year KM LR rates in the negative, close and positive margin cohorts were 1.3%, 4.0%, and 5.2%, respectively (p = 0.001). BCSS and OS were similar in the three margin subgroups. In the close/positive margin cohort, LR rates were 10.2% with age 10% despite whole breast plus boost RT. These patients should be considered for more definitive surgery.
McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.
2002-01-01
A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716
BREAST RECONSTRUCTIONS AFTER BREAST CANCER TREATING
Directory of Open Access Journals (Sweden)
Erik Vrabič
2018-02-01
Full Text Available Background. Breasts are an important symbol of physical beauty, feminity, mothering and sexual desire through the entire history of mankind. Lost of the whole or part of the breast is functional and aesthetic disturbance for woman. It is understandable, that the woman, who is concerned over breast loss, is as appropriate as another person´s concern over the loss of a limb or other body part. Before the 1960, breast reconstruction was considered as a dangerous procedure and it was almost prohibited. Considering the psychological importance of the breast in modern society, the possibility of breast reconstruction for the woman about to undergo a mastectomy is a comforting alternative. We can perform breast reconstruction with autologous tissue (autologous reconstruction, with breast implants and combination of both methods. For autologous reconstruction we can use local tissue (local flaps, or tissue from distant parts of the body (free vascular tissue transfer. Tissue expansion must be performed first, in many cases of breast reconstructions with breast implants. Conclusions. Possibility of breast reconstruction made a big progress last 3 decades. Today we are able to reconstruct almost every defect of the breast and the entire breast. Breast reconstruction rise the quality of life for breast cancer patients. Breast reconstruction is a team work of experts from many medicine specialites. In Slovenia we can offer breast reconstruction for breast cancer patients in Ljubljana, where plastic surgeons from Clinical Department for Plastic Surgery and Burns cooperate with oncologic surgeons. Ten years ago a similar cooperation between plastic surgeons and surgeons of the Centre for Breast Diseases was established in Maribor.
Graph-Based Semi-Supervised Learning for Indoor Localization Using Crowdsourced Data
Directory of Open Access Journals (Sweden)
Liye Zhang
2017-04-01
Full Text Available Indoor positioning based on the received signal strength (RSS of the WiFi signal has become the most popular solution for indoor localization. In order to realize the rapid deployment of indoor localization systems, solutions based on crowdsourcing have been proposed. However, compared to conventional methods, lots of different devices are used in crowdsourcing system and less RSS values are collected by each device. Therefore, the crowdsourced RSS values are more erroneous and can result in significant localization errors. In order to eliminate the signal strength variations across diverse devices, the Linear Regression (LR algorithm is proposed to solve the device diversity problem in crowdsourcing system. After obtaining the uniform RSS values, a graph-based semi-supervised learning (G-SSL method is used to exploit the correlation between the RSS values at nearby locations to estimate an optimal RSS value at each location. As a result, the negative effect of the erroneous measurements could be mitigated. Since the AP locations need to be known in G-SSL algorithm, the Compressed Sensing (CS method is applied to precisely estimate the location of the APs. Based on the location of the APs and a simple signal propagation model, the RSS difference between different locations is calculated and used as an additional constraint to improve the performance of G-SSL. Furthermore, to exploit the sparsity of the weights used in the G-SSL, we use the CS method to reconstruct these weights more accurately and make a further improvement on the performance of the G-SSL. Experimental results show improved results in terms of the smoothness of the radio map and the localization accuracy.
International Nuclear Information System (INIS)
Torres-Roca, Javier F.; Fulp, William J.; Caudell, Jimmy J.; Servant, Nicolas; Bollet, Marc A.; Vijver, Marc van de; Naghavi, Arash O.; Harris, Eleanor E.; Eschrich, Steven A.
2015-01-01
Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and
Energy Technology Data Exchange (ETDEWEB)
Torres-Roca, Javier F., E-mail: javier.torresroca@moffitt.org [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Department of Chemical Biology and Molecular Medicine, Moffitt Cancer Center, Tampa, Florida (United States); Fulp, William J. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States); Department of Biostatistics, Moffitt Cancer Center, Tampa, Florida (United States); Caudell, Jimmy J. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Servant, Nicolas [Institut Curie, INSERM U900, Paris (France); Mines ParisTech, Paris (France); Bollet, Marc A. [Institut Curie, INSERM U900, Paris (France); Vijver, Marc van de [Netherlands Cancer Institute, Amsterdam (Netherlands); Naghavi, Arash O. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Harris, Eleanor E. [East Carolina University, Greensborough, North Carolina (United States); Eschrich, Steven A. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States)
2015-11-01
Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and
IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram
Woods, Carol M.
2008-01-01
Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…
Kinect Posture Reconstruction Based on a Local Mixture of Gaussian Process Models.
Liu, Zhiguang; Zhou, Liuyang; Leung, Howard; Shum, Hubert P H
2016-11-01
Depth sensor based 3D human motion estimation hardware such as Kinect has made interactive applications more popular recently. However, it is still challenging to accurately recognize postures from a single depth camera due to the inherently noisy data derived from depth images and self-occluding action performed by the user. In this paper, we propose a new real-time probabilistic framework to enhance the accuracy of live captured postures that belong to one of the action classes in the database. We adopt the Gaussian Process model as a prior to leverage the position data obtained from Kinect and marker-based motion capture system. We also incorporate a temporal consistency term into the optimization framework to constrain the velocity variations between successive frames. To ensure that the reconstructed posture resembles the accurate parts of the observed posture, we embed a set of joint reliability measurements into the optimization framework. A major drawback of Gaussian Process is its cubic learning complexity when dealing with a large database due to the inverse of a covariance matrix. To solve the problem, we propose a new method based on a local mixture of Gaussian Processes, in which Gaussian Processes are defined in local regions of the state space. Due to the significantly decreased sample size in each local Gaussian Process, the learning time is greatly reduced. At the same time, the prediction speed is enhanced as the weighted mean prediction for a given sample is determined by the nearby local models only. Our system also allows incrementally updating a specific local Gaussian Process in real time, which enhances the likelihood of adapting to run-time postures that are different from those in the database. Experimental results demonstrate that our system can generate high quality postures even under severe self-occlusion situations, which is beneficial for real-time applications such as motion-based gaming and sport training.
International Nuclear Information System (INIS)
Wong, Philip; Han, Kathy; Sykes, Jenna; Catton, Charles; Laframboise, Stephane; Fyles, Anthony; Manchul, Lee; Levin, Wilfred; Milosevic, Michael
2013-01-01
To examine the role of radiotherapy (RT) in uterine leiomyosarcomas (LMS) and to determine the patient population who may benefit from RT. From 1998–2008, 69 patients with primary uterine LMS underwent hysterectomy with or without pelvic radiotherapy to a median dose of 45 Gy. Univariate analysis was performed using the Kaplan-Meier method and cumulative-incidence function, and multivariate analyses using Fine and Gray or Cox proportional hazard models. Following surgery, 32 out of 69 patients received RT. There was no evidence of any correlation between patient, disease and treatment characteristics and the use of RT. Median follow-up was 57 months. RT was associated with reduced local recurrence (3y LR 19% vs. 39%; Gray’s p = 0.019) and improved overall survival (3y OS 69% vs. 35%; log-rank p = 0.025) on univariate analysis. Multivariate analysis demonstrated that RT reduced LR (HR: 0.28, CI: 0.11-0.69, p = 0.006) and increased OS (HR: 0.44, CI: 0.23-0.85, p = 0.014) independent of other clinical and pathologic factors. Positive surgical margins increased the odds of LR (HR: 5.6, CI: 2.3-13.4, p = 0.00012). Large tumor size and advanced stage (II-IV) were associated with the development of distant metastases and inferior OS. Postoperative pelvic RT reduces LR and improves OS of patients with uterine LMS
A Novel Nipple Reconstruction Technique for Maintaining Nipple Projection: The Boomerang Flap
Directory of Open Access Journals (Sweden)
Young-Eun Kim
2016-09-01
Full Text Available Nipple-areolar complex (NAC reconstruction is the final step in the long journey of breast reconstruction for mastectomy patients. Successful NAC reconstruction depends on the use of appropriate surgical techniques that are simple and reliable. To date, numerous techniques have been used for nipple reconstruction, including contralateral nipple sharing and various local flaps. Recently, it has been common to utilize local flaps. However, the most common nipple reconstruction problem encountered with local flaps is the loss of nipple projection; there can be approximately 50% projection loss in reconstructed nipples over long-term follow-up. Several factors might contribute to nipple projection loss, and we tried to overcome these factors by performing nipple reconstructions using a boomerang flap technique, which is a modified C–V flap that utilizes the previous mastectomy scar to maintain long-term nipple projection.
A Novel Nipple Reconstruction Technique for Maintaining Nipple Projection: The Boomerang Flap.
Kim, Young-Eun; Hong, Ki Yong; Minn, Kyung Won; Jin, Ung Sik
2016-09-01
Nipple-areolar complex (NAC) reconstruction is the final step in the long journey of breast reconstruction for mastectomy patients. Successful NAC reconstruction depends on the use of appropriate surgical techniques that are simple and reliable. To date, numerous techniques have been used for nipple reconstruction, including contralateral nipple sharing and various local flaps. Recently, it has been common to utilize local flaps. However, the most common nipple reconstruction problem encountered with local flaps is the loss of nipple projection; there can be approximately 50% projection loss in reconstructed nipples over long-term follow-up. Several factors might contribute to nipple projection loss, and we tried to overcome these factors by performing nipple reconstructions using a boomerang flap technique, which is a modified C-V flap that utilizes the previous mastectomy scar to maintain long-term nipple projection.
Kronowitz, Steven J; Lam, Candace; Terefe, Welela; Hunt, Kelly K; Kuerer, Henry M; Valero, Vicente; Lance, Samuel; Robb, Geoffrey L; Feng, Lei; Buchholz, Thomas A
2011-06-01
The authors examined the safety of a protocol for planned skin-preserving delayed breast reconstruction after postmastectomy radiotherapy with placement of a tissue expander for patients with locally advanced breast cancer (stages IIB and III). The authors compared 47 patients treated according to the protocol between December 2003 and May 2008 with 47 disease-stage-matched control patients who underwent standard delayed reconstruction after postmastectomy radiotherapy (no skin preservation or tissue expander) during the same period. Protocol-group complication rates were 21 percent for skin-preserving mastectomy and placement of the expander (stage 1), 5 percent for postmastectomy radiotherapy, 25 percent for expander reinflation after radiotherapy, and 24 percent for skin-preserving delayed reconstruction. The complication rate for standard delayed reconstruction was 38 percent. Tissue-expander loss rates were 32 percent overall, 9 percent for stage 1, 5 percent for postmastectomy radiotherapy, and 22 percent for reinflation. Wound-healing complications after reconstruction occurred in 3 percent of protocol-group and 10 percent of control-group patients. The median follow-up time for patients still alive at last follow-up was 40 months (range, 8.5 to 85.3 months). Three-year recurrence-free survival rates were 92 percent (95 percent CI, 83 to 100 percent) and 86 percent (95 percent CI, 76 to 98 percent) for the protocol and control groups, respectively (p = 0.87). In patients with locally advanced breast cancer, skin-preserving mastectomy with a deflated tissue expander on the chest wall during postmastectomy radiotherapy does not increase locoregional recurrence risk and is associated with lower complication rates of definitive reconstruction.
Quantitative reconstruction of past Danish landscapes: The first results
DEFF Research Database (Denmark)
Odgaard, Bent Vad; Nielsen, Anne Birgitte
We present a first attempt at pollen based quantitative reconstruction of land cover around 9 Danish lake sites for the past 2500 years, based on models of pollen dispersal and -deposition (Prentice, 1985; Sugita, 1993, 1994), and pollen productivity estimates produced from a historical calibrati...... are then used in the Landscape Reconstruction Algorithm, LRA, (Sugita & Walker, 2000; Sugita, in press) to separate background and local pollen signals at small sites, thus providing reconstructions of local vegetation around the sites....
Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen
2016-03-01
While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.
International Nuclear Information System (INIS)
El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.
2014-01-01
Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light
Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J
2016-01-01
The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.
SU-D-206-03: Segmentation Assisted Fast Iterative Reconstruction Method for Cone-Beam CT
International Nuclear Information System (INIS)
Wu, P; Mao, T; Gong, S; Wang, J; Niu, T; Sheng, K; Xie, Y
2016-01-01
Purpose: Total Variation (TV) based iterative reconstruction (IR) methods enable accurate CT image reconstruction from low-dose measurements with sparse projection acquisition, due to the sparsifiable feature of most CT images using gradient operator. However, conventional solutions require large amount of iterations to generate a decent reconstructed image. One major reason is that the expected piecewise constant property is not taken into consideration at the optimization starting point. In this work, we propose an iterative reconstruction method for cone-beam CT (CBCT) using image segmentation to guide the optimization path more efficiently on the regularization term at the beginning of the optimization trajectory. Methods: Our method applies general knowledge that one tissue component in the CT image contains relatively uniform distribution of CT number. This general knowledge is incorporated into the proposed reconstruction using image segmentation technique to generate the piecewise constant template on the first-pass low-quality CT image reconstructed using analytical algorithm. The template image is applied as an initial value into the optimization process. Results: The proposed method is evaluated on the Shepp-Logan phantom of low and high noise levels, and a head patient. The number of iterations is reduced by overall 40%. Moreover, our proposed method tends to generate a smoother reconstructed image with the same TV value. Conclusion: We propose a computationally efficient iterative reconstruction method for CBCT imaging. Our method achieves a better optimization trajectory and a faster convergence behavior. It does not rely on prior information and can be readily incorporated into existing iterative reconstruction framework. Our method is thus practical and attractive as a general solution to CBCT iterative reconstruction. This work is supported by the Zhejiang Provincial Natural Science Foundation of China (Grant No. LR16F010001), National High-tech R
SU-D-206-03: Segmentation Assisted Fast Iterative Reconstruction Method for Cone-Beam CT
Energy Technology Data Exchange (ETDEWEB)
Wu, P; Mao, T; Gong, S; Wang, J; Niu, T [Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Institute of Translational Medicine, Zhejiang University, Hangzhou, Zhejiang (China); Sheng, K [Department of Radiation Oncology, University of California, Los Angeles, Los Angeles, CA (United States); Xie, Y [Institute of Biomedical and Health Engineering, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, Guangdong (China)
2016-06-15
Purpose: Total Variation (TV) based iterative reconstruction (IR) methods enable accurate CT image reconstruction from low-dose measurements with sparse projection acquisition, due to the sparsifiable feature of most CT images using gradient operator. However, conventional solutions require large amount of iterations to generate a decent reconstructed image. One major reason is that the expected piecewise constant property is not taken into consideration at the optimization starting point. In this work, we propose an iterative reconstruction method for cone-beam CT (CBCT) using image segmentation to guide the optimization path more efficiently on the regularization term at the beginning of the optimization trajectory. Methods: Our method applies general knowledge that one tissue component in the CT image contains relatively uniform distribution of CT number. This general knowledge is incorporated into the proposed reconstruction using image segmentation technique to generate the piecewise constant template on the first-pass low-quality CT image reconstructed using analytical algorithm. The template image is applied as an initial value into the optimization process. Results: The proposed method is evaluated on the Shepp-Logan phantom of low and high noise levels, and a head patient. The number of iterations is reduced by overall 40%. Moreover, our proposed method tends to generate a smoother reconstructed image with the same TV value. Conclusion: We propose a computationally efficient iterative reconstruction method for CBCT imaging. Our method achieves a better optimization trajectory and a faster convergence behavior. It does not rely on prior information and can be readily incorporated into existing iterative reconstruction framework. Our method is thus practical and attractive as a general solution to CBCT iterative reconstruction. This work is supported by the Zhejiang Provincial Natural Science Foundation of China (Grant No. LR16F010001), National High-tech R
Energy Technology Data Exchange (ETDEWEB)
Tweed, Dylan; Yang, Xiaohu; Li, Shijie; Jing, Y. P. [Center for Astronomy and Astrophysics, Shanghai Jiao Tong University, Shanghai 200240 (China); Wang, Huiyuan [Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Cui, Weiguang [Departamento de Física Teórica, Módulo 15, Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Zhang, Youcai [Shanghai Astronomical Observatory, Nandan Road 80, Shanghai 200030 (China); Mo, H. J., E-mail: dtweed@sjtu.edu.cn [Department of Astronomy, University of Massachusetts, Amherst MA, 01003-9305 (United States)
2017-05-20
The ELUCID project aims to build a series of realistic cosmological simulations that reproduce the spatial and mass distributions of the galaxies as observed in the Sloan Digital Sky Survey. This requires powerful reconstruction techniques to create constrained initial conditions (ICs). We test the reconstruction method by applying it to several N -body simulations. We use two medium-resolution simulations, which each produced three additional constrained N -body simulations. We compare the resulting friend-of-friend catalogs by using the particle indexes as tracers, and quantify the quality of the reconstruction by varying the main smoothing parameter. The cross-identification method we use proves to be efficient, and the results suggest that the most massive reconstructed halos are effectively traced from the same Lagrangian regions in the ICs. A preliminary time-dependence analysis indicates that high-mass-end halos converge only at a redshift close to the reconstruction redshift. This suggests that, for earlier snapshots, only collections of progenitors may be effectively cross-identified.
Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying
2011-01-01
A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.
International Nuclear Information System (INIS)
Feng, Mary; Jabbari, Siavash; Lin, Alexander; Bradford, Carol R.; Chepeha, Douglas B.; Teknos, Theodoros N.; Worden, Francis P.; Tsien, Christina; Schipper, Matthew J.; Wolf, Gregory T.; Dawson, Laura A.; Eisbruch, Avraham
2005-01-01
Background and purpose: Predictive factors for local-regional (LR) failures after parotid-sparing, Intensity modulated (IMRT) or 3D conformal radiotherapy for head and neck (HN) cancers were assessed. Patients and methods: One hundred and fifty-eight patients with mostly stages III-IV HN squamous cell carcinoma underwent curative bilateral neck irradiation aimed at sparing the parotid glands. Patient, tumor, and treatment factors were analyzed as predictive factors for LR failure. Results: Twenty-three patients had LR recurrence (19 in-field and four marginal). No differences were found in the doses delivered to the PTVs of patients with or without in-field recurrences. In univariate analysis, tumor site was highly predictive for LR failure in both postoperative and definitive RT patients. In postoperative RT patients, pathologic tumor size, margin status, extracapsular extension (ECE) and number of lymph node metastases, were also significantly predictive. Multivariate analysis showed tumor site (oropharynx vs. other sites) to be a significant predictor in all patients, and involved margins and number of involved lymph nodes in postoperative patients. Conclusions: Clinical rather than dosimetric factors predicted for LR failures in this series, and were similar to those reported following standard RT. These factors may aid in the selection of patients for studies of treatment intensification using IMRT
Rakovitch, E; Gray, R; Baehner, F L; Sutradhar, R; Crager, M; Gu, S; Nofech-Mozes, S; Badve, S S; Hanna, W; Hughes, L L; Wood, W C; Davidson, N E; Paszat, L; Shak, S; Sparano, J A; Solin, L J
2018-06-01
Better tools are needed to estimate local recurrence (LR) risk after breast-conserving surgery (BCS) for DCIS. The DCIS score (DS) was validated as a predictor of LR in E5194 and Ontario DCIS cohort (ODC) after BCS. We combined data from E5194 and ODC adjusting for clinicopathological factors to provide refined estimates of the 10-year risk of LR after treatment by BCS alone. Data from E5194 and ODC were combined. Patients with positive margins or multifocality were excluded. Identical Cox regression models were fit for each study. Patient-specific meta-analysis was used to calculate precision-weighted estimates of 10-year LR risk by DS, age, tumor size and year of diagnosis. The combined cohort includes 773 patients. The DS and age at diagnosis, tumor size and year of diagnosis provided independent prognostic information on the 10-year LR risk (p ≤ 0.009). Hazard ratios from E5194 and ODC cohorts were similar for the DS (2.48, 1.95 per 50 units), tumor size ≤ 1 versus > 1-2.5 cm (1.45, 1.47), age ≥ 50 versus 15%) 10-year LR risk after BCS alone compared to utilization of DS alone or clinicopathological factors alone. The combined analysis provides refined estimates of 10-year LR risk after BCS for DCIS. Adding information on tumor size and age at diagnosis to the DS adjusting for year of diagnosis provides improved LR risk estimates to guide treatment decision making.
Energy Technology Data Exchange (ETDEWEB)
Lai Dakun; Liu Chenguang; Eggen, Michael D; He Bin [Department of Biomedical Engineering, University of Minnesota, MN (United States); Iaizzo, Paul A, E-mail: binhe@umn.edu [Department of Surgery, University of Minnesota, MN (United States)
2011-07-07
Localization of the source of cardiac ectopic activity has direct clinical benefits for determining the location of the corresponding ectopic focus. In this study, a recently developed current-density (CD)-based localization approach was experimentally evaluated in noninvasively localizing the origin of the cardiac ectopic activity from body-surface potential maps (BSPMs) in a well-controlled experimental setting. The cardiac ectopic activities were induced in four well-controlled intact pigs by single-site pacing at various sites within the left ventricle (LV). In each pacing study, the origin of the induced ectopic activity was localized by reconstructing the CD distribution on the endocardial surface of the LV from the measured BSPMs and compared with the estimated single moving dipole (SMD) solution and precise pacing site (PS). Over the 60 analyzed beats corresponding to ten pacing sites (six for each), the mean and standard deviation of the distance between the locations of maximum CD value and the corresponding PSs were 16.9 mm and 4.6 mm, respectively. In comparison, the averaged distance between the SMD locations and the corresponding PSs was slightly larger (18.4 {+-} 3.4 mm). The obtained CD distribution of activated sources extending from the stimulus site also showed high consistency with the endocardial potential maps estimated by a minimally invasive endocardial mapping system. The present experimental results suggest that the CD method is able to locate the approximate site of the origin of a cardiac ectopic activity, and that the distribution of the CD can portray the propagation of early activation of an ectopic beat.
Reconstructing the Initial Density Field of the Local Universe: Methods and Tests with Mock Catalogs
Wang, Huiyuan; Mo, H. J.; Yang, Xiaohu; van den Bosch, Frank C.
2013-07-01
Our research objective in this paper is to reconstruct an initial linear density field, which follows the multivariate Gaussian distribution with variances given by the linear power spectrum of the current cold dark matter model and evolves through gravitational instabilities to the present-day density field in the local universe. For this purpose, we develop a Hamiltonian Markov Chain Monte Carlo method to obtain the linear density field from a posterior probability function that consists of two components: a prior of a Gaussian density field with a given linear spectrum and a likelihood term that is given by the current density field. The present-day density field can be reconstructed from galaxy groups using the method developed in Wang et al. Using a realistic mock Sloan Digital Sky Survey DR7, obtained by populating dark matter halos in the Millennium simulation (MS) with galaxies, we show that our method can effectively and accurately recover both the amplitudes and phases of the initial, linear density field. To examine the accuracy of our method, we use N-body simulations to evolve these reconstructed initial conditions to the present day. The resimulated density field thus obtained accurately matches the original density field of the MS in the density range 0.3 \\lesssim \\rho /\\bar{\\rho } \\lesssim 20 without any significant bias. In particular, the Fourier phases of the resimulated density fields are tightly correlated with those of the original simulation down to a scale corresponding to a wavenumber of ~1 h Mpc-1, much smaller than the translinear scale, which corresponds to a wavenumber of ~0.15 h Mpc-1.
Yang, Yang; Xiao, Li; Qu, Wenzhong; Lu, Ye
2017-11-01
Recent theoretical and experimental studies have demonstrated that a local Green's function can be retrieved from the cross-correlation of ambient noise field. This technique can be used to detect fatigue cracking in metallic structures, owing to the fact that the presence of crack can lead to a change in Green's function. This paper presents a method of structural fatigue cracking characterization method by measuring Green's function reconstruction from noise excitation and verifies the feasibility of crack detection in poor noise source distribution. Fatigue cracks usually generate nonlinear effects, in which different wave amplitudes and frequency compositions can cause different nonlinear responses. This study also undertakes analysis of the capacity of the proposed approach to identify fatigue cracking under different noise amplitudes and frequency ranges. Experimental investigations of an aluminum plate are conducted to assess the cross-correlations of received noise between sensor pairs and finally to detect the introduced fatigue crack. A damage index is proposed according to the variation between cross-correlations obtained from the pristine crack closed state and the crack opening-closure state when sufficient noise amplitude is used to generate nonlinearity. A probability distribution map of damage is calculated based on damage indices. The fatigue crack introduced in the aluminum plate is successfully identified and oriented, verifying that a fatigue crack can be detected by reconstructing Green's functions from an imperfect diffuse field in which ambient noise sources exist locally. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
El-Zohairy, M.A.F.; Mostafa, A.; Amin, A.; Abd El-Fattah, H.; Khalifa, Sh.
2009-01-01
The most common indication for mandible resection remains ablative surgery for cancer of the oral cavity and oropharynx. The use of vascularized bone grafts has become state-of-the-art for mandibular reconstruction. However, the high cost of such surgery may not be justified in patients with advanced disease and poor prognosis, or poor performance status. Objective: The purpose of this study was to evaluate outcomes of mandibular reconstruction using titanium plates covered with a pedicled pectoralis major myocutaneous flap after ablative surgery for locally advanced tumors of the oral cavity. Patients and methods: The study involves a total of 33 patients with locally advanced tumors of the oral cavity that were treated over 5 year period (2003-2008) at the National Cancer Institute, Cairo University, Egypt. Mandibular resections were performed for treatment of patients with primary oral cavity tumors invading the mandible followed by mandibular reconstruction using titanium plates covered with a pedicled pectoralis major myocutaneous flap. Results: Of 33 patients, 25 (75.75%) were males and 8 (24.25%) were females. The age ranged from 42 to 70 years (mean 52.3±5.9 years). Tongue cancer was the most common tumor, it affects 17 (51.5%) of the patients, 24 patients received post operative radiation therapy. The flap survival was 100%; partial necrosis of the flap skin was observed in 3 patients. One patient developed wound dehiscence. Oro-cutaneous fistula occurred in 5 patients that closed spontaneously. There were 4 cases of plate failure, one patient experienced plate fracture at 13 months after reconstruction. Three patients developed external plate exposure. All patients achieved good functional and acceptable aesthetic outcome. The overall cause-specific cumulative survival was 72.7% at one year and 56.1% at two years. Conclusions: Titanium plate and pedicled pectoralis major myocutaneous flap is a safe and reliable option for composite mandibular defects
Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter
2013-05-01
Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.
Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam
2010-03-01
Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T
2018-07-01
The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.
The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden
1956-01-01
The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).
Craniofacial Reconstruction Evaluation by Geodesic Network
Directory of Open Access Journals (Sweden)
Junli Zhao
2014-01-01
Full Text Available Craniofacial reconstruction is to estimate an individual’s face model from its skull. It has a widespread application in forensic medicine, archeology, medical cosmetic surgery, and so forth. However, little attention is paid to the evaluation of craniofacial reconstruction. This paper proposes an objective method to evaluate globally and locally the reconstructed craniofacial faces based on the geodesic network. Firstly, the geodesic networks of the reconstructed craniofacial face and the original face are built, respectively, by geodesics and isogeodesics, whose intersections are network vertices. Then, the absolute value of the correlation coefficient of the features of all corresponding geodesic network vertices between two models is taken as the holistic similarity, where the weighted average of the shape index values in a neighborhood is defined as the feature of each network vertex. Moreover, the geodesic network vertices of each model are divided into six subareas, that is, forehead, eyes, nose, mouth, cheeks, and chin, and the local similarity is measured for each subarea. Experiments using 100 pairs of reconstructed craniofacial faces and their corresponding original faces show that the evaluation by our method is roughly consistent with the subjective evaluation derived from thirty-five persons in five groups.
Energy Technology Data Exchange (ETDEWEB)
Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com
2003-07-01
Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)
International Nuclear Information System (INIS)
Ueki, Nami; Matsuo, Yukinori; Nakamura, Mitsuhiro; Narabayashi, Masaru; Sakanaka, Katsuyuki; Norihisa, Yoshiki; Mizowaki, Takashi; Hiraoka, Masahiro; Shibuya, Keiko
2013-01-01
The purpose of this study is to evaluate the dose-volume metrics under different heterogeneity corrections and the factors associated with local recurrence (LR) after stereotactic body radiation therapy (SBRT) for non-small-cell lung cancer (NSCLC). Eighty-three patients who underwent SBRT for pathologically proven stage I NSCLC were reviewed retrospectively. The prescribed dose was 48 Gy in four fractions at the isocenter (IC) under heterogeneity correction with the Batho power law (BPL). The clinical plans were recalculated with Eclipse (Varian) for the same monitor units under the BPL and anisotropic analytical algorithm (AAA) and with no heterogeneity correction (NC). The dose at the IC, dose that covers 95% of the volume (D95), minimum dose (Min), and mean dose (Mean) of the planning target volume (PTV) were compared under each algorithm and between patients with local lesion control (LC) and LR. The IC doses under NC were significantly lower than those under the BPL and AAA. Under the BPL, the mean PTV D95, Min and Mean were 8.0, 9.4 and 7.4% higher than those under the AAA, and 9.6, 9.2 and 4.6% higher than those under NC, respectively. Under the AAA, all dose-volumetric parameters were significantly lower in T1a patients than in those with T1b and T2a. With a median follow-up of 35.9 months, LR occurred in 18 patients. Between the LC and LR groups, no significant differences were observed for any of the metrics. Even after stratification according to T-stage, no significant difference was observed between LC and LR. (author)
CSIR Research Space (South Africa)
Nchabeleng, T
2014-12-01
Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...
Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography
International Nuclear Information System (INIS)
Harris, M.J.; Schlenker, R.A.
1977-01-01
An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed
Application of the LR-56 at DOE Facilities in the United States
International Nuclear Information System (INIS)
Smith, A.C.
1998-05-01
The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities
A comparison of semiglobal and local dense matching algorithms for surface reconstruction
Directory of Open Access Journals (Sweden)
E. Dall'Asta
2014-06-01
Full Text Available Encouraged by the growing interest in automatic 3D image-based reconstruction, the development and improvement of robust stereo matching techniques is one of the most investigated research topic of the last years in photogrammetry and computer vision. The paper is focused on the comparison of some stereo matching algorithms (local and global which are very popular both in photogrammetry and computer vision. In particular, the Semi-Global Matching (SGM, which realizes a pixel-wise matching and relies on the application of consistency constraints during the matching cost aggregation, will be discussed. The results of some tests performed on real and simulated stereo image datasets, evaluating in particular the accuracy of the obtained digital surface models, will be presented. Several algorithms and different implementation are considered in the comparison, using freeware software codes like MICMAC and OpenCV, commercial software (e.g. Agisoft PhotoScan and proprietary codes implementing Least Square e Semi-Global Matching algorithms. The comparisons will also consider the completeness and the level of detail within fine structures, and the reliability and repeatability of the obtainable data.
A comparison of semiglobal and local dense matching algorithms for surface reconstruction
Dall'Asta, E.; Roncella, R.
2014-06-01
Encouraged by the growing interest in automatic 3D image-based reconstruction, the development and improvement of robust stereo matching techniques is one of the most investigated research topic of the last years in photogrammetry and computer vision. The paper is focused on the comparison of some stereo matching algorithms (local and global) which are very popular both in photogrammetry and computer vision. In particular, the Semi-Global Matching (SGM), which realizes a pixel-wise matching and relies on the application of consistency constraints during the matching cost aggregation, will be discussed. The results of some tests performed on real and simulated stereo image datasets, evaluating in particular the accuracy of the obtained digital surface models, will be presented. Several algorithms and different implementation are considered in the comparison, using freeware software codes like MICMAC and OpenCV, commercial software (e.g. Agisoft PhotoScan) and proprietary codes implementing Least Square e Semi-Global Matching algorithms. The comparisons will also consider the completeness and the level of detail within fine structures, and the reliability and repeatability of the obtainable data.
Extension of local front reconstruction method with controlled coalescence model
Rajkotwala, A. H.; Mirsandi, H.; Peters, E. A. J. F.; Baltussen, M. W.; van der Geld, C. W. M.; Kuerten, J. G. M.; Kuipers, J. A. M.
2018-02-01
The physics of droplet collisions involves a wide range of length scales. This poses a challenge to accurately simulate such flows with standard fixed grid methods due to their inability to resolve all relevant scales with an affordable number of computational grid cells. A solution is to couple a fixed grid method with subgrid models that account for microscale effects. In this paper, we improved and extended the Local Front Reconstruction Method (LFRM) with a film drainage model of Zang and Law [Phys. Fluids 23, 042102 (2011)]. The new framework is first validated by (near) head-on collision of two equal tetradecane droplets using experimental film drainage times. When the experimental film drainage times are used, the LFRM method is better in predicting the droplet collisions, especially at high velocity in comparison with other fixed grid methods (i.e., the front tracking method and the coupled level set and volume of fluid method). When the film drainage model is invoked, the method shows a good qualitative match with experiments, but a quantitative correspondence of the predicted film drainage time with the experimental drainage time is not obtained indicating that further development of film drainage model is required. However, it can be safely concluded that the LFRM coupled with film drainage models is much better in predicting the collision dynamics than the traditional methods.
Nonimaging aspects of follow-up in breast cancer reconstruction.
Wood, W C
1991-09-01
Follow-up of patients with breast cancer is directed to the early detection of recurrent or metastatic disease and the detection of new primary breast cancer. The survival benefit of early detection is limited to some patients with local failure or new primary tumors. That imaging is not used in follow-up of patients who have had breast cancer reconstruction is related to possible interference with this putative benefit by the reconstructive procedure. Such follow-up is accomplished by the patient's own surveillance, clinical examination, and laboratory testing supplemented by imaging studies. Clinical follow-up trials of women who have undergone breast reconstructive surgery show no evidence that locally recurrent breast carcinoma is masked when compared with follow-up of women who did not undergo reconstructive procedures. Reshaping of the contralateral breast to match the reconstructed breast introduces the possibility of interference with palpation as well as mammographic distortion in some women. This is an uncommon practical problem except when complicated by fat necrosis.
Energy Technology Data Exchange (ETDEWEB)
Calais, Jeremie; Lemarignier, Charles; Vera, Pierre [Henri Becquerel Cancer Center and Rouen University Hospital, Nuclear Medicine Department, Rouen (France); University of Rouen, QuantIF-LITIS (Equipe d' Accueil 4108-FR CNRS 3638), Faculty of Medicine, Rouen (France); Dubray, Bernard [University of Rouen, QuantIF-LITIS (Equipe d' Accueil 4108-FR CNRS 3638), Faculty of Medicine, Rouen (France); Centre Henri Becquerel and Rouen University Hospital, Department of Radiotherapy and Medical Physics, Rouen (France); Nkhali, Lamyaa; Thureau, Sebastien; Modzelewski, Romain; Gardin, Isabelle [Henri Becquerel Cancer Center and Rouen University Hospital, Nuclear Medicine Department, Rouen (France); University of Rouen, QuantIF-LITIS (Equipe d' Accueil 4108-FR CNRS 3638), Faculty of Medicine, Rouen (France); Centre Henri Becquerel and Rouen University Hospital, Department of Radiotherapy and Medical Physics, Rouen (France); Di Fiore, Frederic [Rouen University Hospital, Department of Gastroenterology, Rouen (France); Rouen University Hospital, Department of Oncology, Henri Becquerel Cancer Center, IRON, Rouen (France); Michel, Pierre [Rouen University Hospital, Department of Gastroenterology, Rouen (France)
2015-05-01
The high failure rates in the radiotherapy (RT) target volume suggest that patients with locally advanced oesophageal cancer (LAOC) would benefit from increased total RT doses. High 2-deoxy-2-[{sup 18}F]fluoro-D-glucose (FDG) uptake (hotspot) on pre-RT FDG positron emission tomography (PET)/CT has been reported to identify intra-tumour sites at increased risk of relapse after RT in non-small cell lung cancer and in rectal cancer. Our aim was to confirm these observations in patients with LAOC and to determine the optimal maximum standardized uptake value (SUV{sub max}) threshold to delineate smaller RT target volumes that would facilitate RT dose escalation without impaired tolerance. The study included 98 consecutive patients with LAOC treated by chemoradiotherapy (CRT). All patients underwent FDG PET/CT at initial staging and during systematic follow-up in a single institution. FDG PET/CT acquisitions were coregistered on the initial CT scan. Various subvolumes within the initial tumour (30, 40, 50, 60, 70, 80 and 90 % SUV{sub max} thresholds) and in the subsequent local recurrence (LR, 40 and 90 % SUV{sub max} thresholds) were pasted on the initial CT scan and compared[Dice, Jaccard, overlap fraction (OF), common volume/baseline volume, common volume/recurrent volume]. Thirty-five patients had LR. The initial metabolic tumour volume was significantly higher in LR tumours than in the locally controlled tumours (mean 25.4 vs 14.2 cc; p = 0.002). The subvolumes delineated on initial PET/CT with a 30-60 % SUV{sub max} threshold were in good agreement with the recurrent volume at 40 % SUV{sub max} (OF = 0.60-0.80). The subvolumes delineated on initial PET/CT with a 30-60 % SUV{sub max} threshold were in good to excellent agreement with the core volume (90 % SUV{sub max}) of the relapse (common volume/recurrent volume and OF indices 0.61-0.89). High FDG uptake on pretreatment PET/CT identifies tumour subvolumes that are at greater risk of recurrence after CRT in
Energy Technology Data Exchange (ETDEWEB)
Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)
2014-04-18
Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.
Miéville, Frédéric A.; Bolard, Gregory; Benkreira, Mohamed; Ayestaran, Paul; Gudinchet, François; Bochud, François; Verdun, Francis R.
2011-03-01
The noise power spectrum (NPS) is the reference metric for understanding the noise content in computed tomography (CT) images. To evaluate the noise properties of clinical multidetector (MDCT) scanners, local 2D and 3D NPSs were computed for different acquisition reconstruction parameters. A 64- and a 128-MDCT scanners were employed. Measurements were performed on a water phantom in axial and helical acquisition modes. CT dose index was identical for both installations. Influence of parameters such as the pitch, the reconstruction filter (soft, standard and bone) and the reconstruction algorithm (filtered-back projection (FBP), adaptive statistical iterative reconstruction (ASIR)) were investigated. Images were also reconstructed in the coronal plane using a reformat process. Then 2D and 3D NPS methods were computed. In axial acquisition mode, the 2D axial NPS showed an important magnitude variation as a function of the z-direction when measured at the phantom center. In helical mode, a directional dependency with lobular shape was observed while the magnitude of the NPS was kept constant. Important effects of the reconstruction filter, pitch and reconstruction algorithm were observed on 3D NPS results for both MDCTs. With ASIR, a reduction of the NPS magnitude and a shift of the NPS peak to the low frequency range were visible. 2D coronal NPS obtained from the reformat images was impacted by the interpolation when compared to 2D coronal NPS obtained from 3D measurements. The noise properties of volume measured in last generation MDCTs was studied using local 3D NPS metric. However, impact of the non-stationarity noise effect may need further investigations.
International Nuclear Information System (INIS)
Zhao, W; Niu, T; Xing, L; Xiong, G; Elmore, K; Min, J; Zhu, J; Wang, L
2015-01-01
Purpose: To significantly improve dual energy CT (DECT) imaging by establishing a new theoretical framework of image-domain material decomposition with incorporation of edge-preserving techniques. Methods: The proposed algorithm, HYPR-NLM, combines the edge-preserving non-local mean filter (NLM) with the HYPR-LR (Local HighlY constrained backPRojection Reconstruction) framework. Image denoising using HYPR-LR framework depends on the noise level of the composite image which is the average of the different energy images. For DECT, the composite image is the average of high- and low-energy images. To further reduce noise, one may want to increase the window size of the filter of the HYPR-LR, leading resolution degradation. By incorporating the NLM filtering and the HYPR-LR framework, HYPR-NLM reduces the boost material decomposition noise using energy information redundancies as well as the non-local mean. We demonstrate the noise reduction and resolution preservation of the algorithm with both iodine concentration numerical phantom and clinical patient data by comparing the HYPR-NLM algorithm to the direct matrix inversion, HYPR-LR and iterative image-domain material decomposition (Iter-DECT). Results: The results show iterative material decomposition method reduces noise to the lowest level and provides improved DECT images. HYPR-NLM significantly reduces noise while preserving the accuracy of quantitative measurement and resolution. For the iodine concentration numerical phantom, the averaged noise levels are about 2.0, 0.7, 0.2 and 0.4 for direct inversion, HYPR-LR, Iter- DECT and HYPR-NLM, respectively. For the patient data, the noise levels of the water images are about 0.36, 0.16, 0.12 and 0.13 for direct inversion, HYPR-LR, Iter-DECT and HYPR-NLM, respectively. Difference images of both HYPR-LR and Iter-DECT show edge effect, while no significant edge effect is shown for HYPR-NLM, suggesting spatial resolution is well preserved for HYPR-NLM. Conclusion: HYPR
PET reconstruction via nonlocal means induced prior.
Hou, Qingfeng; Huang, Jing; Bian, Zhaoying; Chen, Wufan; Ma, Jianhua
2015-01-01
The traditional Bayesian priors for maximum a posteriori (MAP) reconstruction methods usually incorporate local neighborhood interactions that penalize large deviations in parameter estimates for adjacent pixels; therefore, only local pixel differences are utilized. This limits their abilities of penalizing the image roughness. To achieve high-quality PET image reconstruction, this study investigates a MAP reconstruction strategy by incorporating a nonlocal means induced (NLMi) prior (NLMi-MAP) which enables utilizing global similarity information of image. The present NLMi prior approximates the derivative of Gibbs energy function by an NLM filtering process. Specially, the NLMi prior is obtained by subtracting the current image estimation from its NLM filtered version and feeding the residual error back to the reconstruction filter to yield the new image estimation. We tested the present NLMi-MAP method with simulated and real PET datasets. Comparison studies with conventional filtered backprojection (FBP) and a few iterative reconstruction methods clearly demonstrate that the present NLMi-MAP method performs better in lowering noise, preserving image edge and in higher signal to noise ratio (SNR). Extensive experimental results show that the NLMi-MAP method outperforms the existing methods in terms of cross profile, noise reduction, SNR, root mean square error (RMSE) and correlation coefficient (CORR).
Energy Technology Data Exchange (ETDEWEB)
Lafata, K; Ren, L; Cai, J; Yin, F [Duke University Medical Center, Durham, NC (United States)
2016-06-15
Purpose: To develop a methodology based on digitally-reconstructed-fluoroscopy (DRF) to quantitatively assess target localization accuracy of lung SBRT, and to evaluate using both a dynamic digital phantom and a patient dataset. Methods: For each treatment field, a 10-phase DRF is generated based on the planning 4DCT. Each frame is pre-processed with a morphological top-hat filter, and corresponding beam apertures are projected to each detector plane. A template-matching algorithm based on cross-correlation is used to detect the tumor location in each frame. Tumor motion relative beam aperture is extracted in the superior-inferior direction based on each frame’s impulse response to the template, and the mean tumor position (MTP) is calculated as the average tumor displacement. The DRF template coordinates are then transferred to the corresponding MV-cine dataset, which is retrospectively filtered as above. The treatment MTP is calculated within each field’s projection space, relative to the DRF-defined template. The field’s localization error is defined as the difference between the DRF-derived-MTP (planning) and the MV-cine-derived-MTP (delivery). A dynamic digital phantom was used to assess the algorithm’s ability to detect intra-fractional changes in patient alignment, by simulating different spatial variations in the MV-cine and calculating the corresponding change in MTP. Inter-and-intra-fractional variation, IGRT accuracy, and filtering effects were investigated on a patient dataset. Results: Phantom results demonstrated a high accuracy in detecting both translational and rotational variation. The lowest localization error of the patient dataset was achieved at each fraction’s first field (mean=0.38mm), with Fx3 demonstrating a particularly strong correlation between intra-fractional motion-caused localization error and treatment progress. Filtering significantly improved tracking visibility in both the DRF and MV-cine images. Conclusion: We have
Directory of Open Access Journals (Sweden)
Julin Yuan
2015-10-01
Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.
Reconstruction of soft tissue after complicated calcaneal fractures.
Koski, E Antti; Kuokkanen, Hannu O M; Koskinen, Seppo K; Tukiainen, Erkki J
2004-01-01
A total of 35 flap reconstructions were done to cover exposed calcaneal bones in 31 patients. All patients had calcaneal fractures, 19 of which were primarily open. Soft tissue reconstruction for the closed fractures was indicated by a postoperative wound complication. A microvascular flap was used for reconstruction in 21 operations (gracilis, n = 11; anterolateral thigh, n = 5; rectus abdominis, n = 3; and latissimus dorsi, n = 2). A suralis neurocutaneous flap was used in eight, local muscle flaps in three, and local skin flaps in three cases. The mean follow-up time was 14 months (range 3 months-4 years). One suralis flap failed and was replaced by a latissimus dorsi flap. Necrosis of the edges that required revision affected three flaps. Deep infection developed in two patients and delayed wound healing in another four. During the follow-up the soft tissues healed in all patients and there were no signs of calcaneal osteitis. Flaps were considered too bulky in five patients. Soft tissues heal most rapidly with microvascular flaps. In the long term, gracilis muscle covered with free skin grafts gives a good contour to the foot. The suralis flap is reliable and gives a good final aesthetic outcome. Local muscles can be transposed for reconstruction in small defects.
International Nuclear Information System (INIS)
Kobayashi, Satoshi; Takaba, Toshihiro; Kume, Masato; Kashima, Toshitaka; Michihata, Tetsuro.
1996-01-01
Thirty patients (280 areas) whose bypass grafts remained patent after surgical reconstruction of the coronary artery were examined. Before and after reconstruction, local myocardial blood circulation in infarcted regions and post-stenotic regions was measured by 13 NH 3 myocardial positron emission computed tomography (PET) at rest or during physical exercise in order to evaluate the efficacy of coronary artery reconstruction. Before operation, mean blood flow in post-stenotic regions (n=198) was 65±15 ml/min/100 g at rest and 85±23 ml/min/100 g during exercise. After coronary artery bypass grafting (CABG), mean blood flow was increased to 78±21 ml/min/100 g at rest (p, 0.01) and 105±32 ml/min/100 g during exercise (p<0.01). In infarcted regions (n=82), mean blood flow before operation was 51±23 ml/min/100 g at rest and 69±23 ml/min/100 g during exercise. After CABG, it increased to 62±19 ml/min/100 g at rest (p<0.01) and 81±29 ml/min/100 g during exercise (p<0.01). Thus, significant increases in blood flow were observed in both post-stenotic and infarcted regions at rest and physical exercise after operation. The regions of infarction were divided into three groups based on local myocardial blood flow at rest before operation: Group I: greater than 45 ml/min/100 g (n=35); Group II: less than 45 ml/min/100 g (n=30) but greater than 30 ml/min/100 g; and Group III: less than 30 ml/min/100 g (n=30). The efficacy of reconstruction was compared among these groups. The group with preoperative myocardial blood flow greater than 30 ml/min/100 g had increased blood flow after operation, indicating myocardial viability. (author)
Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto
2013-04-01
Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.
Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi
2005-12-01
Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.
Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong
2016-01-01
Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...
Energy Technology Data Exchange (ETDEWEB)
Zhao, Lina [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zhou, Shouhao [Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Balter, Peter [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Shen, Chan [Department of Health Service Research, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gomez, Daniel R.; Welsh, James D.; Lin, Steve H. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Chang, Joe Y., E-mail: jychang@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)
2016-07-15
Purpose: To identify the optimal dose parameters predictive for local/lobar control after stereotactic ablative radiation therapy (SABR) in early-stage non-small cell lung cancer (NSCLC). Methods and Materials: This study encompassed a total of 1092 patients (1200 lesions) with NSCLC of clinical stage T1-T2 N0M0 who were treated with SABR of 50 Gy in 4 fractions or 70 Gy in 10 fractions, depending on tumor location/size, using computed tomography-based heterogeneity corrections and a convolution superposition calculation algorithm. Patients were monitored by chest CT or positron emission tomography/CT and/or biopsy after SABR. Factors predicting local/lobar recurrence (LR) were determined by competing risk multivariate analysis. Continuous variables were divided into 2 subgroups at cutoff values identified by receiver operating characteristic curves. Results: At a median follow-up time of 31.7 months (interquartile range, 14.8-51.3 months), the 5-year time to local recurrence within the same lobe and overall survival rates were 93.8% and 44.8%, respectively. Total cumulative number of patients experiencing LR was 40 (3.7%), occurring at a median time of 14.4 months (range, 4.8-46 months). Using multivariate competing risk analysis, independent predictive factors for LR after SABR were minimum biologically effective dose (BED{sub 10}) to 95% of planning target volume (PTVD95 BED{sub 10}) ≤86 Gy (corresponding to PTV D95 physics dose of 42 Gy in 4 fractions or 55 Gy in 10 fractions) and gross tumor volume ≥8.3 cm{sup 3}. The PTVmean BED{sub 10} was highly correlated with PTVD95 BED{sub 10.} In univariate analysis, a cutoff of 130 Gy for PTVmean BED{sub 10} (corresponding to PTVmean physics dose of 55 Gy in 4 fractions or 75 Gy in 10 fractions) was also significantly associated with LR. Conclusions: In addition to gross tumor volume, higher radiation dose delivered to the PTV predicts for better local/lobar control. We recommend that both PTVD95 BED
Treatment results of localized gastric lymphoma
International Nuclear Information System (INIS)
Abe, Tatsuyuki; Gomi, Hiromichi; Sakaino, Shinjiro; Nakajima, Yasuo
2008-01-01
Between 2000 and 2007, 17 patients with localized gastric lymphoma (10 mucosa-associated lymphoid tissue lymphomas and 7 diffuse large B-cell lymphomas) were treated with radiotherapy alone or doxorubicin-based chemotherapy followed by radiotherapy. Radiation dose of mucosa-associated lymphoid tissue (MALT) lymphoma was 30 Gy with a daily fraction size of 1.5 Gy. Sixteen patients achieved complete remission and the 5-year overall survival of MALT lymphoma and diffuse large B-cell lymphoma (DLBCL) were 100% and 87%, respectively. No gastric perforation and hemorrhage were noticed. Using AP/LR 2-port radiotherapy markedly decreased the liver dose. (author)
Energy Technology Data Exchange (ETDEWEB)
Calvo, Felipe A. [Department of Oncology, Hospital General Universitario Gregorio Marañón, Madrid (Spain); School of Medicine, Complutense University, Madrid (Spain); Sole, Claudio V., E-mail: cvsole@uc.cl [Department of Oncology, Hospital General Universitario Gregorio Marañón, Madrid (Spain); School of Medicine, Complutense University, Madrid (Spain); Service of Radiation Oncology, Instituto de Radiomedicina, Santiago (Chile); Cambeiro, Mauricio [Service of Radiation Oncology, Clínica Universitaria, Universidad de Navarra, Pamplona (Spain); Montero, Angel; Polo, Alfredo [Service of Radiation Oncology, Hospital Universitario Ramón y Cajal, Universidad de Alcala, Madrid (Spain); Gonzalez, Carmen [School of Medicine, Complutense University, Madrid (Spain); Service of Radiation Oncology, Instituto de Radiomedicina, Santiago (Chile); Service of Radiation Oncology, Clínica Universitaria, Universidad de Navarra, Pamplona (Spain); Service of Radiation Oncology, Hospital Universitario Ramón y Cajal, Universidad de Alcala, Madrid (Spain); Service of Radiation Oncology, Hospital General Universitario Gregorio Marañón, Madrid (Spain); Cuervo, Miguel [Service of Orthopedics and Traumatology, Hospital General Universitario Gregorio Marañón, Madrid (Spain); San Julian, Mikel [Service of Orthopedics and Traumatology, Clínica Universitaria, Universidad de Navarra, Pamplona (Spain); and others
2014-01-01
Background: A joint analysis of data from centers involved in the Spanish Cooperative Initiative for Intraoperative Electron Radiotherapy was performed to investigate long-term outcomes of locally recurrent soft tissue sarcoma (LR-STS) patients treated with a multidisciplinary approach. Methods and Materials: Patients with a histologic diagnosis of LR-STS (extremity, 43%; trunk wall, 24%; retroperitoneum, 33%) and no distant metastases who underwent radical surgery and intraoperative electron radiation therapy (IOERT; median dose, 12.5 Gy) were considered eligible for participation in this study. In addition, 62% received external beam radiation therapy (EBRT; median dose, 50 Gy). Results: From 1986 to 2012, a total of 103 patients from 3 Spanish expert IOERT institutions were analyzed. With a median follow-up of 57 months (range, 2-311 months), 5-year local control (LC) was 60%. The 5-year IORT in-field control, disease-free survival (DFS), and overall survival were 73%, 43%, and 52%, respectively. In the multivariate analysis, no EBRT to treat the LR-STS (P=.02) and microscopically involved margin resection status (P=.04) retained significance in relation to LC. With regard to IORT in-field control, only not delivering EBRT to the LR-STS retained significance in the multivariate analysis (P=.03). Conclusion: This joint analysis revealed that surgical margin and EBRT affect LC but that, given the high risk of distant metastases, DFS remains modest. Intensified local treatment needs to be further tested in the context of more efficient concurrent, neoadjuvant, and adjuvant systemic therapy.
International Nuclear Information System (INIS)
Calvo, Felipe A.; Sole, Claudio V.; Cambeiro, Mauricio; Montero, Angel; Polo, Alfredo; Gonzalez, Carmen; Cuervo, Miguel; San Julian, Mikel
2014-01-01
Background: A joint analysis of data from centers involved in the Spanish Cooperative Initiative for Intraoperative Electron Radiotherapy was performed to investigate long-term outcomes of locally recurrent soft tissue sarcoma (LR-STS) patients treated with a multidisciplinary approach. Methods and Materials: Patients with a histologic diagnosis of LR-STS (extremity, 43%; trunk wall, 24%; retroperitoneum, 33%) and no distant metastases who underwent radical surgery and intraoperative electron radiation therapy (IOERT; median dose, 12.5 Gy) were considered eligible for participation in this study. In addition, 62% received external beam radiation therapy (EBRT; median dose, 50 Gy). Results: From 1986 to 2012, a total of 103 patients from 3 Spanish expert IOERT institutions were analyzed. With a median follow-up of 57 months (range, 2-311 months), 5-year local control (LC) was 60%. The 5-year IORT in-field control, disease-free survival (DFS), and overall survival were 73%, 43%, and 52%, respectively. In the multivariate analysis, no EBRT to treat the LR-STS (P=.02) and microscopically involved margin resection status (P=.04) retained significance in relation to LC. With regard to IORT in-field control, only not delivering EBRT to the LR-STS retained significance in the multivariate analysis (P=.03). Conclusion: This joint analysis revealed that surgical margin and EBRT affect LC but that, given the high risk of distant metastases, DFS remains modest. Intensified local treatment needs to be further tested in the context of more efficient concurrent, neoadjuvant, and adjuvant systemic therapy
International Nuclear Information System (INIS)
Huang, Eng-Yen; Chanchien, Chan-Chao; Lin, Hao; Wang, Chung-Chi; Wang, Chong-Jong; Huang, Chao-Cheng
2013-01-01
Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer
Energy Technology Data Exchange (ETDEWEB)
Huang, Eng-Yen [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); School of Traditional Chinese Medicine, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Chanchien, Chan-Chao; Lin, Hao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Wang, Chung-Chi; Wang, Chong-Jong [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Huang, Chao-Cheng, E-mail: huangcc@cgmh.org.tw [Department of Pathology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)
2013-12-01
Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer.
Parameters of calibration of the measurement system of 222 Rn based in LR-115
International Nuclear Information System (INIS)
Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.
2003-01-01
Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)
Heenan, Patrick R; Yu, Hao; Siewny, Matthew G W; Perkins, Thomas T
2018-03-28
Precisely quantifying the energetics that drive the folding of membrane proteins into a lipid bilayer remains challenging. More than 15 years ago, atomic force microscopy (AFM) emerged as a powerful tool to mechanically extract individual membrane proteins from a lipid bilayer. Concurrently, fluctuation theorems, such as the Jarzynski equality, were applied to deduce equilibrium free energies (ΔG 0 ) from non-equilibrium single-molecule force spectroscopy records. The combination of these two advances in single-molecule studies deduced the free-energy of the model membrane protein bacteriorhodopsin in its native lipid bilayer. To elucidate this free-energy landscape at a higher resolution, we applied two recent developments. First, as an input to the reconstruction, we used force-extension curves acquired with a 100-fold higher time resolution and 10-fold higher force precision than traditional AFM studies of membrane proteins. Next, by using an inverse Weierstrass transform and the Jarzynski equality, we removed the free energy associated with the force probe and determined the molecular free-energy landscape of the molecule under study, bacteriorhodopsin. The resulting landscape yielded an average unfolding free energy per amino acid (aa) of 1.0 ± 0.1 kcal/mol, in agreement with past single-molecule studies. Moreover, on a smaller spatial scale, this high-resolution landscape also agreed with an equilibrium measurement of a particular three-aa transition in bacteriorhodopsin that yielded 2.7 kcal/mol/aa, an unexpectedly high value. Hence, while average unfolding ΔG 0 per aa is a useful metric, the derived high-resolution landscape details significant local variation from the mean. More generally, we demonstrated that, as anticipated, the inverse Weierstrass transform is an efficient means to reconstruct free-energy landscapes from AFM data.
Type B liquid package technical issues -- Experience with LR-56 safety analysis
International Nuclear Information System (INIS)
Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.
1997-01-01
In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites
Perturbation measurements in reactor LR-0 and their evaluation
International Nuclear Information System (INIS)
Rypar, W.; Faehrmann, K.H.
1988-07-01
To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs
Directory of Open Access Journals (Sweden)
R. Greco
2013-09-01
Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.
Timm, Matthew J; Matta, Chérif F; Massa, Lou; Huang, Lulu
2014-11-26
Bader's quantum theory of atoms in molecules (QTAIM) and chemical graph theory, merged in the localization-delocalization matrices (LDMs) and the electron-density-weighted connectivity matrices (EDWCM), are shown to benefit in computational speed from the kernel energy method (KEM). The LDM and EDWCM quantum chemical graph matrices of a 66-atom C46H20 hydrogen-terminated armchair graphene nanoribbon, in 14 (2×7) rings of C2v symmetry, are accurately reconstructed from kernel fragments. (This includes the full sets of electron densities at 84 bond critical points and 19 ring critical points, and the full sets of 66 localization and 4290 delocalization indices (LIs and DIs).) The average absolute deviations between KEM and directly calculated atomic electron populations, obtained from the sum of the LIs and half of the DIs of an atom, are 0.0012 ± 0.0018 e(-) (∼0.02 ± 0.03%) for carbon atoms and 0.0007 ± 0.0003 e(-) (∼0.01 ± 0.01%) for hydrogen atoms. The integration errors in the total electron population (296 electrons) are +0.0003 e(-) for the direct calculation (+0.0001%) and +0.0022 e(-) for KEM (+0.0007%). The accuracy of the KEM matrix elements is, thus, probably of the order of magnitude of the combined precision of the electronic structure calculation and the atomic integrations. KEM appears capable of delivering not only the total energies with chemical accuracy (which is well documented) but also local and nonlocal properties accurately, including the DIs between the fragments (crossing fragmentation lines). Matrices of the intact ribbon, the kernels, the KEM-reconstructed ribbon, and errors are available as Supporting Information .
International Nuclear Information System (INIS)
Turlakow, A.; Larson, S. M.; Coakley, F.; Akhurst, T.; Macapinlac, H. A.; Hricak, H.; Gonen, M.; Kelly, W.; Scher, H.; Leibel, S.; Humm, J.; Scardino, P.
2001-01-01
To compare filtered back projection (FBP) and iterative reconstruction with segmented attenuation correction (IRSAC) in the local imaging of prostate cancer by positron emission tomography with 2-fluorodeoxyglucose (FDG-PET). 13 patients with primary (n=7) or recurrent (n=6) prostate cancer who had increased uptake in the prostate on FDG-PET performed without urinary catheterization, contemporaneous biopsy confirming the presence of active tumor in the prostate, were retrospectively identified. Two independent nuclear medicine physicians separately rated FBP and IRSAC images for visualization of prostatic activity on a 4-point scale. Results were compared using biopsy and cross-sectional imaging findings as the standard of reference. IRSAC images were significantly better that FBP in terms of visualization of prostatic activity in 12 of 13 patients, and were equivalent in 1 patient (p<0.001, Wilcoxon signed ranks test). In particular, 2 foci of tumor activity in 2 different patients seen on IRSAC images were not visible on FBP images. In 11 patients who had a gross tumor mass evident on cross-sectional imaging, there was good agreement between PET and cross-sectional anatomic imaging with respect to tumor localization. In selected patients, cancer can be imaged within the prostate using FDG-PET, and IRSAC is superior to FBP in image reconstruction for local tumor visualization
Rod drop in the LR-0 reactor core comprising 55 fuel assemblies
International Nuclear Information System (INIS)
Hadek, J.; Grundmann, U.
1989-09-01
Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs
Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons
International Nuclear Information System (INIS)
Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.
1987-01-01
The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)
Reconstructive breast implantation after mastectomy for breast cancer
DEFF Research Database (Denmark)
Henriksen, Trine F; Fryzek, Jon P; Hölmich, Lisbet R
2005-01-01
BACKGROUND: Clinical reports have raised concern about local complications following breast implantation used in reconstructive or cosmetic surgery, but there is a shortage of epidemiological studies in this area. OBJECTIVE: To assess in a prospective epidemiological manner the occurrence of short......-term local complications in a nationwide implantation registry. DESIGN, SETTING, AND PARTICIPANTS: The Danish Registry for Plastic Surgery of the Breast prospectively collects preoperative, perioperative, and postoperative information on Danish women undergoing breast augmentation. Through the registry, we...... collected data on short-term local complications among 574 women who underwent postmastectomy reconstruction with breast implants from June 1, 1999, through July 24, 2003. MAIN OUTCOME MEASURES: Complication incidence rates. RESULTS: Thirty-one percent of the women who underwent initial implantation...
Bell inequalities for falsifying mesoscopic local realism via amplification of quantum noise
Reid, M. D.
2018-04-01
Macroscopic realism (MR) per se specifies that a system which has two macroscopically distinct states available to it (such as a cat being dead or alive) is at all times predetermined to be in one or other of those two states. A minimal assumption of a macroscopic realistic theory therefore is the validity of a hidden variable λM that predetermines the outcome (whether dead or alive) of a measurement M ̂ distinguishing the two states. Proposals to test MR generally introduce a second premise to further qualify the meaning of MR. Thus, we consider a model, macroscopic local realism (MLR), where the second premise is that measurements at one location cannot cause an instantaneous macroscopic change δ to the results of measurements made on a second system at another location. To provide a practical test, we define the intermediate concept of δ -scopic local realism (δ -LR), where δ ≠0 can be quantified, but need not be macroscopic. By considering the amplification of quantum fluctuations, we show how negation of δ -LR is possible using fields violating a continuous variable Bell inequality. A modified Bell-Clauser-Horne-Shimony-Holt inequality is derived that tests δ -LR, and a quantitative proposal given for experiments based on polarization entanglement. In the proposal, δ is the magnitude of the quantum noise scaled by an adjustable coherent amplitude α that can also be considered part of the measurement apparatus. Thus, δ is large in an absolute sense, but scales inversely with the square root of the system size, which is proportional to |α| 2. We discuss how the proposed experiment gives a realization of a type of Schrödinger-cat experiment without problems of decoherence.
Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...
Results of isolated lateral retinacular reconstruction for iatrogenic medial patellar instability.
Sanchis-Alfonso, Vicente; Montesinos-Berry, Erik; Monllau, Joan Carles; Merchant, Alan C
2015-03-01
The aim of this study was to assess the outcomes of an isolated lateral retinaculum reconstruction for iatrogenic medial patellar instability (IMPI) in patients with continued pain after failed lateral retinacular release (LRR), including associated psychometric analysis. Pain was assessed using the visual analog scale (VAS) and disability was determined with the Lysholm scale. Psychological variables such as anxiety, depression, catastrophizing, and fear-of-movement beliefs were studied by using self-administered psychometric questionnaires. All 17 patients (13 women and 4 men) in this retrospective study had undergone LRR previously for anterior knee pain or lateral patellar instability. Four patients had undergone LRR plus proximal (Insall) realignment, and one had undergone LRR plus a medial tibial tubercle transfer. After their procedures, all had disabling symptoms. All patients underwent reconstructive surgery for IMPI. At a minimum follow-up of 2 years (range, 2 to 8 years), the mean preoperative VAS score was 7.6 (range, 5 to 9) and improved to 1.9 (range, 0 to 8) at the time of final follow-up (P surgery, 4 patients (24%) had the clinical criteria for depression, 10 (59%) had anxiety, 7 (41%) had "catastrophizing" ideas concerning pain, and all (100%) had kinesiophobia (fear of movement). After surgery, none of the patients had depression or anxiety, none had catastrophizing ideation, and only 53% had kinesiophobia. Reconstruction of the deep transverse layer of the lateral retinaculum (LR) using a central strip of the iliotibial band for IMPI in patients with continued pain after failed LRR can successfully treat these severely disabled patients. Level IV, therapeutic case series. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
An alternative to the crystallographic reconstruction of austenite in steels
International Nuclear Information System (INIS)
Bernier, Nicolas; Bracke, Lieven; Malet, Loïc; Godet, Stéphane
2014-01-01
An alternative crystallographic austenite reconstruction programme written in Matlab is developed by combining the best features of the existing models: the orientation relationship refinement, the local pixel-by-pixel analysis and the nuclei identification and spreading strategy. This programme can be directly applied to experimental electron backscatter diffraction mappings. Its applicability is demonstrated on both quenching and partitioning and as-quenched lath-martensite steels. - Highlights: • An alternative crystallographic austenite reconstruction program is developed. • The method combines a local analysis and a nuclei identification/spreading strategy. • The validity of the calculated orientation relationship is verified on a Q and P steel. • The accuracy of the reconstructed microtexture is investigated on a martensite steel
Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor
International Nuclear Information System (INIS)
Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech
2008-01-01
This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)
Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor
Energy Technology Data Exchange (ETDEWEB)
Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)
2008-07-01
This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)
International Nuclear Information System (INIS)
Khan, Atif J.; Vicini, Frank A.; Beitsch, Peter; Goyal, Sharad; Kuerer, Henry M.; Keisch, Martin; Quiet, Coral; Zannis, Victor; Keleher, Angela; Snyder, Howard; Gittleman, Mark; Whitworth, Pat; Fine, Richard; Lyden, Maureen; Haffty, Bruce G.
2012-01-01
Purpose: The American Society of Breast Surgeons enrolled women in a registry trial to prospectively study patients treated with the MammoSite Radiation Therapy System breast brachytherapy device. The present report examined the outcomes in women aged >70 years enrolled in the trial. Methods and Materials: A total of 1,449 primary early stage breast cancers were treated in 1,440 women. Of these, 537 occurred in women >70 years old. Fisher’s exact test was performed to correlate age (≤70 vs. >70 years) with toxicity and with cosmesis. The association of age with local recurrence (LR) failure times was investigated by fitting a parametric model. Results: Older women were less likely to develop telangiectasias than younger women (7.9% vs. 12.4%, p = 0.0083). The incidence of other toxicities was similar. Cosmesis was good or excellent in 92% of the women >70 years old. No significant difference was found in LR as a function of age. The 5-year actuarial LR rate with invasive disease for the older vs. younger population was 2.79% and 2.92%, respectively (p = 0.5780). In women >70 years with hormone-sensitive tumors ≤2 cm who received hormonal therapy (n = 195), the 5-year actuarial rate of LR, overall survival, disease-free survival, and cause-specific survival was 2.06%, 89.3%, 87%, and 97.5%, respectively. These outcomes were similar in women who did not receive hormonal therapy. Women with small, estrogen receptor-negative disease had worse LR, overall survival, and disease-free survival compared with receptor-positive patients. Conclusions: Accelerated partial breast irradiation with the MammoSite radiation therapy system resulted in low toxicity and produced similar cosmesis and local control at 5 years in women >70 years compared with younger women. This treatment should be considered as an alternative to omitting adjuvant radiotherapy for older women with small-volume, early-stage breast cancer.
Energy Technology Data Exchange (ETDEWEB)
Khan, Atif J., E-mail: atif_khan@rwjuh.edu [Robert Wood Johnson University Hospital, Cancer Institute of New Jersey, New Brunswick, NJ (United States); Vicini, Frank A.; Beitsch, Peter [American Society of Breast Surgeons, Columbia, MD (United States); Goyal, Sharad [Robert Wood Johnson University Hospital, Cancer Institute of New Jersey, New Brunswick, NJ (United States); Kuerer, Henry M.; Keisch, Martin; Quiet, Coral; Zannis, Victor; Keleher, Angela; Snyder, Howard; Gittleman, Mark; Whitworth, Pat; Fine, Richard [American Society of Breast Surgeons, Columbia, MD (United States); Lyden, Maureen [BioStat International, Inc., Tampa, FL (United States); Haffty, Bruce G. [Robert Wood Johnson University Hospital, Cancer Institute of New Jersey, New Brunswick, NJ (United States); American Society of Breast Surgeons, Columbia, MD (United States)
2012-10-01
Purpose: The American Society of Breast Surgeons enrolled women in a registry trial to prospectively study patients treated with the MammoSite Radiation Therapy System breast brachytherapy device. The present report examined the outcomes in women aged >70 years enrolled in the trial. Methods and Materials: A total of 1,449 primary early stage breast cancers were treated in 1,440 women. Of these, 537 occurred in women >70 years old. Fisher's exact test was performed to correlate age ({<=}70 vs. >70 years) with toxicity and with cosmesis. The association of age with local recurrence (LR) failure times was investigated by fitting a parametric model. Results: Older women were less likely to develop telangiectasias than younger women (7.9% vs. 12.4%, p = 0.0083). The incidence of other toxicities was similar. Cosmesis was good or excellent in 92% of the women >70 years old. No significant difference was found in LR as a function of age. The 5-year actuarial LR rate with invasive disease for the older vs. younger population was 2.79% and 2.92%, respectively (p = 0.5780). In women >70 years with hormone-sensitive tumors {<=}2 cm who received hormonal therapy (n = 195), the 5-year actuarial rate of LR, overall survival, disease-free survival, and cause-specific survival was 2.06%, 89.3%, 87%, and 97.5%, respectively. These outcomes were similar in women who did not receive hormonal therapy. Women with small, estrogen receptor-negative disease had worse LR, overall survival, and disease-free survival compared with receptor-positive patients. Conclusions: Accelerated partial breast irradiation with the MammoSite radiation therapy system resulted in low toxicity and produced similar cosmesis and local control at 5 years in women >70 years compared with younger women. This treatment should be considered as an alternative to omitting adjuvant radiotherapy for older women with small-volume, early-stage breast cancer.
Pedicle Anterolateral Thigh Flap Reconstruction after Pelvic Tumor Resection: A Case Report
Directory of Open Access Journals (Sweden)
Robert M. Whitfield
2010-01-01
Full Text Available A 47-year-old female with a locally advanced urologic malignancy previously managed with resection, diversion, and postoperative radiation therapy presented for management of her recurrent cancer that had eroded through the soft tissues of the left inner thigh and vulva. On all staging studies the tumor involved the left common femoral artery, and vein, both above and below the inguinal ligament. The difficulty with such tumors is the availability of tissue to reconstruct the defect. The patient had a history of deep venous thrombosis in the femoral venous system. A local flap was the most logical type of reconstruction. The patient had a right lower quadrant ureterostomy with a large parastomal hernia which further limited the local flap options. An anterolateral thigh flap from the opposite thigh was used to reconstruct the soft tissue deficit in this patient. This resurfaced the defect and provided coverage for the vascular reconstruction.
Pathological Predictors for Site of Local Recurrence After Radiotherapy for Prostate Cancer
Energy Technology Data Exchange (ETDEWEB)
Chopra, Supriya [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Toi, Ants [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Medical Imaging, University of Toronto, Toronto (Canada); Taback, Nathan [Division of Biostatistics, Dalla Lana School of Public Health, University of Toronto, Toronto (Canada); Evans, Andrew [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Pathology, University of Toronto, Toronto (Canada); Haider, Masoom A. [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Medical Imaging, University of Toronto, Toronto (Canada); Sunnybrook Health Sciences Center, Toronto (Canada); Milosevic, Michael; Bristow, Robert G.; Chung, Peter; Bayley, Andrew [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Morton, Gerard; Vesprini, Danny [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Odette Cancer Center, Sunnybrook Health Sciences Center, Toronto (Canada); Warde, Padraig; Catton, Charles [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Menard, Cynthia, E-mail: Cynthia.Menard@rmp.uhn.on.ca [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada)
2012-03-01
Purpose: Rational design of targeted radiotherapy (RT) in prostate cancer (Pca) hinges on a better understanding of spatial patterns of recurrence. We sought to identify pathological factors predictive for site of local recurrence (LR) after external beam RT. Methods and Materials: Prospective databases were reviewed to identify men with LR after RT from 1997 through 2009. Patients with biochemical failure and biopsy-confirmed Pca more than 2 years after RT were evaluated. Prediction for site of recurrence based on the following pretreatment factors was determined on independent and cluster-sextant basis: presence of malignancy, dominant vs. nondominant percentage core length (PCL) involvement, PCL {>=} or <40%, and Gleason score. Sites of dominant PCL were defined as sextants with peak PCL involvement minus 10%, and >5% for each patient. Results: Forty-one patients with low-intermediate risk Pca constituted the study cohort. Median time to biopsy after RT was 51 months (range, 24-145). Of 246 sextants, 74 were involved with tumor at baseline. When sextants are treated as independent observations the presence of malignancy (77% vs. 22%, p = 0.0001), dominant PCL (90% vs. 46%, p = 0.0001), and PCL {>=}40% (89% vs. 68 %, p = 0.04) were found to be significant predictors for LR, although PCL {>=}40% did not retain statistical significance if sextants were considered correlated. The vast majority of patients (95%) recurred at the original site of dominant PCL or PCL {>=}40%, and 44% also recurred in regions of nondominant PCL <40% (n = 8) and/or benign sampling (n = 14) at baseline. Conclusions: LR after RT predominantly occurs in regions bearing higher histological tumor burden but are not isolated to these sites. Our data highlights the value of spatially resolved baseline pathological sampling and may assist in the design of clinical trials tailoring RT dose prescriptions to subregions of the prostate gland.
Innovations in diabetic foot reconstruction using supermicrosurgery.
Suh, Hyun Suk; Oh, Tae Suk; Hong, Joon Pio
2016-01-01
The treatment of diabetic foot ulceration is complex with multiple factors involved, and it may often lead to limb amputation. Hence, a multidisciplinary approach is warranted to cover the spectrum of treatment for diabetic foot, but in complex wounds, surgical treatment is inevitable. Surgery may involve the decision to preserve the limb by reconstruction or to amputate it. Reconstruction involves preserving the limb with secure coverage. Local flaps usually are able to provide sufficient coverage for small or moderate sized wound, but for larger wounds, soft tissue coverage involves flaps that are distantly located from the wound. Reconstruction of distant flap usually involves microsurgery, and now, further innovative methods such as supermicrosurgery have further given complex wounds a better chance to be reconstructed and limbs salvaged. This article reviews the microsurgery involved in reconstruction and introduces the new method of supermicrosurgery. Copyright © 2016 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Canavan, Joycelin; Truong, Pauline T.; Smith, Sally L.; Lu, Linghong; Lesperance, Mary; Olivotto, Ivo A.
2014-01-01
Purpose: To evaluate whether local recurrence (LR) risk has changed over time among women with stage I breast cancer treated with breast-conserving therapy. Methods and Materials: Subjects were 5974 women aged ≥50 years diagnosis with pT1N0 breast cancer from 1989 to 2006, treated with breast-conserving surgery and radiation therapy. Clinicopathologic characteristics, treatment, and LR outcomes were compared among 4 cohorts stratified by year of diagnosis: 1989 to 1993 (n=1077), 1994 to 1998 (n=1633), 1999 to 2002 (n=1622), and 2003 to 2006 (n=1642). Multivariable analysis was performed, with year of diagnosis as a continuous variable. Results: Median follow-up time was 8.6 years. Among patients diagnosed in 1989 to 1993, 1994 to 1998, 1999 to 2002, and 2003 to 2006, the proportions of grade 1 tumors increased (16% vs 29% vs 40% vs 39%, respectively, P<.001). Surgical margin clearance rates increased from 82% to 93% to 95% and 88%, respectively (P<.001). Over time, the proportions of unknown estrogen receptor (ER) status decreased (29% vs 10% vs 1.2% vs 0.5%, respectively, P<.001), whereas ER-positive tumors increased (56% vs 77% vs 86% vs 86%, respectively, P<.001). Hormone therapy use increased (23% vs 23% vs 62% vs 73%, respectively, P<.001), and chemotherapy use increased (2% vs 5% vs 10% vs 13%, respectively, P<.001). The 5-year cumulative incidence rates of LR over the 4 time periods were 2.8% vs 1.7% vs 0.9% vs 0.8%, respectively (Gray's test, P<.001). On competing risk multivariable analysis, year of diagnosis was significantly associated with decreased LR (hazard ratio, 0.92 per year, P=.0003). Relative to grade 1 histology, grades 2, 3, and unknown were associated with increased LR. Hormone therapy use was associated with reduced LR. Conclusion: Significant changes in the multimodality management of stage I breast cancer have occurred over the past 2 decades. More favorable-risk tumors were diagnosed, and margin clearance and systemic therapy use
Energy Technology Data Exchange (ETDEWEB)
Canavan, Joycelin, E-mail: canavanjoycelin@gmail.com [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Truong, Pauline T.; Smith, Sally L. [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Lu, Linghong; Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, British Columbia (Canada); Olivotto, Ivo A. [Department of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary (Canada)
2014-01-01
Purpose: To evaluate whether local recurrence (LR) risk has changed over time among women with stage I breast cancer treated with breast-conserving therapy. Methods and Materials: Subjects were 5974 women aged ≥50 years diagnosis with pT1N0 breast cancer from 1989 to 2006, treated with breast-conserving surgery and radiation therapy. Clinicopathologic characteristics, treatment, and LR outcomes were compared among 4 cohorts stratified by year of diagnosis: 1989 to 1993 (n=1077), 1994 to 1998 (n=1633), 1999 to 2002 (n=1622), and 2003 to 2006 (n=1642). Multivariable analysis was performed, with year of diagnosis as a continuous variable. Results: Median follow-up time was 8.6 years. Among patients diagnosed in 1989 to 1993, 1994 to 1998, 1999 to 2002, and 2003 to 2006, the proportions of grade 1 tumors increased (16% vs 29% vs 40% vs 39%, respectively, P<.001). Surgical margin clearance rates increased from 82% to 93% to 95% and 88%, respectively (P<.001). Over time, the proportions of unknown estrogen receptor (ER) status decreased (29% vs 10% vs 1.2% vs 0.5%, respectively, P<.001), whereas ER-positive tumors increased (56% vs 77% vs 86% vs 86%, respectively, P<.001). Hormone therapy use increased (23% vs 23% vs 62% vs 73%, respectively, P<.001), and chemotherapy use increased (2% vs 5% vs 10% vs 13%, respectively, P<.001). The 5-year cumulative incidence rates of LR over the 4 time periods were 2.8% vs 1.7% vs 0.9% vs 0.8%, respectively (Gray's test, P<.001). On competing risk multivariable analysis, year of diagnosis was significantly associated with decreased LR (hazard ratio, 0.92 per year, P=.0003). Relative to grade 1 histology, grades 2, 3, and unknown were associated with increased LR. Hormone therapy use was associated with reduced LR. Conclusion: Significant changes in the multimodality management of stage I breast cancer have occurred over the past 2 decades. More favorable-risk tumors were diagnosed, and margin clearance and systemic therapy use
Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments
International Nuclear Information System (INIS)
Aharmim, B.; Sabir, A.; Marah, H.
2002-01-01
A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones
Urken, Mark L; Roche, Ansley M; Kiplagat, Kimberly J; Dewey, Eliza H; Lazarus, Cathy; Likhterov, Ilya; Buchbinder, Daniel; Okay, Devin J
2018-03-14
Palatomaxillary defects were historically restored with a prosthetic obturator; however, advances in local and free tissue transfer has provided a viable alternative for appropriately selected patients with palatomaxillary defects. A retrospective chart review of patients who underwent palatomaxillary reconstruction by the lead author between 1998 and 2016 was conducted. Patients who were restored with a palatal obturator were excluded. One hundred forty patients were reconstructed with a total of 159 local, regional, and free flaps with a 96.7% success rate. Seventy-four patients (52.8%) underwent prosthodontic rehabilitation, with 183 implants placed and an 86% success rate. Palatomaxillary reconstruction applying a systematic approach, using a multitude of techniques, is a safe and effective way to restore patients without compromising the ability to maintain surveillance. Prosthodontic rehabilitation can be achieved in a high percentage of patients using dental implants, leading to optimal aesthetic and functional results. © 2018 Wiley Periodicals, Inc.
Last, Carsten
2017-01-01
This book proposes a new approach to handle the problem of limited training data. Common approaches to cope with this problem are to model the shape variability independently across predefined segments or to allow artificial shape variations that cannot be explained through the training data, both of which have their drawbacks. The approach presented uses a local shape prior in each element of the underlying data domain and couples all local shape priors via smoothness constraints. The book provides a sound mathematical foundation in order to embed this new shape prior formulation into the well-known variational image segmentation framework. The new segmentation approach so obtained allows accurate reconstruction of even complex object classes with only a few training shapes at hand.
Reconstruction of the midface and maxilla.
Dalgorf, Dustin; Higgins, Kevin
2008-08-01
To review the current classification systems and reconstructive options available for restoration of maxillectomy defects. Defects involving the midface can have a great functional and aesthetic impact on the patient. Adequate restoration of the complex three-dimensional maxillary structure is required to replace form and function of the native tissue. An in-depth discussion of appropriate recipient vessel selection and reconstructive options are included in this article. The superficial temporal vessel system is presented as a reliable anastomosis site for restoration of midfacial defects. In addition, the complications of vein grafting, arteriovenous fistula loops and alternative recipient vessels sites are addressed to manage the challenge of the vessel-depleted neck. The current indications, advantages and disadvantages of local, regional and free-flap reconstructive options available for maxillectomy defects are highlighted in order to aid the surgeon in appropriate flap selection. A myriad of reconstructive options are available to restore maxillectomy defects. The surgeon must consider each defect and the needs of the individual patient when choosing the best suited reconstructive technique.
Energy Technology Data Exchange (ETDEWEB)
Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division
2016-08-31
Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.
International Nuclear Information System (INIS)
Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.
2016-01-01
Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.
Directory of Open Access Journals (Sweden)
Laura Villanueva-Alcojol
2011-12-01
Full Text Available El traumatismo por arma de fuego en el territorio maxilofacial constituye uno de los mayores retos a los que se enfrenta el cirujano a la hora de la reconstrucción. La diferencia esencial con otro tipo de traumatismos es la severidad de la lesión y la pérdida de tejidos óseos y blandos. Podemos encontrar en la literatura numerosos artículos sobre reconstrucción facial tras extirpación oncológica; sin embargo, hay pocos documentos que discutan la utilización de colgajos locales y libres microvascularizados para reconstrucción de defectos tras traumatismos de alta energía, y los algoritmos terapéuticos para reconstrucción postraumática. En este trabajo se presenta un caso de reconstrucción del tercio inferior facial tras intento de autolisis y se hace una revisión de los principios de tratamiento de este tipo de pacientes.Gunshot wounds to the maxillofacial region are a challenging problem for the surgeon responsible for reconstruction. The essential difference with respect to other injuries is the severity of the lesion and soft and hard tissue loss. Extensive literature exists on facial reconstruction following tumor extirpation, but there are few reports on the use of local flaps and free tissue transfer for the post-traumatic reconstruction of high-energy defects and therapeutic algorithms for post-traumatic reconstruction. The authors report the case of a patient with reconstruction of the lower third of the face after a suicide attempt and review the principles of treatment of these patients.
Prostate implant reconstruction from C-arm images with motion-compensated tomosynthesis
International Nuclear Information System (INIS)
Dehghan, Ehsan; Moradi, Mehdi; Wen, Xu; French, Danny; Lobo, Julio; Morris, W. James; Salcudean, Septimiu E.; Fichtinger, Gabor
2011-01-01
Purpose: Accurate localization of prostate implants from several C-arm images is necessary for ultrasound-fluoroscopy fusion and intraoperative dosimetry. The authors propose a computational motion compensation method for tomosynthesis-based reconstruction that enables 3D localization of prostate implants from C-arm images despite C-arm oscillation and sagging. Methods: Five C-arm images are captured by rotating the C-arm around its primary axis, while measuring its rotation angle using a protractor or the C-arm joint encoder. The C-arm images are processed to obtain binary seed-only images from which a volume of interest is reconstructed. The motion compensation algorithm, iteratively, compensates for 2D translational motion of the C-arm by maximizing the number of voxels that project on a seed projection in all of the images. This obviates the need for C-arm full pose tracking traditionally implemented using radio-opaque fiducials or external trackers. The proposed reconstruction method is tested in simulations, in a phantom study and on ten patient data sets. Results: In a phantom implanted with 136 dummy seeds, the seed detection rate was 100% with a localization error of 0.86 ± 0.44 mm (Mean ± STD) compared to CT. For patient data sets, a detection rate of 99.5% was achieved in approximately 1 min per patient. The reconstruction results for patient data sets were compared against an available matching-based reconstruction method and showed relative localization difference of 0.5 ± 0.4 mm. Conclusions: The motion compensation method can successfully compensate for large C-arm motion without using radio-opaque fiducial or external trackers. Considering the efficacy of the algorithm, its successful reconstruction rate and low computational burden, the algorithm is feasible for clinical use.
Prostate implant reconstruction from C-arm images with motion-compensated tomosynthesis
Energy Technology Data Exchange (ETDEWEB)
Dehghan, Ehsan; Moradi, Mehdi; Wen, Xu; French, Danny; Lobo, Julio; Morris, W. James; Salcudean, Septimiu E.; Fichtinger, Gabor [School of Computing, Queen' s University, Kingston, Ontario K7L-3N6 (Canada); Department of Electrical and Computer Engineering, University of British Columbia, Vancouver, British Columbia V6T-1Z4 (Canada); Vancouver Cancer Centre, Vancouver, British Columbia V5Z-1E6 (Canada); Department of Electrical and Computer Engineering, University of British Columbia, Vancouver, British Columbia V6T-1Z4 (Canada); School of Computing, Queen' s University, Kingston, Ontario K7L-3N6 (Canada)
2011-10-15
Purpose: Accurate localization of prostate implants from several C-arm images is necessary for ultrasound-fluoroscopy fusion and intraoperative dosimetry. The authors propose a computational motion compensation method for tomosynthesis-based reconstruction that enables 3D localization of prostate implants from C-arm images despite C-arm oscillation and sagging. Methods: Five C-arm images are captured by rotating the C-arm around its primary axis, while measuring its rotation angle using a protractor or the C-arm joint encoder. The C-arm images are processed to obtain binary seed-only images from which a volume of interest is reconstructed. The motion compensation algorithm, iteratively, compensates for 2D translational motion of the C-arm by maximizing the number of voxels that project on a seed projection in all of the images. This obviates the need for C-arm full pose tracking traditionally implemented using radio-opaque fiducials or external trackers. The proposed reconstruction method is tested in simulations, in a phantom study and on ten patient data sets. Results: In a phantom implanted with 136 dummy seeds, the seed detection rate was 100% with a localization error of 0.86 {+-} 0.44 mm (Mean {+-} STD) compared to CT. For patient data sets, a detection rate of 99.5% was achieved in approximately 1 min per patient. The reconstruction results for patient data sets were compared against an available matching-based reconstruction method and showed relative localization difference of 0.5 {+-} 0.4 mm. Conclusions: The motion compensation method can successfully compensate for large C-arm motion without using radio-opaque fiducial or external trackers. Considering the efficacy of the algorithm, its successful reconstruction rate and low computational burden, the algorithm is feasible for clinical use.
Directory of Open Access Journals (Sweden)
Tingting Xu
2014-01-01
Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.
Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman
2018-04-25
A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.
[Pelvic reconstructions after bone tumor resection].
Anract, Philippe; Biau, David; Babinet, Antoine; Tomeno, Bernard
2014-02-01
The three more frequent primitive malignant bone tumour which concerned the iliac bone are chondrosarcoma, following Ewing sarcoma and osteosarcoma. Wide resection remains the most important part of the treatment associated with chemotherapy for osteosarcoma and the Ewing sarcoma. Iliac wing resections and obdurate ring don't required reconstruction. However, acetabular resections and iliac wing resection with disruption of the pelvic ring required reconstruction to provide acceptable functional result. Acetabular reconstruction remains high technical demanding challenge. After isolated acetabular resection or associated to obdurate ring, our usual method of reconstruction is homolateral proximal femoral autograft and total hip prosthesis but it is possible to also used : saddle prosthesis, Mac Minn prosthesis with auto or allograft, modular prosthesis or custom made prosthesis, massive allograft with or without prosthesis and femoro-ilac arthrodesis. After resection of the iliac wing plus acetabulum, reconstruction can be performed by femoro-obturatrice and femora-sacral arthrodesis, homolateral proximal femoral autograft and prosthesis, femoral medialisation, massive allograft and massive allograft. Carcinological results are lesser than resection for distal limb tumor, local recurrence rate range 17 to 45%. Functional results after Iliac wing and obdurate ring are good. However, acetabular reconstruction provide uncertain functional results. The lesser results arrive after hemipelvic or acetabular and iliac wing resection-reconstruction, especially when gluteus muscles were also resected. The most favourable results arrive after isolated acetabular or acetabular plus obturateur ring resection-reconstruction.
The reconstruction of male hair-bearing facial regions.
Ridgway, Emily B; Pribaz, Julian J
2011-01-01
Loss of hair-bearing regions of the face caused by trauma, tumor resection, or burn presents a difficult reconstructive task for plastic surgeons. The ideal tissue substitute should have the same characteristics as the facial area affected, consisting of thin, pliable tissue with a similar color match and hair-bearing quality. This is a retrospective study of 34 male patients who underwent reconstruction of hair-bearing facial regions performed by the senior author (J.J.P.). Local and pedicled flaps were used primarily to reconstruct defects after tumor extirpation, trauma, infections, and burns. Two patients had irradiation before reconstruction. Two patients had prior facial reconstruction with free flaps. The authors found that certain techniques of reconstructing defects in hair-bearing facial regions were more successful than others in particular facial regions and in different sizes of defects. The authors were able to develop a simple algorithm for management of facial defects involving the hair-bearing regions of the eyebrow, sideburn, beard, and mustache that may prospectively aid the planning of reconstructive strategy in these cases.
Acellular dermal matrix based nipple reconstruction: A modified technique
Directory of Open Access Journals (Sweden)
Raghavan Vidya
2017-09-01
Full Text Available Nipple areolar reconstruction (NAR has evolved with the advancement in breast reconstruction and can improve self-esteem and, consequently, patient satisfaction. Although a variety of reconstruction techniques have been described in the literature varying from nipple sharing, local flaps to alloplastic and allograft augmentation, over time, loss of nipple projection remains a major problem. Acellular dermal matrices (ADM have revolutionised breast reconstruction more recently. We discuss the use of ADM to act as a base plate and strut to give support to the base and offer nipple bulk and projection in a primary procedure of NAR with a local clover shaped dermal flap in 5 breasts (4 patients. We used 5-point Likert scales (1 = highly unsatisfied, 5 = highly satisfied to assess patient satisfaction. Median age was 46 years (range: 38–55 years. Nipple projection of 8 mm, 7 mm, and 7 mms were achieved in the unilateral cases and 6 mm in the bilateral case over a median 18 month period. All patients reported at least a 4 on the Likert scale. We had no post-operative complications. It seems that nipple areolar reconstruction [NAR] using ADM can achieve nipple projection which is considered aesthetically pleasing for patients.
Block Compressed Sensing of Images Using Adaptive Granular Reconstruction
Directory of Open Access Journals (Sweden)
Ran Li
2016-01-01
Full Text Available In the framework of block Compressed Sensing (CS, the reconstruction algorithm based on the Smoothed Projected Landweber (SPL iteration can achieve the better rate-distortion performance with a low computational complexity, especially for using the Principle Components Analysis (PCA to perform the adaptive hard-thresholding shrinkage. However, during learning the PCA matrix, it affects the reconstruction performance of Landweber iteration to neglect the stationary local structural characteristic of image. To solve the above problem, this paper firstly uses the Granular Computing (GrC to decompose an image into several granules depending on the structural features of patches. Then, we perform the PCA to learn the sparse representation basis corresponding to each granule. Finally, the hard-thresholding shrinkage is employed to remove the noises in patches. The patches in granule have the stationary local structural characteristic, so that our method can effectively improve the performance of hard-thresholding shrinkage. Experimental results indicate that the reconstructed image by the proposed algorithm has better objective quality when compared with several traditional ones. The edge and texture details in the reconstructed image are better preserved, which guarantees the better visual quality. Besides, our method has still a low computational complexity of reconstruction.
Lee, Sae Byul; Lee, Jong Won; Kim, Hee Jeong; Ko, Beom Seok; Son, Byung Ho; Eom, Jin Sup; Lee, Taik Jong; Ahn, Sei-Hyun
2018-05-01
To evaluate the oncological outcomes of patients with breast cancer after nipple-sparing mastectomy (NSM)/skin-sparing mastectomy (SSM), followed by immediate reconstruction, as compared to conventional mastectomy (CM).SSM/NSM has been increasingly used to treat women with breast cancer who wish to preserve the overlying breast skin, but concern exist regarding its oncological safety due to the potential for residual breast tissue. We report our experience performing SSM/NSM for breast cancer treatment compared to CM with a long follow-up period.All consecutive patients who underwent mastectomy for breast cancer at Asan Medical Center between January 1993 and December 2008 were identified by retrospective medical chart review. The patients who underwent NSM/SSM, followed by immediate breast reconstruction with a pedicled transverse rectus abdominis musculocutaneous flap (TRAM), were compared to the patients who underwent CM in terms of breast-cancer specific survival (BCSS) rate, distant metastasis-free survival (DMFS) rate, and local recurrence (LR) rate.During the study period, 6028 patients underwent mastectomy for breast cancer. Of these, 1032 and 4996 underwent NSM/SSM with TRAM and CM, respectively. Their median follow-up durations were 94.4 (range, 8.1-220.2) and 110.8 (range, 6.1-262.0) months, respectively. Their 5 year BCSS rates were 95.4% and 88.1%, respectively (log-rank, P < .001). Their 5 year DMFS rates were 93.0% and 85.6%, respectively (log-rank, P < .001).Relative to CM, NSM/SSM, followed by immediate breast reconstruction, may be a viable and oncologically safe surgical treatment in selected patients with breast cancer.
Reconstruction of Laser-Induced Surface Topography from Electron Backscatter Diffraction Patterns.
Callahan, Patrick G; Echlin, McLean P; Pollock, Tresa M; De Graef, Marc
2017-08-01
We demonstrate that the surface topography of a sample can be reconstructed from electron backscatter diffraction (EBSD) patterns collected with a commercial EBSD system. This technique combines the location of the maximum background intensity with a correction from Monte Carlo simulations to determine the local surface normals at each point in an EBSD scan. A surface height map is then reconstructed from the local surface normals. In this study, a Ni sample was machined with a femtosecond laser, which causes the formation of a laser-induced periodic surface structure (LIPSS). The topography of the LIPSS was analyzed using atomic force microscopy (AFM) and reconstructions from EBSD patterns collected at 5 and 20 kV. The LIPSS consisted of a combination of low frequency waviness due to curtaining and high frequency ridges. The morphology of the reconstructed low frequency waviness and high frequency ridges matched the AFM data. The reconstruction technique does not require any modification to existing EBSD systems and so can be particularly useful for measuring topography and its evolution during in situ experiments.
Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner
International Nuclear Information System (INIS)
De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.
2014-01-01
An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)
International Nuclear Information System (INIS)
Abner, A.; Schnitt, S.; Connolly, J.; Recht, A.; Bornstein, B.; Nixon, A.; Hetelekidis, S.; Silver, B.; Harris, J.R.
1997-01-01
Purpose: Lobular carcinoma in situ, when found in an otherwise benign breast biopsy, is associated with an increased risk of developing a subsequent invasive breast cancer. Among patients with an infiltrating cancer resected without margin assessment, the extent of ductal carcinoma in situ is an established risk factor for LR after CS and RT. However, the association between the presence and extent of LCIS and the risk of recurrence in patients treated with CS and RT for infiltrating breast cancer remains at issue. Materials and Methods: Between 1968 and 1986, 1625 patients with clinical stage T1 and T2 invasive breast cancer were treated at the Joint Center for Radiation Therapy with complete gross tumor excision and RT to a total of ≥60 Gy. Of these, 1160 had infiltrating ductal cancer (IDC), infiltrating lobular cancer (ILC), or mixed IDC/ILC (IMC) and sufficient pathologic material for review by the study pathologists (SS and JC) to establish the presence or absence of LCIS and were evaluable at 10 years. LCIS was present adjacent to the invasive cancer in (43(1027)) IDC (4%), and either within or adjacent to the infiltrating tumor in (70(82)) ILC (85%) and (26(51)) IMC (51%). Margins were evaluable in 35% of LCIS-positive patients and 33% of LCIS-negative patients. The median follow-up time was 153 months for surviving patients. Results: The 10-year crude risk of recurrence by first site of failure for all patients was as follows: Furthermore, there was no significant relationship between the extent of the LCIS adjacent to the invasive tumor and the LR risk: The 10-year crude risk of contralateral breast cancer was 7% for the patients with LCIS and 7% for those without LCIS. CONCLUSION: We conclude that neither the presence nor the extent of LCIS is related to the risk of LR in patients with invasive breast cancer treated with CS and RT. Thus, LCIS should not be considered a contraindication to breast conservation with CS and RT
RECONSTRUCTION OF FACIAL SKIN DEFECT BY VARIOUS FLAPS : OUR EXPERIENCE
Directory of Open Access Journals (Sweden)
Atishkumar B.
2015-08-01
Full Text Available INTRODUCTION : Face represents complete personality of human being. Cosmetically it is very important part of a person especially for woman. There are many situations when due to disease or trauma, facial defect arises, which requires reconstruction by either local or distant surgical flaps . METHODS AND MATERIALS : In rural places, we come across many patients suffering from trauma and skin malignancy of face. These patients require reconstruction done esthetically with local flaps. Objective of this study is to share our exper ience of providing esthetically good results at our secondary referral care center. Hereby, we present case series of 14 patients operated at our institute. These patients were analyzed according to the age, sex, nature of injury and anatomical location of lesion on the face. All these patients were operated and reconstruction of defect was done with various local flaps best suited for respective lesion, under local anesthesia or sedation. Post - operative nature of wound was analyzed for flap viability or fl ap necrosis . RESULTS : Amongst them were 7 male and 7 female, ages ranging from 4 to 80 years. 7out of 14 patients were of basal cell carcinoma, 4 were due to trauma, 2 were due to dog bite and 1 case of recurrent pleomorphic adenoma at root of nose. All patients had excellent flap viability at end of 6 months and flap achieving almost similar color and contour as that of surrounding skin. CONCLUSION : Reconstruction of facial defects by local flaps is very easy and cost effective technique. This can be don e even at secondary referral care centre with minimal availability of facilities
Blind void filling in LR-EPONs: How efficient it can be?
Elrasad, Amr; Shihada, Basem
2015-01-01
This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.
Blind void filling in LR-EPONs: How efficient it can be?
Elrasad, Amr
2015-07-01
This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.
Energy Technology Data Exchange (ETDEWEB)
Peulen, Heike [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Mantel, Frederick [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Department of Radiation Oncology, University Hospital Zurich, Zurich (Switzerland); Guckenberger, Matthias [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Belderbos, José [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Werner-Wasik, Maria [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Hope, Andrew; Giuliani, Meredith [Department of Radiation Oncology University of Toronto and Princess Margaret Cancer Center, Toronto, Ontario (Canada); Grills, Inga [Department of Radiation Oncology Beaumont Hospital, Royal Oak, Michigan (United States); Sonke, Jan-Jakob, E-mail: j.sonke@nki.nl [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands)
2016-09-01
Purpose: Fibrotic changes after stereotactic body radiation therapy (SBRT) for stage I non-small cell lung cancer (NSCLC) are difficult to distinguish from local recurrences (LR), hampering proper patient selection for salvage therapy. This study validates previously reported high-risk computed tomography (CT) features (HRFs) for detection of LR in an independent patient cohort. Methods and Materials: From a multicenter database, 13 patients with biopsy-proven LR were matched 1:2 to 26 non-LR control patients based on dose, planning target volume (PTV), follow-up time, and lung lobe. Tested HRFs were enlarging opacity, sequential enlarging opacity, enlarging opacity after 12 months, bulging margin, linear margin disappearance, loss of air bronchogram, and craniocaudal growth. Additionally, 2 new features were analyzed: the occurrence of new unilateral pleural effusion, and growth based on relative volume, assessed by manual delineation. Results: All HRFs were significantly associated with LR except for loss of air bronchogram. The best performing HRFs were bulging margin, linear margin disappearance, and craniocaudal growth. Receiver operating characteristic analysis of the number of HRFs to detect LR had an area under the curve (AUC) of 0.97 (95% confidence interval [CI] 0.9-1.0), which was identical to the performance described in the original report. The best compromise (closest to 100% sensitivity and specificity) was found at ≥4 HRFs, with a sensitivity of 92% and a specificity of 85%. A model consisting of only 2 HRFs, bulging margin and craniocaudal growth, resulted in a sensitivity of 85% and a specificity of 100%, with an AUC of 0.96 (95% CI 0.9-1.0) (HRFs ≥2). Pleural effusion and relative growth did not significantly improve the model. Conclusion: We successfully validated CT-based HRFs for detection of LR after SBRT for early-stage NSCLC. As an alternative to number of HRFs, we propose a simplified model with the combination of the 2 best HRFs
Thörmer, Gregor; Garnov, Nikita; Moche, Michael; Haase, Jürgen; Kahn, Thomas; Busse, Harald
2012-04-01
To determine whether a greatly reduced spatial resolution of fully reconstructed projection MR images can be used for the simultaneous 3D localization of multiple MR-visible markers and to assess the feasibility of a subsecond position tracking for clinical purposes. Miniature, inductively coupled RF coils were imaged in three orthogonal planes with a balanced steady-state free precession (SSFP) sequence and automatically localized using a two-dimensional template fitting and a subsequent three-dimensional (3D) matching of the coordinates. Precision, accuracy, speed and robustness of 3D localization were assessed for decreasing in-plane resolutions (0.6-4.7 mm). The feasibility of marker tracking was evaluated at the lowest resolution by following a robotically driven needle on a complex 3D trajectory. Average 3D precision and accuracy, sensitivity and specificity of localization ranged between 0.1 and 0.4 mm, 0.5 and 1.0 mm, 100% and 95%, and 100% and 96%, respectively. At the lowest resolution, imaging and localization took ≈350 ms and provided an accuracy of ≈1.0 mm. In the tracking experiment, the needle was clearly depicted on the oblique scan planes defined by the markers. Image-based marker localization at a greatly reduced spatial resolution is considered a feasible approach to monitor reference points or rigid instruments at subsecond update rates. Copyright © 2012 Elsevier Inc. All rights reserved.
The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...
Energy Technology Data Exchange (ETDEWEB)
Pazos, Montserrat; Corradini, Stefanie; Schoenecker, Stephan; Scheithauer, Heike; Belka, Claus [LMU Munich, Department of Radiation Oncology, Munich (Germany); Dian, Darius [Mednord Munich Clinic, Munich (Germany); Bodungen, Vera von; Ditsch, Nina; Wuerstlein, Rachel; Harbeck, Nadia [LMU Munich, Breast Center, Department of Obstetrics and Gynecology, Munich (Germany)
2017-04-15
The optimal sequence of mastectomy with immediate breast reconstruction (IBR) and radiotherapy (RT) for the treatment of locally advanced breast cancer (LABC) is still under debate. Increased rates of postoperative complications are described following postmastectomy RT. Neoadjuvant RT aims to improve the aesthetic results and simplify the reconstructive pathway. A total of 22 patients diagnosed with LABC and treated with neoadjuvant RT followed by mastectomy and IBR between 04/2012 and 03/2015 were retrospectively analyzed. RT consisted of external beam RT to the breast and the regional lymphatics, if indicated. Both implant-based and autologous tissue-transfer reconstruction techniques were used. At the time of RT, 10 patients had no prior surgery and 12 patients had previously undergone breast-conserving surgery (BCS) with positive resection margins without the possibility to perform a second BCS. Additional neoadjuvant chemotherapy was administered in 18 patients prior to RT. A complete pathological response was achieved in 55.0% of patients. The 2-year overall survival rate was 89.3%, the 2-year disease-free-survival 79.8% and the local-recurrence-free survival was 95.2%. The cosmetic result was excellent or good in 66% of the patients treated with upfront mastectomy and 37% of the patients who had previously undergone BCS. Among patients who received implant-based IBR, 4 patients developed serious wound-healing problems with implant loss. The most satisfactory results were achieved with autologous tissue reconstruction. A sequential neoadjuvant chemo-/radiotherapy to allow IBR following mastectomy in selected cases of LABC seems feasible and can be safely attempted. Careful patient selection, close monitoring, and continuous patient support is mandatory to ensure compliance in this treatment strategy. (orig.) [German] Die optimale Therapiesequenz von Mastektomie mit sofortiger Brustrekonstruktion (IBR) und Radiotherapie (RT) beim lokal fortgeschrittenen
Quantitative reconstruction of past land cover in Denmark - The first results
DEFF Research Database (Denmark)
Nielsen, Anne Birgitte; Odgaard, Bent Vad
reflects a frequency change in the same direction of the mother plant may be unsubstantiated. Here, we present a first attempt at pollen based quantitative reconstruction of land cover around 9 Danish lake sites for the past 2500 years, based on models of pollen dispersal and -deposition (Prentice, 1985...... and local pollen signals at small sites, thus providing reconstructions of local vegetation around the sites. Results reflect rather stable land cover through the last 2500 years at the regional level but strong forest-open land dynamics at the local scale. The approach should be applicable to any...
Revisit of Nasolabial flap in the reconstruction of defects involving ...
African Journals Online (AJOL)
Conclusion: Data from this study suggest that NL flap is a reliable option for reconstruction of the oral floor, in form as well as function, without esthetic compromise and has a major role even in this era of free flaps. Keywords: Floor of mouth defects, local flaps, nasolabail flap, oral cavity defects, reconstruction, regional flaps ...
Detector independent cellular automaton algorithm for track reconstruction
Energy Technology Data Exchange (ETDEWEB)
Kisel, Ivan; Kulakov, Igor; Zyzak, Maksym [Goethe Univ. Frankfurt am Main (Germany); Frankfurt Institute for Advanced Studies, Frankfurt am Main (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH (Germany); Collaboration: CBM-Collaboration
2013-07-01
Track reconstruction is one of the most challenging problems of data analysis in modern high energy physics (HEP) experiments, which have to process per second of the order of 10{sup 7} events with high track multiplicity and density, registered by detectors of different types and, in many cases, located in non-homogeneous magnetic field. Creation of reconstruction package common for all experiments is considered to be important in order to consolidate efforts. The cellular automaton (CA) track reconstruction approach has been used successfully in many HEP experiments. It is very simple, efficient, local and parallel. Meanwhile it is intrinsically independent of detector geometry and good candidate for common track reconstruction. The CA implementation for the CBM experiment has been generalized and applied to the ALICE ITS and STAR HFT detectors. Tests with simulated collisions have been performed. The track reconstruction efficiencies are at the level of 95% for majority of the signal tracks for all detectors.
Implant breast reconstruction after salvage mastectomy in previously irradiated patients.
Persichetti, Paolo; Cagli, Barbara; Simone, Pierfranco; Cogliandro, Annalisa; Fortunato, Lucio; Altomare, Vittorio; Trodella, Lucio
2009-04-01
The most common surgical approach in case of local tumor recurrence after quadrantectomy and radiotherapy is salvage mastectomy. Breast reconstruction is the subsequent phase of the treatment and the plastic surgeon has to operate on previously irradiated and manipulated tissues. The medical literature highlights that breast reconstruction with tissue expanders is not a pursuable option, considering previous radiotherapy a contraindication. The purpose of this retrospective study is to evaluate the influence of previous radiotherapy on 2-stage breast reconstruction (tissue expander/implant). Only patients with analogous timing of radiation therapy and the same demolitive and reconstructive procedures were recruited. The results of this study prove that, after salvage mastectomy in previously irradiated patients, implant reconstruction is still possible. Further comparative studies are, of course, advisable to draw any conclusion on the possibility to perform implant reconstruction in previously irradiated patients.
Four-parameter analytical local model potential for atoms
International Nuclear Information System (INIS)
Fei, Yu; Jiu-Xun, Sun; Rong-Gang, Tian; Wei, Yang
2009-01-01
Analytical local model potential for modeling the interaction in an atom reduces the computational effort in electronic structure calculations significantly. A new four-parameter analytical local model potential is proposed for atoms Li through Lr, and the values of four parameters are shell-independent and obtained by fitting the results of X a method. At the same time, the energy eigenvalues, the radial wave functions and the total energies of electrons are obtained by solving the radial Schrödinger equation with a new form of potential function by Numerov's numerical method. The results show that our new form of potential function is suitable for high, medium and low Z atoms. A comparison among the new potential function and other analytical potential functions shows the greater flexibility and greater accuracy of the present new potential function. (atomic and molecular physics)
International Nuclear Information System (INIS)
Vallejo Delgado, L.R.
1989-01-01
This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)
Hongbo Guo; Xiaowei He; Muhan Liu; Zeyu Zhang; Zhenhua Hu; Jie Tian
2017-06-01
Cerenkov luminescence tomography (CLT) provides a novel technique for 3-D noninvasive detection of radiopharmaceuticals in living subjects. However, because of the severe scattering of Cerenkov light, the reconstruction accuracy and stability of CLT is still unsatisfied. In this paper, a modified weight multispectral CLT (wmCLT) reconstruction strategy was developed which split the Cerenkov radiation spectrum into several sub-spectral bands and weighted the sub-spectral results to obtain the final result. To better evaluate the property of the wmCLT reconstruction strategy in terms of accuracy, stability and practicability, several numerical simulation experiments and in vivo experiments were conducted and the results obtained were compared with the traditional multispectral CLT (mCLT) and hybrid-spectral CLT (hCLT) reconstruction strategies. The numerical simulation results indicated that wmCLT strategy significantly improved the accuracy of Cerenkov source localization and intensity quantitation and exhibited good stability in suppressing noise in numerical simulation experiments. And the comparison of the results achieved from different in vivo experiments further indicated significant improvement of the wmCLT strategy in terms of the shape recovery of the bladder and the spatial resolution of imaging xenograft tumors. Overall the strategy reported here will facilitate the development of nuclear and optical molecular tomography in theoretical study.
Long-term outcome after mastectomy with immediate breast reconstruction
DEFF Research Database (Denmark)
Stralman, K.; Mollerup, C.L.; Kristoffersen, U.S.
2008-01-01
INTRODUCTION: The purpose of this study was to investigate long term outcome for women who had undergone mastectomy and immediate breast reconstruction. MATERIAL AND METHODS: Patient files of 167 immediately reconstructed breast cancer patients were reviewed for late surgical complications....... Furthermore, information of local recurrence rate, radiotherapy and death was obtained from the Danish Breast Cancer Cooperative Group register. Histopatological high and low risk patients were compared with respect to locoregional recurrence rate, recurrence free survival and death. Unpaired t...... found no increase in the occurrence of capsular contracture in our study group in patients who received radiotherapy. CONCLUSION: Immediate breast reconstruction seems to be oncologically safe. Breast reconstruction performed with implants was associated with a higher risk of late complications...
Atmospheric inverse modeling via sparse reconstruction
Hase, Nils; Miller, Scot M.; Maaß, Peter; Notholt, Justus; Palm, Mathias; Warneke, Thorsten
2017-10-01
Many applications in atmospheric science involve ill-posed inverse problems. A crucial component of many inverse problems is the proper formulation of a priori knowledge about the unknown parameters. In most cases, this knowledge is expressed as a Gaussian prior. This formulation often performs well at capturing smoothed, large-scale processes but is often ill equipped to capture localized structures like large point sources or localized hot spots. Over the last decade, scientists from a diverse array of applied mathematics and engineering fields have developed sparse reconstruction techniques to identify localized structures. In this study, we present a new regularization approach for ill-posed inverse problems in atmospheric science. It is based on Tikhonov regularization with sparsity constraint and allows bounds on the parameters. We enforce sparsity using a dictionary representation system. We analyze its performance in an atmospheric inverse modeling scenario by estimating anthropogenic US methane (CH4) emissions from simulated atmospheric measurements. Different measures indicate that our sparse reconstruction approach is better able to capture large point sources or localized hot spots than other methods commonly used in atmospheric inversions. It captures the overall signal equally well but adds details on the grid scale. This feature can be of value for any inverse problem with point or spatially discrete sources. We show an example for source estimation of synthetic methane emissions from the Barnett shale formation.
International Nuclear Information System (INIS)
Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.
2007-01-01
Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1
Botulinum toxin in preparation of oral cavity for microsurgical reconstruction.
Corradino, Bartolo; Di Lorenzo, Sara; Mossuto, Carmela; Costa, Renato Patrizio; Moschella, Francesco
2010-01-01
Infiltration of botulinum toxin in the major salivary glands allows a temporary reduction of salivation that begins 8 days afterwards and returns to normal within 2 months. The inhibition of salivary secretion, carried out before the oral cavity reconstructive surgery, could allow a reduction of the incidence of oro-cutaneous fistulas and local complications. Saliva stagnation is a risk factor for patients who have to undergo reconstructive microsurgery of the oral cavity, because of fistula formation and local complications in the oral cavity. The authors suggest infiltration of botulinum toxin in the major salivary glands to reduce salivation temporarily during the healing stage. During the preoperative stage, 20 patients with oral cavity carcinoma who were candidates for microsurgical reconstruction underwent sialoscintigraphy and a quantitative measurement of the salivary secretion. Injection of botulinum toxin was carried out in the salivary glands 4 days before surgery. The saliva quantitative measurement was repeated 3 and 8 days after infiltration, sialoscintigraphy after 15 days. In all cases, the saliva quantitative measurement revealed a reduction of 50% and 70% of the salivary secretion after 72 h and 8 days, respectively. A lower rate of local complications was observed.
Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)
Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli
2017-06-01
The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.
International Nuclear Information System (INIS)
Xi Yun; Zhang Min; Guo Rui; Zhang Miao; Hu Jiajia; Li Biao
2012-01-01
Objective: To evaluate the accuracy and predictive value of 18 F-FDG PET or PET/CT in the assessment of neoadjuvant chemotherapy in locally advanced breast cancer by meta-analysis. Methods: Relevant studies were retrieved from PubMed, Embase, Cochrane and Wanfang, in English or Chinese. To ensure the homogeneity of all included studies, selection criteria were established and all the studies were scored according to a quality assessment of diagnostic accuracy studies (QUADAS) table. The combined Se, Sp, LR, diagnostic odds ratio (DOR), and AUC of PET and other conventional imaging techniques were compared. The assessment standard of neoadjuvant chemotherapy by conventional imaging techniques is tumor size change. Funnel plot and analysis with meta-regression were performed to explore the source of heterogeneity. Results: Sixteen eligible studies were included with a total of 662 subjects. The combined results were: (1) PET: Se PET 86.1% (247/287), Sp PET 69.6% (261/375), LR + PET 3.18, LR - PET 0.23, DOR PET 17.26; (2) Other imaging techniques: Se d 57.2% (91/159), Sp d 48.5% (50/103), LR + d 1.07, LR - d 0.87, DOR d 1.30. ROC analysis showed that Q * values of PET (Q PET * ) and other imaging techniques (Q d * ) were 0.8058 and 0.5328, respectively. Funnel plot showed that publication bias was not the main source of heterogeneity. Meta-regression results suggested that the year of publication might be one of the sources of heterogeneity (P=0.05). Conclusion: This meta-analysis suggests that, in the assessment of treatment response of neoadjuvant chemotherapy for breast cancer, FDG PET or PET/CT in monitoring the changes in glucose metabolism is more accurate than conventional imaging techniques in monitoring tumor size. (authors)
Modern principles of reconstructive surgery for advanced head and neck tumors
Kulbakin, D. E.; Choinzonov, E. L.; Mukhamedov, M. R.; Garbukov, E. U.; Shtin, V. I.; Havkin, N. M.; Vasilev, R. V.
2017-09-01
Background: Surgery remains the mainstay of treatment for head and neck cancer. Reconstruction after cancer surgery can help to restore both the appearance and function of the affected areas. Materials and methods: From 2008 to 2016, a total of 120 reconstructive surgeries were performed at the Department of Head and Neck Tumors of Tomsk Cancer Research Institute. The majority of patients had locally advanced cancer (T3 stage in 49 patients and T4 stage in 41 patients). The localizations of the defects requiring reconstruction were as follows: oral cavity—26 cases; tongue—24 cases; skin (including defects of lower lip)—12 cases; maxilla—14 cases; larynx and hypopharynx—12 cases; lips—6 cases, cheek—11 cases, and mandibulla—5 cases. Various free flaps (83%) and pedicle flaps (17%) were used for the reconstruction of the large defects following extirpation of head and neck malignant tumors. In 15 cases (13%), the implants from titanium and titanium nickelide (TiNi) were used to restore the supporting and skeletal functions of the reconstructed region. We used 3D model of the patient's skull for a more precise planning of the reconstruction of maxillofacial bone defects. Results: Good functional results were achieved in most cases. Full flap necrosis was observed in 12 cases (10%). Fibular flap necroses were noted in 8 cases (7%). Conclusions: Single-stage reconstructions of the lost structures after tumor resection significantly improve survival of head and neck cancer patients without causing significant functional and aesthetic damage, as well as contribute to quick rehabilitation of these patients and improvement of their social status. To reduce postoperative complications after reconstructive surgery, it is necessary to carefully select the appropriate reconstructive implant materials.
Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments
International Nuclear Information System (INIS)
Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.
2006-01-01
The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope
Jumping spark evaluation of α-radiograms taken on strippable LR-115 film
International Nuclear Information System (INIS)
Somogyi, G.; Hunyadi, I.; Varga, Zs.
1978-01-01
Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)
Directory of Open Access Journals (Sweden)
Ji Hwan Lee
2014-05-01
Full Text Available Background For early breast cancer patients, skin-sparing mastectomy or nipple-sparing mastectomy with sentinel lymph node biopsy has become the mainstream treatment for immediate breast reconstruction in possible cases. However, a few cases of skin necrosis caused by methylene blue dye (MBD used for sentinel lymph node localization have been reported. Methods Immediate breast reconstruction using a silicone implant was performed on 35 breasts of 34 patients after mastectomy. For sentinel lymph node localization, 1% MBD (3 mL was injected into the subareolar area. The operation site was inspected in the postoperative evaluation. Results Six cases of immediate breast reconstruction using implants were complicated by methylene blue dye. One case of local infection was improved by conservative treatment. In two cases, partial necrosis and wound dehiscence of the incision areas were observed; thus, debridement and closure were performed. Of the three cases of wide skin necrosis, two cases underwent removal of the dead tissue and implants, followed by primary closure. In the other case, the breast implant was salvaged using latissimus dorsi musculocutaneous flap reconstruction. Conclusions The complications were caused by MBD toxicity, which aggravated blood disturbance and skin tension after implant insertion. When planning immediate breast reconstruction using silicone implants, complications of MBD should be discussed in detail prior to surgery, and appropriate management in the event of complications is required.
A singular-value method for reconstruction of nonradial and lossy objects.
Jiang, Wei; Astheimer, Jeffrey; Waag, Robert
2012-03-01
Efficient inverse scattering algorithms for nonradial lossy objects are presented using singular-value decomposition to form reduced-rank representations of the scattering operator. These algorithms extend eigenfunction methods that are not applicable to nonradial lossy scattering objects because the scattering operators for these objects do not have orthonormal eigenfunction decompositions. A method of local reconstruction by segregation of scattering contributions from different local regions is also presented. Scattering from each region is isolated by forming a reduced-rank representation of the scattering operator that has domain and range spaces comprised of far-field patterns with retransmitted fields that focus on the local region. Methods for the estimation of the boundary, average sound speed, and average attenuation slope of the scattering object are also given. These methods yielded approximations of scattering objects that were sufficiently accurate to allow residual variations to be reconstructed in a single iteration. Calculated scattering from a lossy elliptical object with a random background, internal features, and white noise is used to evaluate the proposed methods. Local reconstruction yielded images with spatial resolution that is finer than a half wavelength of the center frequency and reproduces sound speed and attenuation slope with relative root-mean-square errors of 1.09% and 11.45%, respectively.
INTEGRATION OF VIDEO IMAGES AND CAD WIREFRAMES FOR 3D OBJECT LOCALIZATION
Directory of Open Access Journals (Sweden)
R. A. Persad
2012-07-01
Full Text Available The tracking of moving objects from single images has received widespread attention in photogrammetric computer vision and considered to be at a state of maturity. This paper presents a model-driven solution for localizing moving objects detected from monocular, rotating and zooming video images in a 3D reference frame. To realize such a system, the recovery of 2D to 3D projection parameters is essential. Automatic estimation of these parameters is critical, particularly for pan-tilt-zoom (PTZ surveillance cameras where parameters change spontaneously upon camera motion. In this work, an algorithm for automated parameter retrieval is proposed. This is achieved by matching linear features between incoming images from video sequences and simple geometric 3D CAD wireframe models of man-made structures. The feature matching schema uses a hypothesis-verify optimization framework referred to as LR-RANSAC. This novel method improves the computational efficiency of the matching process in comparison to the standard RANSAC robust estimator. To demonstrate the applicability and performance of the method, experiments have been performed on indoor and outdoor image sequences under varying conditions with lighting changes and occlusions. Reliability of the matching algorithm has been analyzed by comparing the automatically determined camera parameters with ground truth (GT. Dependability of the retrieved parameters for 3D localization has also been assessed by comparing the difference between 3D positions of moving image objects estimated using the LR-RANSAC-derived parameters and those computed using GT parameters.
K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)
2016-01-01
markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of
Stumpf, Camile Cesa; Biazus, Jorge Villanova; Zucatto, Fernando Schuh Ângela Erguy; Cericatto, Rodrigo; Cavalheiro, José Antônio Crespo; Damin, Andrea Pires Souto; Melo, Márcia Portela
2017-01-01
to evaluate local and systemic recurrence of breast cancer in patients submitted to autologous fat grafting in the immediate reconstruction after conservative surgery for breast cancer. this is a historical cohort study comparing 167 patients submitted to conservative surgery without reconstruction (conservative surgery group) with 27 patients submitted to conservative treatment with immediate graft reconstruction, following the Coleman's technique (lipofilling group). All patients had invasive carcinoma and were operated by a single surgeon from 2004 to 2011. The postoperative follow-up time was 36 months. the overall incidence of local recurrence was 2.4%. No patient in the lipofilling group had local recurrence during the study period. For systemic recurrence, the rates obtained were 3.7% (one patient) for the fat grafting group and 1.8% (three patients) for the conservative surgery group without reconstruction. there was no significant difference for local or systemic recurrence in the groups studied. Immediate autologous fat grafting appears to be a safe procedure. avaliar recorrência local e sistêmica do câncer de mama em pacientes submetidas ao enxerto autólogo de gordura na reconstrução imediata após cirurgia conservadora para o câncer de mama. estudo de coorte histórica em que foram comparadas 167 pacientes submetidas à cirurgia conservadora sem reconstrução com 27 pacientes submetidas ao tratamento conservador com reconstrução imediata do enxerto, seguindo técnica de Coleman. Todas as pacientes eram portadoras de carcinoma invasor e foram operadas por um único cirurgião, no período de 2004 a 2011. O tempo de acompanhamento pós-operatório foi 36 meses. a incidência global de recidiva local foi 2,4%. Nenhuma paciente do grupo de lipoenxertia apresentou recorrência local durante o período do estudo. Para recorrência sistêmica, as taxas obtidas foram de 3,7% (uma paciente) para o grupo lipoenxertia e 1,8% (três pacientes) para grupo
Investigations into the biodegradation of microcystin-LR in wastewaters
International Nuclear Information System (INIS)
Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.
2010-01-01
Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.
Development of measuring system with self-powered neutron detectors for the LR-0 reactor
International Nuclear Information System (INIS)
Erben, O.; Horinek, K.; Szasz, Z.
1989-01-01
A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs
Vishnukumar, S.; Wilscy, M.
2017-12-01
In this paper, we propose a single image Super-Resolution (SR) method based on Compressive Sensing (CS) and Improved Total Variation (TV) Minimization Sparse Recovery. In the CS framework, low-resolution (LR) image is treated as the compressed version of high-resolution (HR) image. Dictionary Training and Sparse Recovery are the two phases of the method. K-Singular Value Decomposition (K-SVD) method is used for dictionary training and the dictionary represents HR image patches in a sparse manner. Here, only the interpolated version of the LR image is used for training purpose and thereby the structural self similarity inherent in the LR image is exploited. In the sparse recovery phase the sparse representation coefficients with respect to the trained dictionary for LR image patches are derived using Improved TV Minimization method. HR image can be reconstructed by the linear combination of the dictionary and the sparse coefficients. The experimental results show that the proposed method gives better results quantitatively as well as qualitatively on both natural and remote sensing images. The reconstructed images have better visual quality since edges and other sharp details are preserved.
Directory of Open Access Journals (Sweden)
Košťál Michal
2016-01-01
Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.
On distributed wavefront reconstruction for large-scale adaptive optics systems.
de Visser, Cornelis C; Brunner, Elisabeth; Verhaegen, Michel
2016-05-01
The distributed-spline-based aberration reconstruction (D-SABRE) method is proposed for distributed wavefront reconstruction with applications to large-scale adaptive optics systems. D-SABRE decomposes the wavefront sensor domain into any number of partitions and solves a local wavefront reconstruction problem on each partition using multivariate splines. D-SABRE accuracy is within 1% of a global approach with a speedup that scales quadratically with the number of partitions. The D-SABRE is compared to the distributed cumulative reconstruction (CuRe-D) method in open-loop and closed-loop simulations using the YAO adaptive optics simulation tool. D-SABRE accuracy exceeds CuRe-D for low levels of decomposition, and D-SABRE proved to be more robust to variations in the loop gain.
Ensemble Kalman filter for the reconstruction of the Earth's mantle circulation
Bocher, Marie; Fournier, Alexandre; Coltice, Nicolas
2018-02-01
Recent advances in mantle convection modeling led to the release of a new generation of convection codes, able to self-consistently generate plate-like tectonics at their surface. Those models physically link mantle dynamics to surface tectonics. Combined with plate tectonic reconstructions, they have the potential to produce a new generation of mantle circulation models that use data assimilation methods and where uncertainties in plate tectonic reconstructions are taken into account. We provided a proof of this concept by applying a suboptimal Kalman filter to the reconstruction of mantle circulation (Bocher et al., 2016). Here, we propose to go one step further and apply the ensemble Kalman filter (EnKF) to this problem. The EnKF is a sequential Monte Carlo method particularly adapted to solve high-dimensional data assimilation problems with nonlinear dynamics. We tested the EnKF using synthetic observations consisting of surface velocity and heat flow measurements on a 2-D-spherical annulus model and compared it with the method developed previously. The EnKF performs on average better and is more stable than the former method. Less than 300 ensemble members are sufficient to reconstruct an evolution. We use covariance adaptive inflation and localization to correct for sampling errors. We show that the EnKF results are robust over a wide range of covariance localization parameters. The reconstruction is associated with an estimation of the error, and provides valuable information on where the reconstruction is to be trusted or not.
Energy Technology Data Exchange (ETDEWEB)
Haefner, Matthias Felix; Lang, Kristin; Koerber, Stefan Alexander; Debus, Juergen [University Hospital of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); National Center for Radiation Research in Oncology (NCRO), Heidelberg Institute for Radiation Oncology (HIRO), Heidelberg (Germany); Verma, Vivek [University of Nebraska Medical Center, Department of Radiation Oncology, Omaha, NE (United States); Uhlmann, Lorenz [University of Heidelberg, Institute of Medical Biometry and Informatics (IMBI), Heidelberg (Germany); Sterzing, Florian [National Center for Radiation Research in Oncology (NCRO), Heidelberg Institute for Radiation Oncology (HIRO), Heidelberg (Germany); Hospital Kempten, Department of Radiation Oncology, Kempten (Germany)
2018-02-15
Randomized trials examining neoadjuvant chemoradiotherapy followed by surgical resection (nCRT-S) and definitive CRT (dCRT) for esophageal cancer (EC) patients are hampered by use of nonstandard treatment paradigms. Outcomes of nCRT-S versus dCRT in a more common patient population are lacking. We investigated local control and survival, evaluated clinical factors associated with endpoints, and assessed patterns of failure between these cohorts. We retrospectively analyzed 130 patients with locally advanced EC receiving either dCRT or nCRT-S at our institution from 2000-2012. Inclusion criteria were curatively treated nonmetastatic EC, Karnofsky performance status ≥70%, and receipt of concomitant CRT. Patients were excluded if receiving <41 Gy neoadjuvantly or <50 Gy definitively. Kaplan-Meier analysis was used to evaluate local recurrence (LR), progression-free survival (PFS), and overall survival (OS). Univariate and multivariate Cox proportional hazards modeling addressed factors associated with outcomes. Patterns of failure were enumerated as local, regional, or distant. Mean follow-up was 34.2 months. The 3-year LR was 10.8% in the nCRT-S group and 21.5% in the dCRT group (p = 0.266). Median PFS were 15.6 and 14.9 months, respectively (p = 0.549). Median OS were 20.6 and 25.9 months, respectively (p = 0.81). On univariate and multivariate analysis, none of the investigated factors was associated with outcomes, although node-positive disease showed a trend for worse OS and PFS. Most common failures in both groups were distant (dCRT 31.2% vs. nCRT-S 21.6%) followed by local in-field recurrences (dCRT 26.9% vs. nCRT-S 10.8%). In this institutional analysis, no significant differences regarding outcomes and patterns of failure were observed between nCRT-S and dCRT. (orig.) [German] Randomisierte Studien, welche die neoadjuvante Radiochemotherapie (CRT) einschliesslich konsekutiver Operation (nCRT-S) mit der definitiven Radiochemotherapie (dCRT) fuer
Data-Driven Neural Network Model for Robust Reconstruction of Automobile Casting
Lin, Jinhua; Wang, Yanjie; Li, Xin; Wang, Lu
2017-09-01
In computer vision system, it is a challenging task to robustly reconstruct complex 3D geometries of automobile castings. However, 3D scanning data is usually interfered by noises, the scanning resolution is low, these effects normally lead to incomplete matching and drift phenomenon. In order to solve these problems, a data-driven local geometric learning model is proposed to achieve robust reconstruction of automobile casting. In order to relieve the interference of sensor noise and to be compatible with incomplete scanning data, a 3D convolution neural network is established to match the local geometric features of automobile casting. The proposed neural network combines the geometric feature representation with the correlation metric function to robustly match the local correspondence. We use the truncated distance field(TDF) around the key point to represent the 3D surface of casting geometry, so that the model can be directly embedded into the 3D space to learn the geometric feature representation; Finally, the training labels is automatically generated for depth learning based on the existing RGB-D reconstruction algorithm, which accesses to the same global key matching descriptor. The experimental results show that the matching accuracy of our network is 92.2% for automobile castings, the closed loop rate is about 74.0% when the matching tolerance threshold τ is 0.2. The matching descriptors performed well and retained 81.6% matching accuracy at 95% closed loop. For the sparse geometric castings with initial matching failure, the 3D matching object can be reconstructed robustly by training the key descriptors. Our method performs 3D reconstruction robustly for complex automobile castings.
Microsurgical reconstruction of extensive oncological scalp defects
Directory of Open Access Journals (Sweden)
Ole eGoertz
2015-09-01
Full Text Available While most small to medium defects of the scalp can be covered by local flaps, large defects or complicating factors like a history of radiotherapy often require a microsurgical reconstruction.Several factors need to be considered in such procedures. A sufficient preoperative planning is based on adequate imaging of the malignancy and a multi-disciplinary concept. Several flaps are available for such reconstructions, of which the latissimus dorsi and anterior lateral thigh flaps are the most commonly used ones.In very large defects, combined flaps such as a parascapular / latissimus dorsi flaps can be highly useful or necessary. The most commonly used recipient vessels for microsurgical scalp reconstructions are the superficial temporal vessels, but various other feasible choices exist. If the concomitant veins are not sufficient, the jugular veins represent a safe backup alternative but require a vessel interposition or long pedicle. Postoperative care and patient positioning can be difficult in these patients but can be facilitated by various devices. Overall, microsurgical reconstruction of large scalp defects is a feasible undertaking if the mentioned key factors are taken into account.
Radiation survey and management on the reconstructed radioactive work-site
International Nuclear Information System (INIS)
Yu Tao; Liang Shiqiang; Wang Youmei
2004-12-01
The experiences of radiation survey and administration in the prophase on reconstructed radioactive work-site are summarized. The advance works are to investigate the reconstructed work-site, settle working plans, devise inspecting flow charts, deal with something in time in the local and train the staffers. The works about prophasic decontaminating, removing and cleaning up the site have been finished, which have established the deep foundation to develop later task. (authors)
Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model
Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna
2016-01-01
International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...
Fast dictionary-based reconstruction for diffusion spectrum imaging.
Bilgic, Berkin; Chatnuntawech, Itthi; Setsompop, Kawin; Cauley, Stephen F; Yendiki, Anastasia; Wald, Lawrence L; Adalsteinsson, Elfar
2013-11-01
Diffusion spectrum imaging reveals detailed local diffusion properties at the expense of substantially long imaging times. It is possible to accelerate acquisition by undersampling in q-space, followed by image reconstruction that exploits prior knowledge on the diffusion probability density functions (pdfs). Previously proposed methods impose this prior in the form of sparsity under wavelet and total variation transforms, or under adaptive dictionaries that are trained on example datasets to maximize the sparsity of the representation. These compressed sensing (CS) methods require full-brain processing times on the order of hours using MATLAB running on a workstation. This work presents two dictionary-based reconstruction techniques that use analytical solutions, and are two orders of magnitude faster than the previously proposed dictionary-based CS approach. The first method generates a dictionary from the training data using principal component analysis (PCA), and performs the reconstruction in the PCA space. The second proposed method applies reconstruction using pseudoinverse with Tikhonov regularization with respect to a dictionary. This dictionary can either be obtained using the K-SVD algorithm, or it can simply be the training dataset of pdfs without any training. All of the proposed methods achieve reconstruction times on the order of seconds per imaging slice, and have reconstruction quality comparable to that of dictionary-based CS algorithm.
Directory of Open Access Journals (Sweden)
Oleh Dzyubachyk
Full Text Available In small animal imaging studies, when the locations of the micro-structures of interest are unknown a priori, there is a simultaneous need for full-body coverage and high resolution. In MRI, additional requirements to image contrast and acquisition time will often make it impossible to acquire such images directly. Recently, a resolution enhancing post-processing technique called super-resolution reconstruction (SRR has been demonstrated to improve visualization and localization of micro-structures in small animal MRI by combining multiple low-resolution acquisitions. However, when the field-of-view is large relative to the desired voxel size, solving the SRR problem becomes very expensive, in terms of both memory requirements and computation time. In this paper we introduce a novel local approach to SRR that aims to overcome the computational problems and allow researchers to efficiently explore both global and local characteristics in whole-body small animal MRI. The method integrates state-of-the-art image processing techniques from the areas of articulated atlas-based segmentation, planar reformation, and SRR. A proof-of-concept is provided with two case studies involving CT, BLI, and MRI data of bone and kidney tumors in a mouse model. We show that local SRR-MRI is a computationally efficient complementary imaging modality for the precise characterization of tumor metastases, and that the method provides a feasible high-resolution alternative to conventional MRI.
Dzyubachyk, Oleh; Khmelinskii, Artem; Plenge, Esben; Kok, Peter; Snoeks, Thomas J A; Poot, Dirk H J; Löwik, Clemens W G M; Botha, Charl P; Niessen, Wiro J; van der Weerd, Louise; Meijering, Erik; Lelieveldt, Boudewijn P F
2014-01-01
In small animal imaging studies, when the locations of the micro-structures of interest are unknown a priori, there is a simultaneous need for full-body coverage and high resolution. In MRI, additional requirements to image contrast and acquisition time will often make it impossible to acquire such images directly. Recently, a resolution enhancing post-processing technique called super-resolution reconstruction (SRR) has been demonstrated to improve visualization and localization of micro-structures in small animal MRI by combining multiple low-resolution acquisitions. However, when the field-of-view is large relative to the desired voxel size, solving the SRR problem becomes very expensive, in terms of both memory requirements and computation time. In this paper we introduce a novel local approach to SRR that aims to overcome the computational problems and allow researchers to efficiently explore both global and local characteristics in whole-body small animal MRI. The method integrates state-of-the-art image processing techniques from the areas of articulated atlas-based segmentation, planar reformation, and SRR. A proof-of-concept is provided with two case studies involving CT, BLI, and MRI data of bone and kidney tumors in a mouse model. We show that local SRR-MRI is a computationally efficient complementary imaging modality for the precise characterization of tumor metastases, and that the method provides a feasible high-resolution alternative to conventional MRI.
Directory of Open Access Journals (Sweden)
E. Zea Escamilla
2015-09-01
Full Text Available This data article presents the life cycle inventories of 20 transitional shelter solutions. The data was gathered from the reports 8 shelter designs [1]; 10 post-disaster shelter designs [2]; the environmental impact of brick production outside of Europe [3]; and the optimization of bamboo-based post-disaster housing units for tropical and subtropical regions using LCA methodologies [4]. These reports include bill of quantities, plans, performance analysis, and lifespan of the studied shelters. The data from these reports was used to develop the Life Cycle Inventories (LCI. All the amounts were converted from their original units (length, volume and amount into mass (kg units and the transport distance into ton×km. These LCIs represent the production phases of each shelter and the transportation distances for the construction materials. Two types of distances were included, local (road and international (freight ship, which were estimated based on the area of the country of study. Furthermore, the digital visualization of the shelters is presented for each of the 20 designs. Moreover, this data article presents a summary of the results for the categories Environment, Cost and Risk and the contribution to the environmental impact from the different building components of each shelter. These results are related to the article “Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs”[5
Zea Escamilla, E; Habert, G
2015-09-01
This data article presents the life cycle inventories of 20 transitional shelter solutions. The data was gathered from the reports 8 shelter designs [1]; 10 post-disaster shelter designs [2]; the environmental impact of brick production outside of Europe [3]; and the optimization of bamboo-based post-disaster housing units for tropical and subtropical regions using LCA methodologies [4]. These reports include bill of quantities, plans, performance analysis, and lifespan of the studied shelters. The data from these reports was used to develop the Life Cycle Inventories (LCI). All the amounts were converted from their original units (length, volume and amount) into mass (kg) units and the transport distance into ton×km. These LCIs represent the production phases of each shelter and the transportation distances for the construction materials. Two types of distances were included, local (road) and international (freight ship), which were estimated based on the area of the country of study. Furthermore, the digital visualization of the shelters is presented for each of the 20 designs. Moreover, this data article presents a summary of the results for the categories Environment, Cost and Risk and the contribution to the environmental impact from the different building components of each shelter. These results are related to the article "Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs"[5].
International Nuclear Information System (INIS)
Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.
1998-01-01
In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving
Septal graft in laryngeal reconstruction
International Nuclear Information System (INIS)
Bahannan, Abdulrahman; Slavicek, A.; Taudy, M.; Chovanec, M.
2006-01-01
A 62-year-old woman presented with symptoms of dyspnea. Ultrasonography and computed tomography examinations revealed mass extending from the cricoid cartilage to the left lobe of thyroid gland and thyroid cartilage. Cytology revealed possibility of cartilaginous origin, which was proven to be chondrosarcoma (Grade 1) from the biopsy specimen obtained during panendosopy. She underwent one stage radical resection and immediate reconstruction of laryngeal skeleton defect by mucocartilaginous graft from the nasal septum. Her postoperative course was optimal with preservation of the laryngeal functions. Twenty-eight months postoperatively, she had to undergo total laryngectomy as a salvage procedure for the advanced local recurrence. We report on the relatively easy technique for functional reconstruction of the large laryngeal defect with the employment cartilage graft from the nasal septum. (author)
Directory of Open Access Journals (Sweden)
Vitor Vasconcelos
2011-12-01
Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.
Nilsen, T.; Divine, D.; Rypdal, M.; Werner, J.; Rypdal, K.
2016-12-01
A modified two-dimensional stochastic-diffusive energy balance model (EBM) defined on a sphere was used for generating pseudoproxy/instrumental data and target data for surface temperature. The EBM is described in Rypdal et al. (2015). The target field has prescribed long-range memory (LRM) properties in time, and a frequency-dependent autocorrelation function in space. The Bayesian hierarchical model BARCAST, was used to generate surface temperature field reconstructions of an area corresponding to the European landmass for the past millennium. BARCAST has a built-in multivariate AR(1) model for the evolution of the temperature field, with an exponential, spatial covariance function, (Tingley & Huybers, 2010). The AR(1) process has a short-range memory, and we seek to find out how the competing spatiotemporal models influence the persistence of the reconstruction. A number of pseudoproxy experiments were performed with a fixed proxy network, using different signal-to-noise ratios (SNR) and colors of noise, (white/red). To study the persistence properties, the power-law relation of the power spectral density for LRM processes was used: S(f) f-β. The spectral exponent β was estimated both for local data and the spatial mean of the full region. The local β for the target varies between (0.1, 0.4), and for the spatial mean β 0.6. Results for the reconstructions show that the local and global memory is influenced by the noise color and level. Low noise levels or absence of noise results in reconstructions that exhibit similar properties as the target, while for higher noise levels the reconstructions have memory properties of a white/red character, (SNR=0.3 by standard deviation). Since an SNR of 0.5-0.25 is considered realistic for real proxy records, this implies that estimates of temporal persistence from proxy-based reconstructions reflect the proxy noise to a high degree, and not the signal as desired. Rypdal et al., 2015: Spatiotemporal Long-Range Persistence
On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term
International Nuclear Information System (INIS)
Heydari-Fard, Malihe
2010-01-01
The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity
Biologic collagen cylinder with skate flap technique for nipple reconstruction.
Tierney, Brian P; Hodde, Jason P; Changkuon, Daniela I
2014-01-01
A surgical technique using local tissue skate flaps combined with cylinders made from a naturally derived biomaterial has been used effectively for nipple reconstruction. A retrospective review of patients who underwent nipple reconstruction using this technique was performed. Comorbidities and type of breast reconstruction were collected. Outcome evaluation included complications, surgical revisions, and nipple projection. There were 115 skate flap reconstructions performed in 83 patients between July 2009 and January 2013. Patients ranged from 32 to 73 years old. Average body mass index was 28.0. The most common comorbidities were hypertension (39.8%) and smoking (16.9%). After breast reconstruction, 68.7% of the patients underwent chemotherapy and 20.5% underwent radiation. Seventy-one patients had immediate breast reconstruction with expanders and 12 had delayed reconstruction. The only reported complications were extrusions (3.5%). Six nipples (5.2%) in 5 patients required surgical revision due to loss of projection; two patients had minor loss of projection but did not require surgical revision. Nipple projection at time of surgery ranged from 6 to 7 mm and average projection at 6 months was 3-5 mm. A surgical technique for nipple reconstruction using a skate flap with a graft material is described. Complications are infrequent and short-term projection measurements are encouraging.
Inference-Based Surface Reconstruction of Cluttered Environments
Biggers, K.
2012-08-01
We present an inference-based surface reconstruction algorithm that is capable of identifying objects of interest among a cluttered scene, and reconstructing solid model representations even in the presence of occluded surfaces. Our proposed approach incorporates a predictive modeling framework that uses a set of user-provided models for prior knowledge, and applies this knowledge to the iterative identification and construction process. Our approach uses a local to global construction process guided by rules for fitting high-quality surface patches obtained from these prior models. We demonstrate the application of this algorithm on several example data sets containing heavy clutter and occlusion. © 2012 IEEE.
Ensemble Kalman filter for the reconstruction of the Earth's mantle circulation
Directory of Open Access Journals (Sweden)
M. Bocher
2018-02-01
Full Text Available Recent advances in mantle convection modeling led to the release of a new generation of convection codes, able to self-consistently generate plate-like tectonics at their surface. Those models physically link mantle dynamics to surface tectonics. Combined with plate tectonic reconstructions, they have the potential to produce a new generation of mantle circulation models that use data assimilation methods and where uncertainties in plate tectonic reconstructions are taken into account. We provided a proof of this concept by applying a suboptimal Kalman filter to the reconstruction of mantle circulation (Bocher et al., 2016. Here, we propose to go one step further and apply the ensemble Kalman filter (EnKF to this problem. The EnKF is a sequential Monte Carlo method particularly adapted to solve high-dimensional data assimilation problems with nonlinear dynamics. We tested the EnKF using synthetic observations consisting of surface velocity and heat flow measurements on a 2-D-spherical annulus model and compared it with the method developed previously. The EnKF performs on average better and is more stable than the former method. Less than 300 ensemble members are sufficient to reconstruct an evolution. We use covariance adaptive inflation and localization to correct for sampling errors. We show that the EnKF results are robust over a wide range of covariance localization parameters. The reconstruction is associated with an estimation of the error, and provides valuable information on where the reconstruction is to be trusted or not.
Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons
International Nuclear Information System (INIS)
Sawamura, Teruko; Yamazaki, Hatsuo
1988-01-01
This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)
Reconstruction of pressure sores with perforator-based propeller flaps.
Jakubietz, Rafael G; Jakubietz, Danni F; Zahn, Robert; Schmidt, Karsten; Meffert, Rainer H; Jakubietz, Michael G
2011-03-01
Perforator flaps have been successfully used for reconstruction of pressure sores. Although V-Y advancement flaps approximate debrided wound edges, perforator-based propeller flaps allow rotation of healthy tissue into the defect. Perforator-based propeller flaps were planned in 13 patients. Seven pressure sores were over the sacrum, five over the ischial tuberosity, and one on the tip of the scapula. Three patients were paraplegic, six were bedridden, and five were ambulatory. In three patients, no perforators were found. In 10 patients, propeller flaps were transferred. In two patients, total flap necrosis occurred, which was reconstructed with local advancement flaps. In two cases, a wound dehiscence occurred and had to be revised. One hematoma required evacuation. No further complications were noted. No recurrence at the flap site occurred. Local perforator flaps allow closure of pressure sores without harvesting muscle. The propeller version has the added benefit of transferring tissue from a distant site, avoiding reapproximation of original wound edges. Twisting of the pedicle may cause torsion and venous obstruction. This can be avoided by dissecting a pedicle of at least 3 cm. Propeller flaps are a safe option for soft tissue reconstruction of pressure sores. © Thieme Medical Publishers.
Sellbom, Martin; Bagby, R. Michael
2008-01-01
In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…
Fast Dictionary-Based Reconstruction for Diffusion Spectrum Imaging
Bilgic, Berkin; Chatnuntawech, Itthi; Setsompop, Kawin; Cauley, Stephen F.; Yendiki, Anastasia; Wald, Lawrence L.; Adalsteinsson, Elfar
2015-01-01
Diffusion Spectrum Imaging (DSI) reveals detailed local diffusion properties at the expense of substantially long imaging times. It is possible to accelerate acquisition by undersampling in q-space, followed by image reconstruction that exploits prior knowledge on the diffusion probability density functions (pdfs). Previously proposed methods impose this prior in the form of sparsity under wavelet and total variation (TV) transforms, or under adaptive dictionaries that are trained on example datasets to maximize the sparsity of the representation. These compressed sensing (CS) methods require full-brain processing times on the order of hours using Matlab running on a workstation. This work presents two dictionary-based reconstruction techniques that use analytical solutions, and are two orders of magnitude faster than the previously proposed dictionary-based CS approach. The first method generates a dictionary from the training data using Principal Component Analysis (PCA), and performs the reconstruction in the PCA space. The second proposed method applies reconstruction using pseudoinverse with Tikhonov regularization with respect to a dictionary. This dictionary can either be obtained using the K-SVD algorithm, or it can simply be the training dataset of pdfs without any training. All of the proposed methods achieve reconstruction times on the order of seconds per imaging slice, and have reconstruction quality comparable to that of dictionary-based CS algorithm. PMID:23846466
A study on image reconstruction for seed localization for permanent prostate brachytherapy
International Nuclear Information System (INIS)
Hong, Ju Young; Rah, Jeong Eun; Suh, Tae Suk
2007-01-01
This study was to design and fabricate a phantom for prostate cancer brachytherapy to validate a developed program applying a 3-film technique, and to compare it with the conventional 2-film technique for determining the location of an implanted seed. The images were obtained from overlapped seeds by randomly placing a maximum of 63 seeds in the interior-posterior (AP) position and at -30 .deg. to 30 .deg. at 15 .deg. intervals. Images obtained by use of the phantom were applied to the image processing procedure, and were then processed into the development program for seed localization. In this study, cases were set where one seed overlapped, where two seeds overlapped and where none of the three views resolved all seeds. The distance between the centers of each seed to the reference seed was calculated in a prescribed region. This distance determined the location of each seed in a given band. The location of the overlapped seeds was compared with that of the 2-film technique. With this program, the detection rate was 92.2% (at ± 15 .deg. ), 94.1% (at ± 30 .deg.) and 70.6% (compared to the use of the 2-film technique). The overlaps were caused by one or more than two seeds that overlapped; the developed program can identify the location of each seed perfectly. However, for the third case the program was not able to resolve the overlap of the seeds. This program can be used to improve treatment outcome for the brachytherapy of prostate cancer by reducing the number of errors in the process of reconstructing the locations of perfectly overlapped seeds
Hrouzek, Pavel; Štys, Dalibor; Martens, Harald
2013-01-01
Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036
Directory of Open Access Journals (Sweden)
Jan Urban
2013-01-01
Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.
Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald
2013-01-01
Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.
Energy Technology Data Exchange (ETDEWEB)
Dickie, Colleen I., E-mail: Colleen.dickie@rmp.uhn.on.ca [Radiation Medicine Program, Princess Margaret Hospital, Toronto (Canada); Griffin, Anthony M. [Division of Orthopaedic Surgery, University Musculoskeletal Oncology Unit, Mount Sinai Hospital, Toronto (Canada); University of Toronto, Toronto (Canada); Parent, Amy L. [Radiation Medicine Program, Princess Margaret Hospital, Toronto (Canada); Chung, Peter W.M.; Catton, Charles N. [Radiation Medicine Program, Princess Margaret Hospital, Toronto (Canada); University of Toronto, Toronto (Canada); Svensson, Jon [AngliaRuskin University, Cambridge (United Kingdom); Ferguson, Peter C.; Wunder, Jay S.; Bell, Robert S. [Division of Orthopaedic Surgery, University Musculoskeletal Oncology Unit, Mount Sinai Hospital, Toronto (Canada); University of Toronto, Toronto (Canada); Sharpe, Michael B.; O' Sullivan, Brian [Radiation Medicine Program, Princess Margaret Hospital, Toronto (Canada); University of Toronto, Toronto (Canada)
2012-03-15
Purpose: To examine the geometric relationship between local recurrence (LR) and external beam radiotherapy (RT) volumes for soft-tissue sarcoma (STS) patients treated with function-preserving surgery and RT. Methods and Materials: Sixty of 768 (7.8%) STS patients treated with combined therapy within our institution from 1990 through 2006 developed an LR. Thirty-two received preoperative RT, 16 postoperative RT, and 12 preoperative RT plus a postoperative boost. Treatment records, RT simulation images, and diagnostic MRI/CT data sets of the original and LR disease were retrospectively compared. For LR location analysis, three RT target volumes were defined according to the International Commission on Radiation Units and Measurements 29 as follows: (1) the gross tumor or operative bed; (2) the treatment volume (TV) extending 5 cm longitudinally beyond the tumor or operative bed unless protected by intact barriers to spread and at least 1-2 cm axially (the TV was enclosed by the isodose curve representing the prescribed target absorbed dose [TAD] and accounted for target/patient setup uncertainty and beam characteristics), and (3) the irradiated volume (IRV) that received at least 50% of the TAD, including the TV. LRs were categorized as developing in field within the TV, marginal (on the edge of the IRV), and out of field (occurring outside of the IRV). Results: Forty-nine tumors relapsed in field (6.4% overall). Nine were out of field (1.1% overall), and 2 were marginal (0.3% overall). Conclusions: The majority of STS tumors recur in field, indicating that the incidence of LR may be affected more by differences in biologic and molecular characteristics rather than aberrations in RT dose or target volume coverage. In contrast, only two patients relapsed at the IRV boundary, suggesting that the risk of a marginal relapse is low when the TV is appropriately defined. These data support the accurate delivery of optimal RT volumes in the most precise way using advanced
International Nuclear Information System (INIS)
Dickie, Colleen I.; Griffin, Anthony M.; Parent, Amy L.; Chung, Peter W.M.; Catton, Charles N.; Svensson, Jon; Ferguson, Peter C.; Wunder, Jay S.; Bell, Robert S.; Sharpe, Michael B.; O’Sullivan, Brian
2012-01-01
Purpose: To examine the geometric relationship between local recurrence (LR) and external beam radiotherapy (RT) volumes for soft-tissue sarcoma (STS) patients treated with function-preserving surgery and RT. Methods and Materials: Sixty of 768 (7.8%) STS patients treated with combined therapy within our institution from 1990 through 2006 developed an LR. Thirty-two received preoperative RT, 16 postoperative RT, and 12 preoperative RT plus a postoperative boost. Treatment records, RT simulation images, and diagnostic MRI/CT data sets of the original and LR disease were retrospectively compared. For LR location analysis, three RT target volumes were defined according to the International Commission on Radiation Units and Measurements 29 as follows: (1) the gross tumor or operative bed; (2) the treatment volume (TV) extending 5 cm longitudinally beyond the tumor or operative bed unless protected by intact barriers to spread and at least 1–2 cm axially (the TV was enclosed by the isodose curve representing the prescribed target absorbed dose [TAD] and accounted for target/patient setup uncertainty and beam characteristics), and (3) the irradiated volume (IRV) that received at least 50% of the TAD, including the TV. LRs were categorized as developing in field within the TV, marginal (on the edge of the IRV), and out of field (occurring outside of the IRV). Results: Forty-nine tumors relapsed in field (6.4% overall). Nine were out of field (1.1% overall), and 2 were marginal (0.3% overall). Conclusions: The majority of STS tumors recur in field, indicating that the incidence of LR may be affected more by differences in biologic and molecular characteristics rather than aberrations in RT dose or target volume coverage. In contrast, only two patients relapsed at the IRV boundary, suggesting that the risk of a marginal relapse is low when the TV is appropriately defined. These data support the accurate delivery of optimal RT volumes in the most precise way using advanced
Quantitative SPECT reconstruction of iodine-123 data
International Nuclear Information System (INIS)
Gilland, D.R.; Jaszczak, R.J.; Greer, K.L.; Coleman, R.E.
1991-01-01
Many clinical and research studies in nuclear medicine require quantitation of iodine-123 ( 123 I) distribution for the determination of kinetics or localization. The objective of this study was to implement several reconstruction methods designed for single-photon emission computed tomography (SPECT) using 123 I and to evaluate their performance in terms of quantitative accuracy, image artifacts, and noise. The methods consisted of four attenuation and scatter compensation schemes incorporated into both the filtered backprojection/Chang (FBP) and maximum likelihood-expectation maximization (ML-EM) reconstruction algorithms. The methods were evaluated on data acquired of a phantom containing a hot sphere of 123 I activity in a lower level background 123 I distribution and nonuniform density media. For both reconstruction algorithms, nonuniform attenuation compensation combined with either scatter subtraction or Metz filtering produced images that were quantitatively accurate to within 15% of the true value. The ML-EM algorithm demonstrated quantitative accuracy comparable to FBP and smaller relative noise magnitude for all compensation schemes
Volumetric localization of somatosensory cortex in children using synthetic aperture magnetometry
International Nuclear Information System (INIS)
Xiang, Jing; Holowka, Stephanie; Chuang, Sylvester; Sharma, Rohit; Hunjan, Amrita; Otsubo, Hiroshi
2003-01-01
Magnetic signal from the human brain can be measured noninvasively by using magnetoencephalography (MEG). This study was designed to localize and reconstruct the neuromagnetic activity in the somatosensory cortex in children Twenty children were studied using a 151-channel MEG system with electrical stimulation applied to median nerves. Data were analyzed using synthetic aperture magnetometry (SAM). A clear deflection (M1) was clearly identified in 18 children (90%, 18/20). Two frequency bands, 30-60 Hz and 60-120 Hz, were found to be related to somatosensory cortex. Magnetic activity was localized in the posterior bank of the central sulcus in 16 children. The extent of the reconstructed neuromagnetic activity of the left hemisphere was significantly larger than that of the right hemisphere (P<0.01). Somatosensory cortex was accurately localized by using SAM. The extent of the reconstructed neuromagnetic activity suggested that the left hemisphere was the dominant side in the somatosensory system in children. We postulate that the volumetric characteristics of the reconstructed neuromagnetic activity are able to indicate the functionality of the brain. (orig.)
Validation of Magnetic Reconstruction Codes for Real-Time Applications
International Nuclear Information System (INIS)
Mazon, D.; Murari, A.; Boulbe, C.; Faugeras, B.; Blum, J.; Svensson, J.; Quilichini, T.; Gelfusa, M.
2010-01-01
The real-time reconstruction of the plasma magnetic equilibrium in a tokamak is a key point to access high-performance regimes. Indeed, the shape of the plasma current density profile is a direct output of the reconstruction and has a leading effect for reaching a steady-state high-performance regime of operation. The challenge is thus to develop real-time methods and algorithms that reconstruct the magnetic equilibrium from the perspective of using these outputs for feedback control purposes. In this paper the validation of the JET real-time equilibrium reconstruction codes using both a Bayesian approach and a full equilibrium solver named Equinox will be detailed, the comparison being performed with the off-line equilibrium code EFIT (equilibrium fitting) or the real-time boundary reconstruction code XLOC (X-point local expansion). In this way a significant database, a methodology, and a strategy for the validation are presented. The validation of the results has been performed using a validated database of 130 JET discharges with a large variety of magnetic configurations. Internal measurements like polarimetry and motional Stark effect have been also used for the Equinox validation including some magnetohydrodynamic signatures for the assessment of the reconstructed safety profile and current density. (authors)
Energy Technology Data Exchange (ETDEWEB)
Freitag, Martin T. [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); Clinical Cooperation Unit Nuclear Medicine, German Cancer Research Center, Heidelberg (Germany); Radtke, Jan P. [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); University Hospital Heidelberg, Department of Urology, Heidelberg (Germany); Afshar-Oromieh, Ali; Flechsig, Paul; Giesel, Frederik; Haberkorn, Uwe [University Hospital Heidelberg, Department of Nuclear Medicine, Heidelberg (Germany); Roethke, Matthias C.; Bonekamp, David; Schlemmer, Heinz-Peter [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); Hadaschik, Boris A.; Hohenfellner, Markus [University Hospital Heidelberg, Department of Urology, Heidelberg (Germany); Gleave, Martin [University of British Columbia, The Vancouver Prostate Centre, Vancouver (Canada); Kopka, Klaus; Eder, Matthias [Division of Radiopharmaceutical Chemistry, German Cancer Research Center, Heidelberg (Germany); Heusser, Thorsten; Kachelriess, Marc [Department of Medical Physics in Radiology, German Cancer Research Center, Heidelberg (Germany); Wieczorek, Kathrin [University Hospital Heidelberg, Institute of Pathology, Heidelberg (Germany); Sachpekidis, Christos; Dimitrakopoulou-Strauss, A. [Clinical Cooperation Unit Nuclear Medicine, German Cancer Research Center, Heidelberg (Germany)
2017-05-15
The positron emission tomography (PET) tracer {sup 68}Ga-PSMA-11, targeting the prostate-specific membrane antigen (PSMA), is rapidly excreted into the urinary tract. This leads to significant radioactivity in the bladder, which may limit the PET-detection of local recurrence (LR) of prostate cancer (PC) after radical prostatectomy (RP), developing in close proximity to the bladder. Here, we analyze if there is additional value of multi-parametric magnetic resonance imaging (mpMRI) compared to the {sup 68}Ga-PSMA-11-PET-component of PET/CT or PET/MRI to detect LR. One hundred and nineteen patients with biochemical recurrence after prior RP underwent both hybrid {sup 68}Ga-PSMA-11-PET/CT{sub low-dose} (1 h p.i.) and -PET/MRI (2-3 h p.i.) including a mpMRI protocol of the prostatic bed. The comparison of both methods was restricted to the abdomen with focus on LR (McNemar). Bladder-LR distance and recurrence size were measured in axial T2w-TSE. A logistic regression was performed to determine the influence of these variables on detectability in {sup 68}Ga-PSMA-11-PET. Standardized-uptake-value (SUV{sub mean}) quantification of LR was performed. There were 93/119 patients that had at least one pathologic finding. In addition, 18/119 Patients (15.1%) were diagnosed with a LR in mpMRI of PET/MRI but only nine were PET-positive in PET/CT and PET/MRI. This mismatch was statistically significant (p = 0.004). Detection of LR using the PET-component was significantly influenced by proximity to the bladder (p = 0.028). The PET-pattern of LR-uptake was classified into three types (1): separated from bladder; (2): fuses with bladder, and (3): obliterated by bladder. The size of LRs did not affect PET-detectability (p = 0.84), mean size was 1.7 ± 0.69 cm long axis, 1.2 ± 0.46 cm short-axis. SUV{sub mean} in nine men was 8.7 ± 3.7 (PET/CT) and 7.0 ± 4.2 (PET/MRI) but could not be quantified in the remaining nine cases (obliterated by bladder). The present study demonstrates
Biologic Collagen Cylinder with Skate Flap Technique for Nipple Reconstruction
Directory of Open Access Journals (Sweden)
Brian P. Tierney
2014-01-01
Full Text Available A surgical technique using local tissue skate flaps combined with cylinders made from a naturally derived biomaterial has been used effectively for nipple reconstruction. A retrospective review of patients who underwent nipple reconstruction using this technique was performed. Comorbidities and type of breast reconstruction were collected. Outcome evaluation included complications, surgical revisions, and nipple projection. There were 115 skate flap reconstructions performed in 83 patients between July 2009 and January 2013. Patients ranged from 32 to 73 years old. Average body mass index was 28.0. The most common comorbidities were hypertension (39.8% and smoking (16.9%. After breast reconstruction, 68.7% of the patients underwent chemotherapy and 20.5% underwent radiation. Seventy-one patients had immediate breast reconstruction with expanders and 12 had delayed reconstruction. The only reported complications were extrusions (3.5%. Six nipples (5.2% in 5 patients required surgical revision due to loss of projection; two patients had minor loss of projection but did not require surgical revision. Nipple projection at time of surgery ranged from 6 to 7 mm and average projection at 6 months was 3–5 mm. A surgical technique for nipple reconstruction using a skate flap with a graft material is described. Complications are infrequent and short-term projection measurements are encouraging.
Discussion of Source Reconstruction Models Using 3D MCG Data
Melis, Massimo De; Uchikawa, Yoshinori
In this study we performed the source reconstruction of magnetocardiographic signals generated by the human heart activity to localize the site of origin of the heart activation. The localizations were performed in a four compartment model of the human volume conductor. The analyses were conducted on normal subjects and on a subject affected by the Wolff-Parkinson-White syndrome. Different models of the source activation were used to evaluate whether a general model of the current source can be applied in the study of the cardiac inverse problem. The data analyses were repeated using normal and vector component data of the MCG. The results show that a distributed source model has the better accuracy in performing the source reconstructions, and that 3D MCG data allow finding smaller differences between the different source models.
Nonlocal Regularized Algebraic Reconstruction Techniques for MRI: An Experimental Study
Directory of Open Access Journals (Sweden)
Xin Li
2013-01-01
Full Text Available We attempt to revitalize researchers' interest in algebraic reconstruction techniques (ART by expanding their capabilities and demonstrating their potential in speeding up the process of MRI acquisition. Using a continuous-to-discrete model, we experimentally study the application of ART into MRI reconstruction which unifies previous nonuniform-fast-Fourier-transform- (NUFFT- based and gridding-based approaches. Under the framework of ART, we advocate the use of nonlocal regularization techniques which are leveraged from our previous research on modeling photographic images. It is experimentally shown that nonlocal regularization ART (NR-ART can often outperform their local counterparts in terms of both subjective and objective qualities of reconstructed images. On one real-world k-space data set, we find that nonlocal regularization can achieve satisfactory reconstruction from as few as one-third of samples. We also address an issue related to image reconstruction from real-world k-space data but overlooked in the open literature: the consistency of reconstructed images across different resolutions. A resolution-consistent extension of NR-ART is developed and shown to effectively suppress the artifacts arising from frequency extrapolation. Both source codes and experimental results of this work are made fully reproducible.
Nasoseptal flap for palatal reconstruction after hemi-maxillectomy: case report.
Alwashahi, M K; Battaglia, P; Turri-Zanoni, M; Castelnuovo, P
2018-01-01
Palatal reconstruction following maxillectomy is a surgical challenge, and a nasoseptal flap is a feasible approach. This paper reports the first known successful clinical case of a nasoseptal pedicle flap applied for the reconstruction of maxillary bone following hemi-maxillectomy. This report describes hemi-maxillectomy in a 60-year-old Italian male diagnosed with stage IV squamous cell carcinoma of the left maxilla. Endoscopic transnasal extended medial maxillectomy was performed, followed by a transoral modified midfacial degloving technique for removal of the maxillary bone. The contralateral nasoseptal pedicle flap was used to reconstruct the defect. The case was followed up prospectively for the assessment of flap reception and healing. The locally accessible nasoseptal flap is a viable alternative for palatal reconstruction; therefore, a second surgical procedure with its associated donor site morbidity can be avoided. Large-scale studies may help in establishing the cosmetic and functional outcomes.
Directory of Open Access Journals (Sweden)
Vanessa de Farias
2009-06-01
Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced
Do our reconstructions of ENSO have too much low-frequency variability?
Loope, G. R.; Overpeck, J. T.
2017-12-01
Reconstructing the spectrum of Pacific SST variability has proven to be difficult both because of complications with proxy systems such as tree rings and the relatively small number of records from the tropical Pacific. We show that the small number of long coral δ18O and Sr/Ca records has caused a bias towards having too much low-frequency variability in PCR, CPS, and RegEM reconstructions of Pacific variability. This occurs because the individual coral records used in the reconstructions have redder spectra than the shared signal (e.g. ENSO). This causes some of the unshared, low-frequency signal from local climate, salinity and possibly coral biology to bleed into the reconstruction. With enough chronologies in a reconstruction, this unshared noise cancels out but the problem is exacerbated in our longest reconstructions where fewer records are available. Coral proxies tend to have more low-frequency variability than SST observations so this problem is smaller but can still be seen in pseudoproxy experiments using observations and reanalysis data. The identification of this low-frequency bias in coral reconstructions helps bring the spectra of ENSO reconstructions back into line with both models and observations. Although our analysis is mostly constrained to the 20th century due to lack of sufficient data, we expect that as more long chronologies are developed, the low-frequency signal in ENSO reconstructions will be greatly reduced.
Jacobs, Loraine Cristina do Valle
2011-01-01
Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...
Stepladder Reconstructive Options in Post-Ablative Complex Surgical Defects in the Head and Neck
International Nuclear Information System (INIS)
EL MARAKBY, H.H.; NAGUIB, Sh.F.; EL-SAWY, A.F.; AMIN, A.A.
2008-01-01
Background: Reconstruction of head and neck defects can pose many challenges to the reconstructive head and neck surgeon. Achieving the best cosmetic and functional results without compromising the safety of oncologic surgery are the primary reconstructive goals. Speech and articulation are particularly important in oral reconstructive procedures. In addition, preservation of the integrity and function of the donor sites should always be considered in all reconstructive procedures. Aim of the Study: The aim of the study is to evaluate different reconstructive options in complex defects of the head and neck region after resection of malignant tumours. The feasibility of the reconstructive ladder starting from simple techniques such as local flaps and skin grafts up to free flaps will be assessed. Patients and Methods: In this study we evaluated different reconstructive procedures used in 50 patients with complex head and neck defects undertaken at the department of surgery at the National Cancer Institute between July 2003 and December 2007. Results: The average age of patients was 52 years and the range was 26-67 years. Most of the tumours were either squamous cell carcinoma (74%) or Basal cell carcinoma (20%). Tumour sites included the nose (6%), lip (10%), cheek (12%) scalp (6%) as well as mucosal defects of the oral cavity (40%) and the hypopharynx (20%). We used local flaps and skin grafts in reconstruction in 36% of cases and pedicled flaps in 32% while free flaps were used in 32% of cases. Complications occurred in 32% of patients of which total flaps loss constituted 6% and partial flap loss 4%. Minor complications such as oro-cutaneous fistulae, wound infection, seroma and haematoma were noticed in 22% and all of them were treated conservatively. The final functional and aesthetic results were satisfactory in 60% of cases while poor results were encountered in patients who suffered some degree of flap loss.
Anesthesia Approach in Endovascular Aortic Reconstruction
Directory of Open Access Journals (Sweden)
Ayşin Alagöl
2013-03-01
Full Text Available Introduction: We have analyzed our initial results of our anesthesia techniques in our new-onset endovascular aortic reconstruction cases.Patients and Methods: The perioperative data of 15 elective and emergent endovascular aortic reconstruction cases that were operated in 2010-2011 were collected in a database. The choice of anesthesia was made by the risk factors, surgical team’s preferences, type and location of the aortic pathology and by the predicted operation duration. The data of local and general anesthesia cases were compared.Results: Thirteen (86.7% cases were male and 2 (13.3% female. Eleven patients were in ASA Class III. The demographic parameters, ASA classifications, concurrent diseases were similar in both groups. Thirteen (86.7% cases had infrarenal abdominal aortic aneurysm and 2 (13.3% had Type III aortic dissection. The diastolic arterial pressures were lower in general anesthesia group in 20th and 40th minutes’ measurements just like the mean arterial pressure measurements at the 40th, 100th minutes and during the deployment of the graft. Postoperative mortality occurred in 3 (20.0% patients and they all had general anesthesia and they were operated on emergency basis. Postoperative morbidity occurred in four patients that had general anesthesia (acute renal failure, multi-organ failure and pneumonia. The other patient had atrial fibrillation on the 1st postoperative day and was converted to sinus rhythm with amiodarone infusion.Conclusion: Edovascular aortic reconstruction procedures can safely be performed with both general and local anesthesia less invasively compared to open surgery. General anesthesia may be preferred for the better hemodynamic control.
Zhang, Lingli; Zeng, Li; Guo, Yumeng
2018-03-15
Restricted by the scanning environment in some CT imaging modalities, the acquired projection data are usually incomplete, which may lead to a limited-angle reconstruction problem. Thus, image quality usually suffers from the slope artifacts. The objective of this study is to first investigate the distorted domains of the reconstructed images which encounter the slope artifacts and then present a new iterative reconstruction method to address the limited-angle X-ray CT reconstruction problem. The presented framework of new method exploits the structural similarity between the prior image and the reconstructed image aiming to compensate the distorted edges. Specifically, the new method utilizes l0 regularization and wavelet tight framelets to suppress the slope artifacts and pursue the sparsity. New method includes following 4 steps to (1) address the data fidelity using SART; (2) compensate for the slope artifacts due to the missed projection data using the prior image and modified nonlocal means (PNLM); (3) utilize l0 regularization to suppress the slope artifacts and pursue the sparsity of wavelet coefficients of the transformed image by using iterative hard thresholding (l0W); and (4) apply an inverse wavelet transform to reconstruct image. In summary, this method is referred to as "l0W-PNLM". Numerical implementations showed that the presented l0W-PNLM was superior to suppress the slope artifacts while preserving the edges of some features as compared to the commercial and other popular investigative algorithms. When the image to be reconstructed is inconsistent with the prior image, the new method can avoid or minimize the distorted edges in the reconstructed images. Quantitative assessments also showed that applying the new method obtained the highest image quality comparing to the existing algorithms. This study demonstrated that the presented l0W-PNLM yielded higher image quality due to a number of unique characteristics, which include that (1) it utilizes
Learning-based compressed sensing for infrared image super resolution
Zhao, Yao; Sui, Xiubao; Chen, Qian; Wu, Shaochi
2016-05-01
This paper presents an infrared image super-resolution method based on compressed sensing (CS). First, the reconstruction model under the CS framework is established and a Toeplitz matrix is selected as the sensing matrix. Compared with traditional learning-based methods, the proposed method uses a set of sub-dictionaries instead of two coupled dictionaries to recover high resolution (HR) images. And Toeplitz sensing matrix allows the proposed method time-efficient. Second, all training samples are divided into several feature spaces by using the proposed adaptive k-means classification method, which is more accurate than the standard k-means method. On the basis of this approach, a complex nonlinear mapping from the HR space to low resolution (LR) space can be converted into several compact linear mappings. Finally, the relationships between HR and LR image patches can be obtained by multi-sub-dictionaries and HR infrared images are reconstructed by the input LR images and multi-sub-dictionaries. The experimental results show that the proposed method is quantitatively and qualitatively more effective than other state-of-the-art methods.
Emission computerized-tomography and determination of local brain function
International Nuclear Information System (INIS)
Kuhl, D.E.; Alavi, A.; Reivich, M.; Edwards, R.Q.; Fenton, C.A.; Zimmerman, R.A.
1975-01-01
Methods for the three dimensional reconstruction of /sup 99m/Tc brain scans are described. The diagnostic advantages of computerized tomography in the localization of brain tumors and in measurements of local cerebral blood flow are discussed. (U.S.)
Linear single-step image reconstruction in the presence of nonscattering regions
Dehghani, H.; Delpy, D. T.
2002-06-01
There is growing interest in the use of near-infrared spectroscopy for the noninvasive determination of the oxygenation level within biological tissue. Stemming from this application, there has been further research in using this technique for obtaining tomographic images of the neonatal head, with the view of determining the level of oxygenated and deoxygenated blood within the brain. Because of computational complexity, methods used for numerical modeling of photon transfer within tissue have usually been limited to the diffusion approximation of the Boltzmann transport equation. The diffusion approximation, however, is not valid in regions of low scatter, such as the cerebrospinal fluid. Methods have been proposed for dealing with nonscattering regions within diffusing materials through the use of a radiosity-diffusion model. Currently, this new model assumes prior knowledge of the void region; therefore it is instructive to examine the errors introduced in applying a simple diffusion-based reconstruction scheme in cases where a nonscattering region exists. We present reconstructed images, using linear algorithms, of models that contain a nonscattering region within a diffusing material. The forward data are calculated by using the radiosity-diffusion model, and the inverse problem is solved by using either the radiosity-diffusion model or the diffusion-only model. When using data from a model containing a clear layer and reconstructing with the correct model, one can reconstruct the anomaly, but the qualitative accuracy and the position of the reconstructed anomaly depend on the size and the position of the clear regions. If the inverse model has no information about the clear regions (i.e., it is a purely diffusing model), an anomaly can be reconstructed, but the resulting image has very poor qualitative accuracy and poor localization of the anomaly. The errors in quantitative and localization accuracies depend on the size and location of the clear regions.
Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar
2017-01-01
In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1 protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.
Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...
DEFF Research Database (Denmark)
Gunnarsson, Gudjon L.; Demmissie, Meheret Beferkadu; Havemann, Ingemar
2017-01-01
Total loss of the lower lip is debilitating and poses a reconstructive challenge. Aiming to restore oral continence and function and also cosmetic appearance, a successful reconstruction has a huge impact on the quality of life for the individual patient. Early sources of local tissue rearrangement...
Robust, Efficient Depth Reconstruction With Hierarchical Confidence-Based Matching.
Sun, Li; Chen, Ke; Song, Mingli; Tao, Dacheng; Chen, Gang; Chen, Chun
2017-07-01
In recent years, taking photos and capturing videos with mobile devices have become increasingly popular. Emerging applications based on the depth reconstruction technique have been developed, such as Google lens blur. However, depth reconstruction is difficult due to occlusions, non-diffuse surfaces, repetitive patterns, and textureless surfaces, and it has become more difficult due to the unstable image quality and uncontrolled scene condition in the mobile setting. In this paper, we present a novel hierarchical framework with multi-view confidence-based matching for robust, efficient depth reconstruction in uncontrolled scenes. Particularly, the proposed framework combines local cost aggregation with global cost optimization in a complementary manner that increases efficiency and accuracy. A depth map is efficiently obtained in a coarse-to-fine manner by using an image pyramid. Moreover, confidence maps are computed to robustly fuse multi-view matching cues, and to constrain the stereo matching on a finer scale. The proposed framework has been evaluated with challenging indoor and outdoor scenes, and has achieved robust and efficient depth reconstruction.
Macrodystrophia lipomatosa: a reconstructive approach to gigantism of the foot.
Watt, Andrew J; Chung, Kevin C
2004-01-01
Localized gigantism poses a challenging surgical dilemma, and it may be treated with amputation. This case report documents the application of a reconstructive approach to a severe case of pedal macrodystrophia lipomatosa in a 1-year-old girl. A series of 3 surgeries were designed to reduce the length, width, height, and overall bulk of the congenitally enlarged foot. The 3 procedures debulked the foot for normal ambulation and same-size shoe wear for both feet. The resulting functional and aesthetic improvements achieved through reconstructive treatment provided a desirable alternative to amputation.
Kelsey, Chris R; Higgins, Kristin A; Peterson, Bercedis L; Chino, Junzo P; Marks, Lawrence B; D'Amico, Thomas A; Varlotto, John M
2013-10-01
To define subgroups at high risk of local recurrence (LR) after surgery for non-small cell lung cancer using a recursive partitioning analysis (RPA). This Institutional Review Board-approved study included patients who underwent upfront surgery for I-IIIA non-small cell lung cancer at Duke Cancer Institute (primary set) or at other participating institutions (validation set). The 2 data sets were analyzed separately and identically. Disease recurrence at the surgical margin, ipsilateral hilum, and/or mediastinum was considered an LR. Recursive partitioning was used to build regression trees for the prediction of local recurrence-free survival (LRFS) from standard clinical and pathological factors. LRFS distributions were estimated with the Kaplan-Meier method. The 1411 patients in the primary set had a 5-year LRFS rate of 77% (95% confidence interval [CI], 0.74-0.81), and the 889 patients in the validation set had a 5-year LRFS rate of 76% (95% CI, 0.72-0.80). The RPA of the primary data set identified 3 terminal nodes based on stage and histology. These nodes and their 5-year LRFS rates were as follows: (1) stage I/adenocarcinoma, 87% (95% CI, 0.83-0.90); (2) stage I/squamous or large cell, 72% (95% CI, 0.65-0.79); and (3) stage II-IIIA, 62% (95% CI, 0.55-0.69). The validation RPA identified 3 terminal nodes based on lymphovascular invasion (LVI) and stage: (1) no LVI/stage IA, 82% (95% CI, 0.76-0.88); (2) no LVI/stage IB-IIIA, 73% (95% CI, 0.69-0.80); and (3) LVI, 58% (95% CI, 0.47-0.69). The risk of LR was similar in the primary and validation patient data sets. There was discordance between the 2 data sets regarding the clinical factors that best segregate patients into risk groups. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.
Giant basal cell carcinoma of the face: surgical management and challenges for reconstruction.
Maimaiti, A; Mijiti, A; Yarbag, A; Moming, A
2016-02-01
Giant basal cell carcinoma, in which the tumour measures 5 cm or greater in diameter, is a very rare skin malignancy that accounts for less than 1 per cent of all basal cell tumours. Very few studies have reported on the incidence, resection and reconstruction of this lesion worldwide. In total, 17 patients with giant basal cell carcinoma of the head and neck region underwent surgical excision and reconstruction at our hospital. Medical charts were retrospectively reviewed and analysed. The lesion was usually in the forehead, eyelid, lips or nasal-cheek region. The greatest diameter ranged from 5 to 11 cm, with 5-6 cm being the most common size at the time of presentation. All patients had their tumour resected and reconstructed in a single-stage procedure, mostly with a local advancement flap, and with no post-operative flap failure. Giant basal cell carcinoma of the head and neck can be successfully treated with a local flap in a single-stage approach.
Stochastic Optical Reconstruction Microscopy (STORM).
Xu, Jianquan; Ma, Hongqiang; Liu, Yang
2017-07-05
Super-resolution (SR) fluorescence microscopy, a class of optical microscopy techniques at a spatial resolution below the diffraction limit, has revolutionized the way we study biology, as recognized by the Nobel Prize in Chemistry in 2014. Stochastic optical reconstruction microscopy (STORM), a widely used SR technique, is based on the principle of single molecule localization. STORM routinely achieves a spatial resolution of 20 to 30 nm, a ten-fold improvement compared to conventional optical microscopy. Among all SR techniques, STORM offers a high spatial resolution with simple optical instrumentation and standard organic fluorescent dyes, but it is also prone to image artifacts and degraded image resolution due to improper sample preparation or imaging conditions. It requires careful optimization of all three aspects-sample preparation, image acquisition, and image reconstruction-to ensure a high-quality STORM image, which will be extensively discussed in this unit. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Software compensation in Particle Flow reconstruction
Lan Tran, Huong; Sefkow, Felix; Green, Steven; Marshall, John; Thomson, Mark; Simon, Frank
2017-01-01
The Particle Flow approach to calorimetry requires highly granular calorimeters and sophisticated software algorithms in order to reconstruct and identify individual particles in complex event topologies. The high spatial granularity, together with analog energy information, can be further exploited in software compensation. In this approach, the local energy density is used to discriminate electromagnetic and purely hadronic sub-showers within hadron showers in the detector to improve the energy resolution for single particles by correcting for the intrinsic non-compensation of the calorimeter system. This improvement in the single particle energy resolution also results in a better overall jet energy resolution by improving the energy measurement of identified neutral hadrons and improvements in the pattern recognition stage by a more accurate matching of calorimeter energies to tracker measurements. This paper describes the software compensation technique and its implementation in Particle Flow reconstruct...
Regional compensation for statistical maximum likelihood reconstruction error of PET image pixels
International Nuclear Information System (INIS)
Forma, J; Ruotsalainen, U; Niemi, J A
2013-01-01
In positron emission tomography (PET), there is an increasing interest in studying not only the regional mean tracer concentration, but its variation arising from local differences in physiology, the tissue heterogeneity. However, in reconstructed images this physiological variation is shadowed by a large reconstruction error, which is caused by noisy data and the inversion of tomographic problem. We present a new procedure which can quantify the error variation in regional reconstructed values for given PET measurement, and reveal the remaining tissue heterogeneity. The error quantification is made by creating and reconstructing the noise realizations of virtual sinograms, which are statistically similar with the measured sinogram. Tests with physical phantom data show that the characterization of error variation and the true heterogeneity are possible, despite the existing model error when real measurement is considered. (paper)
Veljkovic, Andrea; Le, Vu; Escudero, Mario; Salat, Peter; Wing, Kevin; Penner, Murray; Younger, Alastair
2018-03-21
Reamed intramedullary (IM) screw fixation for proximal fifth metatarsal fractures is technically challenging with potentially devastating complications if basic principles are not followed. A case of an iatrogenic fourth-degree burn after elective reamed IM screw fixation of a proximal fifth metatarsal fracture in a high-level athlete is reported. The case was complicated by postoperative osteomyelitis with third-degree soft-tissue defect. This was successfully treated with staged autologous bone graft reconstruction, tendon reconstruction, and local bi-pedicle flap coverage. The patient returned to competitive-level sports, avoiding the need for fifth ray amputation. Critical points of the IM screw technique and definitive reconstruction are discussed. Bulk autograft reconstruction is a safe and effective alternative to ray amputation in segmental defects of the fifth metatarsal.Level of evidence V.
FPGA Hardware Acceleration of a Phylogenetic Tree Reconstruction with Maximum Parsimony Algorithm
BLOCK, Henry; MARUYAMA, Tsutomu
2017-01-01
In this paper, we present an FPGA hardware implementation for a phylogenetic tree reconstruction with a maximum parsimony algorithm. We base our approach on a particular stochastic local search algorithm that uses the Progressive Neighborhood and the Indirect Calculation of Tree Lengths method. This method is widely used for the acceleration of the phylogenetic tree reconstruction algorithm in software. In our implementation, we define a tree structure and accelerate the search by parallel an...
Complications of anterior cruciate ligament reconstruction: MR imaging
Energy Technology Data Exchange (ETDEWEB)
Papakonstantinou, Olympia; Chung, Christine B.; Chanchairujira, Kullanuch; Resnick, Donald L. [Department of Radiology, Veterans Affairs Medical Center, University of California, 3350 La Jolla Village Dr., San Diego, CA 92161 (United States)
2003-05-01
Arthroscopic reconstruction of the anterior cruciate ligament (ACL) using autografts or allografts is being performed with increasing frequency, particularly in young athletes. Although the procedure is generally well tolerated, with good success rates, early and late complications have been documented. As clinical manifestations of graft complications are often non-specific and plain radiographs cannot directly visualize the graft and the adjacent soft tissues, MR imaging has a definite role in the diagnosis of complications after ACL reconstruction and may direct subsequent therapeutic management. Our purpose is to review the normal MR imaging of the ACL graft and present the MR imaging findings of a wide spectrum of complications after ACL reconstruction, such as graft impingement, graft rupture, cystic degeneration of the graft, postoperative infection of the knee, diffuse and localized (i.e., cyclops lesion) arthrofibrosis, and associated donor site abnormalities. Awareness of the MR imaging findings of complications as well as the normal appearances of the normal ACL graft is essential for correct interpretation. (orig.)
Complications of anterior cruciate ligament reconstruction: MR imaging
International Nuclear Information System (INIS)
Papakonstantinou, Olympia; Chung, Christine B.; Chanchairujira, Kullanuch; Resnick, Donald L.
2003-01-01
Arthroscopic reconstruction of the anterior cruciate ligament (ACL) using autografts or allografts is being performed with increasing frequency, particularly in young athletes. Although the procedure is generally well tolerated, with good success rates, early and late complications have been documented. As clinical manifestations of graft complications are often non-specific and plain radiographs cannot directly visualize the graft and the adjacent soft tissues, MR imaging has a definite role in the diagnosis of complications after ACL reconstruction and may direct subsequent therapeutic management. Our purpose is to review the normal MR imaging of the ACL graft and present the MR imaging findings of a wide spectrum of complications after ACL reconstruction, such as graft impingement, graft rupture, cystic degeneration of the graft, postoperative infection of the knee, diffuse and localized (i.e., cyclops lesion) arthrofibrosis, and associated donor site abnormalities. Awareness of the MR imaging findings of complications as well as the normal appearances of the normal ACL graft is essential for correct interpretation. (orig.)
Complications of massive allograft reconstruction for bone tumors
Directory of Open Access Journals (Sweden)
Abolhasan Borjian
2006-11-01
Full Text Available BACKGROUND: Since the evolution of multi-drug chemotherapy and radiotherapy and new sophisticated surgical techniques, limb salvage and reconstruction, rather than amputation, has become the preferred treatment for patients with bone tumors. One option is allograft replacement. Although allograft has several advantages, it is not without complications. This study was performed to observe these complications in a group of patients treated with allograft replacement for bone tumor resection. The purpose was to gain an overview of the factors predisposing to these complications to minimize their occurrence. METHODS: This retrospective study was performed on patients with benign aggressive and malignant bone tumors undergoing limb reconstruction with allograft between 1997 and 2005 in Al-Zahra and Kashani Hospitals in Isfahan, Iran. Data was collected from patient files, clinical notes, radiographs and a recent physical examination. Complications including local recurrence, fracture of allograft, fixation failure, nonunion, infection, skin necrosis and neurological damage were recorded. RESULTS: Sixty patients including 39 males and 21 females were studied. The mean age of patients was 23 ± 11.7 years. The mean follow-up interval was 28.1 ± 12.4 months (mean ± SD. Complications were allograft fracture in 20%, local recurrence in 16%, fixation failure in 11%, nonunion in 6%, infection in 6%, skin necrosis in 6%, and peroneal nerve palsy in 1% of cases. Most local recurrences (60% were those with a mal-performed biopsy. Most allograft fractures occurred when a short plate was used. CONCLUSIONS: Allograft replacement for bone tumors remains a valid option. To avoid complications, biopsy should be done by a trained surgeon in bone oncology. A long plate is recommended for fixation. Sterility and graft processing must be optimal. Autogenous bone graft must be added at host-allograft junction. KEY WORDS: Bone tumors, bone allograft, limb
Esthetic and functional reconstruction after parotidectomy in pediatric patients - A case series.
Bryant, Lucas M; Cognetti, David; Baker, Adam; Roy, Sudeep; Johnston, Douglas R; Curry, Joseph; Krein, Howard
2015-12-01
Parotidectomy is a mainstay of treatment for benign and malignant parotid lesions in children and adults. Depending on surgical methods used and tumor size, parotidectomy may result in significant facial disfigurement as well as functional challenges. We describe a series of four pediatric patients, ages 13-16 who presented to our clinic with a parotid mass. All patients underwent parotidectomy with immediate reconstruction by local tissue rearrangement or free fat graft. Esthetic and functional reconstruction after parotidectomy is not well described in pediatric otolaryngology literature. A review of current literature and description of reconstructive methods is included. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie
2010-01-01
LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)
Paholpak, Permsak; Sirichativapee, Winai; Wisanuyotin, Taweechok; Kosuwon, Weerachai; Jeeravipoolvarn, Polasak
2015-06-01
To evaluate the clinical results of primary malignant musculoskeletal tumors treated with wide resection and recycling autograft reconstruction using liquid nitrogen. We reviewed 12 patients who had a primary malignant bone and soft tissue tumor treated by wide resection and recycling autograft reconstruction using liquid nitrogen between March 2006 and March 2013. The results were judged by recurrence, functional status and complications. Functional status was assessed according to the Musculoskeletal Tumor Society Score (MSTSS). Clinical failure was defined as need for reoperation in order to change the type of reconstruction or to amputate, and the presence of local recurrence. The most common tumor was osteosarcoma (eight cases) followed by Ewing's sarcoma (two cases). The tibia was the most frequently involved skeletal site (six cases) followed by the femur (three cases). The median follow-up period was 32 months. In 12 patients, 7 were still alive without recurrence. There were 3 clinical failures: 1 local recurrence and 2 graft complications at 28, 51 and 20 months after reconstruction, respectively. The main complication was infection (three cases). All osteotomy sites were radiographic unions, and the union time was 8.2 ± 2.7 months. The mean ± SD MSTSS score was 79% ± 11%; excellent functional results were achieved in seven patients. Recycling autograft reconstruction using liquid nitrogen had favorable clinical outcomes in terms of functional status and local recurrence. This reconstruction method, therefore, represents a reasonable alternative for limb salvage surgery. © 2014 Wiley Publishing Asia Pty Ltd.
Principle and Reconstruction Algorithm for Atomic-Resolution Holography
Matsushita, Tomohiro; Muro, Takayuki; Matsui, Fumihiko; Happo, Naohisa; Hosokawa, Shinya; Ohoyama, Kenji; Sato-Tomita, Ayana; Sasaki, Yuji C.; Hayashi, Kouichi
2018-06-01
Atomic-resolution holography makes it possible to obtain the three-dimensional (3D) structure around a target atomic site. Translational symmetry of the atomic arrangement of the sample is not necessary, and the 3D atomic image can be measured when the local structure of the target atomic site is oriented. Therefore, 3D local atomic structures such as dopants and adsorbates are observable. Here, the atomic-resolution holography comprising photoelectron holography, X-ray fluorescence holography, neutron holography, and their inverse modes are treated. Although the measurement methods are different, they can be handled with a unified theory. The algorithm for reconstructing 3D atomic images from holograms plays an important role. Although Fourier transform-based methods have been proposed, they require the multiple-energy holograms. In addition, they cannot be directly applied to photoelectron holography because of the phase shift problem. We have developed methods based on the fitting method for reconstructing from single-energy and photoelectron holograms. The developed methods are applicable to all types of atomic-resolution holography.
Reconstructing Global-scale Ionospheric Outflow With a Satellite Constellation
Liemohn, M. W.; Welling, D. T.; Jahn, J. M.; Valek, P. W.; Elliott, H. A.; Ilie, R.; Khazanov, G. V.; Glocer, A.; Ganushkina, N. Y.; Zou, S.
2017-12-01
The question of how many satellites it would take to accurately map the spatial distribution of ionospheric outflow is addressed in this study. Given an outflow spatial map, this image is then reconstructed from a limited number virtual satellite pass extractions from the original values. An assessment is conducted of the goodness of fit as a function of number of satellites in the reconstruction, placement of the satellite trajectories relative to the polar cap and auroral oval, season and universal time (i.e., dipole tilt relative to the Sun), geomagnetic activity level, and interpolation technique. It is found that the accuracy of the reconstructions increases sharply from one to a few satellites, but then improves only marginally with additional spacecraft beyond 4. Increased dwell time of the satellite trajectories in the auroral zone improves the reconstruction, therefore a high-but-not-exactly-polar orbit is most effective for this task. Local time coverage is also an important factor, shifting the auroral zone to different locations relative to the virtual satellite orbit paths. The expansion and contraction of the polar cap and auroral zone with geomagnetic activity influences the coverage of the key outflow regions, with different optimal orbit configurations for each level of activity. Finally, it is found that reconstructing each magnetic latitude band individually produces a better fit to the original image than 2-D image reconstruction method (e.g., triangulation). A high-latitude, high-altitude constellation mission concept is presented that achieves acceptably accurate outflow reconstructions.
A deep learning-based reconstruction of cosmic ray-induced air showers
Erdmann, M.; Glombitza, J.; Walz, D.
2018-01-01
We describe a method of reconstructing air showers induced by cosmic rays using deep learning techniques. We simulate an observatory consisting of ground-based particle detectors with fixed locations on a regular grid. The detector's responses to traversing shower particles are signal amplitudes as a function of time, which provide information on transverse and longitudinal shower properties. In order to take advantage of convolutional network techniques specialized in local pattern recognition, we convert all information to the image-like grid of the detectors. In this way, multiple features, such as arrival times of the first particles and optimized characterizations of time traces, are processed by the network. The reconstruction quality of the cosmic ray arrival direction turns out to be competitive with an analytic reconstruction algorithm. The reconstructed shower direction, energy and shower depth show the expected improvement in resolution for higher cosmic ray energy.
Sensor-Topology Based Simplicial Complex Reconstruction from Mobile Laser Scanning
Guinard, S.; Vallet, B.
2018-05-01
We propose a new method for the reconstruction of simplicial complexes (combining points, edges and triangles) from 3D point clouds from Mobile Laser Scanning (MLS). Our main goal is to produce a reconstruction of a scene that is adapted to the local geometry of objects. Our method uses the inherent topology of the MLS sensor to define a spatial adjacency relationship between points. We then investigate each possible connexion between adjacent points and filter them by searching collinear structures in the scene, or structures perpendicular to the laser beams. Next, we create triangles for each triplet of self-connected edges. Last, we improve this method with a regularization based on the co-planarity of triangles and collinearity of remaining edges. We compare our results to a naive simplicial complexes reconstruction based on edge length.
Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.
Feng, Rulin; Peterson, Kirk A
2017-08-28
New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal
PET image reconstruction using multi-parametric anato-functional priors
Mehranian, Abolfazl; Belzunce, Martin A.; Niccolini, Flavia; Politis, Marios; Prieto, Claudia; Turkheimer, Federico; Hammers, Alexander; Reader, Andrew J.
2017-08-01
In this study, we investigate the application of multi-parametric anato-functional (MR-PET) priors for the maximum a posteriori (MAP) reconstruction of brain PET data in order to address the limitations of the conventional anatomical priors in the presence of PET-MR mismatches. In addition to partial volume correction benefits, the suitability of these priors for reconstruction of low-count PET data is also introduced and demonstrated, comparing to standard maximum-likelihood (ML) reconstruction of high-count data. The conventional local Tikhonov and total variation (TV) priors and current state-of-the-art anatomical priors including the Kaipio, non-local Tikhonov prior with Bowsher and Gaussian similarity kernels are investigated and presented in a unified framework. The Gaussian kernels are calculated using both voxel- and patch-based feature vectors. To cope with PET and MR mismatches, the Bowsher and Gaussian priors are extended to multi-parametric priors. In addition, we propose a modified joint Burg entropy prior that by definition exploits all parametric information in the MAP reconstruction of PET data. The performance of the priors was extensively evaluated using 3D simulations and two clinical brain datasets of [18F]florbetaben and [18F]FDG radiotracers. For simulations, several anato-functional mismatches were intentionally introduced between the PET and MR images, and furthermore, for the FDG clinical dataset, two PET-unique active tumours were embedded in the PET data. Our simulation results showed that the joint Burg entropy prior far outperformed the conventional anatomical priors in terms of preserving PET unique lesions, while still reconstructing functional boundaries with corresponding MR boundaries. In addition, the multi-parametric extension of the Gaussian and Bowsher priors led to enhanced preservation of edge and PET unique features and also an improved bias-variance performance. In agreement with the simulation results, the clinical results
[Red lip defects. Reconstructive techniques and indications].
Simon, E; Stricker, M; Duroure, F
2002-10-01
The attractive color of the red lip must be the object of very meticulous reconstruction in their form and pigmentation. This can be done only by using the buccal mucosa. The graf is less indicated. There are multiple local flaps that have been proposed using the same lip, the jugal mucosa and the tongue. The authors will show the principal procedures found in the literature.
Li, Mingyong; Duan, Jianping; Wang, Lily; Zhu, Haifeng
2018-04-01
Although several tree-ring density-based summer/late summer temperature reconstructions have been developed on the Tibetan Plateau (TP), the understanding of the local/regional characteristics of summer temperature fluctuations on a long-term scale in some regions is still limited. To improve our understanding in these aspects, more local or regional summer temperature reconstructions extending back over several centuries are required. In this study, a new mean latewood density (LWD) chronology from Abies georgei var. smithii from the upper tree line of Sygera Mountain on the southeastern TP was developed to reconstruct the late summer temperature variability since 1820 CE. The bootstrapped correlation analysis showed that the LWD chronology index was significantly and positively correlated with the late summer (August-September) mean temperatures (r1950-2008 = 0.63, p < 0.001) recorded at the nearest meteorological station and that this reconstruction has considerable potential to represent the late summer temperature variability at the regional scale. Our late summer temperature reconstruction revealed three obvious cold periods (i.e., 1872-1908, 1913-1937 and 1941-1966) and two relatively warm phases (i.e., 1821-1871 and 1970-2008) over the past two centuries. Comparisons of our reconstruction with other independent tree-ring-based temperature reconstructions, glacier fluctuations and historical documental records from neighboring regions showed good agreement in these relatively cold and warm intervals. Our reconstruction exhibits an overall increasing temperature trend since the 1960s, providing new evidence supporting the recent warming of the TP. Moreover, our results also indicate that the late summer temperature variability of Sygera Mountain on the southeastern TP has potential links with the Pacific Decadal Oscillation (PDO).
International Nuclear Information System (INIS)
Giuliani, Meredith E.; Lindsay, Patricia E.; Sun, Alexander; Bezjak, Andrea; Le, Lisa W.; Brade, Anthony; Cho, John; Leighl, Natasha B.; Shepherd, Frances A.; Hope, Andrew J.
2012-01-01
Purpose: To determine the patterns of loco-regional (LR) and distant failure in patients with limited-stage small cell lung carcinoma (LS-SCLC) treated with curative intent. Methods: From 1997 to 2008, 253 LS-SCLC patients were treated with curative intent chemo-radiation at our institution. A retrospective review identified sites of failure. The cumulative LR failure (LRF) rate was calculated. Distant failure-free survival (FFS) and overall survival (OS) were calculated using the Kaplan–Meier method. Volumetric images of LR failures were delineated and registered with the original radiation treatment plans if available. Dosimetric parameters for the delineated failure volumes were calculated from the original treatment information. Results: The median follow-up was 19 months. The site of first failure was LR in 34, distant in 80 and simultaneous LR and distant in 31 patients. The cumulative LRF rate was 29% and 38% at 2 and 5 years. OS was 44% at 2 years. Seventy patients had electronically archived treatment plans of which there were 16 LR failures (7 local and 39 regional failure volumes). Of the local and regional failure volumes 29% and 31% were in-field, respectively. Conclusions: The predominant pattern of LR failure was marginal or out-of-field. LR failures may be preventable with improved radiotherapy target definition.
Unit Advancement Flap for Lower Lip Reconstruction.
Ogino, Akihiro; Onishi, Kiyoshi; Okada, Emi; Nakamichi, Miho
2018-05-01
Lower lip reconstruction requires consideration of esthetic and functional outcome in selecting a surgical procedure, and reconstruction with local tissue is useful. The authors reconstructed full-thickness defects with a unit advancement flap. Reconstruction was performed using this method in 4 patients with lower lip squamous cell carcinoma in whom tumor resection with preservation of the mouth angle was possible. The lower lip resection width was 30 to 45 mm, accounting for 50% to 68% of the entire width of the lower lip. The flap was prepared by lateral extension from above the mental unit and matched with the potential wrinkle line of the lower lip in order to design a unit morphology surrounded by the anterior margin of the depressor labii inferioris muscle. It was elevated as a full-thickness flap composed of the orbicularis oris muscle, skin, and mucosa of the residual lower lip from the bilateral sides, and advanced to the defect. Flap transfer was adjusted by small triangular resection of the skin on the lateral side of the mental unit. The postoperative scar was inconspicuous in all patients and there was no impairment of the mouth opening-closing or articulation functions. This was a relatively simple surgical procedure. A blood supply of the flap was stable, and continuity of the orbicularis oris muscle was reconstructed by transferred the residual lower lip advancement flap from the bilateral sides. The postoperative mouth opening-closing function was sufficient, and dentures could be placed from an early phase in elderly patients. The postoperative scar was consistent with the lip unit morphology, being esthetically superior. This procedure may be applicable for reconstruction of defects approximately 1/3 to 2/3 the width of the lower lip where the mouth angle is preserved.
Three-dimensional tomosynthetic image restoration for brachytherapy source localization
International Nuclear Information System (INIS)
Persons, Timothy M.
2001-01-01
Tomosynthetic image reconstruction allows for the production of a virtually infinite number of slices from a finite number of projection views of a subject. If the reconstructed image volume is viewed in toto, and the three-dimensional (3D) impulse response is accurately known, then it is possible to solve the inverse problem (deconvolution) using canonical image restoration methods (such as Wiener filtering or solution by conjugate gradient least squares iteration) by extension to three dimensions in either the spatial or the frequency domains. This dissertation presents modified direct and iterative restoration methods for solving the inverse tomosynthetic imaging problem in 3D. The significant blur artifact that is common to tomosynthetic reconstructions is deconvolved by solving for the entire 3D image at once. The 3D impulse response is computed analytically using a fiducial reference schema as realized in a robust, self-calibrating solution to generalized tomosynthesis. 3D modulation transfer function analysis is used to characterize the tomosynthetic resolution of the 3D reconstructions. The relevant clinical application of these methods is 3D imaging for brachytherapy source localization. Conventional localization schemes for brachytherapy implants using orthogonal or stereoscopic projection radiographs suffer from scaling distortions and poor visibility of implanted seeds, resulting in compromised source tracking (reported errors: 2-4 mm) and dosimetric inaccuracy. 3D image reconstruction (using a well-chosen projection sampling scheme) and restoration of a prostate brachytherapy phantom is used for testing. The approaches presented in this work localize source centroids with submillimeter error in two Cartesian dimensions and just over one millimeter error in the third
Implications of Liebig’s law of the minimum for tree-ring reconstructions of climate
Stine, A. R.; Huybers, P.
2017-11-01
A basic principle of ecology, known as Liebig’s Law of the Minimum, is that plant growth reflects the strongest limiting environmental factor. This principle implies that a limiting environmental factor can be inferred from historical growth and, in dendrochronology, such reconstruction is generally achieved by averaging collections of standardized tree-ring records. Averaging is optimal if growth reflects a single limiting factor and noise but not if growth also reflects locally variable stresses that intermittently limit growth. In this study a collection of Arctic tree ring records is shown to follow scaling relationships that are inconsistent with the signal-plus-noise model of tree growth but consistent with Liebig’s Law acting at the local level. Also consistent with law-of-the-minimum behavior is that reconstructions based on the least-stressed trees in a given year better-follow variations in temperature than typical approaches where all tree-ring records are averaged. Improvements in reconstruction skill occur across all frequencies, with the greatest increase at the lowest frequencies. More comprehensive statistical-ecological models of tree growth may offer further improvement in reconstruction skill.
Directory of Open Access Journals (Sweden)
Junjie Peng
Full Text Available To develop prognostic nomograms for predicting outcomes in patients with locally advanced rectal cancers who do not receive preoperative treatment.A total of 883 patients with stage II-III rectal cancers were retrospectively collected from a single institution. Survival analyses were performed to assess each variable for overall survival (OS, local recurrence (LR and distant metastases (DM. Cox models were performed to develop a predictive model for each endpoint. The performance of model prediction was validated by cross validation and on an independent group of patients.The 5-year LR, DM and OS rates were 22.3%, 32.7% and 63.8%, respectively. Two prognostic nomograms were successfully developed to predict 5-year OS and DM-free survival rates, with c-index of 0.70 (95% CI = [0.66, 0.73] and 0.68 (95% CI = [0.64, 0.72] on the original dataset, and 0.76 (95% CI = [0.67, 0.86] and 0.73 (95% CI = [0.63, 0.83] on the validation dataset, respectively. Factors in our models included age, gender, carcinoembryonic antigen value, tumor location, T stage, N stage, metastatic lymph nodes ratio, adjuvant chemotherapy and chemoradiotherapy. Predicted by our nomogram, substantial variability in terms of 5-year OS and DM-free survival was observed within each TNM stage category.The prognostic nomograms integrated demographic and clinicopathological factors to account for tumor and patient heterogeneity, and thereby provided a more individualized outcome prognostication. Our individualized prediction nomograms could help patients with preoperatively under-staged rectal cancer about their postoperative treatment strategies and follow-up protocols.
Scrotal Reconstruction with a Pedicled Gracilis Muscle Flap after ...
African Journals Online (AJOL)
Several scrotal reconstructive options are available including split thickness skin grafts, scrotal advancement flaps, local fasciocutaneous, muscle or myocutaneous flaps, and free tissue transfer. We report a case of a 34 year old African male who presented as a referral from a district hospital with a scrotal defect and ...
Reconstructing Northeastern United States temperatures using Atlantic white cedar tree rings
Pearl, Jessie K.; Anchukaitis, Kevin J.; Pederson, Neil; Donnelly, Jeffrey P.
2017-11-01
Our knowledge of climate variability in the densely populated Northeastern United States is limited to instrumental data of the last century. Most regional paleoclimate proxies reflect a mix of climate responses, which makes reconstructing historical climate a challenge. Here we analyze tree-ring chronologies from Atlantic white cedar (Chamaecyparis thyoides) as a potential regional paleotemperature proxy. We evaluate our tree-ring network for spatiotemporal climate signal strength and reconstruction skill across New England. Atlantic white cedar sites in the northern section of the species’ range exhibit positive significant annual growth relationships with local and regional temperatures. Chronologies constructed from northern sites yield skillful reconstructions of temperature that reproduce centennial, multidecadal, and interannual variability in the instrumental record, providing a novel paleotemperature record for New England.
Jiang, L; Lou, J L; Wang, K J; Fang, M Y; Fu, Z F
2018-02-07
Objective: To investigate the value of planned neck dissection combined with induction chemotherapy and concurrent chemoradiotherapy in regional control and the outcome of locally advanced head and neck squamous cell carcinoma. Methods: A prospective randomized controlled study totally enrolled sixty-four patients of head and neck squamous cell carcinomas(include oropharynx, hypopharynx, and larynx) in stages Ⅳa-Ⅳb with lymph node metastase was were N2-N3. All patients firstly received 2-3 cycles of induction chemotherapy(ICT), then divided into two groups randomly, according to the efficacy of ICT. Group A(the study group) received planned neck dissection(PND) and concurrent chemoradiotherapy(CCRT). Group B(the control group) received concurrent chemoradiotherapy(CCRT). The differences in clinicopathologic features, local recurrence(LR), regional recurrence(RR), disease-free survival(DFS), and overall survival(OS) between the two groups were estimated. SPSS 19.0 software was used to analyze the data. Results: Group A enrolled twenty-one patients, and group B enrolled forty-three patients.The follow-up of all patients were 4-55 months, median follow-up time was 22 months. In study group, two-year OS and DFS were 80.9% and 68.3%, respectively. In control group, two-year OS and DFS were 90.7% and 67.1%, respectively. There was no significant difference in gender( P =0.215), age( P =0.828), primary tumor site( P =0.927), LR( P =0.126), DFS( P =0.710), and OS( P =0.402) between the two groups, while the RR(χ(2)=5.640, P squamous cell carcinoma.
Algebraic reconstruction techniques for spectral reconstruction in diffuse optical tomography
International Nuclear Information System (INIS)
Brendel, Bernhard; Ziegler, Ronny; Nielsen, Tim
2008-01-01
Reconstruction in diffuse optical tomography (DOT) necessitates solving the diffusion equation, which is nonlinear with respect to the parameters that have to be reconstructed. Currently applied solving methods are based on the linearization of the equation. For spectral three-dimensional reconstruction, the emerging equation system is too large for direct inversion, but the application of iterative methods is feasible. Computational effort and speed of convergence of these iterative methods are crucial since they determine the computation time of the reconstruction. In this paper, the iterative methods algebraic reconstruction technique (ART) and conjugated gradients (CGs) as well as a new modified ART method are investigated for spectral DOT reconstruction. The aim of the modified ART scheme is to speed up the convergence by considering the specific conditions of spectral reconstruction. As a result, it converges much faster to favorable results than conventional ART and CG methods
Stability indicators in network reconstruction.
Directory of Open Access Journals (Sweden)
Michele Filosi
Full Text Available The number of available algorithms to infer a biological network from a dataset of high-throughput measurements is overwhelming and keeps growing. However, evaluating their performance is unfeasible unless a 'gold standard' is available to measure how close the reconstructed network is to the ground truth. One measure of this is the stability of these predictions to data resampling approaches. We introduce NetSI, a family of Network Stability Indicators, to assess quantitatively the stability of a reconstructed network in terms of inference variability due to data subsampling. In order to evaluate network stability, the main NetSI methods use a global/local network metric in combination with a resampling (bootstrap or cross-validation procedure. In addition, we provide two normalized variability scores over data resampling to measure edge weight stability and node degree stability, and then introduce a stability ranking for edges and nodes. A complete implementation of the NetSI indicators, including the Hamming-Ipsen-Mikhailov (HIM network distance adopted in this paper is available with the R package nettools. We demonstrate the use of the NetSI family by measuring network stability on four datasets against alternative network reconstruction methods. First, the effect of sample size on stability of inferred networks is studied in a gold standard framework on yeast-like data from the Gene Net Weaver simulator. We also consider the impact of varying modularity on a set of structurally different networks (50 nodes, from 2 to 10 modules, and then of complex feature covariance structure, showing the different behaviours of standard reconstruction methods based on Pearson correlation, Maximum Information Coefficient (MIC and False Discovery Rate (FDR strategy. Finally, we demonstrate a strong combined effect of different reconstruction methods and phenotype subgroups on a hepatocellular carcinoma miRNA microarray dataset (240 subjects, and we
Sum frequency generation image reconstruction: Aliphatic membrane under spherical cap geometry
Energy Technology Data Exchange (ETDEWEB)
Volkov, Victor [Bereozovaya 2A, Konstantinovo, Moscow Region 140207 (Russian Federation)
2014-10-07
The article explores an opportunity to approach structural properties of phospholipid membranes using Sum Frequency Generation microscopy. To establish the principles of sum frequency generation image reconstruction in such systems, at first approach, we may adopt an idealistic spherical cap uniform assembly of hydrocarbon molecules. Quantum mechanical studies for decanoic acid (used here as a representative molecular system) provide necessary information on transition dipole moments and Raman tensors of the normal modes specific to methyl terminal – a typical moiety in aliphatic (and phospholipid) membranes. Relative degree of localization and frequencies of the normal modes of methyl terminals make nonlinearities of this moiety to be promising in structural analysis using Sum Frequency Generation imaging. Accordingly, the article describes derivations of relevant macroscopic nonlinearities and suggests a mapping procedure to translate amplitudes of the nonlinearities onto microscopy image plane according to geometry of spherical assembly, local molecular orientation, and optical geometry. Reconstructed images indicate a possibility to extract local curvature of bilayer envelopes of spherical character. This may have practical implications for structural extractions in membrane systems of practical relevance.
Riccio, Charles A.; Zeiderman, Matthew R.; Chowdhry, Saeed; Wilhelmi, Bradon J.
2015-01-01
Introduction: Nipple-areola complex reconstruction (NAR) is the final procedure in breast reconstruction after the majority of mastectomies. Many methods of NAR have been described, each with inherent advantages and disadvantages depending on local healthy tissue availability, previous scarring and procedures, and the operative morbidity of the NAR technique. Nipple reconstructions may be complicated by scars or previous nipple reconstruction, making the procedure more challenging. We propose...
Spectral image reconstruction using an edge preserving spatio-spectral Wiener estimation.
Urban, Philipp; Rosen, Mitchell R; Berns, Roy S
2009-08-01
Reconstruction of spectral images from camera responses is investigated using an edge preserving spatio-spectral Wiener estimation. A Wiener denoising filter and a spectral reconstruction Wiener filter are combined into a single spatio-spectral filter using local propagation of the noise covariance matrix. To preserve edges the local mean and covariance matrix of camera responses is estimated by bilateral weighting of neighboring pixels. We derive the edge-preserving spatio-spectral Wiener estimation by means of Bayesian inference and show that it fades into the standard Wiener reflectance estimation shifted by a constant reflectance in case of vanishing noise. Simulation experiments conducted on a six-channel camera system and on multispectral test images show the performance of the filter, especially for edge regions. A test implementation of the method is provided as a MATLAB script at the first author's website.
Plastic surgery in chest wall reconstruction: relevant aspects - case series
Directory of Open Access Journals (Sweden)
Diogo Franco
Full Text Available Objective: to discuss the participation of Plastic Surgery in the reconstruction of the chest wall, highlighting relevant aspects of interdisciplinaryness. Methods: we analyzed charts from 20 patients who underwent extensive resection of the thoracic integument, between 2000 and 2014, recording the indication of resection, the extent and depth of the raw areas, types of reconstructions performed and complications. Results: among the 20 patients, averaging 55 years old, five were males and 15 females. They resections were: one squamous cell carcinoma, two basal cell carcinomas, five chondrosarcomas and 12 breast tumors. The extent of the bloody areas ranged from 4x9 cm to 25x40 cm. In 12 patients the resection included the muscular plane. In the remaining eight, the tumor removal achieved a total wall thickness. For reconstruction we used: one muscular flap associated with skin grafting, nine flaps and ten regional fasciocutaneous flaps. Two patients undergoing reconstruction with fasciocutaneous flaps had partially suffering of the flap, solved with employment of a myocutaneous flap. The other patients displayed no complications with the techniques used, requiring only one surgery. Conclusion: the proper assessment of local tissues and flaps available for reconstruction, in addition to the successful integration of Plastic Surgery with the specialties involved in the treatment, enable extensive resections of the chest wall and reconstructions that provide patient recovery.
The Reliability of Pectorals Major Myocutaneous Flap in Head and Neck Reconstruction
International Nuclear Information System (INIS)
El-Marakby, H.H.
2006-01-01
Background: The pectorals major myocutaneous pedicle flap (PMMPF) has been considered to be the workhorse of pedicled flaps in head and neck reconstruction. Several series of PMMPF procedures in head and neck reconstruction have been reported in the literature. Even with the worldwide use of free flaps, the flap is still considered the mainstay head and neck reconstructive procedures in many centers. However, the flap is usually associated with a high incidence of complications in addition 10 its large bulk compared with the free fasciocutaneous flaps. Also the final functional and the aesthetic results are not comparable to free flaps head and neck reconstruction. Aim of the Study: The aim of the study is to evaluate the reliability of such flap in selected cases of head and neck reconstruction. The indications, technique, complications and the functional as well as the aesthetic results of the flap utilization were evaluated. Patients and Methods: Between May 2002 and May 2005 a 26 consecutive head and neck reconstruction procedures using the PMMPF were carried out on 25 patients at the Department of Surgery, National Cancer Institute, Cairo University. The indications for the flap use were defects due to resection of stage II-IV cancer in the head and neck region. The site, stage of the disease and the presence or absence of distant metastasis were assessed. Also preoperative assessment included the fitness of patients for such an extensive procedure. The total operative time, the need for blood transfusion, the postoperative complications, were all documented. The length of hospital stay, the follow-up of patients as well as the incidence of local recurrence underneath the flap were all evaluated. Results: Pectorals major myocutaneous pedicled flap reconstructions were used to reconstruct defects in the following sites: oral cavity (LO patients); oropharynx/hypopharynx, (5 patients); and neck or face (10 patients). Of the 26 PMMPF reconstructions. 22 flaps were
International Nuclear Information System (INIS)
Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin
2014-01-01
This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies
Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin
2014-06-01
This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.
SENSOR-TOPOLOGY BASED SIMPLICIAL COMPLEX RECONSTRUCTION FROM MOBILE LASER SCANNING
Directory of Open Access Journals (Sweden)
S. Guinard
2018-05-01
Full Text Available We propose a new method for the reconstruction of simplicial complexes (combining points, edges and triangles from 3D point clouds from Mobile Laser Scanning (MLS. Our main goal is to produce a reconstruction of a scene that is adapted to the local geometry of objects. Our method uses the inherent topology of the MLS sensor to define a spatial adjacency relationship between points. We then investigate each possible connexion between adjacent points and filter them by searching collinear structures in the scene, or structures perpendicular to the laser beams. Next, we create triangles for each triplet of self-connected edges. Last, we improve this method with a regularization based on the co-planarity of triangles and collinearity of remaining edges. We compare our results to a naive simplicial complexes reconstruction based on edge length.
Taylor, Fiona G M; Quirke, Philip; Heald, Richard J; Moran, Brendan J; Blomqvist, Lennart; Swift, Ian R; Sebag-Montefiore, David; Tekkis, Paris; Brown, Gina
2014-01-01
The prognostic relevance of preoperative high-resolution magnetic resonance imaging (MRI) assessment of circumferential resection margin (CRM) involvement is unknown. This follow-up study of 374 patients with rectal cancer reports the relationship between preoperative MRI assessment of CRM staging, American Joint Committee on Cancer (AJCC) TNM stage, and clinical variables with overall survival (OS), disease-free survival (DFS), and time to local recurrence (LR). Patients underwent protocol high-resolution pelvic MRI. Tumor distance to the mesorectal fascia of ≤ 1 mm was recorded as an MRI-involved CRM. A Cox proportional hazards model was used in multivariate analysis to determine the relationship of MRI assessment of CRM to survivorship after adjusting for preoperative covariates. Surviving patients were followed for a median of 62 months. The 5-year OS was 62.2% in patients with MRI-clear CRM compared with 42.2% in patients with MRI-involved CRM with a hazard ratio (HR) of 1.97 (95% CI, 1.27 to 3.04; P < .01). The 5-year DFS was 67.2% (95% CI, 61.4% to 73%) for MRI-clear CRM compared with 47.3% (95% CI, 33.7% to 60.9%) for MRI-involved CRM with an HR of 1.65 (95% CI, 1.01 to 2.69; P < .05). Local recurrence HR for MRI-involved CRM was 3.50 (95% CI, 1.53 to 8.00; P < .05). MRI-involved CRM was the only preoperative staging parameter that remained significant for OS, DFS, and LR on multivariate analysis. High-resolution MRI preoperative assessment of CRM status is superior to AJCC TNM-based criteria for assessing risk of LR, DFS, and OS. Furthermore, MRI CRM involvement is significantly associated with distant metastatic disease; therefore, colorectal cancer teams could intensify treatment and follow-up accordingly to improve survival outcomes.
International Nuclear Information System (INIS)
O'Sullivan, F.; Pawitan, Y.; Harrison, R.L.; Lewellen, T.K.
1990-01-01
In statistical terms, filtered backprojection can be viewed as smoothed Least Squares (LS). In this paper, the authors report on improvement in LS resolution by: incorporating locally adaptive smoothers, imposing positivity and using statistical methods for optimal selection of the resolution parameter. The resulting algorithm has high computational efficiency relative to more elaborate Maximum Likelihood (ML) type techniques (i.e. EM with sieves). Practical aspects of the procedure are discussed in the context of PET and illustrations with computer simulated and real tomograph data are presented. The relative recovery coefficients for a 9mm sphere in a computer simulated hot-spot phantom range from .3 to .6 when the number of counts ranges from 10,000 to 640,000 respectively. The authors will also present results illustrating the relative efficacy of ML and LS reconstruction techniques
Amit Kharat; Sahil Garg; Amarjit Singh; Vilas Kulkarni
2015-01-01
Localized anterior arthrofibrosis (cyclops lesion) is having around 1-9.8% frequency rate after anterior cruciate ligament (ACL) reconstruction. It has been reported to be a significant cause of loss of knee extension after reconstruction of the ACL of the knee. We present a case report of a patient with prior ACL reconstruction who presented with pain and loss of extension following surgery. MR imaging revealed the typical features of cyclops lesion. Repeat arthroscopy excision of the lesion...
Masia, D-R; Castus, P; Delia, G; Casoli, V; Martine, D
2008-02-01
Scrotal elephantiasis is a pathology of often unknown etiology. Symptomatology is characterized by an oedematius infiltration of skin and subcutaneous tissue, hard-bound aspect and purplished color. The scrotum, the penis and the perineal area are gradually affected. This pathology is very invalidating for the patient, on functional, sexual and aesthetic aspects. The authors present the case of a 58-year-old man with an enormous scrotal mass invading the penis and drowning the testicular elements, which were impossible to palpate. The aetiology was determined by exclusion and an iatrogenic origin following the cure of bilateral inguinal hernia was retained. Resection of the scrotal mass was performed. The reconstruction of the scrotal purse and the cutaneous sleeve of the penis were carried out using local flaps of the remaining healthy skin.
Directory of Open Access Journals (Sweden)
Yalcin Kulahci
2012-07-01
Full Text Available The reconstruction of extensive and complex wounds represents a challenging problem for reconstructive surgeon. The reconstructive options to provide cover-age following debridment of these complicated wounds are local, distant flaps, or freetissue transfer. Vertical rectus abdominis flaps have been used succes-sully to repair defects in the groin, hip, perineal, trunk, and breast regions. We encountered flap lymphedema after successful reconstruction of the chronic in-guinal wound with a vertical rectus abdominis (VRAM flap. As far as were able to ascertain, there is no report in the literature related to flap lymphedema.
Visual image reconstruction from human brain activity: A modular decoding approach
International Nuclear Information System (INIS)
Miyawaki, Yoichi; Uchida, Hajime; Yamashita, Okito; Sato, Masa-aki; Kamitani, Yukiyasu; Morito, Yusuke; Tanabe, Hiroki C; Sadato, Norihiro
2009-01-01
Brain activity represents our perceptual experience. But the potential for reading out perceptual contents from human brain activity has not been fully explored. In this study, we demonstrate constraint-free reconstruction of visual images perceived by a subject, from the brain activity pattern. We reconstructed visual images by combining local image bases with multiple scales, whose contrasts were independently decoded from fMRI activity by automatically selecting relevant voxels and exploiting their correlated patterns. Binary-contrast, 10 x 10-patch images (2 100 possible states), were accurately reconstructed without any image prior by measuring brain activity only for several hundred random images. The results suggest that our approach provides an effective means to read out complex perceptual states from brain activity while discovering information representation in multi-voxel patterns.
Jing, Xiaoli; Cheng, Haobo; Wen, Yongfu
2018-04-01
A new local integration algorithm called quality map path integration (QMPI) is reported for shape reconstruction in the fringe reflection technique. A quality map is proposed to evaluate the quality of gradient data locally, and functions as a guideline for the integrated path. The presented method can be employed in wavefront estimation from its slopes over the general shaped surface with slope noise equivalent to that in practical measurements. Moreover, QMPI is much better at handling the slope data with local noise, which may be caused by the irregular shapes of the surface under test. The performance of QMPI is discussed by simulations and experiment. It is shown that QMPI not only improves the accuracy of local integration, but can also be easily implemented with no iteration compared to Southwell zonal reconstruction (SZR). From an engineering point-of-view, the proposed method may also provide an efficient and stable approach for different shapes with high-precise demand.
Directory of Open Access Journals (Sweden)
Abílio Amiguinho
2005-01-01
Full Text Available The process of socio-educational territorialisation in rural contexts is the topic of this text. The theme corresponds to a challenge to address it having as main axis of discussion either the problem of social exclusion or that of local development. The reasons to locate the discussion in this last field of analysis are discussed in the first part of the text. Theoretical and political reasons are there articulated because the question is about projects whose intentions and practices call for the political both in the theoretical debate and in the choices that anticipate intervention. From research conducted for several years, I use contributions that aim at discuss and enlighten how school can be a potential locus of local development. Its identification and recognition as local institution (either because of those that work and live in it or because of those that act in the surrounding context are crucial steps to progressively constitute school as a partner for development. The promotion of the local values and roots, the reconstruction of socio-personal and local identities, the production of sociabilities and the equation and solution of shared problems were the dimensions of a socio-educative intervention, markedly globalising. This scenario, as it is argued, was also, intentionally, one of transformation and of deliberate change of school and of the administration of the educative territoires.
Internet2-based 3D PET image reconstruction using a PC cluster
International Nuclear Information System (INIS)
Shattuck, D.W.; Rapela, J.; Asma, E.; Leahy, R.M.; Chatzioannou, A.; Qi, J.
2002-01-01
We describe an approach to fast iterative reconstruction from fully three-dimensional (3D) PET data using a network of PentiumIII PCs configured as a Beowulf cluster. To facilitate the use of this system, we have developed a browser-based interface using Java. The system compresses PET data on the user's machine, sends these data over a network, and instructs the PC cluster to reconstruct the image. The cluster implements a parallelized version of our preconditioned conjugate gradient method for fully 3D MAP image reconstruction. We report on the speed-up factors using the Beowulf approach and the impacts of communication latencies in the local cluster network and the network connection between the user's machine and our PC cluster. (author)
Practical implementation of tetrahedral mesh reconstruction in emission tomography
Boutchko, R.; Sitek, A.; Gullberg, G. T.
2013-05-01
This paper presents a practical implementation of image reconstruction on tetrahedral meshes optimized for emission computed tomography with parallel beam geometry. Tetrahedral mesh built on a point cloud is a convenient image representation method, intrinsically three-dimensional and with a multi-level resolution property. Image intensities are defined at the mesh nodes and linearly interpolated inside each tetrahedron. For the given mesh geometry, the intensities can be computed directly from tomographic projections using iterative reconstruction algorithms with a system matrix calculated using an exact analytical formula. The mesh geometry is optimized for a specific patient using a two stage process. First, a noisy image is reconstructed on a finely-spaced uniform cloud. Then, the geometry of the representation is adaptively transformed through boundary-preserving node motion and elimination. Nodes are removed in constant intensity regions, merged along the boundaries, and moved in the direction of the mean local intensity gradient in order to provide higher node density in the boundary regions. Attenuation correction and detector geometric response are included in the system matrix. Once the mesh geometry is optimized, it is used to generate the final system matrix for ML-EM reconstruction of node intensities and for visualization of the reconstructed images. In dynamic PET or SPECT imaging, the system matrix generation procedure is performed using a quasi-static sinogram, generated by summing projection data from multiple time frames. This system matrix is then used to reconstruct the individual time frame projections. Performance of the new method is evaluated by reconstructing simulated projections of the NCAT phantom and the method is then applied to dynamic SPECT phantom and patient studies and to a dynamic microPET rat study. Tetrahedral mesh-based images are compared to the standard voxel-based reconstruction for both high and low signal-to-noise ratio
Practical implementation of tetrahedral mesh reconstruction in emission tomography
International Nuclear Information System (INIS)
Boutchko, R; Gullberg, G T; Sitek, A
2013-01-01
This paper presents a practical implementation of image reconstruction on tetrahedral meshes optimized for emission computed tomography with parallel beam geometry. Tetrahedral mesh built on a point cloud is a convenient image representation method, intrinsically three-dimensional and with a multi-level resolution property. Image intensities are defined at the mesh nodes and linearly interpolated inside each tetrahedron. For the given mesh geometry, the intensities can be computed directly from tomographic projections using iterative reconstruction algorithms with a system matrix calculated using an exact analytical formula. The mesh geometry is optimized for a specific patient using a two stage process. First, a noisy image is reconstructed on a finely-spaced uniform cloud. Then, the geometry of the representation is adaptively transformed through boundary-preserving node motion and elimination. Nodes are removed in constant intensity regions, merged along the boundaries, and moved in the direction of the mean local intensity gradient in order to provide higher node density in the boundary regions. Attenuation correction and detector geometric response are included in the system matrix. Once the mesh geometry is optimized, it is used to generate the final system matrix for ML-EM reconstruction of node intensities and for visualization of the reconstructed images. In dynamic PET or SPECT imaging, the system matrix generation procedure is performed using a quasi-static sinogram, generated by summing projection data from multiple time frames. This system matrix is then used to reconstruct the individual time frame projections. Performance of the new method is evaluated by reconstructing simulated projections of the NCAT phantom and the method is then applied to dynamic SPECT phantom and patient studies and to a dynamic microPET rat study. Tetrahedral mesh-based images are compared to the standard voxel-based reconstruction for both high and low signal-to-noise ratio
Directory of Open Access Journals (Sweden)
Emilio Garcia-Tutor
2016-12-01
Full Text Available Background: Locoregional flaps are sufficient in most sacral reconstructions. However, large sacral defects due to malignancy necessitate a different reconstructive approach, with local flaps compromised by radiation and regional flaps inadequate for broad surface areas or substantial volume obliteration. In this report, we present our experience using free muscle transfer for volumetric reconstruction in such cases, and demonstrate 3D haptic models of the sacral defect to aid preoperative planning.Methods: Five consecutive patients with irradiated sacral defects secondary to oncologic resections were included, surface area ranging from 143-600cm2. Latissimus dorsi-based free flap sacral reconstruction was performed in each case, between 2005 and 2011. Where the superior gluteal artery was compromised, the subcostal artery was used as a recipient vessel. Microvascular technique, complications and outcomes are reported. The use of volumetric analysis and 3D printing is also demonstrated, with imaging data converted to 3D images suitable for 3D printing with Osirix software (Pixmeo, Geneva, Switzerland. An office-based, desktop 3D printer was used to print 3D models of sacral defects, used to demonstrate surface area and contour and produce a volumetric print of the dead space needed for flap obliteration. Results: The clinical series of latissimus dorsi free flap reconstructions is presented, with successful transfer in all cases, and adequate soft-tissue cover and volume obliteration achieved. The original use of the subcostal artery as a recipient vessel was successfully achieved. All wounds healed uneventfully. 3D printing is also demonstrated as a useful tool for 3D evaluation of volume and dead-space.Conclusion: Free flaps offer unique benefits in sacral reconstruction where local tissue is compromised by irradiation and tumor recurrence, and dead-space requires accurate volumetric reconstruction. We describe for the first time the use of
Lin, K. H. E.; Wang, P. K.; Lee, S. Y.; Liao, Y. C.; Fan, I. C.; Liao, H. M.
2017-12-01
The Little ice Age (LIA) is one of the most prominent epochs in paleoclimate reconstruction of the Common Era. While the signals of LIA were generally discovered across hemispheres, wide arrays of regional variability were found, and the reconstructed anomalies were sometimes inconsistent across studies by using various proxy data or historical records. This inconsistency is mainly attributed to limited data coverage at fine resolution that can assist high-resolution climate reconstruction in the continuous spatiotemporal trends. Qing dynasty (1644-1911 CE) of China existed in the coldest period of LIA. Owing to a long-standing tradition that acquired local officials to record odds and social or meteorological events, thousands of local chronicles were left. Zhang eds. (2004) took two decades to compile all these meteorological records in a compendium, for which we then digitized and coded all records into our REACHS database system for reconstructing climate. There were in total 1,435 points (sites) in our database for over 80,000 events in the period of time. After implementing two-rounds coding check for data quality control (accuracy rate 87.2%), multiple indexes were retrieved for reconstructing annually and seasonally resolved temperature and precipitation series for North, Central, and South China. The reconstruction methods include frequency count and grading, with usage of multiple regression models to test sensitivity and to calculate correlations among several reconstructed series. Validation was also conducted through comparison with instrumental data and with other reconstructed series in previous studies. Major research results reveal interannual (3-5 years), decadal (8-12 years), and interdecadal (≈30 years) variabilities with strong regional expressions across East China. Cooling effect was not homogenously distributed in space and time. Flood and drought conditions frequently repeated but the spatiotemporal pattern was variant, indicating likely
3D Reconstruction of human bones based on dictionary learning.
Zhang, Binkai; Wang, Xiang; Liang, Xiao; Zheng, Jinjin
2017-11-01
An effective method for reconstructing a 3D model of human bones from computed tomography (CT) image data based on dictionary learning is proposed. In this study, the dictionary comprises the vertices of triangular meshes, and the sparse coefficient matrix indicates the connectivity information. For better reconstruction performance, we proposed a balance coefficient between the approximation and regularisation terms and a method for optimisation. Moreover, we applied a local updating strategy and a mesh-optimisation method to update the dictionary and the sparse matrix, respectively. The two updating steps are iterated alternately until the objective function converges. Thus, a reconstructed mesh could be obtained with high accuracy and regularisation. The experimental results show that the proposed method has the potential to obtain high precision and high-quality triangular meshes for rapid prototyping, medical diagnosis, and tissue engineering. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.
Similarity-regulation of OS-EM for accelerated SPECT reconstruction
Vaissier, P. E. B.; Beekman, F. J.; Goorden, M. C.
2016-06-01
Ordered subsets expectation maximization (OS-EM) is widely used to accelerate image reconstruction in single photon emission computed tomography (SPECT). Speedup of OS-EM over maximum likelihood expectation maximization (ML-EM) is close to the number of subsets used. Although a high number of subsets can shorten reconstruction times significantly, it can also cause severe image artifacts such as improper erasure of reconstructed activity if projections contain few counts. We recently showed that such artifacts can be prevented by using a count-regulated OS-EM (CR-OS-EM) algorithm which automatically adapts the number of subsets for each voxel based on the estimated number of counts that the voxel contributed to the projections. While CR-OS-EM reached high speed-up over ML-EM in high-activity regions of images, speed in low-activity regions could still be very slow. In this work we propose similarity-regulated OS-EM (SR-OS-EM) as a much faster alternative to CR-OS-EM. SR-OS-EM also automatically and locally adapts the number of subsets, but it uses a different criterion for subset regulation: the number of subsets that is used for updating an individual voxel depends on how similar the reconstruction algorithm would update the estimated activity in that voxel with different subsets. Reconstructions of an image quality phantom and in vivo scans show that SR-OS-EM retains all of the favorable properties of CR-OS-EM, while reconstruction speed can be up to an order of magnitude higher in low-activity regions. Moreover our results suggest that SR-OS-EM can be operated with identical reconstruction parameters (including the number of iterations) for a wide range of count levels, which can be an additional advantage from a user perspective since users would only have to post-filter an image to present it at an appropriate noise level.
Sparse representation based image interpolation with nonlocal autoregressive modeling.
Dong, Weisheng; Zhang, Lei; Lukac, Rastislav; Shi, Guangming
2013-04-01
Sparse representation is proven to be a promising approach to image super-resolution, where the low-resolution (LR) image is usually modeled as the down-sampled version of its high-resolution (HR) counterpart after blurring. When the blurring kernel is the Dirac delta function, i.e., the LR image is directly down-sampled from its HR counterpart without blurring, the super-resolution problem becomes an image interpolation problem. In such cases, however, the conventional sparse representation models (SRM) become less effective, because the data fidelity term fails to constrain the image local structures. In natural images, fortunately, many nonlocal similar patches to a given patch could provide nonlocal constraint to the local structure. In this paper, we incorporate the image nonlocal self-similarity into SRM for image interpolation. More specifically, a nonlocal autoregressive model (NARM) is proposed and taken as the data fidelity term in SRM. We show that the NARM-induced sampling matrix is less coherent with the representation dictionary, and consequently makes SRM more effective for image interpolation. Our extensive experimental results demonstrate that the proposed NARM-based image interpolation method can effectively reconstruct the edge structures and suppress the jaggy/ringing artifacts, achieving the best image interpolation results so far in terms of PSNR as well as perceptual quality metrics such as SSIM and FSIM.
Kakagia, D; Karadimas, E; Drosos, G; Ververidis, A; Kazakos, D; Lazarides, M; Verettas, D
2009-01-01
Primary soft tissue reconstruction in complex leg injuries is mandatory in order to protect exposed tissues; however, it may be precluded by the patient's clinical status or by local wound conditions. This retrospective study aims to evaluate the use of negative pressure as an adjunct to delayed soft tissue reconstruction in patients with complex lower limb trauma. Forty-two patients with 49 complex lower limb injuries were treated with Vacuum assisted closure (VAC) 48 hours after bone fixation, vascular repair and surgical debridement. Wound swab cultures were obtained before and after every VAC application. Duration of therapy, wound flora, final reconstructive technique required, outcome and follow-up period were retrieved from medical records. Twenty-four male and eighteen female patients were recruited, with a mean age of 47 years. All were treated with VAC therapy for 15-42 days. Reconstruction was delayed due to the patients' critical condition, advanced age, medical co-morbidities, heavily exuding wounds and questionable viability of soft tissues. Patients were followed up for 90-895 days. Two wounds healed spontaneously, 6 were managed with delayed direct suture, 31 with split thickness skin grafts and 9 required local cutaneous, fasciocutaneous or muscular flaps. One patient died due to fat embolism. Wound bacterial flora progressively decreased in all but one patient. Scar formation was aesthetically acceptable by the patients while function depended on the initial injury. Negative pressure is a safe and effective adjunct to delayed soft tissue reconstruction in high-risk patients with severe lower extremity injuries, minimizing reconstructive requirements and therefore postoperative morbidity.
Stereotactic localization and visualization of the subthalamic nucleus
Institute of Scientific and Technical Information of China (English)
SHEN Wei-gao; WANG Hai-yang; LIN Zhi-guo; SHEN Hong; CHEN Xiao-guang; FU Yi-li; GAO Wen-peng
2009-01-01
Background The subthalamic nucleus (STN) is widely recognized as one of the most important and commonly targeted nuclei in stereotactic and functional neurosurgery. The success of STN surgery depends on accuracy in target determination. Construction of a digitalized atlas of STN based on stereotactic MRI will play an instrumental role in the accuracy of anatomical localization. The aim of this study was to investigate the three-dimensional (3D) target location of STN in stereotactic space and construct a digitalized atlas of STN to accomplish the visualization of the STN on stereotactic MRI, thus providing clinical guidance on the precise anatomical localization of STN.Methods One hundred and twenty healthy people volunteered to be scanned by 1.5 Tesla MRI scanning with 1-mm-thick slice in the standard stereotactic space between 2005 and 2006. One adult male was selected for 3D reconstruction of STN. The precess of 3D reconstruction included identification, manual segmentation, extraction,conservation and reconstruction.Results There was a significant correlation between the coordinates and age (P <0.05). The volume of left STN was significantly larger than the right STN, and there was a significant negative correlation between volume and age (P <0.05).The surface of the STN nucleus after 3D reconstruction appeared smooth, natural and realistic. The morphological feature of STN on the individual brain could be visualized directly in 3D. The 3D reconstructed STN could be rotated,zoomed and displayed at any direction in the stereotactic space. The anteroposterior diameter of the STN nucleus was longer than the vertical and transverse diameters in 3D space. The 3D reconstruction of STN manifested typical structure of the "dual lens".Conclusions The visualization of individual brain atlas based on stereotactic MRI is feasible. However, software for automated segmentation, extraction and registration of MR images need to be further developed.
Microsurgical free flap reconstructions of head and neck region in 406 cases: a 13-year experience.
Gerressen, Marcus; Pastaschek, Claudia Inge; Riediger, Dieter; Hilgers, Ralf-Dieter; Hölzle, Frank; Noroozi, Nelson; Ghassemi, Alireza
2013-03-01
The reconstruction of extended soft tissue and bony defects in the maxillofacial region with microsurgical flaps is considered to be the therapy of first choice. The aim of this retrospective study was to detect different influencing factors concerning flap survival. We examined the data of 406 patient cases (121 female and 285 male cases; mean age, 57 years) undergoing reconstruction with a microsurgical flap in our facility between 1998 and 2010. In these cases 326 soft tissue flaps (radial forearm flap, scapula flap, latissimus dorsi flap, anterolateral thigh flap, lateral arm flap, and jejunum flap) and 80 bony flaps (fibula flap and deep circumflex iliac artery flap) were examined. Evaluated parameters were, among others, the timing of reconstruction, defect localization, and recipient vessels used (external vs internal jugular system), as well as anticoagulative management. We statistically analyzed data by means of a χ(2) test, taking account of the odds ratio with P < .05, which was deemed significant. The overall flap survival rate was approximately 92%, without any gender- or age-specific differences. Primary reconstructions proceeded distinctly more successfully than secondary reconstructions (P < .01). Likewise, the defect localization exerted a significant effect on the survival rate (P = .01), with a more caudal localization affecting flap survival positively. Finally, neither the anticoagulation regimen nor the choice of recipient vein system exercised an influence on the survival rate. Microsurgical tissue transfer is a convenient and reliable method in maxillofacial surgery, provided that one is aware of the determining factors for success. Copyright © 2013 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
Breast reconstruction after mastectomy
Directory of Open Access Journals (Sweden)
Daniel eSchmauss
2016-01-01
Full Text Available Breast cancer is the leading cause of cancer death in women worldwide. Its surgical approach has become less and less mutilating in the last decades. However, the overall number of breast reconstructions has significantly increased lately. Nowadays breast reconstruction should be individualized at its best, first of all taking into consideration oncological aspects of the tumor, neo-/adjuvant treatment and genetic predisposition, but also its timing (immediate versus delayed breast reconstruction, as well as the patient’s condition and wish. This article gives an overview over the various possibilities of breast reconstruction, including implant- and expander-based reconstruction, flap-based reconstruction (vascularized autologous tissue, the combination of implant and flap, reconstruction using non-vascularized autologous fat, as well as refinement surgery after breast reconstruction.
Breast reconstruction - implants
Breast implants surgery; Mastectomy - breast reconstruction with implants; Breast cancer - breast reconstruction with implants ... harder to find a tumor if your breast cancer comes back. Getting breast implants does not take as long as breast reconstruction ...
Subspace exclusion zones for damage localization
DEFF Research Database (Denmark)
Bernal, Dionisio; Ulriksen, Martin Dalgaard
2018-01-01
, this is exploited in the context of structural damage localization to cast the Subspace Exclusion Zone (SEZ) scheme, which locates damage by reconstructing the captured field quantity shifts from analytical subspaces indexed by postulated boundaries, the so-called exclusion zones (EZs), in a model of the structure...
L'Aquila's reconstruction challenges: has Italy learned from its previous earthquake disasters?
Ozerdem, Alpaslan; Rufini, Gianni
2013-01-01
Italy is an earthquake-prone country and its disaster emergency response experiences over the past few decades have varied greatly, with some being much more successful than others. Overall, however, its reconstruction efforts have been criticised for being ad hoc, delayed, ineffective, and untargeted. In addition, while the emergency relief response to the L'Aquila earthquake of 6 April 2009-the primary case study in this evaluation-seems to have been successful, the reconstruction initiative got off to a very problematic start. To explore the root causes of this phenomenon, the paper argues that, owing to the way in which Italian Prime Minister Silvio Berlusconi has politicised the process, the L'Aquila reconstruction endeavour is likely to suffer problems with local ownership, national/regional/municipal coordination, and corruption. It concludes with a set of recommendations aimed at addressing the pitfalls that may confront the L'Aquila reconstruction process over the next few years. © 2013 The Author(s). Journal compilation © Overseas Development Institute, 2013.
Machine-learning model observer for detection and localization tasks in clinical SPECT-MPI
Parages, Felipe M.; O'Connor, J. Michael; Pretorius, P. Hendrik; Brankov, Jovan G.
2016-03-01
In this work we propose a machine-learning MO based on Naive-Bayes classification (NB-MO) for the diagnostic tasks of detection, localization and assessment of perfusion defects in clinical SPECT Myocardial Perfusion Imaging (MPI), with the goal of evaluating several image reconstruction methods used in clinical practice. NB-MO uses image features extracted from polar-maps in order to predict lesion detection, localization and severity scores given by human readers in a series of 3D SPECT-MPI. The population used to tune (i.e. train) the NB-MO consisted of simulated SPECT-MPI cases - divided into normals or with lesions in variable sizes and locations - reconstructed using filtered backprojection (FBP) method. An ensemble of five human specialists (physicians) read a subset of simulated reconstructed images, and assigned a perfusion score for each region of the left-ventricle (LV). Polar-maps generated from the simulated volumes along with their corresponding human scores were used to train five NB-MOs (one per human reader), which are subsequently applied (i.e. tested) on three sets of clinical SPECT-MPI polar maps, in order to predict human detection and localization scores. The clinical "testing" population comprises healthy individuals and patients suffering from coronary artery disease (CAD) in three possible regions, namely: LAD, LcX and RCA. Each clinical case was reconstructed using three reconstruction strategies, namely: FBP with no SC (i.e. scatter compensation), OSEM with Triple Energy Window (TEW) SC method, and OSEM with Effective Source Scatter Estimation (ESSE) SC. Alternative Free-Response (AFROC) analysis of perfusion scores shows that NB-MO predicts a higher human performance for scatter-compensated reconstructions, in agreement with what has been reported in published literature. These results suggest that NB-MO has good potential to generalize well to reconstruction methods not used during training, even for reasonably dissimilar datasets (i
Phase-correcting non-local means filtering for diffusion-weighted imaging of the spinal cord.
Kafali, Sevgi Gokce; Çukur, Tolga; Saritas, Emine Ulku
2018-02-09
DWI suffers from low SNR when compared to anatomical MRI. To maintain reasonable SNR at relatively high spatial resolution, multiple acquisitions must be averaged. However, subject motion or involuntary physiological motion during diffusion-sensitizing gradients cause phase offsets among acquisitions. When the motion is localized to a small region, these phase offsets become particularly problematic. Complex averaging of acquisitions lead to cancellations from these phase offsets, whereas magnitude averaging results in noise amplification. Here, we propose an improved reconstruction for multi-acquisition DWI that effectively corrects for phase offsets while reducing noise. Each acquisition is processed with a refocusing reconstruction for global phase correction and a partial k-space reconstruction via projection-onto-convex-sets (POCS). The proposed reconstruction then embodies a new phase-correcting non-local means (PC-NLM) filter. PC-NLM is performed on the complex-valued outputs of the POCS algorithm aggregated across acquisitions. The PC-NLM filter leverages the shared structure among multiple acquisitions to simultaneously alleviate nuisance factors including phase offsets and noise. Extensive simulations and in vivo DWI experiments of the cervical spinal cord are presented. The results demonstrate that the proposed reconstruction improves image quality by mitigating signal loss because of phase offsets and reducing noise. Importantly, these improvements are achieved while preserving the accuracy of apparent diffusion coefficient maps. An improved reconstruction incorporating a PC-NLM filter for multi-acquisition DWI is presented. This reconstruction can be particularly beneficial for high-resolution or high-b-value DWI acquisitions that suffer from low SNR and phase offsets from local motion. © 2018 International Society for Magnetic Resonance in Medicine.
Directory of Open Access Journals (Sweden)
Hyeuknam Kwon
2013-01-01
Full Text Available Electrical Impedance Tomography (EIT is a very attractive functional imaging method despite the low sensitivity and resolution. The use of internal electrodes with the conventional reconstruction algorithms was not enough to enhance image resolution and accuracy in the region of interest (ROI. We propose a local ROI imaging method with internal electrodes developed from careful analysis of the sensitivity matrix that is designed to reduce the sensitivity of the voxels outside the local region and optimize the sensitivity of the voxel inside the local region. We perform numerical simulations and physical measurements to demonstrate the localized EIT imaging method. In preliminary results with multiple objects we show the benefits of using an internal electrode and the improved resolution due to the local ROI image reconstruction method. The sensitivity is further increased by allowing the surface electrodes to be unevenly spaced with a higher density of surface electrodes near the ROI. Also, we analyse how much the image quality is improved using several performance parameters for comparison. While these have not yet been studied in depth, it convincingly shows an improvement in local sensitivity in images obtained with an internal electrode in comparison to a standard reconstruction method.
Impact of Alternative Inputs and Grooming Methods on Large-R Jet Reconstruction in ATLAS
The ATLAS collaboration
2017-01-01
During Run 1 of the LHC, the optimal reconstruction algorithm for large-$R$ jets in ATLAS, characterized in terms of the ability to discriminate signal from background and robust reconstruction in the presence of pileup, was found to be anti-$k_{t}$ jets with a radius parameter of 1.0, formed from locally calibrated topological calorimeter cell clusters and groomed with the trimming algorithm to remove contributions from pileup and underlying event. Since that time, much theoretical, phenomenological, and experimental work has been performed to improve both the reconstruction of the jet inputs as well as the grooming techniques applied to reconstructed jets. In this work, an inclusive survey of both pileup mitigation algorithms applied to calorimeter cell clusters and grooming algorithms is done to study their pileup stability and ability to identify hadronically decaying W bosons within the ATLAS experiment. It is found that compared to the conventional reconstruction algorithm of large-$R$ trimmed jets form...
Adaptive algebraic reconstruction technique
International Nuclear Information System (INIS)
Lu Wenkai; Yin Fangfang
2004-01-01
Algebraic reconstruction techniques (ART) are iterative procedures for reconstructing objects from their projections. It is proven that ART can be computationally efficient by carefully arranging the order in which the collected data are accessed during the reconstruction procedure and adaptively adjusting the relaxation parameters. In this paper, an adaptive algebraic reconstruction technique (AART), which adopts the same projection access scheme in multilevel scheme algebraic reconstruction technique (MLS-ART), is proposed. By introducing adaptive adjustment of the relaxation parameters during the reconstruction procedure, one-iteration AART can produce reconstructions with better quality, in comparison with one-iteration MLS-ART. Furthermore, AART outperforms MLS-ART with improved computational efficiency
Reconstructive dosimetry for cutaneous radiation syndrome
Energy Technology Data Exchange (ETDEWEB)
Lima, C.M.A.; Lima, A.R.; Degenhardt, Ä.L.; Da Silva, F.C.A., E-mail: dasilva@ird.gov.br [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Valverde, N.J. [Fundacao Eletronuclear de Assistencia Medica, Rio de Janeiro, RJ (Brazil)
2015-10-15
According to the International Atomic Energy Agency (IAEA), a relatively significant number of radiological accidents have occurred in recent years mainly because of the practices referred to as potentially high-risk activities, such as radiotherapy, large irradiators and industrial radiography, especially in gammagraphy assays. In some instances, severe injuries have occurred in exposed persons due to high radiation doses. In industrial radiography, 80 cases involving a total of 120 radiation workers, 110 members of the public including 12 deaths have been recorded up to 2014. Radiological accidents in industrial practices in Brazil have mainly resulted in development of cutaneous radiation syndrome (CRS) in hands and fingers. Brazilian data include 5 serious cases related to industrial gammagraphy, affecting 7 radiation workers and 19 members of the public; however, none of them were fatal. Some methods of reconstructive dosimetry have been used to estimate the radiation dose to assist in prescribing medical treatment. The type and development of cutaneous manifestations in the exposed areas of a person is the first achievable gross dose estimation. This review article presents the state-of-the-art reconstructive dosimetry methods enabling estimation of local radiation doses and provides guidelines for medical handling of the exposed individuals. The review also presents the Chilean and Brazilian radiological accident cases to highlight the importance of reconstructive dosimetry. (author)
Improving parallel imaging by jointly reconstructing multi-contrast data.
Bilgic, Berkin; Kim, Tae Hyung; Liao, Congyu; Manhard, Mary Kate; Wald, Lawrence L; Haldar, Justin P; Setsompop, Kawin
2018-08-01
To develop parallel imaging techniques that simultaneously exploit coil sensitivity encoding, image phase prior information, similarities across multiple images, and complementary k-space sampling for highly accelerated data acquisition. We introduce joint virtual coil (JVC)-generalized autocalibrating partially parallel acquisitions (GRAPPA) to jointly reconstruct data acquired with different contrast preparations, and show its application in 2D, 3D, and simultaneous multi-slice (SMS) acquisitions. We extend the joint parallel imaging concept to exploit limited support and smooth phase constraints through Joint (J-) LORAKS formulation. J-LORAKS allows joint parallel imaging from limited autocalibration signal region, as well as permitting partial Fourier sampling and calibrationless reconstruction. We demonstrate highly accelerated 2D balanced steady-state free precession with phase cycling, SMS multi-echo spin echo, 3D multi-echo magnetization-prepared rapid gradient echo, and multi-echo gradient recalled echo acquisitions in vivo. Compared to conventional GRAPPA, proposed joint acquisition/reconstruction techniques provide more than 2-fold reduction in reconstruction error. JVC-GRAPPA takes advantage of additional spatial encoding from phase information and image similarity, and employs different sampling patterns across acquisitions. J-LORAKS achieves a more parsimonious low-rank representation of local k-space by considering multiple images as additional coils. Both approaches provide dramatic improvement in artifact and noise mitigation over conventional single-contrast parallel imaging reconstruction. Magn Reson Med 80:619-632, 2018. © 2018 International Society for Magnetic Resonance in Medicine. © 2018 International Society for Magnetic Resonance in Medicine.
Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo
International Nuclear Information System (INIS)
Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu
2016-01-01
Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.
Cao, Wuteng; Li, Fangqian; Gong, Jiaying; Liu, Dechao; Deng, Yanhong; Kang, Liang; Zhou, Zhiyang
2016-11-22
To investigate the efficacy of liver acquisition with acceleration volume acquisition (LAVA) gadolinium-enhanced magnetic resonance (MR) sequences and to assess its added accuracy in diagnosing local recurrence (LR) of rectal cancer with conventional T2-weighted fast spin echo (FSE) sequences. Pelvic MRI, including T2-weighted FSE sequences, gadolinium-enhanced sequences of LAVA and T1-weighted FSE with fat suppression, was performed on 225 patients with postoperative rectal cancer. Two readers evaluated the presence of LR according to "T2" (T2 sequences only), "T2 + LAVA-Gad" (LAVA and T2 imaging), and "T2 + T1-fs-Gad" (T1 fat suppression-enhanced sequence with T2 images). To evaluate diagnostic efficiency, imaging quality with LAVA and T1-fs-Gad by subjective scores and the signal intensity (SI) ratio. In the result, the SI ratio of LAVA was significantly higher than that of T1-fs-Gad (p = 0.0001). The diagnostic efficiency of "T2 + LAVA-Gad" was better than that of "T2 + T1-fs-Gad" (p = 0.0016 for Reader 1, p = 0.0001 for Reader 2) and T2 imaging only (p = 0.0001 for Reader 1; p = 0.0001 for Reader 2). Therefore, LAVA gadolinium-enhanced MR increases the accuracy of diagnosis of LR from rectal cancer and could replace conventional T1 gadolinium-enhanced sequences in the postoperative pelvic follow-up of rectal cancer.
Liu, Guo-Chin; Ichiki, Kiyotomo; Tashiro, Hiroyuki; Sugiyama, Naoshi
2016-07-01
Scattering of cosmic microwave background (CMB) radiation in galaxy clusters induces polarization signals determined by the quadrupole anisotropy in the photon distribution at the location of clusters. This `remote quadrupole' derived from the measurements of the induced polarization in galaxy clusters provides an opportunity to reconstruct local CMB temperature anisotropies. In this Letter, we develop an algorithm of the reconstruction through the estimation of the underlying primordial gravitational potential, which is the origin of the CMB temperature and polarization fluctuations and CMB induced polarization in galaxy clusters. We found a nice reconstruction for the quadrupole and octopole components of the CMB temperature anisotropies with the assistance of the CMB induced polarization signals. The reconstruction can be an important consistency test on the puzzles of CMB anomalies, especially for the low-quadrupole and axis-of-evil problems reported in Wilkinson Microwave Anisotropy Probe and Planck data.
Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells
Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor
2013-01-01
Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787
Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells
Directory of Open Access Journals (Sweden)
Gábor Vasas
2013-09-01
Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.
International Nuclear Information System (INIS)
EL-SHERBINY, M.
2008-01-01
bone flaps were nonunion of one end in 2 cases of PLSCG and one case of FVFG. Limb shortening was seen in 32 cases with PLSCG. Conclusion: Summarizing our experience in this small study, we can state that, limb sparing surgical resection of tumors of the proximal humerus is effective in local tumor control and preserving hand and elbow movements. MSTS functional score of the limb after reconstruction and shoulder fusion with FVFG or PLSCG is nearly the same as mobile shoulder reconstruction with endo prosthesis. Shoulder range of movement was grossly limited with prosthesis replacement while a wider range of movement was obtained with shoulder fusion. Pedicled lateral scapular crest graft is able to bridge defects only up to 12 cm whereas the fibula can replace a longer defect. Selection between those reconstructive options should be individualized and is based on the age, the length of defect, the type of resection, intraarticular or extra articular, preservation of deltoid and axillary nerve, the prognosis of the tumor.
International Nuclear Information System (INIS)
Staraselski, Y; Brahme, A; Inal, K; Mishra, R K
2015-01-01
This paper presents the first application of three-dimensional (3D) cross-correlation microstructure reconstruction implemented for a representative volume element (RVE) to facilitate the microstructure engineering of materials. This has been accomplished by developing a new methodology for reconstructing 3D microstructure using experimental two-dimensional electron backscatter diffraction data. The proposed methodology is based on the analytical representation of the generalized form of the two-point correlation function—the distance-disorientation function (DDF). Microstructure reconstruction is accomplished by extending the simulated annealing techniques to perform three term reconstruction with a minimization of the DDF. The new 3D microstructure reconstruction algorithm is employed to determine the 3D RVE containing all of the relevant microstructure information for accurately computing the mechanical response of solids, especially when local microstructural variations influence the global response of the material as in the case of fracture initiation. (paper)
On a full Bayesian inference for force reconstruction problems
Aucejo, M.; De Smet, O.
2018-05-01
In a previous paper, the authors introduced a flexible methodology for reconstructing mechanical sources in the frequency domain from prior local information on both their nature and location over a linear and time invariant structure. The proposed approach was derived from Bayesian statistics, because of its ability in mathematically accounting for experimenter's prior knowledge. However, since only the Maximum a Posteriori estimate was computed, the posterior uncertainty about the regularized solution given the measured vibration field, the mechanical model and the regularization parameter was not assessed. To answer this legitimate question, this paper fully exploits the Bayesian framework to provide, from a Markov Chain Monte Carlo algorithm, credible intervals and other statistical measures (mean, median, mode) for all the parameters of the force reconstruction problem.
Molinelli, Valeria; Angeretti, Maria Gloria; Duka, Ejona; Tarallo, Nicola; Bracchi, Elena; Novario, Raffaele; Fugazzola, Carlo
2018-03-14
To evaluate whether the addition of gadolinium-enhanced MRI and diffusion-weighted imaging (DWI) improves T2 sequence performance for the diagnosis of local recurrence (LR) from rectal cancer and to assess which approach is better at formulating this diagnosis among readers with different experience. Forty-three patients with suspected LR underwent pelvic MRI with T2 weighted (T2) sequences, gadolinium fat-suppressed T1 weighted sequences (post-contrast T1), and DWI sequences. Three readers (expert: G, intermediate: E, resident: V) scored the likelihood of LR on T2, T2 + post-contrast T1, T2 + DWI, and T2 + post-contrast T1 + DWI. In total, 18/43 patients had LR; on T2 images, the expert reader achieved an area under the ROC curve (AUC) of 0.916, sensitivity of 88.9%, and specificity of 76%; the intermediate reader achieved values of 0.890, 88.9%, and 48%, respectively, and the resident achieved values of 0.852, 88.9%, and 48%, respectively. DWI significantly improved the AUC value for the expert radiologist by up to 0.999 (p = 0.04), while post-contrast T1 significantly improved the AUC for the resident by up to 0.950 (p = 0.04). For the intermediate reader, both the T2 + DWI AUC and T2 + post-contrast T1 AUC were better than the T2 AUC (0.976 and 0.980, respectively), but with no statistically significant difference. No statistically significant difference was achieved by any of the three readers by comparing either the T2 + DWI AUCs to the T2 + post-contrast T1 AUCs or the AUCs of the two pairs of sequences to those of the combined three sequences. Furthermore, using the T2 sequences alone, all of the readers achieved a fair number of "equivocal" cases: they decreased with the addition of either DWI or post-contrast T1 sequences and, for the two less experienced readers, they decreased even more with the three combined sequences. Both DWI and T1 post-contrast MRI increased diagnostic performance for LR diagnosis compared to T2; however, no
Comprehensive Use of Curvature for Robust and Accurate Online Surface Reconstruction.
Lefloch, Damien; Kluge, Markus; Sarbolandi, Hamed; Weyrich, Tim; Kolb, Andreas
2017-12-01
Interactive real-time scene acquisition from hand-held depth cameras has recently developed much momentum, enabling applications in ad-hoc object acquisition, augmented reality and other fields. A key challenge to online reconstruction remains error accumulation in the reconstructed camera trajectory, due to drift-inducing instabilities in the range scan alignments of the underlying iterative-closest-point (ICP) algorithm. Various strategies have been proposed to mitigate that drift, including SIFT-based pre-alignment, color-based weighting of ICP pairs, stronger weighting of edge features, and so on. In our work, we focus on surface curvature as a feature that is detectable on range scans alone and hence does not depend on accurate multi-sensor alignment. In contrast to previous work that took curvature into consideration, however, we treat curvature as an independent quantity that we consistently incorporate into every stage of the real-time reconstruction pipeline, including densely curvature-weighted ICP, range image fusion, local surface reconstruction, and rendering. Using multiple benchmark sequences, and in direct comparison to other state-of-the-art online acquisition systems, we show that our approach significantly reduces drift, both when analyzing individual pipeline stages in isolation, as well as seen across the online reconstruction pipeline as a whole.
Estimation of 3D reconstruction errors in a stereo-vision system
Belhaoua, A.; Kohler, S.; Hirsch, E.
2009-06-01
The paper presents an approach for error estimation for the various steps of an automated 3D vision-based reconstruction procedure of manufactured workpieces. The process is based on a priori planning of the task and built around a cognitive intelligent sensory system using so-called Situation Graph Trees (SGT) as a planning tool. Such an automated quality control system requires the coordination of a set of complex processes performing sequentially data acquisition, its quantitative evaluation and the comparison with a reference model (e.g., CAD object model) in order to evaluate quantitatively the object. To ensure efficient quality control, the aim is to be able to state if reconstruction results fulfill tolerance rules or not. Thus, the goal is to evaluate independently the error for each step of the stereo-vision based 3D reconstruction (e.g., for calibration, contour segmentation, matching and reconstruction) and then to estimate the error for the whole system. In this contribution, we analyze particularly the segmentation error due to localization errors for extracted edge points supposed to belong to lines and curves composing the outline of the workpiece under evaluation. The fitting parameters describing these geometric features are used as quality measure to determine confidence intervals and finally to estimate the segmentation errors. These errors are then propagated through the whole reconstruction procedure, enabling to evaluate their effect on the final 3D reconstruction result, specifically on position uncertainties. Lastly, analysis of these error estimates enables to evaluate the quality of the 3D reconstruction, as illustrated by the shown experimental results.
Chiral Orientation of Skeletal Muscle Cells Requires Rigid Substrate
Directory of Open Access Journals (Sweden)
Ninghao Zhu
2017-06-01
Full Text Available Reconstitution of tissue morphology with inherent left–right (LR asymmetry is essential for tissue/organ functions. For skeletal muscle, the largest tissue in mammalian organisms, successful myogenesis requires the regulation of the LR asymmetry to form the appropriate muscle alignment. However, the key factor for reproducing the LR asymmetry of skeletal tissues in a controllable, engineering context remains largely unknown. Recent reports indicate that cell chirality may underlie the LR development in tissue morphogenesis. Here, we report that a rigid substrate is required for the chirality of skeletal muscle cells. By using alternating micropatterned cell-adherent and cell-repellent stripes on a rigid substrate, we found that C2C12 skeletal muscle myoblasts exhibited a unidirectional tilted orientation with respect to the stripe boundary. Importantly, such chiral orientation was reduced when soft substrates were used instead. In addition, we demonstrated the key role of actin stress fibers in the formation of the chiral orientation. This study reveals that a rigid substrate is required for the chiral pattern of myoblasts, paving the way for reconstructing damaged muscle tissue with inherent LR asymmetry in the future.
Determination of power density in VVER-1000 Mock-Up in LR-0 reactor
Directory of Open Access Journals (Sweden)
Košál Michal
2017-01-01
Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.
Online 4-dimensional event reconstruction in the CBM experiment
Energy Technology Data Exchange (ETDEWEB)
Akishina, Valentina [Goethe-Universitaet Frankfurt, Frankfurt am Main (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Joint Institute for Nuclear Research, Dubna (Russian Federation); Kisel, Ivan [Goethe-Universitaet Frankfurt, Frankfurt am Main (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Frankfurt Institute for Advanced Studies, Frankfurt am Main (Germany); Collaboration: CBM-Collaboration
2015-07-01
The heavy-ion experiment CBM will focus on the measurement of rare probes at interaction rates up to 10 MHz with data flow of up to 1 TB/s. The free-running data acquisition, delivering a stream of untriggered detector data, requires full event reconstruction and selection to be performed online not only in space, but also in time. The First-Level Event Selection package consists of several modules: track finding, track fitting, short-lived particles finding, event building and event selection. For track reconstruction the Cellular Automaton (CA) method is used, which allows to reconstruct tracks with high efficiency in a time-slice and perform event building. The time-based CA track finder allows to resolve tracks from a time-slice in event-corresponding groups. The algorithm is intrinsically local and the implementation is both vectorized and parallelized between CPU cores. The CA track finder shows a strong scalability on many-core systems. The speed-up factor of 10.6 on a CPU with 10 hyper-threaded physical cores was achieved.
Ma, Ming; Wang, Huafeng; Liu, Yan; Zhang, Hao; Gu, Xianfeng; Liang, Zhengrong
2014-03-01
Cone-beam computed tomography (CBCT) has attracted growing interest of researchers in image reconstruction. The mAs level of the X-ray tube current, in practical application of CBCT, is mitigated in order to reduce the CBCT dose. The lowering of the X-ray tube current, however, results in the degradation of image quality. Thus, low-dose CBCT image reconstruction is in effect a noise problem. To acquire clinically acceptable quality of image, and keep the X-ray tube current as low as achievable in the meanwhile, some penalized weighted least-squares (PWLS)-based image reconstruction algorithms have been developed. One representative strategy in previous work is to model the prior information for solution regularization using an anisotropic penalty term. To enhance the edge preserving and noise suppressing in a finer scale, a novel algorithm combining the local binary pattern (LBP) with penalized weighted leastsquares (PWLS), called LBP-PWLS-based image reconstruction algorithm, is proposed in this work. The proposed LBP-PWLS-based algorithm adaptively encourages strong diffusion on the local spot/flat region around a voxel and less diffusion on edge/corner ones by adjusting the penalty for cost function, after the LBP is utilized to detect the region around the voxel as spot, flat and edge ones. The LBP-PWLS-based reconstruction algorithm was evaluated using the sinogram data acquired by a clinical CT scanner from the CatPhan® 600 phantom. Experimental results on the noiseresolution tradeoff measurement and other quantitative measurements demonstrated its feasibility and effectiveness in edge preserving and noise suppressing in comparison with a previous PWLS reconstruction algorithm.
Reconstructing extreme AMOC events through nudging of the ocean surface: a perfect model approach
Ortega, Pablo; Guilyardi, Eric; Swingedouw, Didier; Mignot, Juliette; Nguyen, Sébastien
2017-11-01
While the Atlantic Meridional Overturning Circulation (AMOC) is thought to be a crucial component of the North Atlantic climate, past changes in its strength are challenging to quantify, and only limited information is available. In this study, we use a perfect model approach with the IPSL-CM5A-LR model to assess the performance of several surface nudging techniques in reconstructing the variability of the AMOC. Special attention is given to the reproducibility of an extreme positive AMOC peak from a preindustrial control simulation. Nudging includes standard relaxation techniques towards the sea surface temperature and salinity anomalies of this target control simulation, and/or the prescription of the wind-stress fields. Surface nudging approaches using standard fixed restoring terms succeed in reproducing most of the target AMOC variability, including the timing of the extreme event, but systematically underestimate its amplitude. A detailed analysis of the AMOC variability mechanisms reveals that the underestimation of the extreme AMOC maximum comes from a deficit in the formation of the dense water masses in the main convection region, located south of Iceland in the model. This issue is largely corrected after introducing a novel surface nudging approach, which uses a varying restoring coefficient that is proportional to the simulated mixed layer depth, which, in essence, keeps the restoring time scale constant. This new technique substantially improves water mass transformation in the regions of convection, and in particular, the formation of the densest waters, which are key for the representation of the AMOC extreme. It is therefore a promising strategy that may help to better constrain the AMOC variability and other ocean features in the models. As this restoring technique only uses surface data, for which better and longer observations are available, it opens up opportunities for improved reconstructions of the AMOC over the last few decades.
Directory of Open Access Journals (Sweden)
Amit Kharat
2015-01-01
Full Text Available Localized anterior arthrofibrosis (cyclops lesion is having around 1-9.8% frequency rate after anterior cruciate ligament (ACL reconstruction. It has been reported to be a significant cause of loss of knee extension after reconstruction of the ACL of the knee. We present a case report of a patient with prior ACL reconstruction who presented with pain and loss of extension following surgery. MR imaging revealed the typical features of cyclops lesion. Repeat arthroscopy excision of the lesion is the only treatment to reduce the morbidity of the patient.
Pietrosimone, Brian; Loeser, Richard F; Blackburn, J Troy; Padua, Darin A; Harkey, Matthew S; Stanley, Laura E; Luc-Harkey, Brittney A; Ulici, Veronica; Marshall, Stephen W; Jordan, Joanne M; Spang, Jeffery T
2017-10-01
The purpose of our study was to determine the association between biomechanical outcomes of walking gait (peak vertical ground reaction force [vGRF], vGRF loading rate [vGRF-LR], and knee adduction moment [KAM]) 6 months following anterior cruciate ligament reconstruction (ACLR) and biochemical markers of serum type-II collagen turnover (collagen type-II cleavage product to collagen type-II C-propeptide [C2C:CPII]), plasma degenerative enzymes (matrix metalloproteinase-3 [MMP-3]), and a pro-inflammatory cytokine (interleukin-6 [IL-6]). Biochemical markers were evaluated within the first 2 weeks (6.5 ± 3.8 days) following ACL injury and again 6 months following ACLR in eighteen participants. All peak biomechanical outcomes were extracted from the first 50% of the stance phase of walking gait during a 6-month follow-up exam. Limb symmetry indices (LSI) were used to normalize the biomechanical outcomes in the ACLR limb to that of the contralateral limb (ACLR/contralateral). Bivariate correlations were used to assess associations between biomechanical and biochemical outcomes. Greater plasma MMP-3 concentrations after ACL injury and at the 6-month follow-up exam were associated with lesser KAM LSI. Lesser KAM was associated with greater plasma IL-6 at the 6-month follow-up exam. Similarly, lesser vGRF-LR LSI was associated with greater plasma MMP-3 concentrations at the 6-month follow-up exam. Lesser peak vGRF LSI was associated with higher C2C:CPII after ACL injury, yet this association was not significant after accounting for walking speed. Therefore, lesser biomechanical loading in the ACLR limb, compared to the contralateral limb, 6 months following ACLR may be related to deleterious joint tissue metabolism that could influence future cartilage breakdown. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2288-2297, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Valentini, Anna Lia, E-mail: alvalentini@rm.unicatt.it [Department of Bioimaging and Radiological Sciences, Section of Radiology, Universita Cattolica del Sacro Cuore di Roma, Milan (Italy); Gui, Benedetta [Department of Bioimaging and Radiological Sciences, Section of Radiology, Universita Cattolica del Sacro Cuore di Roma, Milan (Italy); D' Agostino, Giuseppe Roberto; Mattiucci, Giancarlo [Department of Bioimaging and Radiological Sciences, Section of Radiotherapy, Universita Cattolica del Sacro Cuore di Roma, Milan (Italy); Clementi, Valeria [Clinical Science Development Group, GE Healthcare, Milan (Italy); Di Molfetta, Ippolita Valentina [Department of Bioimaging and Radiological Sciences, Section of Radiology, Universita Cattolica del Sacro Cuore di Roma, Milan (Italy); Bonomo, Pierluigi [OU Clinic Radiobiology, I.F.C.A. Florence (Italy); Mantini, Giovanna [Department of Bioimaging and Radiological Sciences, Section of Radiotherapy, Universita Cattolica del Sacro Cuore di Roma, Milan (Italy)
2012-11-01
Purpose: To correlate results of three-dimensional magnetic resonance spectroscopic imaging (MRSI) with prostate-specific antigen (PSA) levels and time since external beam irradiation (EBRT) in patients treated with long-term hormone therapy (HT) and EBRT for locally advanced disease to verify successful treatment by documenting the achievement of metabolic atrophy (MA). Methods and Materials: Between 2006 and 2008, 109 patients were consecutively enrolled. MA was assessed by choline and citrate peak area-to-noise-ratio <5:1. Cancerous metabolism (CM) was defined by choline-to-creatine ratio >1.5:1 or choline signal-to-noise-ratio >5:1. To test the strength of association between MRSI results and the time elapsed since EBRT (TEFRT), PSA levels, Gleason score (GS), and stage, logistic regression (LR) was performed. p value <0.05 was statistically significant. The patients' outcomes were verified in 2011. Results: MRSI documented MA in 84 of 109 and CM in 25 of 109 cases. LR showed that age, GS, stage, and initial and recent PSA had no significant impact on MRSI results which were significantly related to PSA values at the time of MRSI and to TEFRT. Patients were divided into three groups according to TEFRT: <1 year, 1-2 years, and >2 years. MA was detected in 54.1% of patients of group 1, 88.9% of group 2, and in 94.5% of group 3 (100% when PSA nadir was reached). CM was detected in 50% of patients with reached PSA nadir in group 1. Local relapse was found in 3 patients previously showing CM at long TEFRT. Conclusion: MA detection, indicative of successful treatment because growth of normal or abnormal cells cannot occur without metabolism, increases with decreasing PSA levels and increasing time on HT after EBRT. This supports long-term HT in advanced prostate cancer. Larger study series are needed to assess whether MRSI could predict local relapse by detecting CM at long TEFRT.
Detection and correction of patient movement in prostate brachytherapy seed reconstruction
Lam, Steve T.; Cho, Paul S.; Marks, Robert J., II; Narayanan, Sreeram
2005-05-01
Intraoperative dosimetry of prostate brachytherapy can help optimize the dose distribution and potentially improve clinical outcome. Evaluation of dose distribution during the seed implant procedure requires the knowledge of 3D seed coordinates. Fluoroscopy-based seed localization is a viable option. From three x-ray projections obtained at different gantry angles, 3D seed positions can be determined. However, when local anaesthesia is used for prostate brachytherapy, the patient movement during fluoroscopy image capture becomes a practical problem. If uncorrected, the errors introduced by patient motion between image captures would cause seed mismatches. Subsequently, the seed reconstruction algorithm would either fail to reconstruct or yield erroneous results. We have developed an algorithm that permits detection and correction of patient movement that may occur between fluoroscopy image captures. The patient movement is decomposed into translational shifts along the tabletop and rotation about an axis perpendicular to the tabletop. The property of spatial invariance of the co-planar imaging geometry is used for lateral movement correction. Cranio-caudal movement is corrected by analysing the perspective invariance along the x-ray axis. Rotation is estimated by an iterative method. The method can detect and correct for the range of patient movement commonly seen in the clinical environment. The algorithm has been implemented for routine clinical use as the preprocessing step for seed reconstruction.
International Nuclear Information System (INIS)
Cerrada, Lucia; San Martin, Jesus
2011-01-01
In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.
Goodenberger, Martin H; Wagner-Bartak, Nicolaus A; Gupta, Shiva; Liu, Xinming; Yap, Ramon Q; Sun, Jia; Tamm, Eric P; Jensen, Corey T
The purpose of this study was to compare abdominopelvic computed tomography images reconstructed with adaptive statistical iterative reconstruction-V (ASIR-V) with model-based iterative reconstruction (Veo 3.0), ASIR, and filtered back projection (FBP). Abdominopelvic computed tomography scans for 36 patients (26 males and 10 females) were reconstructed using FBP, ASIR (80%), Veo 3.0, and ASIR-V (30%, 60%, 90%). Mean ± SD patient age was 32 ± 10 years with mean ± SD body mass index of 26.9 ± 4.4 kg/m. Images were reviewed by 2 independent readers in a blinded, randomized fashion. Hounsfield unit, noise, and contrast-to-noise ratio (CNR) values were calculated for each reconstruction algorithm for further comparison. Phantom evaluation of low-contrast detectability (LCD) and high-contrast resolution was performed. Adaptive statistical iterative reconstruction-V 30%, ASIR-V 60%, and ASIR 80% were generally superior qualitatively compared with ASIR-V 90%, Veo 3.0, and FBP (P ASIR-V 60% with respective CNR values of 5.54 ± 2.39, 8.78 ± 3.15, and 3.49 ± 1.77 (P ASIR 80% had the best and worst spatial resolution, respectively. Adaptive statistical iterative reconstruction-V 30% and ASIR-V 60% provided the best combination of qualitative and quantitative performance. Adaptive statistical iterative reconstruction 80% was equivalent qualitatively, but demonstrated inferior spatial resolution and LCD.
Shi, Junwei; Zhang, Bin; Liu, Fei; Luo, Jianwen; Bai, Jing
2013-09-15
For the ill-posed fluorescent molecular tomography (FMT) inverse problem, the L1 regularization can protect the high-frequency information like edges while effectively reduce the image noise. However, the state-of-the-art L1 regularization-based algorithms for FMT reconstruction are expensive in memory, especially for large-scale problems. An efficient L1 regularization-based reconstruction algorithm based on nonlinear conjugate gradient with restarted strategy is proposed to increase the computational speed with low memory consumption. The reconstruction results from phantom experiments demonstrate that the proposed algorithm can obtain high spatial resolution and high signal-to-noise ratio, as well as high localization accuracy for fluorescence targets.
International Nuclear Information System (INIS)
Huang, Jinhong; Guo, Li; Feng, Qianjin; Chen, Wufan; Feng, Yanqiu
2015-01-01
Image reconstruction from undersampled k-space data accelerates magnetic resonance imaging (MRI) by exploiting image sparseness in certain transform domains. Employing image patch representation over a learned dictionary has the advantage of being adaptive to local image structures and thus can better sparsify images than using fixed transforms (e.g. wavelets and total variations). Dictionary learning methods have recently been introduced to MRI reconstruction, and these methods demonstrate significantly reduced reconstruction errors compared to sparse MRI reconstruction using fixed transforms. However, the synthesis sparse coding problem in dictionary learning is NP-hard and computationally expensive. In this paper, we present a novel sparsity-promoting orthogonal dictionary updating method for efficient image reconstruction from highly undersampled MRI data. The orthogonality imposed on the learned dictionary enables the minimization problem in the reconstruction to be solved by an efficient optimization algorithm which alternately updates representation coefficients, orthogonal dictionary, and missing k-space data. Moreover, both sparsity level and sparse representation contribution using updated dictionaries gradually increase during iterations to recover more details, assuming the progressively improved quality of the dictionary. Simulation and real data experimental results both demonstrate that the proposed method is approximately 10 to 100 times faster than the K-SVD-based dictionary learning MRI method and simultaneously improves reconstruction accuracy. (paper)