
Sample records for lr local reconstruction

  1. Adaptive local surface refinement based on LR NURBS and its application to contact

    Zimmermann, Christopher; Sauer, Roger A.


    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  2. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    Mikus, J.


    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  3. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao


    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  4. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    Josek, R.; Hudec, F.; Rypar, V.


    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  5. Medial canthal reconstruction with multiple local flaps

    Akihiro Ogino


    Conclusion: This method is somewhat complicated compared to reconstruction with a single flap, but it is a combination of standard local flaps and is a simple reconstructive procedure. By adding additional resection, the suture line is consistent with the border of the facial unit, so postoperative scarring is inconspicuous. This technique is aesthetically useful because of the continuity of colour and texture resulting from the use of adjacent flaps.

  6. Function reconstruction from noisy local averages

    Chen Yu; Huang Jianguo; Han Weimin


    A regularization method is proposed for the function reconstruction from noisy local averages in any dimension. Error bounds for the approximate solution in L 2 -norm are derived. A number of numerical examples are provided to show computational performance of the method, with the regularization parameters selected by different strategies

  7. Do Local Elites Capture Natural Disaster Reconstruction Funds?

    Yoshito Takasaki


    This paper examines the allocation of natural disaster reconstruction funds among cyclone victims in rural Fiji. During post-emergency periods, when good information about cyclone damage is available, do local elites, a powerful minority, capture housing construction materials? With effective targeting in both receipt and the amount received, local elites do not capture larger benefits. More severely affected victims are not early recipients, though, because the supply of reconstruction funds...

  8. Digital holographic reconstruction detection of localized corrosion arising from scratches



    Full Text Available In this study, electrochemical methods and the digital holographic reconstruction technique were combined to detect the localized scratch-induced corrosion process of Alloy 690 in 0.50 mol dm-3 H2SO4 containing 0.10 mol dm-3 NaCl. The numerical reconstruction method has been proved to be an effective technique to detect changes of solution concentration. One can obtain direct information from the reconstructed images and capture subtle more revealing changes. It provides a method to detect localized corrosion arising from scratches.

  9. Extra Facial Landmark Localization via Global Shape Reconstruction

    Shuqiu Tan


    Full Text Available Localizing facial landmarks is a popular topic in the field of face analysis. However, problems arose in practical applications such as handling pose variations and partial occlusions while maintaining moderate training model size and computational efficiency still challenges current solutions. In this paper, we present a global shape reconstruction method for locating extra facial landmarks comparing to facial landmarks used in the training phase. In the proposed method, the reduced configuration of facial landmarks is first decomposed into corresponding sparse coefficients. Then explicit face shape correlations are exploited to regress between sparse coefficients of different facial landmark configurations. Finally extra facial landmarks are reconstructed by combining the pretrained shape dictionary and the approximation of sparse coefficients. By applying the proposed method, both the training time and the model size of a class of methods which stack local evidences as an appearance descriptor can be scaled down with only a minor compromise in detection accuracy. Extensive experiments prove that the proposed method is feasible and is able to reconstruct extra facial landmarks even under very asymmetrical face poses.

  10. Unifying LL and LR parsing

    W.H.L.M. Pijls (Wim)


    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  11. Reconstruction of Nasal Skin Cancer Defects with Local Flaps

    A. C. Salgarelli


    Full Text Available Reconstruction of nasal defects must preserve the integrity of complex facial functions and expressions, as well as facial symmetry and a pleasing aesthetic outcome. The reconstructive modality of choice will depend largely on the location, size, and depth of the surgical defect. Individualized therapy is the best course, and numerous flaps have been designed to provide coverage of a variety of nasal-specific defects. We describe our experience in the aesthetic reconstruction of nasal skin defects following oncological surgery. The use of different local flaps for nasal skin cancer defects is reported in 286 patients. Complications in this series were one partial flap dehiscence that healed by secondary intention, two forehead flaps, and one bilobed flap with minimal rim necrosis that resulted in an irregular scar requiring revision. Aesthetic results were deemed satisfactory by all patients and the operating surgeons. The color and texture matches were aesthetically good, and the nasal contour was distinct in all patients. All scars were inconspicuous and symmetrical. No patient had tenting or a flat nose.

  12. Reconstruction of Nasal Skin Cancer Defects with Local Flaps

    Salgarelli, A. C.; Bellini, P.; Multinu, A.; Consolo, U.; Magnoni, C.; Francomano, M.; Fantini, F.; Seidenari, S.


    Reconstruction of nasal defects must preserve the integrity of complex facial functions and expressions, as well as facial symmetry and a pleasing aesthetic outcome. The reconstructive modality of choice will depend largely on the location, size, and depth of the surgical defect. Individualized therapy is the best course, and numerous flaps have been designed to provide coverage of a variety of nasal-specific defects. We describe our experience in the aesthetic reconstruction of nasal skin defects following oncological surgery. The use of different local flaps for nasal skin cancer defects is reported in 286 patients. Complications in this series were one partial flap dehiscence that healed by secondary intention, two forehead flaps, and one bilobed flap with minimal rim necrosis that resulted in an irregular scar requiring revision. Aesthetic results were deemed satisfactory by all patients and the operating surgeons. The color and texture matches were aesthetically good, and the nasal contour was distinct in all patients. All scars were inconspicuous and symmetrical. No patient had tenting or a flat nose.

  13. Extension of local front reconstruction method with controlled coalescence model

    Rajkotwala, A. H.; Mirsandi, H.; Peters, E. A. J. F.; Baltussen, M. W.; van der Geld, C. W. M.; Kuerten, J. G. M.; Kuipers, J. A. M.


    The physics of droplet collisions involves a wide range of length scales. This poses a challenge to accurately simulate such flows with standard fixed grid methods due to their inability to resolve all relevant scales with an affordable number of computational grid cells. A solution is to couple a fixed grid method with subgrid models that account for microscale effects. In this paper, we improved and extended the Local Front Reconstruction Method (LFRM) with a film drainage model of Zang and Law [Phys. Fluids 23, 042102 (2011)]. The new framework is first validated by (near) head-on collision of two equal tetradecane droplets using experimental film drainage times. When the experimental film drainage times are used, the LFRM method is better in predicting the droplet collisions, especially at high velocity in comparison with other fixed grid methods (i.e., the front tracking method and the coupled level set and volume of fluid method). When the film drainage model is invoked, the method shows a good qualitative match with experiments, but a quantitative correspondence of the predicted film drainage time with the experimental drainage time is not obtained indicating that further development of film drainage model is required. However, it can be safely concluded that the LFRM coupled with film drainage models is much better in predicting the collision dynamics than the traditional methods.

  14. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.


    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  15. Inspection of freeform surfaces considering uncertainties in measurement, localization and surface reconstruction

    Mehrad, Vahid; Xue, Deyi; Gu, Peihua


    Inspection of a manufactured freeform surface can be conducted by building its surface model and comparing this manufactured surface model with the ideal design surface model and its tolerance requirement. The manufactured freeform surface model is usually achieved by obtaining measurement points on the manufactured surface, transforming these measurement points from the measurement coordinate system to the design coordinate system through localization, and reconstructing the surface model using the localized measurement points. In this research, a method was developed to estimate the locations and their variances of any selected points on the reconstructed freeform surface considering different sources of uncertainties in measurement, localization and surface reconstruction processes. In this method, first locations and variances of the localized measurement points are calculated considering uncertainties of the measurement points and uncertainties introduced in the localization processes. Then locations and variances of points on the reconstructed freeform surface are obtained considering uncertainties of the localized measurement points and uncertainties introduced in the freeform surface reconstruction process. Two case studies were developed to demonstrate how these three different uncertainty sources influence the quality of the reconstructed freeform curve and freeform surface in inspection. (paper)

  16. Cone-beam local reconstruction based on a Radon inversion transformation

    Wang Xian-Chao; Yan Bin; Li Lei; Hu Guo-En


    The local reconstruction from truncated projection data is one area of interest in image reconstruction for computed tomography (CT), which creates the possibility for dose reduction. In this paper, a filtered-backprojection (FBP) algorithm based on the Radon inversion transform is presented to deal with the three-dimensional (3D) local reconstruction in the circular geometry. The algorithm achieves the data filtering in two steps. The first step is the derivative of projections, which acts locally on the data and can thus be carried out accurately even in the presence of data truncation. The second step is the nonlocal Hilbert filtering. The numerical simulations and the real data reconstructions have been conducted to validate the new reconstruction algorithm. Compared with the approximate truncation resistant algorithm for computed tomography (ATRACT), not only it has a comparable ability to restrain truncation artifacts, but also its reconstruction efficiency is improved. It is about twice as fast as that of the ATRACT. Therefore, this work provides a simple and efficient approach for the approximate reconstruction from truncated projections in the circular cone-beam CT

  17. Homotopic non-local regularized reconstruction from sparse positron emission tomography measurements

    Wong, Alexander; Liu, Chenyi; Wang, Xiao Yu; Fieguth, Paul; Bie, Hongxia


    Positron emission tomography scanners collect measurements of a patient’s in vivo radiotracer distribution. The system detects pairs of gamma rays emitted indirectly by a positron-emitting radionuclide (tracer), which is introduced into the body on a biologically active molecule, and the tomograms must be reconstructed from projections. The reconstruction of tomograms from the acquired PET data is an inverse problem that requires regularization. The use of tightly packed discrete detector rings, although improves signal-to-noise ratio, are often associated with high costs of positron emission tomography systems. Thus a sparse reconstruction, which would be capable of overcoming the noise effect while allowing for a reduced number of detectors, would have a great deal to offer. In this study, we introduce and investigate the potential of a homotopic non-local regularization reconstruction framework for effectively reconstructing positron emission tomograms from such sparse measurements. Results obtained using the proposed approach are compared with traditional filtered back-projection as well as expectation maximization reconstruction with total variation regularization. A new reconstruction method was developed for the purpose of improving the quality of positron emission tomography reconstruction from sparse measurements. We illustrate that promising reconstruction performance can be achieved for the proposed approach even at low sampling fractions, which allows for the use of significantly fewer detectors and have the potential to reduce scanner costs

  18. A New Local Flap Nipple Reconstruction Technique Using Dermal Bridge and Preoperatively Designed Tattoo

    Iwahira, Yoshiko


    Background: Nipple–areolar reconstruction is the final step in breast reconstruction. Reconstruction using local flaps and tattooing is useful in cases of bilateral reconstruction, a small nipple–areolar complex (NAC) as the donor site, and avoiding disturbance of the normal side and other body parts. However, this method can cause projection loss and color fading of the nipple. Moreover, the breast mound is reconstructed with an implant. Methods: We performed nipple–areolar reconstruction of 90 nipples using clover-designed flaps oriented at 120 degrees and tattooing after breast silicone implantation in 64 women. The tattoo was designed before flap operation and stained darker. Following donor site closure, a dermal flap was made as a bridge for nipple support. The nipple space was separated by the dermal flap from the breast mound and was filled with subcutaneous tissue. The size of the reconstructed nipple projection was measured postoperatively and 1 year later. The projection maintenance rate was calculated. Results: The heights of the nipple projection were 11.3 ± 1.8 mm (95% confidence interval [CI]: 10.9–11.7) just after the operation and 6.09 ± 2.4 mm (95% CI: 5.6–6.6) 1 year later. The actual range of nipple projection between these 2 heights was 5.2 ± 2.4 mm (95% CI: 4.7–5.7). The maintenance rate of the reconstructed nipple projection after 12 months was 54.1 ± 20.9 (95% CI: 49.7–58.5). The nipple color was maintained for over a year. Conclusions: Our nipple–areolar reconstruction technique could maintain the projection and color of the reconstructed nipple for a long period. Good outcomes were obtained in this implant-based breast reconstruction. PMID:28507843

  19. Solving LR Conflicts Through Context Aware Scanning

    Leon, C. Rodriguez; Forte, L. Garcia


    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  20. Salient points in reconstruction of nasal skin after tumor ablation with local flaps

    Ali Ebrahimi


    Full Text Available Objective: A variety of nasal skin reconstruction methods are available to meet the esthetic patient's needs. In this article, we review some of modifications of these procedures and share our experience in reconstruction of different parts of the nasal skin following skin tumor ablation. Patients and Methods : From January 2010 to January 2014, 171 patients underwent nasal skin reconstruction after excising cancerous lesions of the involved nasal skin. The patient's history, pre- and post-operation photographs, and the surgery data were collected and assessed. Demographic data related to the type of cancer, defect size and location, type of reconstruction were collected. Results: A variety of local flaps were used based on location and defect features. Nearly all flaps healed primarily without postsurgical significant complications. Conclusion: According to the results and the outcomes of the operations, we concluded that a certain flaps are more effective than others in nasal skin reconstruction. Local flap reconstruction of the nose has good esthetic result with low complication rate.

  1. Reconstructing the gravitational field of the local Universe

    Desmond, Harry; Ferreira, Pedro G.; Lavaux, Guilhem; Jasche, Jens


    Tests of gravity at the galaxy scale are in their infancy. As a first step to systematically uncovering the gravitational significance of galaxies, we map three fundamental gravitational variables - the Newtonian potential, acceleration and curvature - over the galaxy environments of the local Universe to a distance of approximately 200 Mpc. Our method combines the contributions from galaxies in an all-sky redshift survey, haloes from an N-body simulation hosting low-luminosity objects, and linear and quasi-linear modes of the density field. We use the ranges of these variables to determine the extent to which galaxies expand the scope of generic tests of gravity and are capable of constraining specific classes of model for which they have special significance. Finally, we investigate the improvements afforded by upcoming galaxy surveys.

  2. LRSYS, PASCAL LR(1) Parser Generator System

    O'Hair, K.


    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  3. LR: Compact connectivity representation for triangle meshes

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J


    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  4. Accident dynamics of LR-0 reactor

    Vorisek, M.; Tinka, I.


    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  5. Microcystin-LR Induced Immunotoxicity in Mammals

    Yaqoob Lone


    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  6. Local self-similarity descriptor for point-of-interest reconstruction of real-world scenes

    Gao, Xianglu; Wan, Weibing; Zhao, Qunfei; Zhang, Xianmin


    Scene reconstruction is utilized commonly in close-range photogrammetry, with diverse applications in fields such as industry, biology, and aerospace industries. Presented surfaces or wireframe three-dimensional (3D) model reconstruction applications are either too complex or too inflexible to accommodate various types of real-world scenes, however. This paper proposes an algorithm for acquiring point-of-interest (referred to throughout the study as POI) coordinates in 3D space, based on multi-view geometry and a local self-similarity descriptor. After reconstructing several POIs specified by a user, a concise and flexible target object measurement method, which obtains the distance between POIs, is described in detail. The proposed technique is able to measure targets with high accuracy even in the presence of obstacles and non-Lambertian surfaces. The method is so flexible that target objects can be measured with a handheld digital camera. Experimental results further demonstrate the effectiveness of the algorithm. (paper)

  7. Post-disaster housing reconstruction: Perspectives of the NGO and local authorities on delay issues

    Khalid, Khairin Norhashidah; Nifa, Faizatul Akmar Abdul; Ismail, Risyawati Mohamed; Lin, Chong Khai


    Post disaster reconstruction is complex, dynamic and chaotic in nature and as such represents many challenges because it is unlike normal construction. However, the time scale of reconstruction is shorter than the normal construction, but it often deals with uncertainties and the scale of the construction activities required is relatively high. After a disaster impacts a country, many governments, institutions and aid organizations cooperate and involved with the reconstruction process. This is seen as a tool for applying policies and programs designed to remedy the weakness in developmental policies, infrastructure and institutional arrangements. This paper reports a part of an on-going research on post-disaster housing reconstruction in Malaysia. An extensive literature review and pilot interviews were undertaken to establish the factors that contribute to the delay in post-disaster reconstruction project. Accordingly, this paper takes the perspective of recovery from non-government organization (NGO) and local authorities which act as providers of social services, builders of infrastructure, regulators of economic activity and managers of the natural environment. As a result, it is important on how those decisions are made, who is involved in the decision-making, and what are the consequences of this decision.

  8. The relationship between the presence and extent of lobular carcinoma in situ (LCIS) and the risk of local recurrence (LR) in patients with infiltrating cancer of the breast treated with conservative surgery (CS) and radiation therapy (RT)

    Abner, A.; Schnitt, S.; Connolly, J.; Recht, A.; Bornstein, B.; Nixon, A.; Hetelekidis, S.; Silver, B.; Harris, J.R.


    Purpose: Lobular carcinoma in situ, when found in an otherwise benign breast biopsy, is associated with an increased risk of developing a subsequent invasive breast cancer. Among patients with an infiltrating cancer resected without margin assessment, the extent of ductal carcinoma in situ is an established risk factor for LR after CS and RT. However, the association between the presence and extent of LCIS and the risk of recurrence in patients treated with CS and RT for infiltrating breast cancer remains at issue. Materials and Methods: Between 1968 and 1986, 1625 patients with clinical stage T1 and T2 invasive breast cancer were treated at the Joint Center for Radiation Therapy with complete gross tumor excision and RT to a total of ≥60 Gy. Of these, 1160 had infiltrating ductal cancer (IDC), infiltrating lobular cancer (ILC), or mixed IDC/ILC (IMC) and sufficient pathologic material for review by the study pathologists (SS and JC) to establish the presence or absence of LCIS and were evaluable at 10 years. LCIS was present adjacent to the invasive cancer in (43(1027)) IDC (4%), and either within or adjacent to the infiltrating tumor in (70(82)) ILC (85%) and (26(51)) IMC (51%). Margins were evaluable in 35% of LCIS-positive patients and 33% of LCIS-negative patients. The median follow-up time was 153 months for surviving patients. Results: The 10-year crude risk of recurrence by first site of failure for all patients was as follows: Furthermore, there was no significant relationship between the extent of the LCIS adjacent to the invasive tumor and the LR risk: The 10-year crude risk of contralateral breast cancer was 7% for the patients with LCIS and 7% for those without LCIS. CONCLUSION: We conclude that neither the presence nor the extent of LCIS is related to the risk of LR in patients with invasive breast cancer treated with CS and RT. Thus, LCIS should not be considered a contraindication to breast conservation with CS and RT

  9. Reconstructing the metric of the local Universe from number counts observations

    Vallejo, Sergio Andres [ICRANet, Piazza della Repubblica 10, I-65122 Pescara (Italy); Romano, Antonio Enea, E-mail: [Theoretical Physics Department, CERN, CH-1211 Geneva 23 (Switzerland)


    Number counts observations available with new surveys such as the Euclid mission will be an important source of information about the metric of the Universe. We compute the low red-shift expansion for the energy density and the density contrast using an exact spherically symmetric solution in presence of a cosmological constant. At low red-shift the expansion is more precise than linear perturbation theory prediction. We then use the local expansion to reconstruct the metric from the monopole of the density contrast. We test the inversion method using numerical calculations and find a good agreement within the regime of validity of the red-shift expansion. The method could be applied to observational data to reconstruct the metric of the local Universe with a level of precision higher than the one achievable using perturbation theory.

  10. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi


    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  11. A statistical investigation of the effects of edge localized modes on the equilibrium reconstruction in JET

    Murari, A; Peluso, E; Gaudio, P; Gelfusa, M; Maviglia, F; Hawkes, N


    The configuration of magnetic fields is an essential ingredient of tokamak physics. In modern day devices, the magnetic topology is normally derived from equilibrium codes, which solve the Grad–Shafranov equation with constraints imposed by the available measurements. On JET, the main code used for this purpose is EFIT and the more commonly used diagnostics are external pick-up coils. Both the code and the measurements present worse performance during edge localized modes (ELMs). To quantify this aspect, various statistical indicators, based on the values of the residuals and their probability distribution, are defined and calculated. They all show that the quality of EFIT reconstructions is clearly better in the absence of ELMs. To investigate the possible causes of the detrimental effects of ELMs on the reconstruction, the pick-up coils are characterized individually and both the spatial distribution and time behaviour of their residuals are analysed in detail. The coils with a faster time response are the ones reproduced less well by EFIT. The constraints of current and pressure at the separatrix are also varied but the effects of such modifications do not result in decisive improvements in the quality of the reconstructions. The interpretation of this experimental evidence is not absolutely compelling but strongly indicative of deficiencies in the physics model on which the JET reconstruction code is based. (paper)

  12. Multidetector CT of Locally Invasive Advanced Gastric Cancer: Value of Oblique Coronal Reconstructed Images for the Assessment of Local Invasion

    Jung, Jin Hee; Kim, Ah Yong; Kim, Hye Jin; Yook, Jeong Hwan; Yu, Eun Sil; Jang, Yoon Jin; Park, Seong Ho; Shin, Yong Moon; Ha, Hyun Kwon [Asan Medical Center, Seoul (Korea, Republic of)


    To evaluate the diagnostic value of oblique coronal reconstructed CT images to determine the local invasion of advanced gastric cancer (AGC). Thirty-four consecutive patients, who were suspected to have locally invasive advanced gastric cancer (more than T3 stage) on a preoperative MDCT scan and underwent a diagnostic or curative laparotomy, were enrolled in this study. Two reviewers performed an independent blind review of three series of MDCT images in random order; axial (AXI), conventional coronal (CCI), and oblique coronal (OCI) (parallel to long axis of gastric body and pancreas) images. In assessing the local invasion, the reader's confidence for the local invasion of AGC was graded using a five point scale (1 = definitely negative, 5 = definitely positive: T4). With surgical findings and histopathological proofs as reference standards, the diagnostic performance of the three different plans of CT images was employed for the verification of local invasion of AGC on a preoperative CT scan using the receiver operating characteristic (ROC) method. Agreements between the two reviewers were analyzed using weighted kappa statistics. Results: In 19 out of 34 patients, local invasion was confirmed surgically or histopathologically (13 pancreas invasion, 6 liver invasion, 4 major vascular invasion, 3 colon and mesocolon invasion, and 2 spleen invasion). The diagnostic performance of OCI was superior to AXI or CCI in the local invasion of AGC. The differences in the area under the curve of AXI (0.770 {+-} 0.087, 0.700 {+-} 0.094), CCI (0.884 {+-} 0.058, 0.958 {+-} 0.038), and OCI (0.954 {+-} 0.050, 0.956 {+-} 0.049), were statistically significant for both reviewers. Inter-observer agreement was excellent for OCI ({kappa}= .973), which was greater than CCI (({kappa}= .839), and AXI (({kappa}= .763). On a CT scan, OCI might be a useful imaging technique in evaluating locally invasive advanced gastric cancer.

  13. Incorporation of local dependent reliability information into the Prior Image Constrained Compressed Sensing (PICCS) reconstruction algorithm

    Vaegler, Sven; Sauer, Otto; Stsepankou, Dzmitry; Hesser, Juergen


    The reduction of dose in cone beam computer tomography (CBCT) arises from the decrease of the tube current for each projection as well as from the reduction of the number of projections. In order to maintain good image quality, sophisticated image reconstruction techniques are required. The Prior Image Constrained Compressed Sensing (PICCS) incorporates prior images into the reconstruction algorithm and outperforms the widespread used Feldkamp-Davis-Kress-algorithm (FDK) when the number of projections is reduced. However, prior images that contain major variations are not appropriately considered so far in PICCS. We therefore propose the partial-PICCS (pPICCS) algorithm. This framework is a problem-specific extension of PICCS and enables the incorporation of the reliability of the prior images additionally. We assumed that the prior images are composed of areas with large and small deviations. Accordingly, a weighting matrix considered the assigned areas in the objective function. We applied our algorithm to the problem of image reconstruction from few views by simulations with a computer phantom as well as on clinical CBCT projections from a head-and-neck case. All prior images contained large local variations. The reconstructed images were compared to the reconstruction results by the FDK-algorithm, by Compressed Sensing (CS) and by PICCS. To show the gain of image quality we compared image details with the reference image and used quantitative metrics (root-mean-square error (RMSE), contrast-to-noise-ratio (CNR)). The pPICCS reconstruction framework yield images with substantially improved quality even when the number of projections was very small. The images contained less streaking, blurring and inaccurately reconstructed structures compared to the images reconstructed by FDK, CS and conventional PICCS. The increased image quality is also reflected in large RMSE differences. We proposed a modification of the original PICCS algorithm. The pPICCS algorithm

  14. Fast approach to evaluate MAP reconstruction for lesion detection and localization

    Qi, Jinyi; Huesman, Ronald H.


    Lesion detection is an important task in emission tomography. Localization ROC (LROC) studies are often used to analyze the lesion detection and localization performance. Most researchers rely on Monte Carlo reconstruction samples to obtain LROC curves, which can be very time-consuming for iterative algorithms. In this paper we develop a fast approach to obtain LROC curves that does not require Monte Carlo reconstructions. We use a channelized Hotelling observer model to search for lesions, and the results can be easily extended to other numerical observers. We theoretically analyzed the mean and covariance of the observer output. Assuming the observer outputs are multivariate Gaussian random variables, an LROC curve can be directly generated by integrating the conditional probability density functions. The high-dimensional integrals are calculated using a Monte Carlo method. The proposed approach is very fast because no iterative reconstruction is involved. Computer simulations show that the results of the proposed method match well with those obtained using the tradition LROC analysis

  15. A local region of interest image reconstruction via filtered backprojection for fan-beam differential phase-contrast computed tomography

    Qi Zhihua; Chen Guanghong


    Recently, x-ray differential phase contrast computed tomography (DPC-CT) has been experimentally implemented using a conventional source combined with several gratings. Images were reconstructed using a parallel-beam reconstruction formula. However, parallel-beam reconstruction formulae are not directly applicable for a large image object where the parallel-beam approximation fails. In this note, we present a new image reconstruction formula for fan-beam DPC-CT. There are two major features in this algorithm: (1) it enables the reconstruction of a local region of interest (ROI) using data acquired from an angular interval shorter than 180 0 + fan angle and (2) it still preserves the filtered backprojection structure. Numerical simulations have been conducted to validate the image reconstruction algorithm. (note)

  16. Localized Edge Vibrations and Edge Reconstruction by Joule Heating in Graphene Nanostructures

    Engelund, Mads; Fürst, Joachim Alexander; Jauho, Antti-Pekka


    Control of the edge topology of graphene nanostructures is critical to graphene-based electronics. A means of producing atomically smooth zigzag edges using electronic current has recently been demonstrated in experiments [Jia et al., Science 323, 1701 (2009)]. We develop a microscopic theory...... for current-induced edge reconstruction using density functional theory. Our calculations provide evidence for localized vibrations at edge interfaces involving unpassivated armchair edges. We demonstrate that these vibrations couple to the current, estimate their excitation by Joule heating, and argue...

  17. Torso geometry reconstruction and body surface electrode localization using three-dimensional photography.

    Perez-Alday, Erick A; Thomas, Jason A; Kabir, Muammar; Sedaghat, Golriz; Rogovoy, Nichole; van Dam, Eelco; van Dam, Peter; Woodward, William; Fuss, Cristina; Ferencik, Maros; Tereshchenko, Larisa G

    We conducted a prospective clinical study (n=14; 29% female) to assess the accuracy of a three-dimensional (3D) photography-based method of torso geometry reconstruction and body surface electrodes localization. The position of 74 body surface electrocardiographic (ECG) electrodes (diameter 5mm) was defined by two methods: 3D photography, and CT (marker diameter 2mm) or MRI (marker size 10×20mm) imaging. Bland-Altman analysis showed good agreement in X (bias -2.5 [95% limits of agreement (LoA) -19.5 to 14.3] mm), Y (bias -0.1 [95% LoA -14.1 to 13.9] mm), and Z coordinates (bias -0.8 [95% LoA -15.6 to 14.2] mm), as defined by the CT/MRI imaging, and 3D photography. The average Hausdorff distance between the two torso geometry reconstructions was 11.17±3.05mm. Thus, accurate torso geometry reconstruction using 3D photography is feasible. Body surface ECG electrodes coordinates as defined by the CT/MRI imaging, and 3D photography, are in good agreement. Copyright © 2017 Elsevier Inc. All rights reserved.


    Wang Huiyuan; Mo, H. J.; Yang Xiaohu; Van den Bosch, Frank C.


    Our research objective in this paper is to reconstruct an initial linear density field, which follows the multivariate Gaussian distribution with variances given by the linear power spectrum of the current cold dark matter model and evolves through gravitational instabilities to the present-day density field in the local universe. For this purpose, we develop a Hamiltonian Markov Chain Monte Carlo method to obtain the linear density field from a posterior probability function that consists of two components: a prior of a Gaussian density field with a given linear spectrum and a likelihood term that is given by the current density field. The present-day density field can be reconstructed from galaxy groups using the method developed in Wang et al. Using a realistic mock Sloan Digital Sky Survey DR7, obtained by populating dark matter halos in the Millennium simulation (MS) with galaxies, we show that our method can effectively and accurately recover both the amplitudes and phases of the initial, linear density field. To examine the accuracy of our method, we use N-body simulations to evolve these reconstructed initial conditions to the present day. The resimulated density field thus obtained accurately matches the original density field of the MS in the density range 0.3∼ –1 , much smaller than the translinear scale, which corresponds to a wavenumber of ∼0.15 h Mpc –1

  19. Local System Matrix Compression for Efficient Reconstruction in Magnetic Particle Imaging

    T. Knopp


    Full Text Available Magnetic particle imaging (MPI is a quantitative method for determining the spatial distribution of magnetic nanoparticles, which can be used as tracers for cardiovascular imaging. For reconstructing a spatial map of the particle distribution, the system matrix describing the magnetic particle imaging equation has to be known. Due to the complex dynamic behavior of the magnetic particles, the system matrix is commonly measured in a calibration procedure. In order to speed up the reconstruction process, recently, a matrix compression technique has been proposed that makes use of a basis transformation in order to compress the MPI system matrix. By thresholding the resulting matrix and storing the remaining entries in compressed row storage format, only a fraction of the data has to be processed when reconstructing the particle distribution. In the present work, it is shown that the image quality of the algorithm can be considerably improved by using a local threshold for each matrix row instead of a global threshold for the entire system matrix.

  20. Mental health risks in the local workforce engaged in disaster relief and reconstruction.

    Wang, Xiao L; Chan, Cecilia L W; Shi, Zhan B; Wang, Bin


    To build a sustainable workforce for long-term disaster relief and reconstruction, more effort must be made to promote local relief workers' mental health. We conducted 25 semistructured interviews with local relief officials 10 months after the 2008 earthquake in China to investigate the stress and coping experiences in their personal lives as survivors. We conducted thematic analysis of interview transcripts. Traumatic bereavement and grief, housing and financial difficulties, and work-family conflict were the three main sources of stress in the respondents' personal lives. The coping themes were finding meaning and purpose in life through relief work, colleagues' support and understanding, suppression or avoidance of grief, appreciation for life, hardiness, optimism, letting nature take its course, and making up for loss. We suggest that relief work has a double-edged-sword effect on workers' coping abilities. We discuss the implications of this effect for work-life balance measures and trauma and grief counseling services.

  1. Main: 1LR5 [RPSD[Archive

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  2. Holographic Reconstruction of Photoelectron Diffraction and Its Circular Dichroism for Local Structure Probing

    Matsui, Fumihiko; Matsushita, Tomohiro; Daimon, Hiroshi


    The local atomic structure around a specific element atom can be recorded as a photoelectron diffraction pattern. Forward focusing peaks and diffraction rings around them indicate the directions and distances from the photoelectron emitting atom to the surrounding atoms. The state-of-the-art holography reconstruction algorithm enables us to image the local atomic arrangement around the excited atom in a real space. By using circularly polarized light as an excitation source, the angular momentum transfer from the light to the photoelectron induces parallax shifts in these diffraction patterns. As a result, stereographic images of atomic arrangements are obtained. These diffraction patterns can be used as atomic-site-resolved probes for local electronic structure investigation in combination with spectroscopy techniques. Direct three-dimensional atomic structure visualization and site-specific electronic property analysis methods are reviewed. Furthermore, circular dichroism was also found in valence photoelectron and Auger electron diffraction patterns. The investigation of these new phenomena provides hints for the development of new techniques for local structure probing.

  3. L-R asymmetry in gut's

    Karadayi, H.R.


    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  4. Estimating local noise power spectrum from a few FBP-reconstructed CT scans

    Zeng, Rongping, E-mail:; Gavrielides, Marios A.; Petrick, Nicholas; Sahiner, Berkman; Li, Qin; Myers, Kyle J. [Division of Imaging, Diagnostics, and Software Reliability, Office of Science and Engineering Laboratories, CDRH, FDA, Silver Spring, Maryland 20993 (United States)


    Purpose: Traditional ways to estimate 2D CT noise power spectrum (NPS) involve an ensemble average of the power spectrums of many noisy scans. When only a few scans are available, regions of interest are often extracted from different locations to obtain sufficient samples to estimate the NPS. Using image samples from different locations ignores the nonstationarity of CT noise and thus cannot accurately characterize its local properties. The purpose of this work is to develop a method to estimate local NPS using only a few fan-beam CT scans. Methods: As a result of FBP reconstruction, the CT NPS has the same radial profile shape for all projection angles, with the magnitude varying with the noise level in the raw data measurement. This allows a 2D CT NPS to be factored into products of a 1D angular and a 1D radial function in polar coordinates. The polar separability of CT NPS greatly reduces the data requirement for estimating the NPS. The authors use this property and derive a radial NPS estimation method: in brief, the radial profile shape is estimated from a traditional NPS based on image samples extracted at multiple locations. The amplitudes are estimated by fitting the traditional local NPS to the estimated radial profile shape. The estimated radial profile shape and amplitudes are then combined to form a final estimate of the local NPS. We evaluate the accuracy of the radial NPS method and compared it to traditional NPS methods in terms of normalized mean squared error (NMSE) and signal detectability index. Results: For both simulated and real CT data sets, the local NPS estimated with no more than six scans using the radial NPS method was very close to the reference NPS, according to the metrics of NMSE and detectability index. Even with only two scans, the radial NPS method was able to achieve a fairly good accuracy. Compared to those estimated using traditional NPS methods, the accuracy improvement was substantial when a few scans were available

  5. Are the paleoclimatic reconstructions based on mammals biased by the local landscape?

    Garcia-Alix, Antonio


    The paleoclimatic reconstructions deduced from mammal associations might have been biased by the complex local effect of the landscape. This effect is especially important in tectonically active regions where important landscape changes occurred in short-time periods. In this abstract, I present a coupled paleoenvironmental approach 1) using the ecological requirement of the faunal associations, and 2) using isotopic analyses in both sediments and small mammal teeth in order to discern between climate and landscape effects. Southern Iberian Peninsula was a tectonically active area during the late Miocene and Pliocene, and the environmental and humidity data deduced from the faunal associations agree with the sedimentary evolution of the basin. However, these humidity trends are usually opposite to the humidity reconstruction deduced from the carbon isotopic data in rodent teeth and from the isotopic composition of the sediments (C and O), which are scarcely influenced by the landscape. So, changes in the landscape, probably boosted by tectonics, gave rise to the development of endorheic and/or exorheic systems in the areas and conditioned the extension of these systems, affecting taxa with high dependence on humidity. Similar outcomes have been observed in early-middle Miocene records from north Spain. In those cases, the response of small mammal associations to abrupt climate changes might have been also buffered by the landscape. On the other hand, records where there was no important landscape changes, such as those from an early- middle Miocene coastal area of eastern Spain, do not show that disagreement in the humidity and environmental reconstructions following both methods.

  6. Reconstructing the Initial Density Field of the Local Universe: Methods and Tests with Mock Catalogs

    Wang, Huiyuan; Mo, H. J.; Yang, Xiaohu; van den Bosch, Frank C.


    Our research objective in this paper is to reconstruct an initial linear density field, which follows the multivariate Gaussian distribution with variances given by the linear power spectrum of the current cold dark matter model and evolves through gravitational instabilities to the present-day density field in the local universe. For this purpose, we develop a Hamiltonian Markov Chain Monte Carlo method to obtain the linear density field from a posterior probability function that consists of two components: a prior of a Gaussian density field with a given linear spectrum and a likelihood term that is given by the current density field. The present-day density field can be reconstructed from galaxy groups using the method developed in Wang et al. Using a realistic mock Sloan Digital Sky Survey DR7, obtained by populating dark matter halos in the Millennium simulation (MS) with galaxies, we show that our method can effectively and accurately recover both the amplitudes and phases of the initial, linear density field. To examine the accuracy of our method, we use N-body simulations to evolve these reconstructed initial conditions to the present day. The resimulated density field thus obtained accurately matches the original density field of the MS in the density range 0.3 \\lesssim \\rho /\\bar{\\rho } \\lesssim 20 without any significant bias. In particular, the Fourier phases of the resimulated density fields are tightly correlated with those of the original simulation down to a scale corresponding to a wavenumber of ~1 h Mpc-1, much smaller than the translinear scale, which corresponds to a wavenumber of ~0.15 h Mpc-1.

  7. Locally Advanced Cheek Carcinoma; Radical Surgery and Reconstruction of Though and Through Defects

    Denewer, A.T.; Steet, A.E.; Mohamed, O.H.; Aly, O.F.


    Background: Squamous cell carcinoma of the cheek is a locoregionally aggressive tumor. Radical resection may be curative in cases of large tumor without distant metastases. We reviewed forty eight consecutive cases of Sq.c.c. of the oral cavity to evaluate the feasibility and efficacy of the reconstructive method. Patients and Methods: Forty eight cases of invasive Sq.c.c. affecting the cheek performed in Mansoura University, Surgical Oncology Department. From November 2001 to October 2004 were included. Twenty cafes presented primarily, and 28 were relapsing after previous surgery or radiotherapy. Tumors of T 3 and T 4 size were included. Radical excision with adequate safety margin followed by reconstruction was done in the same setting using: A- Double layered pectorals major flap (n=30). B- Pectorals major flap for external surface and tongue flap for mucosal lining (n=10). C- Pectorals major flap plus free Latissmus dorsi flap (n=3). D- Latissmus dorsi flap plus tongue flap (n=5). Results: Nine cases (18.7%) had local and distant relapse after a median follow up period of 36 months. However, total flap loss was not encountered. There were partial loss of three tongue flaps, seven pectorals flaps corrected with debridement and re approximation. Two patients had oral incompetence. Orocutaneous salivary fistula persistent more than three weeks occurred in eight patients. Functional outcome in terms of oral competence, sensibility, chewing movements was satisfactory in all but three cases. In Conclusion: Radical resection of extensive cheek carcinoma and reconstruction using pedicled flaps is an effective, economic and reliable method for oncologic and functional purposes

  8. Paleoecological reconstruction of hominin-bearing middle Pliocene localities at Woranso-Mille, Ethiopia.

    Curran, Sabrina C; Haile-Selassie, Yohannes


    Woranso-Mille is a paleoanthropological site in Ethiopia sampling an important and under-represented time period in human evolution (3.8-3.6 million years ago). Specimens of cf. Australopithecus anamensis, Australopithecus afarensis, and the recently named Australopithecus deyiremeda have been recovered from this site. Using multiple habitat proxies, this study provides a paleoecological reconstruction of two fossiliferous collection areas from Woranso-Mille, Aralee Issie (ARI) and Mesgid Dora (MSD). Previous reconstructions based on faunal assemblages have pointed, due to the presence of aepycerotins, alcelaphins, and proboscideans, to the existence of open habitats as well as more closed ones, based on the occurrence of cercopithecids, giraffids, and traglephins. Results from community structure analysis (proportions of locomotor and dietary adaptations) at ARI and MSD indicated a predominance of open habitats, such as shrublands. Mesowear analysis revealed that ungulates of all dietary types (grazers, leaf and fruit browsers, and mixed feeders) were present in nearly equal proportions. Ecomorphological analyses using linear measurements of the astragalus and phalanges indicated that bovids utilizing locomotor behaviors associated with all habitat types were present, though the intermediate-cover habitat bovids were best represented in the sample (Heavy cover at ARI and Light cover at MSD). Together, these results suggest that the ARI and MSD localities were heterogeneous habitats (mosaics), likely with densely vegetated areas along a paleo-river and more open regions (woodlands, grasslands) available away from the river. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Reconstruction in extensive axillary Hidradenitis suppurativa with local fasciocutaneous V-Y advancement flaps

    Sharma Ramesh


    Full Text Available We present our experience with the use of local fasciocutaneous V-Y advancement flaps in the reconstruction of 10 axillae in 6 patients for large defects following wide excision of long-standing Hidradenitis suppurativa of the axilla. The defects were closed with local V-Y subcutaneous island flaps. A single flap from the chest wall was sufficient for moderate defects. However, for larger defects, an additional flap was taken from the medial side of the ipsilateral arm. The donor defects could be closed primarily in all the patients. The local areas of the lateral chest wall and the medial side of the arm have a plentiful supply of cutaneous perforators and the flaps can be designed in a V-Y fashion without resorting to preoperative marking of the perforator. The flaps were freed sufficiently to allow adequate movement for closure of the defects. Although no attempt was made to identify the perforators specifically, many perforators were seen entering the flap. Some perforators can be safely divided to increase reach of the flap. All the flaps survived completely. A follow up of 2.5 years is presented.

  10. Kinect Posture Reconstruction Based on a Local Mixture of Gaussian Process Models.

    Liu, Zhiguang; Zhou, Liuyang; Leung, Howard; Shum, Hubert P H


    Depth sensor based 3D human motion estimation hardware such as Kinect has made interactive applications more popular recently. However, it is still challenging to accurately recognize postures from a single depth camera due to the inherently noisy data derived from depth images and self-occluding action performed by the user. In this paper, we propose a new real-time probabilistic framework to enhance the accuracy of live captured postures that belong to one of the action classes in the database. We adopt the Gaussian Process model as a prior to leverage the position data obtained from Kinect and marker-based motion capture system. We also incorporate a temporal consistency term into the optimization framework to constrain the velocity variations between successive frames. To ensure that the reconstructed posture resembles the accurate parts of the observed posture, we embed a set of joint reliability measurements into the optimization framework. A major drawback of Gaussian Process is its cubic learning complexity when dealing with a large database due to the inverse of a covariance matrix. To solve the problem, we propose a new method based on a local mixture of Gaussian Processes, in which Gaussian Processes are defined in local regions of the state space. Due to the significantly decreased sample size in each local Gaussian Process, the learning time is greatly reduced. At the same time, the prediction speed is enhanced as the weighted mean prediction for a given sample is determined by the nearby local models only. Our system also allows incrementally updating a specific local Gaussian Process in real time, which enhances the likelihood of adapting to run-time postures that are different from those in the database. Experimental results demonstrate that our system can generate high quality postures even under severe self-occlusion situations, which is beneficial for real-time applications such as motion-based gaming and sport training.

  11. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia


    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  12. Localization of endocardial ectopic activity by means of noninvasive endocardial surface current density reconstruction

    Lai Dakun; Liu Chenguang; Eggen, Michael D; He Bin [Department of Biomedical Engineering, University of Minnesota, MN (United States); Iaizzo, Paul A, E-mail: [Department of Surgery, University of Minnesota, MN (United States)


    Localization of the source of cardiac ectopic activity has direct clinical benefits for determining the location of the corresponding ectopic focus. In this study, a recently developed current-density (CD)-based localization approach was experimentally evaluated in noninvasively localizing the origin of the cardiac ectopic activity from body-surface potential maps (BSPMs) in a well-controlled experimental setting. The cardiac ectopic activities were induced in four well-controlled intact pigs by single-site pacing at various sites within the left ventricle (LV). In each pacing study, the origin of the induced ectopic activity was localized by reconstructing the CD distribution on the endocardial surface of the LV from the measured BSPMs and compared with the estimated single moving dipole (SMD) solution and precise pacing site (PS). Over the 60 analyzed beats corresponding to ten pacing sites (six for each), the mean and standard deviation of the distance between the locations of maximum CD value and the corresponding PSs were 16.9 mm and 4.6 mm, respectively. In comparison, the averaged distance between the SMD locations and the corresponding PSs was slightly larger (18.4 {+-} 3.4 mm). The obtained CD distribution of activated sources extending from the stimulus site also showed high consistency with the endocardial potential maps estimated by a minimally invasive endocardial mapping system. The present experimental results suggest that the CD method is able to locate the approximate site of the origin of a cardiac ectopic activity, and that the distribution of the CD can portray the propagation of early activation of an ectopic beat.

  13. Main: 1LR4 [RPSD[Archive

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  14. Tools to Perform Local Dense 3D Reconstruction of Shallow Water Seabed.

    Avanthey, Loïca; Beaudoin, Laurent; Gademer, Antoine; Roux, Michel


    Tasks such as distinguishing or identifying individual objects of interest require the production of dense local clouds at the scale of these individual objects of interest. Due to the physical and dynamic properties of an underwater environment, the usual dense matching algorithms must be rethought in order to be adaptive. These properties also imply that the scene must be observed at close range. Classic robotized acquisition systems are oversized for local studies in shallow water while the systematic acquisition of data is not guaranteed with divers. We address these two major issues through a multidisciplinary approach. To efficiently acquire on-demand stereoscopic pairs using simple logistics in small areas of shallow water, we devised an agile light-weight dedicated system which is easy to reproduce. To densely match two views in a reliable way, we devised a reconstruction algorithm that automatically accounts for the dynamics, variability and light absorption of the underwater environment. Field experiments in the Mediterranean Sea were used to assess the results.

  15. Tools to Perform Local Dense 3D Reconstruction of Shallow Water Seabed

    Loïca Avanthey


    Full Text Available Tasks such as distinguishing or identifying individual objects of interest require the production of dense local clouds at the scale of these individual objects of interest. Due to the physical and dynamic properties of an underwater environment, the usual dense matching algorithms must be rethought in order to be adaptive. These properties also imply that the scene must be observed at close range. Classic robotized acquisition systems are oversized for local studies in shallow water while the systematic acquisition of data is not guaranteed with divers. We address these two major issues through a multidisciplinary approach. To efficiently acquire on-demand stereoscopic pairs using simple logistics in small areas of shallow water, we devised an agile light-weight dedicated system which is easy to reproduce. To densely match two views in a reliable way, we devised a reconstruction algorithm that automatically accounts for the dynamics, variability and light absorption of the underwater environment. Field experiments in the Mediterranean Sea were used to assess the results.

  16. Active learning for semi-supervised clustering based on locally linear propagation reconstruction.

    Chang, Chin-Chun; Lin, Po-Yi


    The success of semi-supervised clustering relies on the effectiveness of side information. To get effective side information, a new active learner learning pairwise constraints known as must-link and cannot-link constraints is proposed in this paper. Three novel techniques are developed for learning effective pairwise constraints. The first technique is used to identify samples less important to cluster structures. This technique makes use of a kernel version of locally linear embedding for manifold learning. Samples neither important to locally linear propagation reconstructions of other samples nor on flat patches in the learned manifold are regarded as unimportant samples. The second is a novel criterion for query selection. This criterion considers not only the importance of a sample to expanding the space coverage of the learned samples but also the expected number of queries needed to learn the sample. To facilitate semi-supervised clustering, the third technique yields inferred must-links for passing information about flat patches in the learned manifold to semi-supervised clustering algorithms. Experimental results have shown that the learned pairwise constraints can capture the underlying cluster structures and proven the feasibility of the proposed approach. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Improved free-energy landscape reconstruction of bacteriorhodopsin highlights local variations in unfolding energy.

    Heenan, Patrick R; Yu, Hao; Siewny, Matthew G W; Perkins, Thomas T


    Precisely quantifying the energetics that drive the folding of membrane proteins into a lipid bilayer remains challenging. More than 15 years ago, atomic force microscopy (AFM) emerged as a powerful tool to mechanically extract individual membrane proteins from a lipid bilayer. Concurrently, fluctuation theorems, such as the Jarzynski equality, were applied to deduce equilibrium free energies (ΔG 0 ) from non-equilibrium single-molecule force spectroscopy records. The combination of these two advances in single-molecule studies deduced the free-energy of the model membrane protein bacteriorhodopsin in its native lipid bilayer. To elucidate this free-energy landscape at a higher resolution, we applied two recent developments. First, as an input to the reconstruction, we used force-extension curves acquired with a 100-fold higher time resolution and 10-fold higher force precision than traditional AFM studies of membrane proteins. Next, by using an inverse Weierstrass transform and the Jarzynski equality, we removed the free energy associated with the force probe and determined the molecular free-energy landscape of the molecule under study, bacteriorhodopsin. The resulting landscape yielded an average unfolding free energy per amino acid (aa) of 1.0 ± 0.1 kcal/mol, in agreement with past single-molecule studies. Moreover, on a smaller spatial scale, this high-resolution landscape also agreed with an equilibrium measurement of a particular three-aa transition in bacteriorhodopsin that yielded 2.7 kcal/mol/aa, an unexpectedly high value. Hence, while average unfolding ΔG 0 per aa is a useful metric, the derived high-resolution landscape details significant local variation from the mean. More generally, we demonstrated that, as anticipated, the inverse Weierstrass transform is an efficient means to reconstruct free-energy landscapes from AFM data.

  18. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Kumar, Manoj; Srivastava, Sheela


    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  19. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł


    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  20. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Woźny, Maciej, E-mail: [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)


    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  1. A comparison of semiglobal and local dense matching algorithms for surface reconstruction

    E. Dall'Asta


    Full Text Available Encouraged by the growing interest in automatic 3D image-based reconstruction, the development and improvement of robust stereo matching techniques is one of the most investigated research topic of the last years in photogrammetry and computer vision. The paper is focused on the comparison of some stereo matching algorithms (local and global which are very popular both in photogrammetry and computer vision. In particular, the Semi-Global Matching (SGM, which realizes a pixel-wise matching and relies on the application of consistency constraints during the matching cost aggregation, will be discussed. The results of some tests performed on real and simulated stereo image datasets, evaluating in particular the accuracy of the obtained digital surface models, will be presented. Several algorithms and different implementation are considered in the comparison, using freeware software codes like MICMAC and OpenCV, commercial software (e.g. Agisoft PhotoScan and proprietary codes implementing Least Square e Semi-Global Matching algorithms. The comparisons will also consider the completeness and the level of detail within fine structures, and the reliability and repeatability of the obtainable data.

  2. A comparison of semiglobal and local dense matching algorithms for surface reconstruction

    Dall'Asta, E.; Roncella, R.


    Encouraged by the growing interest in automatic 3D image-based reconstruction, the development and improvement of robust stereo matching techniques is one of the most investigated research topic of the last years in photogrammetry and computer vision. The paper is focused on the comparison of some stereo matching algorithms (local and global) which are very popular both in photogrammetry and computer vision. In particular, the Semi-Global Matching (SGM), which realizes a pixel-wise matching and relies on the application of consistency constraints during the matching cost aggregation, will be discussed. The results of some tests performed on real and simulated stereo image datasets, evaluating in particular the accuracy of the obtained digital surface models, will be presented. Several algorithms and different implementation are considered in the comparison, using freeware software codes like MICMAC and OpenCV, commercial software (e.g. Agisoft PhotoScan) and proprietary codes implementing Least Square e Semi-Global Matching algorithms. The comparisons will also consider the completeness and the level of detail within fine structures, and the reliability and repeatability of the obtainable data.

  3. WWER safety investigations on LR-0 reactor

    Mikus, J.


    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  4. Development of new anatomy reconstruction software to localize cardiac isochrones to the cardiac surface from the 12 lead ECG.

    van Dam, Peter M; Gordon, Jeffrey P; Laks, Michael M; Boyle, Noel G


    Non-invasive electrocardiographic imaging (ECGI) of the cardiac muscle can help the pre-procedure planning of the ablation of ventricular arrhythmias by reducing the time to localize the origin. Our non-invasive ECGI system, the cardiac isochrone positioning system (CIPS), requires non-intersecting meshes of the heart, lungs and torso. However, software to reconstruct the meshes of the heart, lungs and torso with the capability to check and prevent these intersections is currently lacking. Consequently the reconstruction of a patient specific model with realistic atrial and ventricular wall thickness and incorporating blood cavities, lungs and torso usually requires additional several days of manual work. Therefore new software was developed that checks and prevents any intersections, and thus enables the use of accurate reconstructed anatomical models within CIPS. In this preliminary study we investigated the accuracy of the created patient specific anatomical models from MRI or CT. During the manual segmentation of the MRI data the boundaries of the relevant tissues are determined. The resulting contour lines are used to automatically morph reference meshes of the heart, lungs or torso to match the boundaries of the morphed tissue. Five patients were included in the study; models of the heart, lungs and torso were reconstructed from standard cardiac MRI images. The accuracy was determined by computing the distance between the segmentation contours and the morphed meshes. The average accuracy of the reconstructed cardiac geometry was within 2mm with respect to the manual segmentation contours on the MRI images. Derived wall volumes and left ventricular wall thickness were within the range reported in literature. For each reconstructed heart model the anatomical heart axis was computed using the automatically determined anatomical landmarks of the left apex and the mitral valve. The accuracy of the reconstructed heart models was well within the accuracy of the used

  5. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  6. Microcystin-LR equivalent concentrations in fish tissue during a ...

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  7. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  8. Assessment of co-seismic landslide susceptibility using LR and ...

    Suchita Shrestha


    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  9. MO-DE-207A-11: Sparse-View CT Reconstruction Via a Novel Non-Local Means Method

    Chen, Z; Qi, H; Wu, S; Xu, Y; Zhou, L


    Purpose: Sparse-view computed tomography (CT) reconstruction is an effective strategy to reduce the radiation dose delivered to patients. Due to its insufficiency of measurements, traditional non-local means (NLM) based reconstruction methods often lead to over-smoothness in image edges. To address this problem, an adaptive NLM reconstruction method based on rotational invariance (RIANLM) is proposed. Methods: The method consists of four steps: 1) Initializing parameters; 2) Algebraic reconstruction technique (ART) reconstruction using raw projection data; 3) Positivity constraint of the image reconstructed by ART; 4) Update reconstructed image by using RIANLM filtering. In RIANLM, a novel similarity metric that is rotational invariance is proposed and used to calculate the distance between two patches. In this way, any patch with similar structure but different orientation to the reference patch would win a relatively large weight to avoid over-smoothed image. Moreover, the parameter h in RIANLM which controls the decay of the weights is adaptive to avoid over-smoothness, while it in NLM is not adaptive during the whole reconstruction process. The proposed method is named as ART-RIANLM and validated on Shepp-Logan phantom and clinical projection data. Results: In our experiments, the searching neighborhood size is set to 15 by 15 and the similarity window is set to 3 by 3. For the simulated case with a resolution of 256 by 256 Shepp-Logan phantom, the ART-RIANLM produces higher SNR (35.38dB<24.00dB) and lower MAE (0.0006<0.0023) reconstructed image than ART-NLM. The visual inspection demonstrated that the proposed method could suppress artifacts or noises more effectively and preserve image edges better. Similar results were found for clinical data case. Conclusion: A novel ART-RIANLM method for sparse-view CT reconstruction is presented with superior image. Compared to the conventional ART-NLM method, the SNR and MAE from ART-RIANLM increases 47% and decreases 74

  10. ‘Interrupted’ Landscapes: Post-Earthquake Reconstruction in between Urban Renewal and Social Identity of Local Communities

    Matteo Clemente


    Full Text Available The present study deals with the topic of post-seismic reconstruction focusing on landscape and social issues. Sustainable reconstruction requires a connection between the physical context of a given territory and the immaterial (historical, cultural, productive values that constitute the place’s identity. In this perspective, those places that have been destroyed by severe earthquakes or other disasters could be labelled as “interrupted landscapes”, meaning a drastic break in the individual stories attaching the people to their own territory, as well as an abrupt alteration of the continuous process by which people attribute a sense to their own territory. The study discusses selected cases of post-earthquake reconstruction in Italy, providing an overview of different visions for development of the new towns, that oscillate between two contrasting approaches: the “new town” model, implying the construction of a new town off-site and the “in loco” model. Looking for the reasons for failures of the new town model reconstruction, the study also debates the social dimension of urban landscapes, reflecting upon the notion of ‘collective identity’ connecting place attachment to cultural heritage. These issues were finally considered when defining strategic guidelines for sustainable urban reconstruction promoting place identity and preserving the intimate characteristics of the affected landscapes. Governance actions were defined along with sustainability strategies based on the investigated case studies, outlining a series of best practices that may promote the permanent involvement of local communities.

  11. A study on image reconstruction for seed localization for permanent prostate brachytherapy

    Hong, Ju Young; Rah, Jeong Eun; Suh, Tae Suk


    This study was to design and fabricate a phantom for prostate cancer brachytherapy to validate a developed program applying a 3-film technique, and to compare it with the conventional 2-film technique for determining the location of an implanted seed. The images were obtained from overlapped seeds by randomly placing a maximum of 63 seeds in the interior-posterior (AP) position and at -30 .deg. to 30 .deg. at 15 .deg. intervals. Images obtained by use of the phantom were applied to the image processing procedure, and were then processed into the development program for seed localization. In this study, cases were set where one seed overlapped, where two seeds overlapped and where none of the three views resolved all seeds. The distance between the centers of each seed to the reference seed was calculated in a prescribed region. This distance determined the location of each seed in a given band. The location of the overlapped seeds was compared with that of the 2-film technique. With this program, the detection rate was 92.2% (at ± 15 .deg. ), 94.1% (at ± 30 .deg.) and 70.6% (compared to the use of the 2-film technique). The overlaps were caused by one or more than two seeds that overlapped; the developed program can identify the location of each seed perfectly. However, for the third case the program was not able to resolve the overlap of the seeds. This program can be used to improve treatment outcome for the brachytherapy of prostate cancer by reducing the number of errors in the process of reconstructing the locations of perfectly overlapped seeds

  12. Linking local retention, self-recruitment, and persistence in marine metapopulations

    Lett, Christophe; Nguyen-Huu, Tri; Cuif, Marion; Saenz Agudelo, Pablo; Kaplan, David M.


    Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR

  13. 3D skin surface reconstruction from a single image by merging global curvature and local texture using the guided filtering for 3D haptic palpation.

    Lee, K; Kim, M; Kim, K


    Skin surface evaluation has been studied using various imaging techniques. However, all these studies had limited impact because they were performed using visual exam only. To improve on this scenario with haptic feedback, we propose 3D reconstruction of the skin surface using a single image. Unlike extant 3D skin surface reconstruction algorithms, we utilize the local texture and global curvature regions, combining the results for reconstruction. The first entails the reconstruction of global curvature, achieved by bilateral filtering that removes noise on the surface while maintaining the edge (ie, furrow) to obtain the overall curvature. The second entails the reconstruction of local texture, representing the fine wrinkles of the skin, using an advanced form of bilateral filtering. The final image is then composed by merging the two reconstructed images. We tested the curvature reconstruction part by comparing the resulting curvatures with measured values from real phantom objects while local texture reconstruction was verified by measuring skin surface roughness. Then, we showed the reconstructed result of our proposed algorithm via the reconstruction of various real skin surfaces. The experimental results demonstrate that our approach is a promising technology to reconstruct an accurate skin surface with a single skin image. We proposed 3D skin surface reconstruction using only a single camera. We highlighted the utility of global curvature, which has not been considered important in the past. Thus, we proposed a new method for 3D reconstruction that can be used for 3D haptic palpation, dividing the concepts of local and global regions. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Usefulness of ventricular endocardial electric reconstruction from body surface potential maps to noninvasively localize ventricular ectopic activity in patients

    Lai, Dakun; Sun, Jian; Li, Yigang; He, Bin


    As radio frequency (RF) catheter ablation becomes increasingly prevalent in the management of ventricular arrhythmia in patients, an accurate and rapid determination of the arrhythmogenic site is of important clinical interest. The aim of this study was to test the hypothesis that the inversely reconstructed ventricular endocardial current density distribution from body surface potential maps (BSPMs) can localize the regions critical for maintenance of a ventricular ectopic activity. Patients with isolated and monomorphic premature ventricular contractions (PVCs) were investigated by noninvasive BSPMs and subsequent invasive catheter mapping and ablation. Equivalent current density (CD) reconstruction (CDR) during symptomatic PVCs was obtained on the endocardial ventricular surface in six patients (four men, two women, years 23-77), and the origin of the spontaneous ectopic activity was localized at the location of the maximum CD value. Compared with the last (successful) ablation site (LAS), the mean and standard deviation of localization error of the CDR approach were 13.8 and 1.3 mm, respectively. In comparison, the distance between the LASs and the estimated locations of an equivalent single moving dipole in the heart was 25.5 ± 5.5 mm. The obtained CD distribution of activated sources extending from the catheter ablation site also showed a high consistency with the invasively recorded electroanatomical maps. The noninvasively reconstructed endocardial CD distribution is suitable to predict a region of interest containing or close to arrhythmia source, which may have the potential to guide RF catheter ablation.

  15. Absolute Transition Rates in {sup 188}lr

    Malmskog, S G; Berg, V


    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  16. Use of computer-assisted design and manufacturing to localize dural venous sinuses during reconstructive surgery for craniosynostosis.

    Iyer, Rajiv R; Wu, Adela; Macmillan, Alexandra; Musavi, Leila; Cho, Regina; Lopez, Joseph; Jallo, George I; Dorafshar, Amir H; Ahn, Edward S


    Cranial vault remodeling surgery for craniosynostosis carries the potential risk of dural venous sinus injury given the extensive bony exposure. Identification of the dural venous sinuses can be challenging in patients with craniosynostosis given the lack of accurate surface-localizing landmarks. Computer-aided design and manufacturing (CAD/CAM) has allowed surgeons to pre-operatively plan these complex procedures in an effort to increase reconstructive efficiency. An added benefit of this technology is the ability to intraoperatively map the dural venous sinuses based on pre-operative imaging. We utilized CAD/CAM technology to intraoperatively map the dural venous sinuses for patients undergoing reconstructive surgery for craniosynostosis in an effort to prevent sinus injury, increase operative efficiency, and enhance patient safety. Here, we describe our experience utilizing this intraoperative technology in pediatric patients with craniosynostosis. We retrospectively reviewed the charts of children undergoing reconstructive surgery for craniosynostosis using CAD/CAM surgical planning guides at our institution between 2012 and 2016. Data collected included the following: age, gender, type of craniosynostosis, estimated blood loss, sagittal sinus deviation from the sagittal suture, peri-operative outcomes, and hospital length of stay. Thirty-two patients underwent reconstructive cranial surgery for craniosynostosis, with a median age of 11 months (range, 7-160). Types of synostosis included metopic (6), unicoronal (6), sagittal (15), lambdoid (1), and multiple suture (4). Sagittal sinus deviation from the sagittal suture was maximal in unicoronal synostosis patients (10.2 ± 0.9 mm). All patients tolerated surgery well, and there were no occurrences of sagittal sinus, transverse sinus, or torcular injury. The use of CAD/CAM technology allows for accurate intraoperative dural venous sinus localization during reconstructive surgery for craniosynostosis and

  17. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...


    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  18. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Xiaobin Guo


    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  19. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    Zeller, P.; Clement, M.; Fessard, V.


    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  20. Two-step superresolution approach for surveillance face image through radial basis function-partial least squares regression and locality-induced sparse representation

    Jiang, Junjun; Hu, Ruimin; Han, Zhen; Wang, Zhongyuan; Chen, Jun


    Face superresolution (SR), or face hallucination, refers to the technique of generating a high-resolution (HR) face image from a low-resolution (LR) one with the help of a set of training examples. It aims at transcending the limitations of electronic imaging systems. Applications of face SR include video surveillance, in which the individual of interest is often far from cameras. A two-step method is proposed to infer a high-quality and HR face image from a low-quality and LR observation. First, we establish the nonlinear relationship between LR face images and HR ones, according to radial basis function and partial least squares (RBF-PLS) regression, to transform the LR face into the global face space. Then, a locality-induced sparse representation (LiSR) approach is presented to enhance the local facial details once all the global faces for each LR training face are constructed. A comparison of some state-of-the-art SR methods shows the superiority of the proposed two-step approach, RBF-PLS global face regression followed by LiSR-based local patch reconstruction. Experiments also demonstrate the effectiveness under both simulation conditions and some real conditions.

  1. Reconstruction of Local Sea Levels at South West Pacific Islands—A Multiple Linear Regression Approach (1988-2014)

    Kumar, V.; Melet, A.; Meyssignac, B.; Ganachaud, A.; Kessler, W. S.; Singh, A.; Aucan, J.


    Rising sea levels are a critical concern in small island nations. The problem is especially serious in the western south Pacific, where the total sea level rise over the last 60 years has been up to 3 times the global average. In this study, we aim at reconstructing sea levels at selected sites in the region (Suva, Lautoka—Fiji, and Nouméa—New Caledonia) as a multilinear regression (MLR) of atmospheric and oceanic variables. We focus on sea level variability at interannual-to-interdecadal time scales, and trend over the 1988-2014 period. Local sea levels are first expressed as a sum of steric and mass changes. Then a dynamical approach is used based on wind stress curl as a proxy for the thermosteric component, as wind stress curl anomalies can modulate the thermocline depth and resultant sea levels via Rossby wave propagation. Statistically significant predictors among wind stress curl, halosteric sea level, zonal/meridional wind stress components, and sea surface temperature are used to construct a MLR model simulating local sea levels. Although we are focusing on the local scale, the global mean sea level needs to be adjusted for. Our reconstructions provide insights on key drivers of sea level variability at the selected sites, showing that while local dynamics and the global signal modulate sea level to a given extent, most of the variance is driven by regional factors. On average, the MLR model is able to reproduce 82% of the variance in island sea level, and could be used to derive local sea level projections via downscaling of climate models.

  2. Reconstruction of railroads at Klaipéda da National Seaport: Local Health Impact Assessment Case in Lithuania

    Ingrida Zurlytè


    Full Text Available Background: Introduction of health impact assessment (HIA as a national legal requirement for planned economic activity projects in 2002 and the further development of related procedures and methodological requirements has boosted the number of HIAs carried out both as an integrated part of environmental impact assessment (EIA procedures as well as an independent activity. Most of HIAs have been conduct for local projects. The HIA for the reconstruction of the southern section of the railroads in Klaip da National Seaport is one of the local HIAs in Lithuania carried out as an independent procedure. Methods: The HIA for the reconstruction of the southern section of the railroads in Klaipda National Seaport was carried out following the national legal procedure for the cases not foreseen in the Law on Environmental Impact Assessment of Planned Economic Activity and the national HIA methodological regulations. The HIA included a literature review, analysis of related technical documentation, data on existing and estimated air pollution and environmental noise levels and possible health consequences, analysis of local demographic and health statistics; interviews with the residents living in proximity of the planned activity, analysis of public complaints on existing activities at Klaip da National Seaport, site visit and round table discussions with the proponent of the planned activity, planning company and representatives of the public health authority. The standard or intermediate type of perspective HIA was applied. Results: The HIA report has pointed out noise, vibration, ambient air pollution, psychological factors as related to possible negative impact on health of residents living in the mostly exposed locations. Interviews with inhabitants living in proximity of the planned activity have shown that majority of them knew nothing about the reconstruction plans. Recommendations were provided in the report how to minimise

  3. Passive detection and localization of fatigue cracking in aluminum plates using Green's function reconstruction from ambient noise.

    Yang, Yang; Xiao, Li; Qu, Wenzhong; Lu, Ye


    Recent theoretical and experimental studies have demonstrated that a local Green's function can be retrieved from the cross-correlation of ambient noise field. This technique can be used to detect fatigue cracking in metallic structures, owing to the fact that the presence of crack can lead to a change in Green's function. This paper presents a method of structural fatigue cracking characterization method by measuring Green's function reconstruction from noise excitation and verifies the feasibility of crack detection in poor noise source distribution. Fatigue cracks usually generate nonlinear effects, in which different wave amplitudes and frequency compositions can cause different nonlinear responses. This study also undertakes analysis of the capacity of the proposed approach to identify fatigue cracking under different noise amplitudes and frequency ranges. Experimental investigations of an aluminum plate are conducted to assess the cross-correlations of received noise between sensor pairs and finally to detect the introduced fatigue crack. A damage index is proposed according to the variation between cross-correlations obtained from the pristine crack closed state and the crack opening-closure state when sufficient noise amplitude is used to generate nonlinearity. A probability distribution map of damage is calculated based on damage indices. The fatigue crack introduced in the aluminum plate is successfully identified and oriented, verifying that a fatigue crack can be detected by reconstructing Green's functions from an imperfect diffuse field in which ambient noise sources exist locally. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The hydration enthalpies of Md3+ and Lr3+

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.


    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  5. Systematic assembly homogenization and local flux reconstruction for nodal method calculations of fast reactor power distributions

    Dorning, J.J.


    A simultaneous pin lattice cell and fuel bundle homogenization theory has been developed for use with nodal diffusion calculations of practical reactors. The theoretical development of the homogenization theory, which is based on multiple-scales asymptotic expansion methods carried out through fourth order in a small parameter, starts from the transport equation and systematically yields: a cell-homogenized bundled diffusion equation with self-consistent expressions for the cell-homogenized cross sections and diffusion tensor elements; and a bundle-homogenized global reactor diffusion equation with self-consistent expressions for the bundle-homogenized cross sections and diffusion tensor elements. The continuity of the angular flux at cell and bundle interfaces also systematically yields jump conditions for the scaler flux or so-called flux discontinuity factors on the cell and bundle interfaces in terms of the two adjacent cell or bundle eigenfunctions. The expressions required for the reconstruction of the angular flux or the 'de-homogenization' theory were obtained as an integral part of the development; hence the leading order transport theory angular flux is easily reconstructed throughout the reactor including the regions in the interior of the fuel bundles or computational nodes and in the interiors of the pin lattice cells. The theoretical development shows that the exact transport theory angular flux is obtained to first order from the whole-reactor nodal diffusion calculations, done using the homogenized nuclear data and discontinuity factors, is a product of three computed quantities: a ''cell shape function''; a ''bundle shape function''; and a ''global shape function''. 10 refs

  6. local

    Abílio Amiguinho


    Full Text Available The process of socio-educational territorialisation in rural contexts is the topic of this text. The theme corresponds to a challenge to address it having as main axis of discussion either the problem of social exclusion or that of local development. The reasons to locate the discussion in this last field of analysis are discussed in the first part of the text. Theoretical and political reasons are there articulated because the question is about projects whose intentions and practices call for the political both in the theoretical debate and in the choices that anticipate intervention. From research conducted for several years, I use contributions that aim at discuss and enlighten how school can be a potential locus of local development. Its identification and recognition as local institution (either because of those that work and live in it or because of those that act in the surrounding context are crucial steps to progressively constitute school as a partner for development. The promotion of the local values and roots, the reconstruction of socio-personal and local identities, the production of sociabilities and the equation and solution of shared problems were the dimensions of a socio-educative intervention, markedly globalising. This scenario, as it is argued, was also, intentionally, one of transformation and of deliberate change of school and of the administration of the educative territoires.

  7. Multi-person localization and orientation estimation in volumetric scene reconstructions

    Liem, M.C.


    Accurate localization of persons and estimation of their pose are important topics in current-day computer vision research. As part of the pose estimation, estimating the body orientation of a person (i.e. rotation around torso major axis) conveys important information about the person's current

  8. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Kumar, Manoj; Srivastava, Sheela


    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  9. Single Image Super-Resolution Using Global Regression Based on Multiple Local Linear Mappings.

    Choi, Jae-Seok; Kim, Munchurl


    Super-resolution (SR) has become more vital, because of its capability to generate high-quality ultra-high definition (UHD) high-resolution (HR) images from low-resolution (LR) input images. Conventional SR methods entail high computational complexity, which makes them difficult to be implemented for up-scaling of full-high-definition input images into UHD-resolution images. Nevertheless, our previous super-interpolation (SI) method showed a good compromise between Peak-Signal-to-Noise Ratio (PSNR) performances and computational complexity. However, since SI only utilizes simple linear mappings, it may fail to precisely reconstruct HR patches with complex texture. In this paper, we present a novel SR method, which inherits the large-to-small patch conversion scheme from SI but uses global regression based on local linear mappings (GLM). Thus, our new SR method is called GLM-SI. In GLM-SI, each LR input patch is divided into 25 overlapped subpatches. Next, based on the local properties of these subpatches, 25 different local linear mappings are applied to the current LR input patch to generate 25 HR patch candidates, which are then regressed into one final HR patch using a global regressor. The local linear mappings are learned cluster-wise in our off-line training phase. The main contribution of this paper is as follows: Previously, linear-mapping-based conventional SR methods, including SI only used one simple yet coarse linear mapping to each patch to reconstruct its HR version. On the contrary, for each LR input patch, our GLM-SI is the first to apply a combination of multiple local linear mappings, where each local linear mapping is found according to local properties of the current LR patch. Therefore, it can better approximate nonlinear LR-to-HR mappings for HR patches with complex texture. Experiment results show that the proposed GLM-SI method outperforms most of the state-of-the-art methods, and shows comparable PSNR performance with much lower

  10. LALR(1) : LL(1) = LR(0) : LL(0)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.


    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  11. Local structure reconstruction in hydrogenated amorphous silicon from angular correlation and synchrotron diffraction studies

    Britton, D.T.; Minani, E.; Knoesen, D.; Schut, H.; Eijt, S.W.H.; Furlan, F.; Giles, C.; Haerting, M.


    Hydrogenated amorphous silicon (a-Si:H) is a widely used thin film semiconductor material which is still incompletely understood. It is generally assumed to form a continuous random network, with a high concentration of coordination defects (dangling bonds), which are hydrogen terminated. Neither the exact nature of these sites nor the degree of medium range order has been fully determined. In this paper, we present the first results for the local structure, from a combined study using angular correlation of positron annihilation radiation (ACAR) and synchrotron radiation diffraction. Reciprocal space information is obtained directly, for the mesoscale structure and the local defect structure, from the orientation dependent diffraction and 2D-ACAR patterns, respectively. Furthermore, inversion of both patterns yields a comparison of real space information through maps of the silicon-silicon pair correlation function and the electron-positron autocorrelation function B 2γ (r). From this information, it is possible to identify the dominant structural defect as a vacancy-size dangling bond cluster, around which the network strain is fully relaxed

  12. Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs

    E. Zea Escamilla


    Full Text Available This data article presents the life cycle inventories of 20 transitional shelter solutions. The data was gathered from the reports 8 shelter designs [1]; 10 post-disaster shelter designs [2]; the environmental impact of brick production outside of Europe [3]; and the optimization of bamboo-based post-disaster housing units for tropical and subtropical regions using LCA methodologies [4]. These reports include bill of quantities, plans, performance analysis, and lifespan of the studied shelters. The data from these reports was used to develop the Life Cycle Inventories (LCI. All the amounts were converted from their original units (length, volume and amount into mass (kg units and the transport distance into ton×km. These LCIs represent the production phases of each shelter and the transportation distances for the construction materials. Two types of distances were included, local (road and international (freight ship, which were estimated based on the area of the country of study. Furthermore, the digital visualization of the shelters is presented for each of the 20 designs. Moreover, this data article presents a summary of the results for the categories Environment, Cost and Risk and the contribution to the environmental impact from the different building components of each shelter. These results are related to the article “Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs”[5

  13. Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs.

    Zea Escamilla, E; Habert, G


    This data article presents the life cycle inventories of 20 transitional shelter solutions. The data was gathered from the reports 8 shelter designs [1]; 10 post-disaster shelter designs [2]; the environmental impact of brick production outside of Europe [3]; and the optimization of bamboo-based post-disaster housing units for tropical and subtropical regions using LCA methodologies [4]. These reports include bill of quantities, plans, performance analysis, and lifespan of the studied shelters. The data from these reports was used to develop the Life Cycle Inventories (LCI). All the amounts were converted from their original units (length, volume and amount) into mass (kg) units and the transport distance into ton×km. These LCIs represent the production phases of each shelter and the transportation distances for the construction materials. Two types of distances were included, local (road) and international (freight ship), which were estimated based on the area of the country of study. Furthermore, the digital visualization of the shelters is presented for each of the 20 designs. Moreover, this data article presents a summary of the results for the categories Environment, Cost and Risk and the contribution to the environmental impact from the different building components of each shelter. These results are related to the article "Global or local construction materials for post-disaster reconstruction? Sustainability assessment of 20 post-disaster shelter designs"[5].

  14. Oncoplastic Resection of Retroareolar Breast Cancer: Central Quadrantectomy and Reconstruction by Local Skin-Glandular Flap

    Naguib, S.F.


    Background: Patients with central breast neoplasms account for 5 to 20% of breast cancer cases and, for a long time, they have been denied Breast Conservation Surgery (BCS) and conventionally treated with mastectomy. The high incidence of Nipple-Areola-Complex (NAC) involvement usually associated with these tumors necessitates nipple and areolar resection together with an adequate safety margin around the tumor, which yields an unacceptable cosmetic result. With the help of Oncoplastic Surgical Techniques, BCS can be offered to these patients. In this study central quadrantectomy and breast reconstruction by an infero-Iaterally based pedicled flap were evaluated. Patients and Methods: This study comprised 23 women with central breast tumors treated at the National Cancer Institute (NC]), Cairo University and at the Aswan Cancer Center, Egyptian Ministry of Health. Their ages ranged from 31 to 62 years (mean: 48.4±10.2 years). Twenty-two had a palpable mass, while only I had Paget's disease of the nipple without mass. The size of their tumors ranged from 4 to 33mm (mean: 16.9±8.6mm). Only 9 women showed clinical suspicion of NAC involvement in the form of nipple retraction. Seventeen cases had their tumors strictly in the retro-areolar region, while 5 had tumors extending for a maximum of I.5Cm beyond the areolar edge. All patients underwent central quadrantec-tomy with NAC resection removing a cylinder of breast tissue reaching down to the pectoral muscle together with axillary dissection. Advancement of an infero-Iaterally based skin-glandular flap was then carried out. All patients received adjuvant radiotherapy with or without chemotherapy or hormonal therapy. Results: Fourteen patients showed pathological evidence of nipple infiltration (60.8%). The free safety margin (SM) ranged from 9 to 13mm (mean: 10. 0.9mm). This could be accomplished from the first attempt in 18 patients; however, in 5 patients a second wider excision was needed to obtain an adequate

  15. Low rank alternating direction method of multipliers reconstruction for MR fingerprinting.

    Assländer, Jakob; Cloos, Martijn A; Knoll, Florian; Sodickson, Daniel K; Hennig, Jürgen; Lattanzi, Riccardo


    The proposed reconstruction framework addresses the reconstruction accuracy, noise propagation and computation time for magnetic resonance fingerprinting. Based on a singular value decomposition of the signal evolution, magnetic resonance fingerprinting is formulated as a low rank (LR) inverse problem in which one image is reconstructed for each singular value under consideration. This LR approximation of the signal evolution reduces the computational burden by reducing the number of Fourier transformations. Also, the LR approximation improves the conditioning of the problem, which is further improved by extending the LR inverse problem to an augmented Lagrangian that is solved by the alternating direction method of multipliers. The root mean square error and the noise propagation are analyzed in simulations. For verification, in vivo examples are provided. The proposed LR alternating direction method of multipliers approach shows a reduced root mean square error compared to the original fingerprinting reconstruction, to a LR approximation alone and to an alternating direction method of multipliers approach without a LR approximation. Incorporating sensitivity encoding allows for further artifact reduction. The proposed reconstruction provides robust convergence, reduced computational burden and improved image quality compared to other magnetic resonance fingerprinting reconstruction approaches evaluated in this study. Magn Reson Med 79:83-96, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  16. Neoadjuvant radiotherapy followed by mastectomy and immediate breast reconstruction. An alternative treatment option for locally advanced breast cancer

    Pazos, Montserrat; Corradini, Stefanie; Schoenecker, Stephan; Scheithauer, Heike; Belka, Claus [LMU Munich, Department of Radiation Oncology, Munich (Germany); Dian, Darius [Mednord Munich Clinic, Munich (Germany); Bodungen, Vera von; Ditsch, Nina; Wuerstlein, Rachel; Harbeck, Nadia [LMU Munich, Breast Center, Department of Obstetrics and Gynecology, Munich (Germany)


    The optimal sequence of mastectomy with immediate breast reconstruction (IBR) and radiotherapy (RT) for the treatment of locally advanced breast cancer (LABC) is still under debate. Increased rates of postoperative complications are described following postmastectomy RT. Neoadjuvant RT aims to improve the aesthetic results and simplify the reconstructive pathway. A total of 22 patients diagnosed with LABC and treated with neoadjuvant RT followed by mastectomy and IBR between 04/2012 and 03/2015 were retrospectively analyzed. RT consisted of external beam RT to the breast and the regional lymphatics, if indicated. Both implant-based and autologous tissue-transfer reconstruction techniques were used. At the time of RT, 10 patients had no prior surgery and 12 patients had previously undergone breast-conserving surgery (BCS) with positive resection margins without the possibility to perform a second BCS. Additional neoadjuvant chemotherapy was administered in 18 patients prior to RT. A complete pathological response was achieved in 55.0% of patients. The 2-year overall survival rate was 89.3%, the 2-year disease-free-survival 79.8% and the local-recurrence-free survival was 95.2%. The cosmetic result was excellent or good in 66% of the patients treated with upfront mastectomy and 37% of the patients who had previously undergone BCS. Among patients who received implant-based IBR, 4 patients developed serious wound-healing problems with implant loss. The most satisfactory results were achieved with autologous tissue reconstruction. A sequential neoadjuvant chemo-/radiotherapy to allow IBR following mastectomy in selected cases of LABC seems feasible and can be safely attempted. Careful patient selection, close monitoring, and continuous patient support is mandatory to ensure compliance in this treatment strategy. (orig.) [German] Die optimale Therapiesequenz von Mastektomie mit sofortiger Brustrekonstruktion (IBR) und Radiotherapie (RT) beim lokal fortgeschrittenen

  17. ELUCID—Exploring the Local Universe with the reConstructed Initial Density Field. II. Reconstruction Diagnostics, Applied to Numerical Halo Catalogs

    Tweed, Dylan; Yang, Xiaohu; Li, Shijie; Jing, Y. P. [Center for Astronomy and Astrophysics, Shanghai Jiao Tong University, Shanghai 200240 (China); Wang, Huiyuan [Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Cui, Weiguang [Departamento de Física Teórica, Módulo 15, Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Zhang, Youcai [Shanghai Astronomical Observatory, Nandan Road 80, Shanghai 200030 (China); Mo, H. J., E-mail: [Department of Astronomy, University of Massachusetts, Amherst MA, 01003-9305 (United States)


    The ELUCID project aims to build a series of realistic cosmological simulations that reproduce the spatial and mass distributions of the galaxies as observed in the Sloan Digital Sky Survey. This requires powerful reconstruction techniques to create constrained initial conditions (ICs). We test the reconstruction method by applying it to several N -body simulations. We use two medium-resolution simulations, which each produced three additional constrained N -body simulations. We compare the resulting friend-of-friend catalogs by using the particle indexes as tracers, and quantify the quality of the reconstruction by varying the main smoothing parameter. The cross-identification method we use proves to be efficient, and the results suggest that the most massive reconstructed halos are effectively traced from the same Lagrangian regions in the ICs. A preliminary time-dependence analysis indicates that high-mass-end halos converge only at a redshift close to the reconstruction redshift. This suggests that, for earlier snapshots, only collections of progenitors may be effectively cross-identified.

  18. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)


    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  19. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Hussein, A.S.


    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  20. Bulk etch rate of LR-115 cellulose nitrate film

    Harris, M.J.; Schlenker, R.A.


    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  1. Oncologic outcome after local recurrence of chondrosarcoma: Analysis of prognostic factors.

    Kim, Han-Soo; Bindiganavile, Srimanth S; Han, Ilkyu


    Literature on outcome after local recurrence (LR) in chondrosarcoma is scarce and better appreciation of prognostic factors is needed. (1) To evaluate post-LR oncologic outcomes of disease-specific survival and subsequent LR and (2) to identify prognostic factors for post-LR oncologic outcomes. Review of 28 patients with locally recurrent chondrosarcoma from the original cohort of 150 patients, who were treated surgically with or without adjuvants between 1982 and 2011, was performed. Mean age was 46 years (range, 21-73) which included 20 males and 8 females with mean follow up of 8.4 ± 7.5 years (range, 1.2-31.0). Post-LR survival at 5 years was 58.6 ± 10.3%. Age greater than 50 years (P = 0.011) and LR occurring within 1 year of primary surgery (P = 0.011) independently predicted poor survival. Seven patients suffered subsequent LR, which was significantly affected by surgical margin for LR (P = 0.038). Long-term survival of locally recurrent chondrosarcoma is achievable in a substantial number of patients. Older age at onset of LR and shorter interval from primary surgery to LR identifies high risk patients for poor post-LR survival while, wide surgical margins at LR surgery reduces the risk of subsequent LR. © 2015 Wiley Periodicals, Inc.

  2. Microcystin-LR in surface water of Ponjavica river

    Natić Dejan


    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  3. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor


    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.


    Mehmet AYBEKE


    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. A Comparison of the Local Flap and Skin Graft by Location of Face in Reconstruction after Resection of Facial Skin Cancer.

    Lee, Kyung Suk; Kim, Jun Oh; Kim, Nam Gyun; Lee, Yoon Jung; Park, Young Ji; Kim, Jun Sik


    Surgery for reconstruction of defects after surgery should be performed selectively and the many points must be considered. The authors conducted this study to compare the local flap and skin graft by facial location in the reconstruction after resection of facial skin cancer. The authors performed the study in patients that had received treatment in Department of Plastic Surgery, Gyeongsang National University. The cases were analyzed according to the reconstruction methods for the defects after surgery, sex, age, tumor site, and tumor size. Additionally, the authors compared differences of aesthetic satisfaction (out of 5 points) of patients in the local flap and skin graft by facial location after resection of facial skin cancer by dividing the face into eight areas. A total of 153 cases were confirmed. The most common facial skin cancer was basal cell carcinoma (56.8%, 87 cases), followed by squamous cell carcinoma (37.2%, 57 cases) and bowen's disease (5.8%, 9 cases). The most common reconstruction method was local flap 119 cases (77.7%), followed by skin graft 34 cases (22.3%). 86 patients answered the questionnaire and mean satisfaction of the local flap and skin graft were 4.3 and 3.5 ( p =0.04), respectively, indicating that satisfaction of local flap was significantly high. When comparing satisfaction of patients according to results, local flap shows excellent effects in functional and cosmetic aspects would be able to provide excellent results rather than using a skin graft with poor touch and tone compared to the surrounding normal skin.

  6. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor


    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. A multidisciplinary protocol for planned skin-preserving delayed breast reconstruction for patients with locally advanced breast cancer requiring postmastectomy radiation therapy: 3-year follow-up.

    Kronowitz, Steven J; Lam, Candace; Terefe, Welela; Hunt, Kelly K; Kuerer, Henry M; Valero, Vicente; Lance, Samuel; Robb, Geoffrey L; Feng, Lei; Buchholz, Thomas A


    The authors examined the safety of a protocol for planned skin-preserving delayed breast reconstruction after postmastectomy radiotherapy with placement of a tissue expander for patients with locally advanced breast cancer (stages IIB and III). The authors compared 47 patients treated according to the protocol between December 2003 and May 2008 with 47 disease-stage-matched control patients who underwent standard delayed reconstruction after postmastectomy radiotherapy (no skin preservation or tissue expander) during the same period. Protocol-group complication rates were 21 percent for skin-preserving mastectomy and placement of the expander (stage 1), 5 percent for postmastectomy radiotherapy, 25 percent for expander reinflation after radiotherapy, and 24 percent for skin-preserving delayed reconstruction. The complication rate for standard delayed reconstruction was 38 percent. Tissue-expander loss rates were 32 percent overall, 9 percent for stage 1, 5 percent for postmastectomy radiotherapy, and 22 percent for reinflation. Wound-healing complications after reconstruction occurred in 3 percent of protocol-group and 10 percent of control-group patients. The median follow-up time for patients still alive at last follow-up was 40 months (range, 8.5 to 85.3 months). Three-year recurrence-free survival rates were 92 percent (95 percent CI, 83 to 100 percent) and 86 percent (95 percent CI, 76 to 98 percent) for the protocol and control groups, respectively (p = 0.87). In patients with locally advanced breast cancer, skin-preserving mastectomy with a deflated tissue expander on the chest wall during postmastectomy radiotherapy does not increase locoregional recurrence risk and is associated with lower complication rates of definitive reconstruction.

  8. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  9. Multi-slice spiral CT multiplanar reconstruction findings of localized fat collection adjection to the subdiaphragmatic inferior vena cava

    Cao Hetao; Lu Jian; Zhao Jinli; Liu Tingting; Qin Jufeng; Xu Wen; Qin Jiangchun; Jiang Junkang


    Objective: To discusses the MSCT multiplanar reconstruction manifestation (MPR) of localized fat collection adjection to subdiaphragmatic inferior vena cava (IVC fat ). Methods: The thoracic and abdominal MSCT scan data of 8246 patients were browsed,45 patients with presumed IVC fat on axial CT scans were further studied prospectively with MSCT MPR. The predisposing position of IVC fat and its relationship with IVC were observed. It was divided into two kinds of intraluminal type and extraluminal type according to the angle of IVC fat with respect of the wall of IVC.The other 50 patients without IVC fat were randomly selected as the control group. The sagittal inclination angle (SIA) and diameter ratio (DR) between supra- and sub-diaphragmatic IVC between the two groups were compared by using t test. Results: The detection rate was 0.55% (45/8246). Of which hepatic vein lacuna 8 patients, subdiaphragmatic gap medial to IVC 28 patients and IVC groove 9 patients. The shape of IVC fat showed mainly for the round, oval and crescents on axial CT scans, of 15 patients intraluminal type, 4 showed 'target signs'. The shape of IVC fat showed mainly for 'half-moon' at MPR.The SIA and DR at IVC fat group were 21.62° ± 8.42° and 2.01 ±0.84 respectively, at control group were 16.75° ±7.82° (t=1.594, P>0.05) and 1.31 ±0.28 (t=2.341, P<0.05) respectively. Conclusion: The round, oval or half of limited fat density shadow adjection to subdiaphragmatic inferior vena cava which similar to in the lumen is the characteristic performance of IVC fat , it may be an anatomical variation. (authors)

  10. Real-time volumetric image reconstruction and 3D tumor localization based on a single x-ray projection image for lung cancer radiotherapy.

    Li, Ruijiang; Jia, Xun; Lewis, John H; Gu, Xuejun; Folkerts, Michael; Men, Chunhua; Jiang, Steve B


    To develop an algorithm for real-time volumetric image reconstruction and 3D tumor localization based on a single x-ray projection image for lung cancer radiotherapy. Given a set of volumetric images of a patient at N breathing phases as the training data, deformable image registration was performed between a reference phase and the other N-1 phases, resulting in N-1 deformation vector fields (DVFs). These DVFs can be represented efficiently by a few eigenvectors and coefficients obtained from principal component analysis (PCA). By varying the PCA coefficients, new DVFs can be generated, which, when applied on the reference image, lead to new volumetric images. A volumetric image can then be reconstructed from a single projection image by optimizing the PCA coefficients such that its computed projection matches the measured one. The 3D location of the tumor can be derived by applying the inverted DVF on its position in the reference image. The algorithm was implemented on graphics processing units (GPUs) to achieve real-time efficiency. The training data were generated using a realistic and dynamic mathematical phantom with ten breathing phases. The testing data were 360 cone beam projections corresponding to one gantry rotation, simulated using the same phantom with a 50% increase in breathing amplitude. The average relative image intensity error of the reconstructed volumetric images is 6.9% +/- 2.4%. The average 3D tumor localization error is 0.8 +/- 0.5 mm. On an NVIDIA Tesla C1060 GPU card, the average computation time for reconstructing a volumetric image from each projection is 0.24 s (range: 0.17 and 0.35 s). The authors have shown the feasibility of reconstructing volumetric images and localizing tumor positions in 3D in near real-time from a single x-ray image.

  11. LR1: a candidate RNA virus of Leishmania.

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K


    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  12. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat


    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A


    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  14. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan


    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  15. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)


    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  16. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR


    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  17. Perturbation measurements in reactor LR-0 and their evaluation

    Rypar, W.; Faehrmann, K.H.


    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  18. Efficacy of coronary artery reconstruction in maintaining myocardial viability. Quntitative determination of local myocardial circulation with 13NH3 myocardial positron emission tomography

    Kobayashi, Satoshi; Takaba, Toshihiro; Kume, Masato; Kashima, Toshitaka; Michihata, Tetsuro.


    Thirty patients (280 areas) whose bypass grafts remained patent after surgical reconstruction of the coronary artery were examined. Before and after reconstruction, local myocardial blood circulation in infarcted regions and post-stenotic regions was measured by 13 NH 3 myocardial positron emission computed tomography (PET) at rest or during physical exercise in order to evaluate the efficacy of coronary artery reconstruction. Before operation, mean blood flow in post-stenotic regions (n=198) was 65±15 ml/min/100 g at rest and 85±23 ml/min/100 g during exercise. After coronary artery bypass grafting (CABG), mean blood flow was increased to 78±21 ml/min/100 g at rest (p, 0.01) and 105±32 ml/min/100 g during exercise (p<0.01). In infarcted regions (n=82), mean blood flow before operation was 51±23 ml/min/100 g at rest and 69±23 ml/min/100 g during exercise. After CABG, it increased to 62±19 ml/min/100 g at rest (p<0.01) and 81±29 ml/min/100 g during exercise (p<0.01). Thus, significant increases in blood flow were observed in both post-stenotic and infarcted regions at rest and physical exercise after operation. The regions of infarction were divided into three groups based on local myocardial blood flow at rest before operation: Group I: greater than 45 ml/min/100 g (n=35); Group II: less than 45 ml/min/100 g (n=30) but greater than 30 ml/min/100 g; and Group III: less than 30 ml/min/100 g (n=30). The efficacy of reconstruction was compared among these groups. The group with preoperative myocardial blood flow greater than 30 ml/min/100 g had increased blood flow after operation, indicating myocardial viability. (author)

  19. Mandibular Reconstruction Using Pectoralis Major Myocutaneous Flap and Titanium Plates after Ablative Surgery for Locally Advanced Tumors of the Oral Cavity

    El-Zohairy, M.A.F.; Mostafa, A.; Amin, A.; Abd El-Fattah, H.; Khalifa, Sh.


    The most common indication for mandible resection remains ablative surgery for cancer of the oral cavity and oropharynx. The use of vascularized bone grafts has become state-of-the-art for mandibular reconstruction. However, the high cost of such surgery may not be justified in patients with advanced disease and poor prognosis, or poor performance status. Objective: The purpose of this study was to evaluate outcomes of mandibular reconstruction using titanium plates covered with a pedicled pectoralis major myocutaneous flap after ablative surgery for locally advanced tumors of the oral cavity. Patients and methods: The study involves a total of 33 patients with locally advanced tumors of the oral cavity that were treated over 5 year period (2003-2008) at the National Cancer Institute, Cairo University, Egypt. Mandibular resections were performed for treatment of patients with primary oral cavity tumors invading the mandible followed by mandibular reconstruction using titanium plates covered with a pedicled pectoralis major myocutaneous flap. Results: Of 33 patients, 25 (75.75%) were males and 8 (24.25%) were females. The age ranged from 42 to 70 years (mean 52.3±5.9 years). Tongue cancer was the most common tumor, it affects 17 (51.5%) of the patients, 24 patients received post operative radiation therapy. The flap survival was 100%; partial necrosis of the flap skin was observed in 3 patients. One patient developed wound dehiscence. Oro-cutaneous fistula occurred in 5 patients that closed spontaneously. There were 4 cases of plate failure, one patient experienced plate fracture at 13 months after reconstruction. Three patients developed external plate exposure. All patients achieved good functional and acceptable aesthetic outcome. The overall cause-specific cumulative survival was 72.7% at one year and 56.1% at two years. Conclusions: Titanium plate and pedicled pectoralis major myocutaneous flap is a safe and reliable option for composite mandibular defects

  20. Local detection of prostate cancer by positron emission tomography with 2-fluorodeoxyglucose comparison of filtered back projection and iterative reconstruction with segmented attenuation correction

    Turlakow, A.; Larson, S. M.; Coakley, F.; Akhurst, T.; Macapinlac, H. A.; Hricak, H.; Gonen, M.; Kelly, W.; Scher, H.; Leibel, S.; Humm, J.; Scardino, P.


    To compare filtered back projection (FBP) and iterative reconstruction with segmented attenuation correction (IRSAC) in the local imaging of prostate cancer by positron emission tomography with 2-fluorodeoxyglucose (FDG-PET). 13 patients with primary (n=7) or recurrent (n=6) prostate cancer who had increased uptake in the prostate on FDG-PET performed without urinary catheterization, contemporaneous biopsy confirming the presence of active tumor in the prostate, were retrospectively identified. Two independent nuclear medicine physicians separately rated FBP and IRSAC images for visualization of prostatic activity on a 4-point scale. Results were compared using biopsy and cross-sectional imaging findings as the standard of reference. IRSAC images were significantly better that FBP in terms of visualization of prostatic activity in 12 of 13 patients, and were equivalent in 1 patient (p<0.001, Wilcoxon signed ranks test). In particular, 2 foci of tumor activity in 2 different patients seen on IRSAC images were not visible on FBP images. In 11 patients who had a gross tumor mass evident on cross-sectional imaging, there was good agreement between PET and cross-sectional anatomic imaging with respect to tumor localization. In selected patients, cancer can be imaged within the prostate using FDG-PET, and IRSAC is superior to FBP in image reconstruction for local tumor visualization

  1. Some investigations and use of LR-115 track detectors for radon measurements

    Amrani, D


    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  2. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans


    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others


    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  4. Simultaneous 3D localization of multiple MR-visible markers in fully reconstructed MR images: proof-of-concept for subsecond position tracking.

    Thörmer, Gregor; Garnov, Nikita; Moche, Michael; Haase, Jürgen; Kahn, Thomas; Busse, Harald


    To determine whether a greatly reduced spatial resolution of fully reconstructed projection MR images can be used for the simultaneous 3D localization of multiple MR-visible markers and to assess the feasibility of a subsecond position tracking for clinical purposes. Miniature, inductively coupled RF coils were imaged in three orthogonal planes with a balanced steady-state free precession (SSFP) sequence and automatically localized using a two-dimensional template fitting and a subsequent three-dimensional (3D) matching of the coordinates. Precision, accuracy, speed and robustness of 3D localization were assessed for decreasing in-plane resolutions (0.6-4.7 mm). The feasibility of marker tracking was evaluated at the lowest resolution by following a robotically driven needle on a complex 3D trajectory. Average 3D precision and accuracy, sensitivity and specificity of localization ranged between 0.1 and 0.4 mm, 0.5 and 1.0 mm, 100% and 95%, and 100% and 96%, respectively. At the lowest resolution, imaging and localization took ≈350 ms and provided an accuracy of ≈1.0 mm. In the tracking experiment, the needle was clearly depicted on the oblique scan planes defined by the markers. Image-based marker localization at a greatly reduced spatial resolution is considered a feasible approach to monitor reference points or rigid instruments at subsecond update rates. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. From global to local statistical shape priors novel methods to obtain accurate reconstruction results with a limited amount of training shapes

    Last, Carsten


    This book proposes a new approach to handle the problem of limited training data. Common approaches to cope with this problem are to model the shape variability independently across predefined segments or to allow artificial shape variations that cannot be explained through the training data, both of which have their drawbacks. The approach presented uses a local shape prior in each element of the underlying data domain and couples all local shape priors via smoothness constraints. The book provides a sound mathematical foundation in order to embed this new shape prior formulation into the well-known variational image segmentation framework. The new segmentation approach so obtained allows accurate reconstruction of even complex object classes with only a few training shapes at hand.

  6. Investigations into the biodegradation of microcystin-LR in wastewaters

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.


    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  7. From local pixel structure to global image super-resolution: a new face hallucination framework.

    Hu, Yu; Lam, Kin-Man; Qiu, Guoping; Shen, Tingzhi


    We have developed a new face hallucination framework termed from local pixel structure to global image super-resolution (LPS-GIS). Based on the assumption that two similar face images should have similar local pixel structures, the new framework first uses the input low-resolution (LR) face image to search a face database for similar example high-resolution (HR) faces in order to learn the local pixel structures for the target HR face. It then uses the input LR face and the learned pixel structures as priors to estimate the target HR face. We present a three-step implementation procedure for the framework. Step 1 searches the database for K example faces that are the most similar to the input, and then warps the K example images to the input using optical flow. Step 2 uses the warped HR version of the K example faces to learn the local pixel structures for the target HR face. An effective method for learning local pixel structures from an individual face, and an adaptive procedure for fusing the local pixel structures of different example faces to reduce the influence of warping errors, have been developed. Step 3 estimates the target HR face by solving a constrained optimization problem by means of an iterative procedure. Experimental results show that our new method can provide good performances for face hallucination, both in terms of reconstruction error and visual quality; and that it is competitive with existing state-of-the-art methods.

  8. Perspectives of increasing energy efficiency on designing new and reconstruction of present city districts: World experiences and local recommendations

    Pucar Mila


    Full Text Available With 20th century along came a significant increase of energy consumption and a serious ecological crisis caused by the extensive usage of fossil fuels (oil, coal. Because of that, many countries have declared regulations to lower the traditional energy consumption and to stimulate usage of renewable energy sources. This problem is particularly evident in residential buildings sector, because over 50% of the overall energy produced is slinked in this way. This paper gives methodological recommendations regarding the principles of energy efficient housing and general comfort improvement as well as evident advantages of passive solar panels compared to traditional energy sources (fossil fuels. These possibilities are considered in two different scenarios: reconstruction of already built city blocks, and energy efficient implementation in case of brand new structures. This paper considers two different case studies, one reconstructive - a city block in France, built in the mid 60’s and the other of energy efficient settlement in Greece "Solar Village", built in the 80’s, which was designed by bioclimatic principles from the very beginning. Energy efficient planning and design methodological recommendations based on these two examples are regarding the New Belgrade block 7/3, which has been built in the 50’s.

  9. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu


    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu


    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  11. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)


    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  12. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...


    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  13. Interactive local super-resolution reconstruction of whole-body MRI mouse data: a pilot study with applications to bone and kidney metastases.

    Oleh Dzyubachyk

    Full Text Available In small animal imaging studies, when the locations of the micro-structures of interest are unknown a priori, there is a simultaneous need for full-body coverage and high resolution. In MRI, additional requirements to image contrast and acquisition time will often make it impossible to acquire such images directly. Recently, a resolution enhancing post-processing technique called super-resolution reconstruction (SRR has been demonstrated to improve visualization and localization of micro-structures in small animal MRI by combining multiple low-resolution acquisitions. However, when the field-of-view is large relative to the desired voxel size, solving the SRR problem becomes very expensive, in terms of both memory requirements and computation time. In this paper we introduce a novel local approach to SRR that aims to overcome the computational problems and allow researchers to efficiently explore both global and local characteristics in whole-body small animal MRI. The method integrates state-of-the-art image processing techniques from the areas of articulated atlas-based segmentation, planar reformation, and SRR. A proof-of-concept is provided with two case studies involving CT, BLI, and MRI data of bone and kidney tumors in a mouse model. We show that local SRR-MRI is a computationally efficient complementary imaging modality for the precise characterization of tumor metastases, and that the method provides a feasible high-resolution alternative to conventional MRI.

  14. Interactive local super-resolution reconstruction of whole-body MRI mouse data: a pilot study with applications to bone and kidney metastases.

    Dzyubachyk, Oleh; Khmelinskii, Artem; Plenge, Esben; Kok, Peter; Snoeks, Thomas J A; Poot, Dirk H J; Löwik, Clemens W G M; Botha, Charl P; Niessen, Wiro J; van der Weerd, Louise; Meijering, Erik; Lelieveldt, Boudewijn P F


    In small animal imaging studies, when the locations of the micro-structures of interest are unknown a priori, there is a simultaneous need for full-body coverage and high resolution. In MRI, additional requirements to image contrast and acquisition time will often make it impossible to acquire such images directly. Recently, a resolution enhancing post-processing technique called super-resolution reconstruction (SRR) has been demonstrated to improve visualization and localization of micro-structures in small animal MRI by combining multiple low-resolution acquisitions. However, when the field-of-view is large relative to the desired voxel size, solving the SRR problem becomes very expensive, in terms of both memory requirements and computation time. In this paper we introduce a novel local approach to SRR that aims to overcome the computational problems and allow researchers to efficiently explore both global and local characteristics in whole-body small animal MRI. The method integrates state-of-the-art image processing techniques from the areas of articulated atlas-based segmentation, planar reformation, and SRR. A proof-of-concept is provided with two case studies involving CT, BLI, and MRI data of bone and kidney tumors in a mouse model. We show that local SRR-MRI is a computationally efficient complementary imaging modality for the precise characterization of tumor metastases, and that the method provides a feasible high-resolution alternative to conventional MRI.

  15. The localization-delocalization matrix and the electron-density-weighted connectivity matrix of a finite graphene nanoribbon reconstructed from kernel fragments.

    Timm, Matthew J; Matta, Chérif F; Massa, Lou; Huang, Lulu


    Bader's quantum theory of atoms in molecules (QTAIM) and chemical graph theory, merged in the localization-delocalization matrices (LDMs) and the electron-density-weighted connectivity matrices (EDWCM), are shown to benefit in computational speed from the kernel energy method (KEM). The LDM and EDWCM quantum chemical graph matrices of a 66-atom C46H20 hydrogen-terminated armchair graphene nanoribbon, in 14 (2×7) rings of C2v symmetry, are accurately reconstructed from kernel fragments. (This includes the full sets of electron densities at 84 bond critical points and 19 ring critical points, and the full sets of 66 localization and 4290 delocalization indices (LIs and DIs).) The average absolute deviations between KEM and directly calculated atomic electron populations, obtained from the sum of the LIs and half of the DIs of an atom, are 0.0012 ± 0.0018 e(-) (∼0.02 ± 0.03%) for carbon atoms and 0.0007 ± 0.0003 e(-) (∼0.01 ± 0.01%) for hydrogen atoms. The integration errors in the total electron population (296 electrons) are +0.0003 e(-) for the direct calculation (+0.0001%) and +0.0022 e(-) for KEM (+0.0007%). The accuracy of the KEM matrix elements is, thus, probably of the order of magnitude of the combined precision of the electronic structure calculation and the atomic integrations. KEM appears capable of delivering not only the total energies with chemical accuracy (which is well documented) but also local and nonlocal properties accurately, including the DIs between the fragments (crossing fragmentation lines). Matrices of the intact ribbon, the kernels, the KEM-reconstructed ribbon, and errors are available as Supporting Information .

  16. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu


    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  17. Chironomid-based water depth reconstructions: an independent evaluation of site-specific and local inference models

    Engels, S.; Cwynar, L.C.; Rees, A.B.H.; Shuman, B.N.


    Water depth is an important environmental variable that explains a significant portion of the variation in the chironomid fauna of shallow lakes. We developed site-specific and local chironomid water-depth inference models using 26 and 104 surface-sediment samples, respectively, from seven

  18. SU-G-JeP3-01: A Method to Quantify Lung SBRT Target Localization Accuracy Based On Digitally Reconstructed Fluoroscopy

    Lafata, K; Ren, L; Cai, J; Yin, F [Duke University Medical Center, Durham, NC (United States)


    Purpose: To develop a methodology based on digitally-reconstructed-fluoroscopy (DRF) to quantitatively assess target localization accuracy of lung SBRT, and to evaluate using both a dynamic digital phantom and a patient dataset. Methods: For each treatment field, a 10-phase DRF is generated based on the planning 4DCT. Each frame is pre-processed with a morphological top-hat filter, and corresponding beam apertures are projected to each detector plane. A template-matching algorithm based on cross-correlation is used to detect the tumor location in each frame. Tumor motion relative beam aperture is extracted in the superior-inferior direction based on each frame’s impulse response to the template, and the mean tumor position (MTP) is calculated as the average tumor displacement. The DRF template coordinates are then transferred to the corresponding MV-cine dataset, which is retrospectively filtered as above. The treatment MTP is calculated within each field’s projection space, relative to the DRF-defined template. The field’s localization error is defined as the difference between the DRF-derived-MTP (planning) and the MV-cine-derived-MTP (delivery). A dynamic digital phantom was used to assess the algorithm’s ability to detect intra-fractional changes in patient alignment, by simulating different spatial variations in the MV-cine and calculating the corresponding change in MTP. Inter-and-intra-fractional variation, IGRT accuracy, and filtering effects were investigated on a patient dataset. Results: Phantom results demonstrated a high accuracy in detecting both translational and rotational variation. The lowest localization error of the patient dataset was achieved at each fraction’s first field (mean=0.38mm), with Fx3 demonstrating a particularly strong correlation between intra-fractional motion-caused localization error and treatment progress. Filtering significantly improved tracking visibility in both the DRF and MV-cine images. Conclusion: We have

  19. [A case of iatrogenic scrotal elephantiasis: reconstruction of the scrotal purse and the cutaneous sleeve of the penis with local skin flaps].

    Masia, D-R; Castus, P; Delia, G; Casoli, V; Martine, D


    Scrotal elephantiasis is a pathology of often unknown etiology. Symptomatology is characterized by an oedematius infiltration of skin and subcutaneous tissue, hard-bound aspect and purplished color. The scrotum, the penis and the perineal area are gradually affected. This pathology is very invalidating for the patient, on functional, sexual and aesthetic aspects. The authors present the case of a 58-year-old man with an enormous scrotal mass invading the penis and drowning the testicular elements, which were impossible to palpate. The aetiology was determined by exclusion and an iatrogenic origin following the cure of bilateral inguinal hernia was retained. Resection of the scrotal mass was performed. The reconstruction of the scrotal purse and the cutaneous sleeve of the penis were carried out using local flaps of the remaining healthy skin.

  20. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W


    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  1. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup


    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  2. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay


    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  3. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Liqiang Liu


    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  4. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua


    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S


    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  6. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren


    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  7. Integrated Paleoenvironmental Reconstruction and Taphonomy of a Unique Upper Cretaceous Vertebrate-Bearing Locality (Velaux, Southeastern France.

    Aude Cincotta

    Full Text Available The Velaux-La Bastide Neuve fossil-bearing site (Bouches-du-Rhône, France has yielded a diverse vertebrate assemblage dominated by dinosaurs, including the titanosaur Atsinganosaurus velauciensis. We here provide a complete inventory of vertebrate fossils collected during two large-scale field campaigns. Numerous crocodilian teeth occur together with complete skulls. Pterosaur, hybodont shark and fish elements are also represented but uncommon. Magnetostratigraphic analyses associated with biostratigraphic data from dinosaur eggshell and charophytes suggest a Late Campanian age for the locality. Lithologic and taphonomic studies, associated with microfacies and palynofacies analyses, indicate a fluvial setting of moderate energy with broad floodplain. Palynomorphs are quite rare; only three taxa of pollen grains occur: a bisaccate taxon, a second form probably belonging to the Normapolles complex, and another tricolporate taxon. Despite the good state of preservation, these taxa are generally difficult to identify, since they are scarce and have a very minute size. Most of the vertebrate remains are well preserved and suggest transport of the carcasses over short distances before accumulation in channel and overbank facies, together with reworked Aptian grains of glauconite, followed by a rapid burial. The bones accumulated in three thin layers that differ by their depositional modes and their taphonomic histories. Numerous calcareous and iron oxides-rich paleosols developed on the floodplain, suggesting an alternating dry and humid climate in the region during the Late Campanian.

  8. On tests of local realism by CP-violation parameters of K0 mesons

    Genovese, M.


    Recently various papers have proposed to test local realism (LR) by considering electroweak CP-violation parameters values in neutral pseudoscalar meson systems. Considering the large interest for a conclusive test of LR and the experimental accessibility to these tests, in this paper we critically consider these results showing how they, albeit that they are very interesting, require anyway additional assumptions and therefore cannot be considered conclusive tests of LR. (orig.)

  9. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo


    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  10. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.


    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  11. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi


    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  12. The role of social and economic context, and local knowledge for post-disaster reconstruction of high-mountain hazards: a case study from the Peruvian Andes

    Dulce Burga, María; Vicuña, Luis; Jurt, Christine; Huggel, Christian


    Following the occurrence of an extreme event, specific and immediate actions are oriented to relieve basic needs and guarantee the subsistence of daily life. One of the priorities is focused on the reconstruction and relocation to areas away from possible hazard. However, on a long-term perspective, new contexts, concerns and priorities among the affected as well as the immigrated population foster new risk perceptions, which in many cases may include the returning or settlement in areas exposed to hazards. In Santa Teresa (Cusco, Peru), risk has been part of its history. In 1998, two very large debris flows from deglaciated areas, in January and February respectively, destroyed the old city located by the riverside of the Sacsara river; including the loss of lives, housing, loss of infrastructure and roads, electricity and water cuts, among other important losses. Today, the new city is located on a terrace above the river reach; and their current inhabitants, mainly migrants from different cities of the region of Cusco, have a different perspective of this experience. On the contrary, many of the inhabitants who experienced these events have returned to the risk areas where they lost everything, or they have settled in disaster prone areas. There is a set of factors, such as local knowledge (regarding space, economy, etc.) and new social contexts (such as the rise of tourism in risk areas, for example) that are implicit in the current narratives regarding hazard and risk. This work purposes the following questions: how does the social and economic context, as well as local knowledge influence risk perceptions? Are there any differences concerning risk perceptions between groups who decided to live in disaster prone areas and groups who are less exposed to risk? And which are the strategies within the groups regarding risk, considering how this concept is understood among them? In order to analyze these questions, this work is based on a case study in the

  13. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Carol P. S. Lam


    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  14. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)


    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  15. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.


    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  16. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu


    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  17. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang


    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  18. Prognosis after local recurrence after conservative surgery and radiation for early-stage breast cancer

    Galper, Sharon; Blood, Emily; Gelman, Rebecca; Abner, Anthony; Recht, Abram; Kohli, Anita; Wong, Julia S.; Smith, Darrell; Bellon, Jennifer; Connolly, James; Schnitt, Stuart; Winer, Eric; Silver, Barbara B.A.; Harris, Jay R.


    Purpose: To determine the long-term prognosis of patients who develop a local recurrence (LR) after conservative surgery (CS) and radiation therapy (RT) for early-stage invasive breast cancer. Methods and materials: Between 1970 and 1987, 2102 patients with clinical Stage I-II breast cancer were treated with CS+RT. LR was defined as any recurrence within the ipsilateral breast with or without simultaneous regional nodal or distant metastasis. Patients were at risk for a LR until the first of distant metastases, second nonbreast malignancy, or death (DF/S/D). The final study population comprised 341 patients with LR. The median time to LR was 72 months. The median follow-up time after LR was 85 months. A proportional hazards model of time from LR to DF/S/D was done to investigate the influence of factors at initial diagnosis and at LR on subsequent outcome. Results: The actuarial freedom from DF/S/D 5 years after LR was 65% and the survival was 81%. Variables significantly associated with time to DF/S/D were: LR histology (invasive vs. ductal carcinoma in situ, hazard ratio [HR] = 4.1, p 5 years, HR = 2.6, p 5 years, HR = 1.8, p = 0.006); and age at initial diagnosis (≥60 vs. < 60, HR = 1.6, p = 0.01). Conclusions: Many patients with LR after CS+RT have prolonged distant disease-free survival, particularly those able to be treated with mastectomy. Patients with a noninvasive LR, longer interval to LR, or age <60 had a longer time to distant failure, second malignancy, or death than other patients

  19. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann


    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  20. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong


    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  1. PET reconstruction

    O'Sullivan, F.; Pawitan, Y.; Harrison, R.L.; Lewellen, T.K.


    In statistical terms, filtered backprojection can be viewed as smoothed Least Squares (LS). In this paper, the authors report on improvement in LS resolution by: incorporating locally adaptive smoothers, imposing positivity and using statistical methods for optimal selection of the resolution parameter. The resulting algorithm has high computational efficiency relative to more elaborate Maximum Likelihood (ML) type techniques (i.e. EM with sieves). Practical aspects of the procedure are discussed in the context of PET and illustrations with computer simulated and real tomograph data are presented. The relative recovery coefficients for a 9mm sphere in a computer simulated hot-spot phantom range from .3 to .6 when the number of counts ranges from 10,000 to 640,000 respectively. The authors will also present results illustrating the relative efficacy of ML and LS reconstruction techniques

  2. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D


    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  3. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  4. Supplementary Material for: Linking local retention, self-recruitment, and persistence in marine metapopulations

    Lett, Christophe


    Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.

  5. Linking local retention, self-recruitment, and persistence in marine metapopulations

    Lett, Christophe


    Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.

  6. alpha-particle radioactivity from LR 115 by two methods of analysis

    Azkour, K; Adloff, J C; Pape, A


    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  7. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  8. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A


    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  9. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.


    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  10. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Woods, Carol M.


    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  11. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  12. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  13. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup


    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  14. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    Haraksim, Rudolf; Meuwly, Didier


    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  15. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  16. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  17. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael


    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Reconstruction of local fallout composition and gamma-ray exposure in a village contaminated by the first USSR nuclear test in the Semipalatinsk nuclear test site in Kazakhstan.

    Imanaka, Tetsuji; Yamamoto, Masayoshi; Kawai, Kenta; Sakaguchi, Aya; Hoshi, Masaharu; Chaizhunusova, Nailya; Apsalikov, Kazbek


    After the disintegration of the USSR in end of 1991, it became possible for foreign scientists to visit Kazakhstan, in order to investigate the radiological consequences of nuclear explosions that had been conducted at the Semipalatinsk nuclear test site (SNTS). Since the first visit in 1994, our group has been continuing expeditions for soil sampling at various areas around SNTS. The current level of local fallout at SNTS was studied through γ-spectrometry for (137)Cs as well as α-spectrometry for (239,240)Pu. Average values of soil inventory from wide areas around SNTS were 3,500 and 3,700 Bq m(-2) for (137)Cs and (239,240)Pu, respectively, as of January 1, 2000. The average level of (137)Cs is comparable to that in Japan due to global fallout, while the level of (239,240)Pu is several tens of times larger than that in Japan. Areas of strong contamination were found along the trajectories of radioactive fallout, information on which was declassified after the collapse of the USSR. Our recent efforts of soil sampling were concentrated on the area around the Dolon village heavily affected by the radioactive plume from the first USSR atomic bomb test in 1949 and located 110 km east from ground zero of the explosion. Using soil inventory data, retrospective dosimetry was attempted by reconstructing γ-ray exposure from fission product nuclides deposited on the ground. Adopting representative parameters for the initial (137)Cs deposition (13 kBq m(-2)), the refractory/volatile deposition ratio (3.8) and the plume arrival time after explosion (2.5 h), an absorbed dose in air of 600 mGy was obtained for the 1-year cumulative dose in Dolon village, due to the first bomb test in 1949. Considering possible ranges of the parameters, 350 and 910 mGy were estimated for high and low cases of γ-ray dose in air, respectively. It was encouraging that the deduced value was consistent with other estimations using thermal luminescence and archived monitoring data. The present

  19. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Kai Shen


    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  20. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping


    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  1. l0 regularization based on a prior image incorporated non-local means for limited-angle X-ray CT reconstruction.

    Zhang, Lingli; Zeng, Li; Guo, Yumeng


    Restricted by the scanning environment in some CT imaging modalities, the acquired projection data are usually incomplete, which may lead to a limited-angle reconstruction problem. Thus, image quality usually suffers from the slope artifacts. The objective of this study is to first investigate the distorted domains of the reconstructed images which encounter the slope artifacts and then present a new iterative reconstruction method to address the limited-angle X-ray CT reconstruction problem. The presented framework of new method exploits the structural similarity between the prior image and the reconstructed image aiming to compensate the distorted edges. Specifically, the new method utilizes l0 regularization and wavelet tight framelets to suppress the slope artifacts and pursue the sparsity. New method includes following 4 steps to (1) address the data fidelity using SART; (2) compensate for the slope artifacts due to the missed projection data using the prior image and modified nonlocal means (PNLM); (3) utilize l0 regularization to suppress the slope artifacts and pursue the sparsity of wavelet coefficients of the transformed image by using iterative hard thresholding (l0W); and (4) apply an inverse wavelet transform to reconstruct image. In summary, this method is referred to as "l0W-PNLM". Numerical implementations showed that the presented l0W-PNLM was superior to suppress the slope artifacts while preserving the edges of some features as compared to the commercial and other popular investigative algorithms. When the image to be reconstructed is inconsistent with the prior image, the new method can avoid or minimize the distorted edges in the reconstructed images. Quantitative assessments also showed that applying the new method obtained the highest image quality comparing to the existing algorithms. This study demonstrated that the presented l0W-PNLM yielded higher image quality due to a number of unique characteristics, which include that (1) it utilizes

  2. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli


    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  3. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana


    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  4. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun


    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  5. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Sato, Tetsuya K., E-mail:; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)


    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  6. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Ellen Cristine Giese


    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: 

  7. Direct determination of bulk etching rate for LR-115-II solid state ...

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  8. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Jaiok Roh


    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  9. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental


    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  10. Low-priced, time-saving, reliable and stable LR-115 counting system

    Tchorz-Trzeciakiewicz, D.E.


    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  11. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.


    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  12. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden


    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  13. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.


    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  14. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A


    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  15. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu


    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

    Valentina Kubale


    Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

  17. Climate Reconstructions

    National Oceanic and Atmospheric Administration, Department of Commerce — The NOAA Paleoclimatology Program archives reconstructions of past climatic conditions derived from paleoclimate proxies, in addition to the Program's large holdings...

  18. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Lorena Rosso


    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  19. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech


    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  20. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)


    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  1. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    Harris, M.J.; Schlenker, R.A.


    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  2. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.


    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  3. Application of the LR-56 at DOE Facilities in the United States

    Smith, A.C.


    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  4. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    Hadek, J.; Grundmann, U.


    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  5. Combinación de colgajos locales y libre microvascularizado para reconstrucción del tercio facial inferior tras traumatismo por arma de fuego Combination of local and free microvascularized flaps for reconstruction of the lower third of the face after gunshot injury

    Laura Villanueva-Alcojol


    Full Text Available El traumatismo por arma de fuego en el territorio maxilofacial constituye uno de los mayores retos a los que se enfrenta el cirujano a la hora de la reconstrucción. La diferencia esencial con otro tipo de traumatismos es la severidad de la lesión y la pérdida de tejidos óseos y blandos. Podemos encontrar en la literatura numerosos artículos sobre reconstrucción facial tras extirpación oncológica; sin embargo, hay pocos documentos que discutan la utilización de colgajos locales y libres microvascularizados para reconstrucción de defectos tras traumatismos de alta energía, y los algoritmos terapéuticos para reconstrucción postraumática. En este trabajo se presenta un caso de reconstrucción del tercio inferior facial tras intento de autolisis y se hace una revisión de los principios de tratamiento de este tipo de pacientes.Gunshot wounds to the maxillofacial region are a challenging problem for the surgeon responsible for reconstruction. The essential difference with respect to other injuries is the severity of the lesion and soft and hard tissue loss. Extensive literature exists on facial reconstruction following tumor extirpation, but there are few reports on the use of local flaps and free tissue transfer for the post-traumatic reconstruction of high-energy defects and therapeutic algorithms for post-traumatic reconstruction. The authors report the case of a patient with reconstruction of the lower third of the face after a suicide attempt and review the principles of treatment of these patients.

  6. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing


    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  7. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  8. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing


    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  9. Local delivery of controlled-release simvastatin to improve the biocompatibility of polyethylene terephthalate artificial ligaments for reconstruction of the anterior cruciate ligament

    Zhang P


    Full Text Available Peng Zhang,1,* Fei Han,2,* Yunxia Li,1 Jiwu Chen,1 Tianwu Chen,1 Yunlong Zhi,1 Jia Jiang,1 Chao Lin,2 Shiyi Chen,1 Peng Zhao2 1Department of Sports Medicine, Huashan Hospital, Fudan University, 2Shanghai East Hospital, The Institute for Biomedical Engineering and Nanoscience, School of Medicine, Tongji University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The Ligament Advanced Reinforcement System has recently been widely used as the primary graft of choice in anterior cruciate ligament (ACL reconstruction. But the biological graft–bone healing still remains a problem. Previous studies have shown that simvastatin (SIM stimulates bone formation. The objective of this study was to investigate whether surface coating with collagen containing low-dose SIM microsphere could enhance the surface biocompatibility of polyethylene terephthalate (PET artificial ligaments to accelerate graft-to-bone healing. The in vitro studies demonstrated that bone marrow stromal cells on the collagen-coated PET scaffolds (COL/PET and simvastatin/collagen-coated PET scaffolds (SIM/COL/PET proliferated vigorously. Compared with the PET group and the COL/PET group, SIM could induce bone marrow stromal cells’ osteoblastic differentiation, high alkaline phosphatase activity, more mineralization deposition, and more expression of osteoblast-related genes, such as osteocalcin, runt-related transcription factor 2, bone morphogenetic protein-2, and vascular endothelial growth factor, in the SIM/COL/PET group. In vivo, rabbits received ACL reconstruction with different scaffolds. Histological analysis demonstrated that graft–bone healing was significantly greater with angiogenesis and osteogenesis in the SIM/COL/PET group than the other groups. In addition, biomechanical testing at the eighth week demonstrated a significant increase in the ultimate failure load and stiffness in the SIM/COL/PET group. The low dose of SIM

  10. Craniofacial Reconstruction Evaluation by Geodesic Network

    Zhao, Junli; Liu, Cuiting; Wu, Zhongke; Duan, Fuqing; Wang, Kang; Jia, Taorui; Liu, Quansheng


    Craniofacial reconstruction is to estimate an individual’s face model from its skull. It has a widespread application in forensic medicine, archeology, medical cosmetic surgery, and so forth. However, little attention is paid to the evaluation of craniofacial reconstruction. This paper proposes an objective method to evaluate globally and locally the reconstructed craniofacial faces based on the geodesic network. Firstly, the geodesic networks of the reconstructed craniofacial face and the or...

  11. Quality of life outcome measures using UW-QOL questionnaire v4 in early oral cancer/squamous cell cancer resections of the tongue and floor of mouth with reconstruction solely using local methods.

    Boyapati, Raghuram P; Shah, Ketan C; Flood, Valerie; Stassen, Leo F A


    Cancer treatment either by surgery alone or in a combination of surgery, radiotherapy±chemotherapy has significant consequences on the physical, mental, emotional and psychosocial wellbeing of the patient. Measurement of quality of life (QOL) is necessary to understand the patient's perception of their own treatment, as clinicians' views can be biased. Reconstruction of a cancerous defect with a free vascular flap is ideal in large, often composite defects, provided it is appropriate to the advanced stage and prognosis of the disease, medical condition of the patient, availability of surgical and financial resources and allows the prosthetic rehabilitation of the anatomic area. Using University of Washington Quality of life 4 questionnaire (UW-QOL4), we assessed the QOL of 38 patients, who underwent local surgical reconstructions after resection of T1/T2 tongue/floor of mouth squamous cell carcinoma defects. Objective assessment of speech and swallow function was also carried out using therapy outcome measure (TOM) scores by the speech and language therapy team (SALT) aiming to see the differences in the scores obtained in patients who underwent post-operative radiotherapy. Our study, conducted 6months after completion of all oncologic treatment for the primary disease, showed satisfactory levels of quality of life parameters with good function showing that local reconstructive methods are successful and may have benefits in the management of early oral cancers involving the tongue and floor of mouth. They are beneficial by providing a good quality in terms of function, by reducing the operating time, the surgical morbidity, simplifying post-operative care and thereby becoming an efficient, effective and a cost effective method. Copyright © 2012 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  12. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.


    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  13. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.


    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  14. Projections onto Convex Sets Super-Resolution Reconstruction Based on Point Spread Function Estimation of Low-Resolution Remote Sensing Images

    Chong Fan


    Full Text Available To solve the problem on inaccuracy when estimating the point spread function (PSF of the ideal original image in traditional projection onto convex set (POCS super-resolution (SR reconstruction, this paper presents an improved POCS SR algorithm based on PSF estimation of low-resolution (LR remote sensing images. The proposed algorithm can improve the spatial resolution of the image and benefit agricultural crop visual interpolation. The PSF of the highresolution (HR image is unknown in reality. Therefore, analysis of the relationship between the PSF of the HR image and the PSF of the LR image is important to estimate the PSF of the HR image by using multiple LR images. In this study, the linear relationship between the PSFs of the HR and LR images can be proven. In addition, the novel slant knife-edge method is employed, which can improve the accuracy of the PSF estimation of LR images. Finally, the proposed method is applied to reconstruct airborne digital sensor 40 (ADS40 three-line array images and the overlapped areas of two adjacent GF-2 images by embedding the estimated PSF of the HR image to the original POCS SR algorithm. Experimental results show that the proposed method yields higher quality of reconstructed images than that produced by the blind SR method and the bicubic interpolation method.

  15. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei


    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Identification of Patients at Very Low Risk of Local Recurrence After Breast-Conserving Surgery

    Smith, Sally L., E-mail: [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Truong, Pauline T. [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Lu, Linghong; Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, Victoria, British Columbia (Canada); Olivotto, Ivo A. [Division of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary, Calgary, Alberta (Canada)


    Purpose: To identify clinical and pathological factors that identify groups of women with stage I breast cancer with a 5-year risk of local recurrence (LR) ≤1.5% after breast-conserving therapy (BCS) plus whole-breast radiation therapy (RT). Methods and Materials: Study subjects were 5974 patients ≥50 years of age whose cancer was diagnosed between 1989 and 2006, and were referred with pT1 pN0 invasive breast cancer treated with BCS and RT. Cases of 5- and 10-year LR were examined using Kaplan-Meier methods. Recursive partitioning analysis was performed in patients treated with and without endocrine therapy to identify combinations of factors associated with a 5-year LR risk ≤1.5%. Results: The median follow-up was 8.61 years. Median age was 63 years of age (range, 50 to 91). Overall 5-year LR was 1.5% (95% confidence interval [CI], 1.2%-1.9%) and 10-year LR was 3.4% (95% CI, 2.8%-4.0%). Of 2830 patients treated with endocrine therapy, patient subsets identified with 5-year LR ≤1.5% included patients with grade 1 histology (n=1038; LR, 0.2%; 95% CI, 0%-0.5%) or grade 2 histology plus ≥60 years of age (n=843; LR, 0.5%; 95% CI, 0%-1.0%). Ten-year LR for these groups were 0.8% (95% CI, 0.1%-1.6%) and 0.9% (95% CI, 0.2%-1.6%), respectively. Of 3144 patients treated without endocrine therapy, patients with grade 1 histology plus clear margins had 5-year LR ≤1.5% (n=821; LR, 0.6%; 95% CI, 0.1%-1.2%). Ten-year LR for this group was 2.2% (95% CI, 1.0%-3.4%). Conclusions: Histologic grade, age, margin status, and use of endocrine therapy identified 45% of a population-based cohort of female patients over age 50 with stage I breast cancer with a 5-year LR risk ≤1.5% after BCS plus RT. Prospective study is needed to evaluate the safety of omitting RT in patients with such a low risk of LR.

  17. Petz recovery versus matrix reconstruction

    Holzäpfel, Milan; Cramer, Marcus; Datta, Nilanjana; Plenio, Martin B.


    The reconstruction of the state of a multipartite quantum mechanical system represents a fundamental task in quantum information science. At its most basic, it concerns a state of a bipartite quantum system whose subsystems are subjected to local operations. We compare two different methods for obtaining the original state from the state resulting from the action of these operations. The first method involves quantum operations called Petz recovery maps, acting locally on the two subsystems. The second method is called matrix (or state) reconstruction and involves local, linear maps that are not necessarily completely positive. Moreover, we compare the quantities on which the maps employed in the two methods depend. We show that any state that admits Petz recovery also admits state reconstruction. However, the latter is successful for a strictly larger set of states. We also compare these methods in the context of a finite spin chain. Here, the state of a finite spin chain is reconstructed from the reduced states of a few neighbouring spins. In this setting, state reconstruction is the same as the matrix product operator reconstruction proposed by Baumgratz et al. [Phys. Rev. Lett. 111, 020401 (2013)]. Finally, we generalize both these methods so that they employ long-range measurements instead of relying solely on short-range correlations embodied in such local reduced states. Long-range measurements enable the reconstruction of states which cannot be reconstructed from measurements of local few-body observables alone and hereby we improve existing methods for quantum state tomography of quantum many-body systems.

  18. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei


    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M


    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  20. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Tássia Tatiane Pontes Pereira


    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  1. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    Clement, G.; Delvecchio, D.J.; Sazawal, V.


    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  2. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)


    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  3. Broadband Acoustic Transmission Enhancement through a Structured Stiff Plate with Locally Resonant Elements

    Li Yong; Liang Bin; Zou Xin-Ye; Cheng Jian-Chun


    Broadband acoustic transmission enhancement (ATE) is realized for a periodically structured stiff plate without any opening that is conventionally thought to be only capable of supporting narrowband ATE, by introducing locally resonant (LR) elements. This exotic phenomenon is interpreted by analyzing the vibration pattern of the structure-induced LR modes, and is well modeled by a simple 'spring-mass' system which reveals the contribution of the LR effect to the important broadband performance. Our findings should help to better understand the physical mechanism of ATE and may have potential impact on ultrasonic applications such as broadband acoustic filters or compact acoustic devices in subwavelength scale

  4. Vaginal reconstruction

    Lesavoy, M.A.


    Vaginal reconstruction can be an uncomplicated and straightforward procedure when attention to detail is maintained. The Abbe-McIndoe procedure of lining the neovaginal canal with split-thickness skin grafts has become standard. The use of the inflatable Heyer-Schulte vaginal stent provides comfort to the patient and ease to the surgeon in maintaining approximation of the skin graft. For large vaginal and perineal defects, myocutaneous flaps such as the gracilis island have been extremely useful for correction of radiation-damaged tissue of the perineum or for the reconstruction of large ablative defects. Minimal morbidity and scarring ensue because the donor site can be closed primarily. With all vaginal reconstruction, a compliant patient is a necessity. The patient must wear a vaginal obturator for a minimum of 3 to 6 months postoperatively and is encouraged to use intercourse as an excellent obturator. In general, vaginal reconstruction can be an extremely gratifying procedure for both the functional and emotional well-being of patients

  5. ACL Reconstruction

    ... in moderate exercise and recreational activities, or play sports that put less stress on the knees. ACL reconstruction is generally recommended if: You're an athlete and want to continue in your sport, especially if the sport involves jumping, cutting or ...

  6. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin


    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  7. Blind void filling in LR-EPONs: How efficient it can be?

    Elrasad, Amr; Shihada, Basem


    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  8. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli


    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  9. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    Aharmim, B.; Sabir, A.; Marah, H.


    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  10. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    Erben, O.; Horinek, K.; Szasz, Z.


    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  11. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    Sawamura, Teruko; Yamazaki, Hatsuo


    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  12. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.


    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  13. Blind void filling in LR-EPONs: How efficient it can be?

    Elrasad, Amr


    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  14. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    Somogyi, G.; Hunyadi, I.; Varga, Zs.


    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  15. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    Heydari-Fard, Malihe


    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  16. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.


    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  17. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao


    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  18. A Way Out of the Bubble Trouble? - Upon Reconstructing the Origin of the Local Bubble and Loop I via Radioisotopic Signatures on Earth

    Schulreich, Michael Mathias; Breitschwerdt, Dieter; Feige, Jenny; Dettbarn, Christian


    Deep-sea archives all over the world show an enhanced concentration of the radionuclide $^{60}$Fe, isolated in layers dating from about 2.2 Myr ago. Since this comparatively long-lived isotope is not naturally produced on Earth, such an enhancement can only be attributed to extraterrestrial sources, particularly one or several nearby supernovae in the recent past. It has been speculated that these supernovae might have been involved in the formation of the Local Superbubble, our Galactic habi...

  19. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine


    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  20. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)


    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  1. Maxillary reconstruction

    Brown James


    Full Text Available This article aims to discuss the various defects that occur with maxillectomy with a full review of the literature and discussion of the advantages and disadvantages of the various techniques described. Reconstruction of the maxilla can be relatively simple for the standard low maxillectomy that does not involve the orbital floor (Class 2. In this situation the structure of the face is less damaged and the there are multiple reconstructive options for the restoration of the maxilla and dental alveolus. If the maxillectomy includes the orbit (Class 4 then problems involving the eye (enopthalmos, orbital dystopia, ectropion and diplopia are avoided which simplifies the reconstruction. Most controversy is associated with the maxillectomy that involves the orbital floor and dental alveolus (Class 3. A case is made for the use of the iliac crest with internal oblique as an ideal option but there are other methods, which may provide a similar result. A multidisciplinary approach to these patients is emphasised which should include a prosthodontist with a special expertise for these defects.

  2. Local recurrence after laparoscopic radiofrequency ablation of malignant liver tumors: Results of a contemporary series.

    Takahashi, Hideo; Akyuz, Muhammet; Aksoy, Erol; Karabulut, Koray; Berber, Eren


    The aims of this study were to determine the incidence of Local recurrence (LR) in patients at long-term follow-up after laparoscopic RFA (LRFA) and also to determine the risk factors for LR from a contemporary series. Patients undergoing LRFA between 2005 and 2014 by a single surgeon were reviewed. Demographic and perioperative data were analyzed from a prospective database. LRFA was performed on 316 patients with 901 lesions. Median follow-up was 25 months, with 76% of whom completed at least one year of follow-up. The LR rate was 18.4%. The LR in patients followed for less than 12 months was 13.8%, 20.3% for 12 months, and 19.7% for 18 months (P = 0.02). One-fourth of the LRs developed after the 1st year. Morbidity was 8.9% and mortality 0.3%. Tumor type, size, ablation margin, and surgeon experience affected LR, with tumor type, size, and ablation margin being independent. This study shows that 14% of malignant liver tumors will develop LR within a year after LRFA. Additional 4% of the lesions will demonstrate recurrence within 1 cm of the ablation zone, mostly as part of a multifocal recurrence. Ablation margin is the only parameter that the surgeon can manipulate to decrease LR. © 2017 Wiley Periodicals, Inc.

  3. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  4. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    Nchabeleng, T


    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  5. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Gaodao Liang


    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  6. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa


    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  7. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis


    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  8. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Tingting Xu


    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  9. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong


    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  10. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)


    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  11. A Way Out of the Bubble Trouble?—Upon Reconstructing the Origin of the Local Bubble and Loop I via Radioisotopic Signatures on Earth

    Michael Mathias Schulreich


    Full Text Available Deep-sea archives all over the world show an enhanced concentration of the radionuclide 60Fe, isolated in layers dating from about 2.2 Myr ago. Since this comparatively long-lived isotope is not naturally produced on Earth, such an enhancement can only be attributed to extraterrestrial sources, particularly one or several nearby supernovae in the recent past. It has been speculated that these supernovae might have been involved in the formation of the Local Superbubble, our Galactic habitat. Here, we summarize our efforts in giving a quantitative evidence for this scenario. Besides analytical calculations, we present results from high-resolution hydrodynamical simulations of the Local Superbubble and its presumptive neighbor Loop I in different environments, including a self-consistently evolved supernova-driven interstellar medium. For the superbubble modeling, the time sequence and locations of the generating core-collapse supernova explosions are taken into account, which are derived from the mass spectrum of the perished members of certain, carefully preselected stellar moving groups. The release and turbulent mixing of 60Fe is followed via passive scalars, where the yields of the decaying radioisotope were adjusted according to recent stellar evolution calculations. The models are able to reproduce both the timing and the intensity of the 60Fe excess observed with rather high precision. We close with a discussion of recent developments and give future perspectives.

  12. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H


    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Mastectomy Skin Necrosis After Breast Reconstruction: A Comparative Analysis Between Autologous Reconstruction and Implant-Based Reconstruction.

    Sue, Gloria R; Lee, Gordon K


    Mastectomy skin necrosis is a significant problem after breast reconstruction. We sought to perform a comparative analysis on this complication between patients undergoing autologous breast reconstruction and patients undergoing 2-stage expander implant breast reconstruction. A retrospective review was performed on consecutive patients undergoing autologous breast reconstruction or 2-stage expander implant breast reconstruction by the senior author from 2006 through 2015. Patient demographic factors including age, body mass index, history of diabetes, history of smoking, and history of radiation to the breast were collected. Our primary outcome measure was mastectomy skin necrosis. Fisher exact test was used for statistical analysis between the 2 patient cohorts. The treatment patterns of mastectomy skin necrosis were then analyzed. We identified 204 patients who underwent autologous breast reconstruction and 293 patients who underwent 2-stage expander implant breast reconstruction. Patients undergoing autologous breast reconstruction were older, heavier, more likely to have diabetes, and more likely to have had prior radiation to the breast compared with patients undergoing implant-based reconstruction. The incidence of mastectomy skin necrosis was 30.4% of patients in the autologous group compared with only 10.6% of patients in the tissue expander group (P care in the autologous group, only 3.2% were treated with local wound care in the tissue expander group (P skin necrosis is significantly more likely to occur after autologous breast reconstruction compared with 2-stage expander implant-based breast reconstruction. Patients with autologous reconstructions are more readily treated with local wound care compared with patients with tissue expanders, who tended to require operative treatment of this complication. Patients considering breast reconstruction should be counseled appropriately regarding the differences in incidence and management of mastectomy skin

  14. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Feng, Rulin; Peterson, Kirk A


    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal


    T. Dokken


    Full Text Available When viewed from distance, large parts of the topography of landmasses and the bathymetry of the sea and ocean floor can be regarded as a smooth background with local features. Consequently a digital elevation model combining a compact smooth representation of the background with locally added features has the potential of providing a compact and accurate representation for topography and bathymetry. The recent introduction of Locally Refined B-Splines (LR B-splines allows the granularity of spline representations to be locally adapted to the complexity of the smooth shape approximated. This allows few degrees of freedom to be used in areas with little variation, while adding extra degrees of freedom in areas in need of more modelling flexibility. In the EU fp7 Integrating Project IQmulus we exploit LR B-splines for approximating large point clouds representing bathymetry of the smooth sea and ocean floor. A drastic reduction is demonstrated in the bulk of the data representation compared to the size of input point clouds. The representation is very well suited for exploiting the power of GPUs for visualization as the spline format is transferred to the GPU and the triangulation needed for the visualization is generated on the GPU according to the viewing parameters. The LR B-splines are interoperable with other elevation model representations such as LIDAR data, raster representations and triangulated irregular networks as these can be used as input to the LR B-spline approximation algorithms. Output to these formats can be generated from the LR B-spline applications according to the resolution criteria required. The spline models are well suited for change detection as new sensor data can efficiently be compared to the compact LR B-spline representation.

  16. Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)

    Schütz, Martin, E-mail: [Institute of Physical and Theoretical Chemistry, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg (Germany)


    We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.

  17. Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2).

    Schütz, Martin


    We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.

  18. Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)

    Schütz, Martin


    We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a

  19. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor


    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  20. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Gábor Vasas


    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  1. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Carolina Saori Ishii Mauro


    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  2. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.


    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  3. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling


    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  4. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Košál Michal


    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  5. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Mawethu P. Bilibana


    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  6. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Jing Li


    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  7. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.


    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  8. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing


    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. An analysis of the 'costs and effectiveness' of post-mastectomy local-regional radiation therapy

    Marks, L.B.; Prosnitz, L.R.; Hardenbergh, P.H.; Winer, E.T.


    Purpose: To estimate the 'cost/effectiveness' ratio for post-mastectomy local-regional radiation therapy (LR-XRT) for patients with breast cancer. As the risk of local-regional recurrence (LRR) is related to the number of positive axillary lymph nodes, the cost/effectiveness ratio of LR-XRT was assessed for a variable number of positive axillary nodes. For overall survival (OS), the cost per additional life-year is estimated as a function of follow-up duration. Methods/Assumptions: Literature data indicate that the risk of LRR is related to the number of positive axillary nodes (e.g. Fowble, Kuske). For example, the LRR rate is ∼10% for patients with negative nodes, increasing to ∼40% for patients with ≥4 positive nodes. Such data are used to linearly relate the number of positive nodes with the risk of LRR. Additional assumptions include: RT reduces the risk of LRR by 67%; local recurrences are treated with exision/biopsy, LR-XRT and systemic chemotherapy; half of the local recurrences are controlled locally and half will require additional salvage treatment with surgery or chemotherapy. The 5, 10 and 15 yr improvements in OS provided by LR-XRT are estimated to be 3, 7, and 10%, respectively, based on the literature (Overgaard, Ragaz, Klefstrom, Rutqvist). For each year following LR-XRT, the accrued life-years gained are estimated from the published survival curves. Professional and technical charges are used as a surrogate for costs, as follows (in thousands): LR-XRT-15; evaluation of recurrence-2; biopsy plus pathology-1; resection plus pathology-7, chemotherapy-10. Results: The cost per LRR prevented with the addition of routine post-mastectomy LR-XRT is shown, as a function of the number of positive axillary nodes. The cost per additional life-year gained with LR-XRT, as a function of follow-up duration, is shown. With increasing follow-up, the cost per life-year gained decreases as the additional life-years accrue. Conclusions: The cost per LRR

  10. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying


    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  11. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna


    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  12. Breast Reconstruction After Mastectomy

    ... Cancer Prevention Genetics of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Reconstruction After Mastectomy On This Page What is breast reconstruction? How do surgeons use implants to reconstruct a woman’s breast? How do surgeons ...

  13. Breast reconstruction - implants

    Breast implants surgery; Mastectomy - breast reconstruction with implants; Breast cancer - breast reconstruction with implants ... harder to find a tumor if your breast cancer comes back. Getting breast implants does not take as long as breast reconstruction ...

  14. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Sérgio João de Luca


    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  15. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen


    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  16. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Fernanda da Conceição Moreira


    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  17. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.


    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  18. Cool-season precipitation in the southwestern USA since AD 1000: comparison of linear and nonlinear techniques for reconstruction

    Ni, Fenbiao; Cavazos, Tereza; Hughes, Malcolm K.; Comrie, Andrew C.; Funkhouser, Gary


    A 1000 year reconstruction of cool-season (November-April) precipitation was developed for each climate division in Arizona and New Mexico from a network of 19 tree-ring chronologies in the southwestern USA. Linear regression (LR) and artificial neural network (NN) models were used to identify the cool-season precipitation signal in tree rings. Using 1931-88 records, the stepwise LR model was cross-validated with a leave-one-out procedure and the NN was validated with a bootstrap technique. The final models were also independently validated using the 1896-1930 precipitation data. In most of the climate divisions, both techniques can successfully reconstruct dry and normal years, and the NN seems to capture large precipitation events and more variability better than the LR. In the 1000 year reconstructions the NN also produces more distinctive wet events and more variability, whereas the LR produces more distinctive dry events. The 1000 year reconstructed precipitation from the two models shows several sustained dry and wet periods comparable to the 1950s drought (e.g. 16th century mega drought) and to the post-1976 wet period (e.g. 1330s, 1610s). The impact of extreme periods on the environment may be stronger during sudden reversals from dry to wet, which were not uncommon throughout the millennium, such as the 1610s wet interval that followed the 16th century mega drought. The instrumental records suggest that strong dry to wet precipitation reversals in the past 1000 years might be linked to strong shifts from cold to warm El Niño-southern oscillation events and from a negative to positive Pacific decadal oscillation.

  19. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.


    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  20. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko


    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  1. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei


    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.


    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong


    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  3. Adaptive algebraic reconstruction technique

    Lu Wenkai; Yin Fangfang


    Algebraic reconstruction techniques (ART) are iterative procedures for reconstructing objects from their projections. It is proven that ART can be computationally efficient by carefully arranging the order in which the collected data are accessed during the reconstruction procedure and adaptively adjusting the relaxation parameters. In this paper, an adaptive algebraic reconstruction technique (AART), which adopts the same projection access scheme in multilevel scheme algebraic reconstruction technique (MLS-ART), is proposed. By introducing adaptive adjustment of the relaxation parameters during the reconstruction procedure, one-iteration AART can produce reconstructions with better quality, in comparison with one-iteration MLS-ART. Furthermore, AART outperforms MLS-ART with improved computational efficiency


    Erik Vrabič


    Full Text Available Background. Breasts are an important symbol of physical beauty, feminity, mothering and sexual desire through the entire history of mankind. Lost of the whole or part of the breast is functional and aesthetic disturbance for woman. It is understandable, that the woman, who is concerned over breast loss, is as appropriate as another person´s concern over the loss of a limb or other body part. Before the 1960, breast reconstruction was considered as a dangerous procedure and it was almost prohibited. Considering the psychological importance of the breast in modern society, the possibility of breast reconstruction for the woman about to undergo a mastectomy is a comforting alternative. We can perform breast reconstruction with autologous tissue (autologous reconstruction, with breast implants and combination of both methods. For autologous reconstruction we can use local tissue (local flaps, or tissue from distant parts of the body (free vascular tissue transfer. Tissue expansion must be performed first, in many cases of breast reconstructions with breast implants. Conclusions. Possibility of breast reconstruction made a big progress last 3 decades. Today we are able to reconstruct almost every defect of the breast and the entire breast. Breast reconstruction rise the quality of life for breast cancer patients. Breast reconstruction is a team work of experts from many medicine specialites. In Slovenia we can offer breast reconstruction for breast cancer patients in Ljubljana, where plastic surgeons from Clinical Department for Plastic Surgery and Burns cooperate with oncologic surgeons. Ten years ago a similar cooperation between plastic surgeons and surgeons of the Centre for Breast Diseases was established in Maribor.

  5. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao


    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  6. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    R. Greco


    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  7. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman


    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  8. Quantitative reconstruction of past Danish landscapes: The first results

    Odgaard, Bent Vad; Nielsen, Anne Birgitte

    We present a first attempt at pollen based quantitative reconstruction of land cover around 9 Danish lake sites for the past 2500 years, based on models of pollen dispersal and -deposition (Prentice, 1985; Sugita, 1993, 1994), and pollen productivity estimates produced from a historical calibrati...... are then used in the Landscape Reconstruction Algorithm, LRA, (Sugita & Walker, 2000; Sugita, in press) to separate background and local pollen signals at small sites, thus providing reconstructions of local vegetation around the sites....

  9. Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

    Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru


    Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

  10. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail:


    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  11. Simultaneous motion estimation and image reconstruction (SMEIR) for 4D cone-beam CT

    Wang, Jing; Gu, Xuejun


    -blurring artifacts are present, leading to a 24.4% relative reconstruction error in the NACT phantom. View aliasing artifacts are present in 4D-CBCT reconstructed by FDK from 20 projections, with a relative error of 32.1%. When total variation minimization is used to reconstruct 4D-CBCT, the relative error is 18.9%. Image quality of 4D-CBCT is substantially improved by using the SMEIR algorithm and relative error is reduced to 7.6%. The maximum error (MaxE) of tumor motion determined from the DVF obtained by demons registration on a FDK-reconstructed 4D-CBCT is 3.0, 2.3, and 7.1 mm along left–right (L-R), anterior–posterior (A-P), and superior–inferior (S-I) directions, respectively. From the DVF obtained by demons registration on 4D-CBCT reconstructed by total variation minimization, the MaxE of tumor motion is reduced to 1.5, 0.5, and 5.5 mm along L-R, A-P, and S-I directions. From the DVF estimated by SMEIR algorithm, the MaxE of tumor motion is further reduced to 0.8, 0.4, and 1.5 mm along L-R, A-P, and S-I directions, respectively.Conclusions: The proposed SMEIR algorithm is able to estimate a motion model and reconstruct motion-compensated 4D-CBCT. The SMEIR algorithm improves image reconstruction accuracy of 4D-CBCT and tumor motion trajectory estimation accuracy as compared to conventional sequential 4D-CBCT reconstruction and motion estimation

  12. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun


    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.


    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong


    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  14. Innovations in diabetic foot reconstruction using supermicrosurgery.

    Suh, Hyun Suk; Oh, Tae Suk; Hong, Joon Pio


    The treatment of diabetic foot ulceration is complex with multiple factors involved, and it may often lead to limb amputation. Hence, a multidisciplinary approach is warranted to cover the spectrum of treatment for diabetic foot, but in complex wounds, surgical treatment is inevitable. Surgery may involve the decision to preserve the limb by reconstruction or to amputate it. Reconstruction involves preserving the limb with secure coverage. Local flaps usually are able to provide sufficient coverage for small or moderate sized wound, but for larger wounds, soft tissue coverage involves flaps that are distantly located from the wound. Reconstruction of distant flap usually involves microsurgery, and now, further innovative methods such as supermicrosurgery have further given complex wounds a better chance to be reconstructed and limbs salvaged. This article reviews the microsurgery involved in reconstruction and introduces the new method of supermicrosurgery. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.


    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  16. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Vitor Vasconcelos


    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  17. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division


    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  18. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.


    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  19. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J


    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  20. Breast reconstruction - natural tissue

    ... flap; TRAM; Latissimus muscle flap with a breast implant; DIEP flap; DIEAP flap; Gluteal free flap; Transverse upper gracilis flap; TUG; Mastectomy - breast reconstruction with natural tissue; Breast cancer - breast reconstruction with natural tissue

  1. Breast reconstruction after mastectomy

    Daniel eSchmauss


    Full Text Available Breast cancer is the leading cause of cancer death in women worldwide. Its surgical approach has become less and less mutilating in the last decades. However, the overall number of breast reconstructions has significantly increased lately. Nowadays breast reconstruction should be individualized at its best, first of all taking into consideration oncological aspects of the tumor, neo-/adjuvant treatment and genetic predisposition, but also its timing (immediate versus delayed breast reconstruction, as well as the patient’s condition and wish. This article gives an overview over the various possibilities of breast reconstruction, including implant- and expander-based reconstruction, flap-based reconstruction (vascularized autologous tissue, the combination of implant and flap, reconstruction using non-vascularized autologous fat, as well as refinement surgery after breast reconstruction.

  2. A Super-resolution Reconstruction Algorithm for Surveillance Video

    Jian Shao


    Full Text Available Recent technological developments have resulted in surveillance video becoming a primary method of preserving public security. Many city crimes are observed in surveillance video. The most abundant evidence collected by the police is also acquired through surveillance video sources. Surveillance video footage offers very strong support for solving criminal cases, therefore, creating an effective policy, and applying useful methods to the retrieval of additional evidence is becoming increasingly important. However, surveillance video has had its failings, namely, video footage being captured in low resolution (LR and bad visual quality. In this paper, we discuss the characteristics of surveillance video and describe the manual feature registration – maximum a posteriori – projection onto convex sets to develop a super-resolution reconstruction method, which improves the quality of surveillance video. From this method, we can make optimal use of information contained in the LR video image, but we can also control the image edge clearly as well as the convergence of the algorithm. Finally, we make a suggestion on how to adjust the algorithm adaptability by analyzing the prior information of target image.

  3. Treatment and Prognosis of Isolated Local Relapse after Stereotactic Body Radiotherapy for Clinical Stage I Non-Small-Cell Lung Cancer: Importance of Salvage Surgery.

    Hamaji, Masatsugu; Chen, Fengshi; Matsuo, Yukinori; Ueki, Nami; Hiraoka, Masahiro; Date, Hiroshi


    Many efforts have been made to detect local relapse (LR) in the follow-up after stereotactic body radiotherapy (SBRT) for non-small-cell lung cancer (NSCLC) although limited data are available on its treatment and prognosis. We aimed to characterize treatment options and clarify long-term outcomes of isolated LR after SBRT for patients with clinical stage I NSCLC. We reviewed our institutional database in search of patients with isolated LR after SBRT for clinical stage I NSCLC at our institution between 1999 and 2013. Patient characteristics were compared with Mann-Whitney U test, χ2 test, or Fisher's exact test as appropriate. Survival outcomes were estimated with Kaplan-Meier method. Potential prognostic factors were investigated using Cox proportional hazard model. Of 308 patients undergoing SBRT for clinical stage I NSCLC, 49 patients were identified to have isolated LR. Twelve patients underwent salvage surgery, none underwent radiotherapy, and eight patients received chemotherapy, whereas 29 patients received best supportive care. No patient characteristic except operability was significantly related with patient selection for LR treatments. Five-year overall survival (OS) rate of the whole cohort was 47.9% from SBRT and 25.7% from LR. Salvage surgery was associated with improved OS after LR (p = 0.014), and 5-year OS for patients undergoing salvage surgery was 79.5% from LR. It was confirmed that our patient selection for salvage surgery for isolated LR was associated with favorable survival outcomes. Operability based on multidisciplinary conferences, rather than measurable patient characteristics, is essential for appropriate patient selection for salvage surgery.

  4. [Pelvic reconstructions after bone tumor resection].

    Anract, Philippe; Biau, David; Babinet, Antoine; Tomeno, Bernard


    The three more frequent primitive malignant bone tumour which concerned the iliac bone are chondrosarcoma, following Ewing sarcoma and osteosarcoma. Wide resection remains the most important part of the treatment associated with chemotherapy for osteosarcoma and the Ewing sarcoma. Iliac wing resections and obdurate ring don't required reconstruction. However, acetabular resections and iliac wing resection with disruption of the pelvic ring required reconstruction to provide acceptable functional result. Acetabular reconstruction remains high technical demanding challenge. After isolated acetabular resection or associated to obdurate ring, our usual method of reconstruction is homolateral proximal femoral autograft and total hip prosthesis but it is possible to also used : saddle prosthesis, Mac Minn prosthesis with auto or allograft, modular prosthesis or custom made prosthesis, massive allograft with or without prosthesis and femoro-ilac arthrodesis. After resection of the iliac wing plus acetabulum, reconstruction can be performed by femoro-obturatrice and femora-sacral arthrodesis, homolateral proximal femoral autograft and prosthesis, femoral medialisation, massive allograft and massive allograft. Carcinological results are lesser than resection for distal limb tumor, local recurrence rate range 17 to 45%. Functional results after Iliac wing and obdurate ring are good. However, acetabular reconstruction provide uncertain functional results. The lesser results arrive after hemipelvic or acetabular and iliac wing resection-reconstruction, especially when gluteus muscles were also resected. The most favourable results arrive after isolated acetabular or acetabular plus obturateur ring resection-reconstruction.

  5. Tumor-related markers in histologically normal margins correlate with locally recurrent oral squamous cell carcinoma: a retrospective study.

    Wang, Xinhong; Chen, Si; Chen, Xinming; Zhang, Cuicui; Liang, Xueyi


    Oral squamous cell carcinoma (OSCC) is characterized by a high rate of local recurrence (LR) even when the surgical margins are considered histopathologically 'normal'. The aim of our study was to determine the relationship between early tumor-related markers detected in histologically normal margins (HNM) and LR as well as disease-free survival in OSCC. The loss of heterozygosity (LOH) of markers on 9p21 (D9s1747, RPS6, D9s162) and 17p13 (TP53) and the immunostaining results of the corresponding mutant P53, P14, P15, and P16 proteins were assessed and correlated with LR and disease-free survival in 71 OSCC patients who had HNM. Fifteen of 71 patients with HNM developed LR. The presence of the following molecular markers in surgical margins was significantly correlated with the development of LR: LOH on chromosome 9p21 (D9s1747 + RPS6 + D9s162), any LOH, P16, and P53 (chi-square test, P tumor-related markers in histologically 'normal' resection margins may be a useful method for assessing LR in OSCC patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    王文琴; 张永臣; 贾红玲


    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  7. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk


    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.


    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  9. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.


    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  10. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)


    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  11. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)


    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  12. Graph-Based Semi-Supervised Learning for Indoor Localization Using Crowdsourced Data

    Liye Zhang


    Full Text Available Indoor positioning based on the received signal strength (RSS of the WiFi signal has become the most popular solution for indoor localization. In order to realize the rapid deployment of indoor localization systems, solutions based on crowdsourcing have been proposed. However, compared to conventional methods, lots of different devices are used in crowdsourcing system and less RSS values are collected by each device. Therefore, the crowdsourced RSS values are more erroneous and can result in significant localization errors. In order to eliminate the signal strength variations across diverse devices, the Linear Regression (LR algorithm is proposed to solve the device diversity problem in crowdsourcing system. After obtaining the uniform RSS values, a graph-based semi-supervised learning (G-SSL method is used to exploit the correlation between the RSS values at nearby locations to estimate an optimal RSS value at each location. As a result, the negative effect of the erroneous measurements could be mitigated. Since the AP locations need to be known in G-SSL algorithm, the Compressed Sensing (CS method is applied to precisely estimate the location of the APs. Based on the location of the APs and a simple signal propagation model, the RSS difference between different locations is calculated and used as an additional constraint to improve the performance of G-SSL. Furthermore, to exploit the sparsity of the weights used in the G-SSL, we use the CS method to reconstruct these weights more accurately and make a further improvement on the performance of the G-SSL. Experimental results show improved results in terms of the smoothness of the radio map and the localization accuracy.

  13. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Hanna Mazur


    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  14. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    Cerrada, Lucia; San Martin, Jesus


    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  15. Septal graft in laryngeal reconstruction

    Bahannan, Abdulrahman; Slavicek, A.; Taudy, M.; Chovanec, M.


    A 62-year-old woman presented with symptoms of dyspnea. Ultrasonography and computed tomography examinations revealed mass extending from the cricoid cartilage to the left lobe of thyroid gland and thyroid cartilage. Cytology revealed possibility of cartilaginous origin, which was proven to be chondrosarcoma (Grade 1) from the biopsy specimen obtained during panendosopy. She underwent one stage radical resection and immediate reconstruction of laryngeal skeleton defect by mucocartilaginous graft from the nasal septum. Her postoperative course was optimal with preservation of the laryngeal functions. Twenty-eight months postoperatively, she had to undergo total laryngectomy as a salvage procedure for the advanced local recurrence. We report on the relatively easy technique for functional reconstruction of the large laryngeal defect with the employment cartilage graft from the nasal septum. (author)

  16. Stability indicators in network reconstruction.

    Michele Filosi

    Full Text Available The number of available algorithms to infer a biological network from a dataset of high-throughput measurements is overwhelming and keeps growing. However, evaluating their performance is unfeasible unless a 'gold standard' is available to measure how close the reconstructed network is to the ground truth. One measure of this is the stability of these predictions to data resampling approaches. We introduce NetSI, a family of Network Stability Indicators, to assess quantitatively the stability of a reconstructed network in terms of inference variability due to data subsampling. In order to evaluate network stability, the main NetSI methods use a global/local network metric in combination with a resampling (bootstrap or cross-validation procedure. In addition, we provide two normalized variability scores over data resampling to measure edge weight stability and node degree stability, and then introduce a stability ranking for edges and nodes. A complete implementation of the NetSI indicators, including the Hamming-Ipsen-Mikhailov (HIM network distance adopted in this paper is available with the R package nettools. We demonstrate the use of the NetSI family by measuring network stability on four datasets against alternative network reconstruction methods. First, the effect of sample size on stability of inferred networks is studied in a gold standard framework on yeast-like data from the Gene Net Weaver simulator. We also consider the impact of varying modularity on a set of structurally different networks (50 nodes, from 2 to 10 modules, and then of complex feature covariance structure, showing the different behaviours of standard reconstruction methods based on Pearson correlation, Maximum Information Coefficient (MIC and False Discovery Rate (FDR strategy. Finally, we demonstrate a strong combined effect of different reconstruction methods and phenotype subgroups on a hepatocellular carcinoma miRNA microarray dataset (240 subjects, and we

  17. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin


    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  18. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin


    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  19. Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

    Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Liu, Yuan [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Biostatistics and Bioinformatics Shared Resource, Emory University, Atlanta, Georgia (United States); Okwan-Duodu, Derrick [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Flowers, Christopher R. [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Medical Oncology, Emory University, Atlanta, Georgia (United States); Khan, Mohammad K., E-mail: [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States)


    Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy.

  20. Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

    Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng; Liu, Yuan; Okwan-Duodu, Derrick; Flowers, Christopher R.; Khan, Mohammad K.


    Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy

  1. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Hrouzek, Pavel; Štys, Dalibor; Martens, Harald


    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036

  2. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Jan Urban


    Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  3. Estimation of ion competition via correlated responsivity offset in linear ion trap mass spectrometry analysis: theory and practical use in the analysis of cyanobacterial hepatotoxin microcystin-LR in extracts of food additives.

    Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald


    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  4. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong


    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  5. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  6. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto


    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  7. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  8. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Sellbom, Martin; Bagby, R. Michael


    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  9. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.


    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  10. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)


    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  11. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)


    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  12. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam


    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  13. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)


    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  14. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter


    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  15. Long-term outcomes of patients with breast cancer after nipple-sparing mastectomy/skin-sparing mastectomy followed by immediate transverse rectus abdominis musculocutaneous flap reconstruction: Comparison with conventional mastectomy in a single center study.

    Lee, Sae Byul; Lee, Jong Won; Kim, Hee Jeong; Ko, Beom Seok; Son, Byung Ho; Eom, Jin Sup; Lee, Taik Jong; Ahn, Sei-Hyun


    To evaluate the oncological outcomes of patients with breast cancer after nipple-sparing mastectomy (NSM)/skin-sparing mastectomy (SSM), followed by immediate reconstruction, as compared to conventional mastectomy (CM).SSM/NSM has been increasingly used to treat women with breast cancer who wish to preserve the overlying breast skin, but concern exist regarding its oncological safety due to the potential for residual breast tissue. We report our experience performing SSM/NSM for breast cancer treatment compared to CM with a long follow-up period.All consecutive patients who underwent mastectomy for breast cancer at Asan Medical Center between January 1993 and December 2008 were identified by retrospective medical chart review. The patients who underwent NSM/SSM, followed by immediate breast reconstruction with a pedicled transverse rectus abdominis musculocutaneous flap (TRAM), were compared to the patients who underwent CM in terms of breast-cancer specific survival (BCSS) rate, distant metastasis-free survival (DMFS) rate, and local recurrence (LR) rate.During the study period, 6028 patients underwent mastectomy for breast cancer. Of these, 1032 and 4996 underwent NSM/SSM with TRAM and CM, respectively. Their median follow-up durations were 94.4 (range, 8.1-220.2) and 110.8 (range, 6.1-262.0) months, respectively. Their 5 year BCSS rates were 95.4% and 88.1%, respectively (log-rank, P < .001). Their 5 year DMFS rates were 93.0% and 85.6%, respectively (log-rank, P < .001).Relative to CM, NSM/SSM, followed by immediate breast reconstruction, may be a viable and oncologically safe surgical treatment in selected patients with breast cancer.

  16. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Siuly; Li, Yan; Paul Wen, Peng


    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Revisit of Nasolabial flap in the reconstruction of defects involving ...

    Conclusion: Data from this study suggest that NL flap is a reliable option for reconstruction of the oral floor, in form as well as function, without esthetic compromise and has a major role even in this era of free flaps. Keywords: Floor of mouth defects, local flaps, nasolabail flap, oral cavity defects, reconstruction, regional flaps ...

  18. Artificial neural network approach to predict surgical site infection after free-flap reconstruction in patients receiving surgery for head and neck cancer.

    Kuo, Pao-Jen; Wu, Shao-Chun; Chien, Peng-Chen; Chang, Shu-Shya; Rau, Cheng-Shyuan; Tai, Hsueh-Ling; Peng, Shu-Hui; Lin, Yi-Chun; Chen, Yi-Chun; Hsieh, Hsiao-Yun; Hsieh, Ching-Hua


    The aim of this study was to develop an effective surgical site infection (SSI) prediction model in patients receiving free-flap reconstruction after surgery for head and neck cancer using artificial neural network (ANN), and to compare its predictive power with that of conventional logistic regression (LR). There were 1,836 patients with 1,854 free-flap reconstructions and 438 postoperative SSIs in the dataset for analysis. They were randomly assigned tin ratio of 7:3 into a training set and a test set. Based on comprehensive characteristics of patients and diseases in the absence or presence of operative data, prediction of SSI was performed at two time points (pre-operatively and post-operatively) with a feed-forward ANN and the LR models. In addition to the calculated accuracy, sensitivity, and specificity, the predictive performance of ANN and LR were assessed based on area under the curve (AUC) measures of receiver operator characteristic curves and Brier score. ANN had a significantly higher AUC (0.892) of post-operative prediction and AUC (0.808) of pre-operative prediction than LR (both P <0.0001). In addition, there was significant higher AUC of post-operative prediction than pre-operative prediction by ANN (p<0.0001). With the highest AUC and the lowest Brier score (0.090), the post-operative prediction by ANN had the highest overall predictive performance. The post-operative prediction by ANN had the highest overall performance in predicting SSI after free-flap reconstruction in patients receiving surgery for head and neck cancer.

  19. Subsets of Women With Close or Positive Margins After Breast-Conserving Surgery With High Local Recurrence Risk Despite Breast Plus Boost Radiotherapy

    Lupe, Krystine; Truong, Pauline T.; Alexander, Cheryl; Lesperance, Mary; Speers, Caroline; Tyldesley, Scott


    Purpose: (1) To examine the effect of surgical margin status on local recurrence (LR) and survival following breast-conserving therapy; (2) To identify subsets with close or positive margins with high LR risk despite whole breast radiotherapy (RT) plus boost. Methods and Materials: Subjects were 2,264 women with pT1–3, any N, M0 invasive breast cancer, treated with breast-conserving surgery and whole breast ± boost RT. Five-year Kaplan-Meier (KM) LR, breast cancer–specific and overall survival (BCSS and OS) were compared between cohorts with negative (n = 1,980), close (n = 222), and positive (n = 62) margins. LR rates were analyzed according to clinicopathologic characteristics. Multivariable Cox regression modeling and matched analysis of close/positive margin cases and negative margin controls were performed. Results: Median follow-up was 5.2 years. Boost RT was used in 92% of patients with close or positive margins. Five-year KM LR rates in the negative, close and positive margin cohorts were 1.3%, 4.0%, and 5.2%, respectively (p = 0.001). BCSS and OS were similar in the three margin subgroups. In the close/positive margin cohort, LR rates were 10.2% with age 10% despite whole breast plus boost RT. These patients should be considered for more definitive surgery.

  20. Image Reconstruction. Chapter 13

    Nuyts, J. [Department of Nuclear Medicine and Medical Imaging Research Center, Katholieke Universiteit Leuven, Leuven (Belgium); Matej, S. [Medical Image Processing Group, Department of Radiology, University of Pennsylvania, Philadelphia, PA (United States)


    This chapter discusses how 2‑D or 3‑D images of tracer distribution can be reconstructed from a series of so-called projection images acquired with a gamma camera or a positron emission tomography (PET) system [13.1]. This is often called an ‘inverse problem’. The reconstruction is the inverse of the acquisition. The reconstruction is called an inverse problem because making software to compute the true tracer distribution from the acquired data turns out to be more difficult than the ‘forward’ direction, i.e. making software to simulate the acquisition. There are basically two approaches to image reconstruction: analytical reconstruction and iterative reconstruction. The analytical approach is based on mathematical inversion, yielding efficient, non-iterative reconstruction algorithms. In the iterative approach, the reconstruction problem is reduced to computing a finite number of image values from a finite number of measurements. That simplification enables the use of iterative instead of mathematical inversion. Iterative inversion tends to require more computer power, but it can cope with more complex (and hopefully more accurate) models of the acquisition process.

  1. Update on orbital reconstruction.

    Chen, Chien-Tzung; Chen, Yu-Ray


    Orbital trauma is common and frequently complicated by ocular injuries. The recent literature on orbital fracture is analyzed with emphasis on epidemiological data assessment, surgical timing, method of approach and reconstruction materials. Computed tomographic (CT) scan has become a routine evaluation tool for orbital trauma, and mobile CT can be applied intraoperatively if necessary. Concomitant serious ocular injury should be carefully evaluated preoperatively. Patients presenting with nonresolving oculocardiac reflex, 'white-eyed' blowout fracture, or diplopia with a positive forced duction test and CT evidence of orbital tissue entrapment require early surgical repair. Otherwise, enophthalmos can be corrected by late surgery with a similar outcome to early surgery. The use of an endoscope-assisted approach for orbital reconstruction continues to grow, offering an alternative method. Advances in alloplastic materials have improved surgical outcome and shortened operating time. In this review of modern orbital reconstruction, several controversial issues such as surgical indication, surgical timing, method of approach and choice of reconstruction material are discussed. Preoperative fine-cut CT image and thorough ophthalmologic examination are key elements to determine surgical indications. The choice of surgical approach and reconstruction materials much depends on the surgeon's experience and the reconstruction area. Prefabricated alloplastic implants together with image software and stereolithographic models are significant advances that help to more accurately reconstruct the traumatized orbit. The recent evolution of orbit reconstruction improves functional and aesthetic results and minimizes surgical complications.

  2. Refined estimates of local recurrence risks by DCIS score adjusting for clinicopathological features: a combined analysis of ECOG-ACRIN E5194 and Ontario DCIS cohort studies.

    Rakovitch, E; Gray, R; Baehner, F L; Sutradhar, R; Crager, M; Gu, S; Nofech-Mozes, S; Badve, S S; Hanna, W; Hughes, L L; Wood, W C; Davidson, N E; Paszat, L; Shak, S; Sparano, J A; Solin, L J


    Better tools are needed to estimate local recurrence (LR) risk after breast-conserving surgery (BCS) for DCIS. The DCIS score (DS) was validated as a predictor of LR in E5194 and Ontario DCIS cohort (ODC) after BCS. We combined data from E5194 and ODC adjusting for clinicopathological factors to provide refined estimates of the 10-year risk of LR after treatment by BCS alone. Data from E5194 and ODC were combined. Patients with positive margins or multifocality were excluded. Identical Cox regression models were fit for each study. Patient-specific meta-analysis was used to calculate precision-weighted estimates of 10-year LR risk by DS, age, tumor size and year of diagnosis. The combined cohort includes 773 patients. The DS and age at diagnosis, tumor size and year of diagnosis provided independent prognostic information on the 10-year LR risk (p ≤ 0.009). Hazard ratios from E5194 and ODC cohorts were similar for the DS (2.48, 1.95 per 50 units), tumor size ≤ 1 versus  > 1-2.5 cm (1.45, 1.47), age ≥ 50 versus  15%) 10-year LR risk after BCS alone compared to utilization of DS alone or clinicopathological factors alone. The combined analysis provides refined estimates of 10-year LR risk after BCS for DCIS. Adding information on tumor size and age at diagnosis to the DS adjusting for year of diagnosis provides improved LR risk estimates to guide treatment decision making.

  3. Permutationally invariant state reconstruction

    Moroder, Tobias; Hyllus, Philipp; Tóth, Géza


    Feasible tomography schemes for large particle numbers must possess, besides an appropriate data acquisition protocol, an efficient way to reconstruct the density operator from the observed finite data set. Since state reconstruction typically requires the solution of a nonlinear large-scale opti...... optimization, which has clear advantages regarding speed, control and accuracy in comparison to commonly employed numerical routines. First prototype implementations easily allow reconstruction of a state of 20 qubits in a few minutes on a standard computer.......-scale optimization problem, this is a major challenge in the design of scalable tomography schemes. Here we present an efficient state reconstruction scheme for permutationally invariant quantum state tomography. It works for all common state-of-the-art reconstruction principles, including, in particular, maximum...

  4. Target localization of 3D versus 4D cone beam computed tomography in lipiodol-guided stereotactic radiotherapy of hepatocellular carcinomas.

    Chan, Mark; Chiang, Chi Leung; Lee, Venus; Cheung, Steven; Leung, Ronnie; Wong, Matthew; Lee, Frankle; Blanck, Oliver


    Aim of this study was to comparatively evaluate the accuracy of respiration-correlated (4D) and uncorrelated (3D) cone beam computed tomography (CBCT) in localizing lipiodolized hepatocellular carcinomas during stereotactic body radiotherapy (SBRT). 4D-CBCT scans of eighteen HCCs were acquired during free-breathing SBRT following trans-arterial chemo-embolization (TACE) with lipiodol. Approximately 1320 x-ray projections per 4D-CBCT were collected and phase-sorted into ten bins. A 4D registration workflow was followed to register the reconstructed time-weighted average CBCT with the planning mid-ventilation (MidV) CT by an initial bone registration of the vertebrae and then tissue registration of the lipiodol. For comparison, projections of each 4D-CBCT were combined to synthesize 3D-CBCT without phase-sorting. Using the lipiodolized tumor, uncertainties of the treatment setup estimated from the absolute and relative lipiodol position to bone were analyzed separately for 4D- and 3D-CBCT. Qualitatively, 3D-CBCT showed better lipiodol contrast than 4D-CBCT primarily because of a tenfold increase of projections used for reconstruction. Motion artifact was observed to subside in 4D-CBCT compared to 3D-CBCT. Group mean, systematic and random errors estimated from 4D- and 3D-CBCT agreed to within 1 mm in the cranio-caudal (CC) and 0.5 mm in the anterior-posterior (AP) and left-right (LR) directions. Systematic and random errors are largest in the CC direction, amounting to 4.7 mm and 3.7 mm from 3D-CBCT and 5.6 mm and 3.8 mm from 4D-CBCT, respectively. Safety margin calculated from 3D-CBCT and 4D-CBCT differed by 2.1, 0.1 and 0.0 mm in the CC, AP, and LR directions. 3D-CBCT is an adequate alternative to 4D-CBCT when lipoid is used for localizing HCC during free-breathing SBRT. Similar margins are anticipated with 3D- and 4D-CBCT.

  5. Treatment results of localized gastric lymphoma

    Abe, Tatsuyuki; Gomi, Hiromichi; Sakaino, Shinjiro; Nakajima, Yasuo


    Between 2000 and 2007, 17 patients with localized gastric lymphoma (10 mucosa-associated lymphoid tissue lymphomas and 7 diffuse large B-cell lymphomas) were treated with radiotherapy alone or doxorubicin-based chemotherapy followed by radiotherapy. Radiation dose of mucosa-associated lymphoid tissue (MALT) lymphoma was 30 Gy with a daily fraction size of 1.5 Gy. Sixteen patients achieved complete remission and the 5-year overall survival of MALT lymphoma and diffuse large B-cell lymphoma (DLBCL) were 100% and 87%, respectively. No gastric perforation and hemorrhage were noticed. Using AP/LR 2-port radiotherapy markedly decreased the liver dose. (author)

  6. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor


    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  7. PET reconstruction via nonlocal means induced prior.

    Hou, Qingfeng; Huang, Jing; Bian, Zhaoying; Chen, Wufan; Ma, Jianhua


    The traditional Bayesian priors for maximum a posteriori (MAP) reconstruction methods usually incorporate local neighborhood interactions that penalize large deviations in parameter estimates for adjacent pixels; therefore, only local pixel differences are utilized. This limits their abilities of penalizing the image roughness. To achieve high-quality PET image reconstruction, this study investigates a MAP reconstruction strategy by incorporating a nonlocal means induced (NLMi) prior (NLMi-MAP) which enables utilizing global similarity information of image. The present NLMi prior approximates the derivative of Gibbs energy function by an NLM filtering process. Specially, the NLMi prior is obtained by subtracting the current image estimation from its NLM filtered version and feeding the residual error back to the reconstruction filter to yield the new image estimation. We tested the present NLMi-MAP method with simulated and real PET datasets. Comparison studies with conventional filtered backprojection (FBP) and a few iterative reconstruction methods clearly demonstrate that the present NLMi-MAP method performs better in lowering noise, preserving image edge and in higher signal to noise ratio (SNR). Extensive experimental results show that the NLMi-MAP method outperforms the existing methods in terms of cross profile, noise reduction, SNR, root mean square error (RMSE) and correlation coefficient (CORR).

  8. Craniofacial Reconstruction Evaluation by Geodesic Network

    Junli Zhao


    Full Text Available Craniofacial reconstruction is to estimate an individual’s face model from its skull. It has a widespread application in forensic medicine, archeology, medical cosmetic surgery, and so forth. However, little attention is paid to the evaluation of craniofacial reconstruction. This paper proposes an objective method to evaluate globally and locally the reconstructed craniofacial faces based on the geodesic network. Firstly, the geodesic networks of the reconstructed craniofacial face and the original face are built, respectively, by geodesics and isogeodesics, whose intersections are network vertices. Then, the absolute value of the correlation coefficient of the features of all corresponding geodesic network vertices between two models is taken as the holistic similarity, where the weighted average of the shape index values in a neighborhood is defined as the feature of each network vertex. Moreover, the geodesic network vertices of each model are divided into six subareas, that is, forehead, eyes, nose, mouth, cheeks, and chin, and the local similarity is measured for each subarea. Experiments using 100 pairs of reconstructed craniofacial faces and their corresponding original faces show that the evaluation by our method is roughly consistent with the subjective evaluation derived from thirty-five persons in five groups.

  9. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan


    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  10. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Maya Safira Dewi


    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  11. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján


    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  12. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S


    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  13. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    Agba, Dabo Salif Ignace


    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  14. Hybrid spectral CT reconstruction.

    Darin P Clark

    Full Text Available Current photon counting x-ray detector (PCD technology faces limitations associated with spectral fidelity and photon starvation. One strategy for addressing these limitations is to supplement PCD data with high-resolution, low-noise data acquired with an energy-integrating detector (EID. In this work, we propose an iterative, hybrid reconstruction technique which combines the spectral properties of PCD data with the resolution and signal-to-noise characteristics of EID data. Our hybrid reconstruction technique is based on an algebraic model of data fidelity which substitutes the EID data into the data fidelity term associated with the PCD reconstruction, resulting in a joint reconstruction problem. Within the split Bregman framework, these data fidelity constraints are minimized subject to additional constraints on spectral rank and on joint intensity-gradient sparsity measured between the reconstructions of the EID and PCD data. Following a derivation of the proposed technique, we apply it to the reconstruction of a digital phantom which contains realistic concentrations of iodine, barium, and calcium encountered in small-animal micro-CT. The results of this experiment suggest reliable separation and detection of iodine at concentrations ≥ 5 mg/ml and barium at concentrations ≥ 10 mg/ml in 2-mm features for EID and PCD data reconstructed with inherent spatial resolutions of 176 μm and 254 μm, respectively (point spread function, FWHM. Furthermore, hybrid reconstruction is demonstrated to enhance spatial resolution within material decomposition results and to improve low-contrast detectability by as much as 2.6 times relative to reconstruction with PCD data only. The parameters of the simulation experiment are based on an in vivo micro-CT experiment conducted in a mouse model of soft-tissue sarcoma. Material decomposition results produced from this in vivo data demonstrate the feasibility of distinguishing two K-edge contrast agents with

  15. Hybrid spectral CT reconstruction

    Clark, Darin P.


    Current photon counting x-ray detector (PCD) technology faces limitations associated with spectral fidelity and photon starvation. One strategy for addressing these limitations is to supplement PCD data with high-resolution, low-noise data acquired with an energy-integrating detector (EID). In this work, we propose an iterative, hybrid reconstruction technique which combines the spectral properties of PCD data with the resolution and signal-to-noise characteristics of EID data. Our hybrid reconstruction technique is based on an algebraic model of data fidelity which substitutes the EID data into the data fidelity term associated with the PCD reconstruction, resulting in a joint reconstruction problem. Within the split Bregman framework, these data fidelity constraints are minimized subject to additional constraints on spectral rank and on joint intensity-gradient sparsity measured between the reconstructions of the EID and PCD data. Following a derivation of the proposed technique, we apply it to the reconstruction of a digital phantom which contains realistic concentrations of iodine, barium, and calcium encountered in small-animal micro-CT. The results of this experiment suggest reliable separation and detection of iodine at concentrations ≥ 5 mg/ml and barium at concentrations ≥ 10 mg/ml in 2-mm features for EID and PCD data reconstructed with inherent spatial resolutions of 176 μm and 254 μm, respectively (point spread function, FWHM). Furthermore, hybrid reconstruction is demonstrated to enhance spatial resolution within material decomposition results and to improve low-contrast detectability by as much as 2.6 times relative to reconstruction with PCD data only. The parameters of the simulation experiment are based on an in vivo micro-CT experiment conducted in a mouse model of soft-tissue sarcoma. Material decomposition results produced from this in vivo data demonstrate the feasibility of distinguishing two K-edge contrast agents with a spectral

  16. Implant breast reconstruction after salvage mastectomy in previously irradiated patients.

    Persichetti, Paolo; Cagli, Barbara; Simone, Pierfranco; Cogliandro, Annalisa; Fortunato, Lucio; Altomare, Vittorio; Trodella, Lucio


    The most common surgical approach in case of local tumor recurrence after quadrantectomy and radiotherapy is salvage mastectomy. Breast reconstruction is the subsequent phase of the treatment and the plastic surgeon has to operate on previously irradiated and manipulated tissues. The medical literature highlights that breast reconstruction with tissue expanders is not a pursuable option, considering previous radiotherapy a contraindication. The purpose of this retrospective study is to evaluate the influence of previous radiotherapy on 2-stage breast reconstruction (tissue expander/implant). Only patients with analogous timing of radiation therapy and the same demolitive and reconstructive procedures were recruited. The results of this study prove that, after salvage mastectomy in previously irradiated patients, implant reconstruction is still possible. Further comparative studies are, of course, advisable to draw any conclusion on the possibility to perform implant reconstruction in previously irradiated patients.

  17. Effective deep learning training for single-image super-resolution in endomicroscopy exploiting video-registration-based reconstruction.

    Ravì, Daniele; Szczotka, Agnieszka Barbara; Shakir, Dzhoshkun Ismail; Pereira, Stephen P; Vercauteren, Tom


    Probe-based confocal laser endomicroscopy (pCLE) is a recent imaging modality that allows performing in vivo optical biopsies. The design of pCLE hardware, and its reliance on an optical fibre bundle, fundamentally limits the image quality with a few tens of thousands fibres, each acting as the equivalent of a single-pixel detector, assembled into a single fibre bundle. Video registration techniques can be used to estimate high-resolution (HR) images by exploiting the temporal information contained in a sequence of low-resolution (LR) images. However, the alignment of LR frames, required for the fusion, is computationally demanding and prone to artefacts. In this work, we propose a novel synthetic data generation approach to train exemplar-based Deep Neural Networks (DNNs). HR pCLE images with enhanced quality are recovered by the models trained on pairs of estimated HR images (generated by the video registration algorithm) and realistic synthetic LR images. Performance of three different state-of-the-art DNNs techniques were analysed on a Smart Atlas database of 8806 images from 238 pCLE video sequences. The results were validated through an extensive image quality assessment that takes into account different quality scores, including a Mean Opinion Score (MOS). Results indicate that the proposed solution produces an effective improvement in the quality of the obtained reconstructed image. The proposed training strategy and associated DNNs allows us to perform convincing super-resolution of pCLE images.

  18. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Vanessa de Farias


    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  19. Overview of image reconstruction

    Marr, R.B.


    Image reconstruction (or computerized tomography, etc.) is any process whereby a function, f, on R/sup n/ is estimated from empirical data pertaining to its integrals, ∫f(x) dx, for some collection of hyperplanes of dimension k < n. The paper begins with background information on how image reconstruction problems have arisen in practice, and describes some of the application areas of past or current interest; these include radioastronomy, optics, radiology and nuclear medicine, electron microscopy, acoustical imaging, geophysical tomography, nondestructive testing, and NMR zeugmatography. Then the various reconstruction algorithms are discussed in five classes: summation, or simple back-projection; convolution, or filtered back-projection; Fourier and other functional transforms; orthogonal function series expansion; and iterative methods. Certain more technical mathematical aspects of image reconstruction are considered from the standpoint of uniqueness, consistency, and stability of solution. The paper concludes by presenting certain open problems. 73 references

  20. The evolving breast reconstruction

    Thomsen, Jørn Bo; Gunnarsson, Gudjon Leifur


    The aim of this editorial is to give an update on the use of the propeller thoracodorsal artery perforator flap (TAP/TDAP-flap) within the field of breast reconstruction. The TAP-flap can be dissected by a combined use of a monopolar cautery and a scalpel. Microsurgical instruments are generally...... not needed. The propeller TAP-flap can be designed in different ways, three of these have been published: (I) an oblique upwards design; (II) a horizontal design; (III) an oblique downward design. The latissimus dorsi-flap is a good and reliable option for breast reconstruction, but has been criticized...... for oncoplastic and reconstructive breast surgery and will certainly become an invaluable addition to breast reconstructive methods....

  1. Forging Provincial Reconstruction Teams

    Honore, Russel L; Boslego, David V


    The Provincial Reconstruction Team (PRT) training mission completed by First U.S. Army in April 2006 was a joint Service effort to meet a requirement from the combatant commander to support goals in Afghanistan...

  2. Breast Reconstruction with Implants

    ... your surgical options and discuss the advantages and disadvantages of implant-based reconstruction, and may show you ... Policy Notice of Privacy Practices Notice of Nondiscrimination Advertising Mayo Clinic is a not-for-profit organization ...

  3. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos


    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  4. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.


    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  5. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    Vallejo Delgado, L.R.


    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  6. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Košťál Michal


    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  7. Patterns of Local Recurrence and Dose Fractionation of Adjuvant Radiation Therapy in 462 Patients With Soft Tissue Sarcoma of Extremity and Trunk Wall

    Jebsen, Nina L., E-mail: [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Engellau, Jacob [Department of Oncology, Skåne University Hospital, Lund (Sweden); Engström, Katarina [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Bauer, Henrik C. [Department of Molecular Medicine and Surgery, Section for Orthopaedics and Sports Medicine, Karolinska University Hospital, Karolinska Institute, Stockholm (Sweden); Monge, Odd R. [Department of Oncology, Haukeland University Hospital, Bergen (Norway); Muren, Ludvig P. [Department of Physics and Technology, University of Bergen, Bergen (Norway); Department of Medical Physics, Aarhus University and Aarhus University Hospital, Aarhus (Denmark); Eide, Geir E. [Centre for Clinical Research, Haukeland University Hospital, Bergen (Norway); Department of Public Health and Primary Health Care, University of Bergen, Bergen (Norway); Trovik, Clement S. [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Bruland, Øyvind S. [Department of Oncology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway)


    Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma.

  8. Patterns of Local Recurrence and Dose Fractionation of Adjuvant Radiation Therapy in 462 Patients With Soft Tissue Sarcoma of Extremity and Trunk Wall

    Jebsen, Nina L.; Engellau, Jacob; Engström, Katarina; Bauer, Henrik C.; Monge, Odd R.; Muren, Ludvig P.; Eide, Geir E.; Trovik, Clement S.; Bruland, Øyvind S.


    Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma

  9. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Julin Yuan


    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  10. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi


    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  11. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    Jacobs, Loraine Cristina do Valle


    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  12. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T


    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  13. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam


    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  14. A Novel Nipple Reconstruction Technique for Maintaining Nipple Projection: The Boomerang Flap.

    Kim, Young-Eun; Hong, Ki Yong; Minn, Kyung Won; Jin, Ung Sik


    Nipple-areolar complex (NAC) reconstruction is the final step in the long journey of breast reconstruction for mastectomy patients. Successful NAC reconstruction depends on the use of appropriate surgical techniques that are simple and reliable. To date, numerous techniques have been used for nipple reconstruction, including contralateral nipple sharing and various local flaps. Recently, it has been common to utilize local flaps. However, the most common nipple reconstruction problem encountered with local flaps is the loss of nipple projection; there can be approximately 50% projection loss in reconstructed nipples over long-term follow-up. Several factors might contribute to nipple projection loss, and we tried to overcome these factors by performing nipple reconstructions using a boomerang flap technique, which is a modified C-V flap that utilizes the previous mastectomy scar to maintain long-term nipple projection.

  15. A Novel Nipple Reconstruction Technique for Maintaining Nipple Projection: The Boomerang Flap

    Young-Eun Kim


    Full Text Available Nipple-areolar complex (NAC reconstruction is the final step in the long journey of breast reconstruction for mastectomy patients. Successful NAC reconstruction depends on the use of appropriate surgical techniques that are simple and reliable. To date, numerous techniques have been used for nipple reconstruction, including contralateral nipple sharing and various local flaps. Recently, it has been common to utilize local flaps. However, the most common nipple reconstruction problem encountered with local flaps is the loss of nipple projection; there can be approximately 50% projection loss in reconstructed nipples over long-term follow-up. Several factors might contribute to nipple projection loss, and we tried to overcome these factors by performing nipple reconstructions using a boomerang flap technique, which is a modified C–V flap that utilizes the previous mastectomy scar to maintain long-term nipple projection.

  16. Planning Target Margin Calculations for Prostate Radiotherapy Based on Intrafraction and Interfraction Motion Using Four Localization Methods

    Beltran, Chris; Herman, Michael G.; Davis, Brian J.


    Purpose: To determine planning target volume (PTV) margins for prostate radiotherapy based on the internal margin (IM) (intrafractional motion) and the setup margin (SM) (interfractional motion) for four daily localization methods: skin marks (tattoo), pelvic bony anatomy (bone), intraprostatic gold seeds using a 5-mm action threshold, and using no threshold. Methods and Materials: Forty prostate cancer patients were treated with external radiotherapy according to an online localization protocol using four intraprostatic gold seeds and electronic portal images (EPIs). Daily localization and treatment EPIs were obtained. These data allowed inter- and intrafractional analysis of prostate motion. The SM for the four daily localization methods and the IM were determined. Results: A total of 1532 fractions were analyzed. Tattoo localization requires a SM of 6.8 mm left-right (LR), 7.2 mm inferior-superior (IS), and 9.8 mm anterior-posterior (AP). Bone localization requires 3.1, 8.9, and 10.7 mm, respectively. The 5-mm threshold localization requires 4.0, 3.9, and 3.7 mm. No threshold localization requires 3.4, 3.2, and 3.2 mm. The intrafractional prostate motion requires an IM of 2.4 mm LR, 3.4 mm IS and AP. The PTV margin using the 5-mm threshold, including interobserver uncertainty, IM, and SM, is 4.8 mm LR, 5.4 mm IS, and 5.2 mm AP. Conclusions: Localization based on EPI with implanted gold seeds allows a large PTV margin reduction when compared with tattoo localization. Except for the LR direction, bony anatomy localization does not decrease the margins compared with tattoo localization. Intrafractional prostate motion is a limiting factor on margin reduction

  17. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid


    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Reconstructive options in pelvic tumours

    Mayilvahanan N


    Full Text Available Background: Pelvic tumours present a complex problem. It is difficult to choose between limb salvage and hemipelvectomy. Method: Forty three patients of tumours of pelvis underwent limb salvage resection with reconstruction in 32 patients. The majority were chondrosarcomas (20 cases followed by Ewing sarcoma. Stage II B was the most common stage in malignant lesions and all the seven benign lesions were aggressive (B3. Surgical margins achieved were wide in 31 and marginal in 12 cases. Ilium was involved in 51% of cases and periacetabular involvement was seen in 12 patients. The resections done were mostly of types I &II of Enneking′s classification of pelvic resection. Arthrodesis was attempted in 24 patients. Customized Saddle prosthesis was used in seven patients and no reconstruction in 12 patients. Adjuvant chemotherapy was given to all high-grade malignant tumours, combined with radiotherapy in 7 patients. Results: With a mean follow up of 48.5 months and one patient lost to follow up, the recurrence rate among the evaluated cases was 16.6%. Oncologically, 30 patients were continuously disease free with 7 local recurrences and 4 deaths due to disseminated disease and 2 patients died of other causes. During the initial years, satisfactory functional results were achieved with prosthetic replacement. Long-term functional result of 36 patients who were alive at the time of latest follow up was satisfactory in 75% who underwent arthrodesis and in those where no reconstruction was used. We also describe a method of new classification of pelvic resections that clarifies certain shortcomings of the previous systems of classification. Conclusion: Selection of a procedure depends largely on the patient factors, the tumour grade, the resultant defect and the tissue factors. Resection with proper margins gives better functional and oncological results

  19. Integration of a Radiosensitivity Molecular Signature Into the Assessment of Local Recurrence Risk in Breast Cancer

    Torres-Roca, Javier F.; Fulp, William J.; Caudell, Jimmy J.; Servant, Nicolas; Bollet, Marc A.; Vijver, Marc van de; Naghavi, Arash O.; Harris, Eleanor E.; Eschrich, Steven A.


    Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and

  20. Integration of a Radiosensitivity Molecular Signature Into the Assessment of Local Recurrence Risk in Breast Cancer

    Torres-Roca, Javier F., E-mail: [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Department of Chemical Biology and Molecular Medicine, Moffitt Cancer Center, Tampa, Florida (United States); Fulp, William J. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States); Department of Biostatistics, Moffitt Cancer Center, Tampa, Florida (United States); Caudell, Jimmy J. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Servant, Nicolas [Institut Curie, INSERM U900, Paris (France); Mines ParisTech, Paris (France); Bollet, Marc A. [Institut Curie, INSERM U900, Paris (France); Vijver, Marc van de [Netherlands Cancer Institute, Amsterdam (Netherlands); Naghavi, Arash O. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Harris, Eleanor E. [East Carolina University, Greensborough, North Carolina (United States); Eschrich, Steven A. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States)


    Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and

  1. Reconstruction of the midface and maxilla.

    Dalgorf, Dustin; Higgins, Kevin


    To review the current classification systems and reconstructive options available for restoration of maxillectomy defects. Defects involving the midface can have a great functional and aesthetic impact on the patient. Adequate restoration of the complex three-dimensional maxillary structure is required to replace form and function of the native tissue. An in-depth discussion of appropriate recipient vessel selection and reconstructive options are included in this article. The superficial temporal vessel system is presented as a reliable anastomosis site for restoration of midfacial defects. In addition, the complications of vein grafting, arteriovenous fistula loops and alternative recipient vessels sites are addressed to manage the challenge of the vessel-depleted neck. The current indications, advantages and disadvantages of local, regional and free-flap reconstructive options available for maxillectomy defects are highlighted in order to aid the surgeon in appropriate flap selection. A myriad of reconstructive options are available to restore maxillectomy defects. The surgeon must consider each defect and the needs of the individual patient when choosing the best suited reconstructive technique.

  2. Stochastic Optical Reconstruction Microscopy (STORM).

    Xu, Jianquan; Ma, Hongqiang; Liu, Yang


    Super-resolution (SR) fluorescence microscopy, a class of optical microscopy techniques at a spatial resolution below the diffraction limit, has revolutionized the way we study biology, as recognized by the Nobel Prize in Chemistry in 2014. Stochastic optical reconstruction microscopy (STORM), a widely used SR technique, is based on the principle of single molecule localization. STORM routinely achieves a spatial resolution of 20 to 30 nm, a ten-fold improvement compared to conventional optical microscopy. Among all SR techniques, STORM offers a high spatial resolution with simple optical instrumentation and standard organic fluorescent dyes, but it is also prone to image artifacts and degraded image resolution due to improper sample preparation or imaging conditions. It requires careful optimization of all three aspects-sample preparation, image acquisition, and image reconstruction-to ensure a high-quality STORM image, which will be extensively discussed in this unit. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  3. Industrial dynamic tomographic reconstruction

    Oliveira, Eric Ferreira de


    The state of the art methods applied to industrial processes is currently based on the principles of classical tomographic reconstructions developed for tomographic patterns of static distributions, or is limited to cases of low variability of the density distribution function of the tomographed object. Noise and motion artifacts are the main problems caused by a mismatch in the data from views acquired in different instants. All of these add to the known fact that using a limited amount of data can result in the presence of noise, artifacts and some inconsistencies with the distribution under study. One of the objectives of the present work is to discuss the difficulties that arise from implementing reconstruction algorithms in dynamic tomography that were originally developed for static distributions. Another objective is to propose solutions that aim at reducing a temporal type of information loss caused by employing regular acquisition systems to dynamic processes. With respect to dynamic image reconstruction it was conducted a comparison between different static reconstruction methods, like MART and FBP, when used for dynamic scenarios. This comparison was based on a MCNPx simulation as well as an analytical setup of an aluminum cylinder that moves along the section of a riser during the process of acquisition, and also based on cross section images from CFD techniques. As for the adaptation of current tomographic acquisition systems for dynamic processes, this work established a sequence of tomographic views in a just-in-time fashion for visualization purposes, a form of visually disposing density information as soon as it becomes amenable to image reconstruction. A third contribution was to take advantage of the triple color channel necessary to display colored images in most displays, so that, by appropriately scaling the acquired values of each view in the linear system of the reconstruction, it was possible to imprint a temporal trace into the regularly

  4. Alternative reconstruction after pancreaticoduodenectomy

    Cooperman Avram M


    Full Text Available Abstract Background Pancreaticoduodenectomy is the procedure of choice for tumors of the head of the pancreas and periampulla. Despite advances in surgical technique and postoperative care, the procedure continues to carry a high morbidity rate. One of the most common morbidities is delayed gastric emptying with rates of 15%–40%. Following two prolonged cases of delayed gastric emptying, we altered our reconstruction to avoid this complication altogether. Subsequently, our patients underwent a classic pancreaticoduodenectomy with an undivided Roux-en-Y technique for reconstruction. Methods We reviewed the charts of our last 13 Whipple procedures evaluating them for complications, specifically delayed gastric emptying. We compared the outcomes of those patients to a control group of 15 patients who underwent the Whipple procedure with standard reconstruction. Results No instances of delayed gastric emptying occurred in patients who underwent an undivided Roux-en-Y technique for reconstruction. There was 1 wound infection (8%, 1 instance of pneumonia (8%, and 1 instance of bleeding from the gastrojejunal staple line (8%. There was no operative mortality. Conclusion Use of the undivided Roux-en-Y technique for reconstruction following the Whipple procedure may decrease the incidence of delayed gastric emptying. In addition, it has the added benefit of eliminating bile reflux gastritis. Future randomized control trials are recommended to further evaluate the efficacy of the procedure.

  5. SU-D-206-03: Segmentation Assisted Fast Iterative Reconstruction Method for Cone-Beam CT

    Wu, P; Mao, T; Gong, S; Wang, J; Niu, T; Sheng, K; Xie, Y


    Purpose: Total Variation (TV) based iterative reconstruction (IR) methods enable accurate CT image reconstruction from low-dose measurements with sparse projection acquisition, due to the sparsifiable feature of most CT images using gradient operator. However, conventional solutions require large amount of iterations to generate a decent reconstructed image. One major reason is that the expected piecewise constant property is not taken into consideration at the optimization starting point. In this work, we propose an iterative reconstruction method for cone-beam CT (CBCT) using image segmentation to guide the optimization path more efficiently on the regularization term at the beginning of the optimization trajectory. Methods: Our method applies general knowledge that one tissue component in the CT image contains relatively uniform distribution of CT number. This general knowledge is incorporated into the proposed reconstruction using image segmentation technique to generate the piecewise constant template on the first-pass low-quality CT image reconstructed using analytical algorithm. The template image is applied as an initial value into the optimization process. Results: The proposed method is evaluated on the Shepp-Logan phantom of low and high noise levels, and a head patient. The number of iterations is reduced by overall 40%. Moreover, our proposed method tends to generate a smoother reconstructed image with the same TV value. Conclusion: We propose a computationally efficient iterative reconstruction method for CBCT imaging. Our method achieves a better optimization trajectory and a faster convergence behavior. It does not rely on prior information and can be readily incorporated into existing iterative reconstruction framework. Our method is thus practical and attractive as a general solution to CBCT iterative reconstruction. This work is supported by the Zhejiang Provincial Natural Science Foundation of China (Grant No. LR16F010001), National High-tech R

  6. SU-D-206-03: Segmentation Assisted Fast Iterative Reconstruction Method for Cone-Beam CT

    Wu, P; Mao, T; Gong, S; Wang, J; Niu, T [Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Institute of Translational Medicine, Zhejiang University, Hangzhou, Zhejiang (China); Sheng, K [Department of Radiation Oncology, University of California, Los Angeles, Los Angeles, CA (United States); Xie, Y [Institute of Biomedical and Health Engineering, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, Guangdong (China)


    Purpose: Total Variation (TV) based iterative reconstruction (IR) methods enable accurate CT image reconstruction from low-dose measurements with sparse projection acquisition, due to the sparsifiable feature of most CT images using gradient operator. However, conventional solutions require large amount of iterations to generate a decent reconstructed image. One major reason is that the expected piecewise constant property is not taken into consideration at the optimization starting point. In this work, we propose an iterative reconstruction method for cone-beam CT (CBCT) using image segmentation to guide the optimization path more efficiently on the regularization term at the beginning of the optimization trajectory. Methods: Our method applies general knowledge that one tissue component in the CT image contains relatively uniform distribution of CT number. This general knowledge is incorporated into the proposed reconstruction using image segmentation technique to generate the piecewise constant template on the first-pass low-quality CT image reconstructed using analytical algorithm. The template image is applied as an initial value into the optimization process. Results: The proposed method is evaluated on the Shepp-Logan phantom of low and high noise levels, and a head patient. The number of iterations is reduced by overall 40%. Moreover, our proposed method tends to generate a smoother reconstructed image with the same TV value. Conclusion: We propose a computationally efficient iterative reconstruction method for CBCT imaging. Our method achieves a better optimization trajectory and a faster convergence behavior. It does not rely on prior information and can be readily incorporated into existing iterative reconstruction framework. Our method is thus practical and attractive as a general solution to CBCT iterative reconstruction. This work is supported by the Zhejiang Provincial Natural Science Foundation of China (Grant No. LR16F010001), National High-tech R

  7. Reconstructing random media

    Yeong, C.L.; Torquato, S.


    We formulate a procedure to reconstruct the structure of general random heterogeneous media from limited morphological information by extending the methodology of Rintoul and Torquato [J. Colloid Interface Sci. 186, 467 (1997)] developed for dispersions. The procedure has the advantages that it is simple to implement and generally applicable to multidimensional, multiphase, and anisotropic structures. Furthermore, an extremely useful feature is that it can incorporate any type and number of correlation functions in order to provide as much morphological information as is necessary for accurate reconstruction. We consider a variety of one- and two-dimensional reconstructions, including periodic and random arrays of rods, various distribution of disks, Debye random media, and a Fontainebleau sandstone sample. We also use our algorithm to construct heterogeneous media from specified hypothetical correlation functions, including an exponentially damped, oscillating function as well as physically unrealizable ones. copyright 1998 The American Physical Society

  8. Delayed breast implant reconstruction

    Hvilsom, Gitte B.; Hölmich, Lisbet R.; Steding-Jessen, Marianne


    We evaluated the association between radiation therapy and severe capsular contracture or reoperation after 717 delayed breast implant reconstruction procedures (288 1- and 429 2-stage procedures) identified in the prospective database of the Danish Registry for Plastic Surgery of the Breast during...... of radiation therapy was associated with a non-significantly increased risk of reoperation after both 1-stage (HR = 1.4; 95% CI: 0.7-2.5) and 2-stage (HR = 1.6; 95% CI: 0.9-3.1) procedures. Reconstruction failure was highest (13.2%) in the 2-stage procedures with a history of radiation therapy. Breast...... reconstruction approaches other than implants should be seriously considered among women who have received radiation therapy....


    A. N. Svetashov


    Full Text Available To detect the most appropriate to heel bone injury severity variants of reconstructive osteosynthesis it was analyzed treatment results of 56 patients. In 15 (26.8% patients classic methods of surgical service were applied, in 41 (73.2% cases to restore the defect porous implants were used. Osteosynthesis without heel bone plastic restoration accomplishment was ineffective in 60% patients from control group. Reconstructive osteosynthesis method ensures long-term good functional effect of rehabilitation in 96.4% patients from the basic group.

  10. Vertex reconstruction in CMS

    Chabanat, E.; D'Hondt, J.; Estre, N.; Fruehwirth, R.; Prokofiev, K.; Speer, T.; Vanlaer, P.; Waltenberger, W.


    Due to the high track multiplicity in the final states expected in proton collisions at the LHC experiments, novel vertex reconstruction algorithms are required. The vertex reconstruction problem can be decomposed into a pattern recognition problem ('vertex finding') and an estimation problem ('vertex fitting'). Starting from least-squares methods, robustifications of the classical algorithms are discussed and the statistical properties of the novel methods are shown. A whole set of different approaches for the vertex finding problem is presented and compared in relevant physics channels

  11. Vertex Reconstruction in CMS

    Chabanat, E; D'Hondt, J; Vanlaer, P; Prokofiev, K; Speer, T; Frühwirth, R; Waltenberger, W


    Because of the high track multiplicity in the final states expected in proton collisions at the LHC experiments, novel vertex reconstruction algorithms are required. The vertex reconstruction problem can be decomposed into a pattern recognition problem ("vertex finding") and an estimation problem ("vertex fitting"). Starting from least-square methods, ways to render the classical algorithms more robust are discussed and the statistical properties of the novel methods are shown. A whole set of different approaches for the vertex finding problem is presented and compared in relevant physics channels.

  12. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna


    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  13. [Red lip defects. Reconstructive techniques and indications].

    Simon, E; Stricker, M; Duroure, F


    The attractive color of the red lip must be the object of very meticulous reconstruction in their form and pigmentation. This can be done only by using the buccal mucosa. The graf is less indicated. There are multiple local flaps that have been proposed using the same lip, the jugal mucosa and the tongue. The authors will show the principal procedures found in the literature.

  14. Detector independent cellular automaton algorithm for track reconstruction

    Kisel, Ivan; Kulakov, Igor; Zyzak, Maksym [Goethe Univ. Frankfurt am Main (Germany); Frankfurt Institute for Advanced Studies, Frankfurt am Main (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH (Germany); Collaboration: CBM-Collaboration


    Track reconstruction is one of the most challenging problems of data analysis in modern high energy physics (HEP) experiments, which have to process per second of the order of 10{sup 7} events with high track multiplicity and density, registered by detectors of different types and, in many cases, located in non-homogeneous magnetic field. Creation of reconstruction package common for all experiments is considered to be important in order to consolidate efforts. The cellular automaton (CA) track reconstruction approach has been used successfully in many HEP experiments. It is very simple, efficient, local and parallel. Meanwhile it is intrinsically independent of detector geometry and good candidate for common track reconstruction. The CA implementation for the CBM experiment has been generalized and applied to the ALICE ITS and STAR HFT detectors. Tests with simulated collisions have been performed. The track reconstruction efficiencies are at the level of 95% for majority of the signal tracks for all detectors.

  15. Postoperative radiotherapy improves local control and survival in patients with uterine leiomyosarcoma

    Wong, Philip; Han, Kathy; Sykes, Jenna; Catton, Charles; Laframboise, Stephane; Fyles, Anthony; Manchul, Lee; Levin, Wilfred; Milosevic, Michael


    To examine the role of radiotherapy (RT) in uterine leiomyosarcomas (LMS) and to determine the patient population who may benefit from RT. From 1998–2008, 69 patients with primary uterine LMS underwent hysterectomy with or without pelvic radiotherapy to a median dose of 45 Gy. Univariate analysis was performed using the Kaplan-Meier method and cumulative-incidence function, and multivariate analyses using Fine and Gray or Cox proportional hazard models. Following surgery, 32 out of 69 patients received RT. There was no evidence of any correlation between patient, disease and treatment characteristics and the use of RT. Median follow-up was 57 months. RT was associated with reduced local recurrence (3y LR 19% vs. 39%; Gray’s p = 0.019) and improved overall survival (3y OS 69% vs. 35%; log-rank p = 0.025) on univariate analysis. Multivariate analysis demonstrated that RT reduced LR (HR: 0.28, CI: 0.11-0.69, p = 0.006) and increased OS (HR: 0.44, CI: 0.23-0.85, p = 0.014) independent of other clinical and pathologic factors. Positive surgical margins increased the odds of LR (HR: 5.6, CI: 2.3-13.4, p = 0.00012). Large tumor size and advanced stage (II-IV) were associated with the development of distant metastases and inferior OS. Postoperative pelvic RT reduces LR and improves OS of patients with uterine LMS

  16. Reconstructing Neutrino Mass Spectrum

    Smirnov, A. Yu.


    Reconstruction of the neutrino mass spectrum and lepton mixing is one of the fundamental problems of particle physics. In this connection we consider two central topics: (i) the origin of large lepton mixing, (ii) possible existence of new (sterile) neutrino states. We discuss also possible relation between large mixing and existence of sterile neutrinos.

  17. Position reconstruction in LUX

    Akerib, D. S.; Alsum, S.; Araújo, H. M.; Bai, X.; Bailey, A. J.; Balajthy, J.; Beltrame, P.; Bernard, E. P.; Bernstein, A.; Biesiadzinski, T. P.; Boulton, E. M.; Brás, P.; Byram, D.; Cahn, S. B.; Carmona-Benitez, M. C.; Chan, C.; Currie, A.; Cutter, J. E.; Davison, T. J. R.; Dobi, A.; Druszkiewicz, E.; Edwards, B. N.; Fallon, S. R.; Fan, A.; Fiorucci, S.; Gaitskell, R. J.; Genovesi, J.; Ghag, C.; Gilchriese, M. G. D.; Hall, C. R.; Hanhardt, M.; Haselschwardt, S. J.; Hertel, S. A.; Hogan, D. P.; Horn, M.; Huang, D. Q.; Ignarra, C. M.; Jacobsen, R. G.; Ji, W.; Kamdin, K.; Kazkaz, K.; Khaitan, D.; Knoche, R.; Larsen, N. A.; Lenardo, B. G.; Lesko, K. T.; Lindote, A.; Lopes, M. I.; Manalaysay, A.; Mannino, R. L.; Marzioni, M. F.; McKinsey, D. N.; Mei, D.-M.; Mock, J.; Moongweluwan, M.; Morad, J. A.; Murphy, A. St. J.; Nehrkorn, C.; Nelson, H. N.; Neves, F.; O'Sullivan, K.; Oliver-Mallory, K. C.; Palladino, K. J.; Pease, E. K.; Rhyne, C.; Shaw, S.; Shutt, T. A.; Silva, C.; Solmaz, M.; Solovov, V. N.; Sorensen, P.; Sumner, T. J.; Szydagis, M.; Taylor, D. J.; Taylor, W. C.; Tennyson, B. P.; Terman, P. A.; Tiedt, D. R.; To, W. H.; Tripathi, M.; Tvrznikova, L.; Uvarov, S.; Velan, V.; Verbus, J. R.; Webb, R. C.; White, J. T.; Whitis, T. J.; Witherell, M. S.; Wolfs, F. L. H.; Xu, J.; Yazdani, K.; Young, S. K.; Zhang, C.


    The (x, y) position reconstruction method used in the analysis of the complete exposure of the Large Underground Xenon (LUX) experiment is presented. The algorithm is based on a statistical test that makes use of an iterative method to recover the photomultiplier tube (PMT) light response directly from the calibration data. The light response functions make use of a two dimensional functional form to account for the photons reflected on the inner walls of the detector. To increase the resolution for small pulses, a photon counting technique was employed to describe the response of the PMTs. The reconstruction was assessed with calibration data including 83mKr (releasing a total energy of 41.5 keV) and 3H (β- with Q = 18.6 keV) decays, and a deuterium-deuterium (D-D) neutron beam (2.45 MeV) . Within the detector's fiducial volume, the reconstruction has achieved an (x, y) position uncertainty of σ = 0.82 cm and σ = 0.17 cm for events of only 200 and 4,000 detected electroluminescence photons respectively. Such signals are associated with electron recoils of energies ~0.25 keV and ~10 keV, respectively. The reconstructed position of the smallest events with a single electron emitted from the liquid surface (22 detected photons) has a horizontal (x, y) uncertainty of 2.13 cm.

  18. Unit Advancement Flap for Lower Lip Reconstruction.

    Ogino, Akihiro; Onishi, Kiyoshi; Okada, Emi; Nakamichi, Miho


    Lower lip reconstruction requires consideration of esthetic and functional outcome in selecting a surgical procedure, and reconstruction with local tissue is useful. The authors reconstructed full-thickness defects with a unit advancement flap. Reconstruction was performed using this method in 4 patients with lower lip squamous cell carcinoma in whom tumor resection with preservation of the mouth angle was possible. The lower lip resection width was 30 to 45 mm, accounting for 50% to 68% of the entire width of the lower lip. The flap was prepared by lateral extension from above the mental unit and matched with the potential wrinkle line of the lower lip in order to design a unit morphology surrounded by the anterior margin of the depressor labii inferioris muscle. It was elevated as a full-thickness flap composed of the orbicularis oris muscle, skin, and mucosa of the residual lower lip from the bilateral sides, and advanced to the defect. Flap transfer was adjusted by small triangular resection of the skin on the lateral side of the mental unit. The postoperative scar was inconspicuous in all patients and there was no impairment of the mouth opening-closing or articulation functions. This was a relatively simple surgical procedure. A blood supply of the flap was stable, and continuity of the orbicularis oris muscle was reconstructed by transferred the residual lower lip advancement flap from the bilateral sides. The postoperative mouth opening-closing function was sufficient, and dentures could be placed from an early phase in elderly patients. The postoperative scar was consistent with the lip unit morphology, being esthetically superior. This procedure may be applicable for reconstruction of defects approximately 1/3 to 2/3 the width of the lower lip where the mouth angle is preserved.

  19. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Augusto Etchegaray


    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  20. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    Oberholster, Paul J


    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  1. Predictive factors of local-regional recurrences following parotid sparing intensity modulated or 3D conformal radiotherapy for head and neck cancer

    Feng, Mary; Jabbari, Siavash; Lin, Alexander; Bradford, Carol R.; Chepeha, Douglas B.; Teknos, Theodoros N.; Worden, Francis P.; Tsien, Christina; Schipper, Matthew J.; Wolf, Gregory T.; Dawson, Laura A.; Eisbruch, Avraham


    Background and purpose: Predictive factors for local-regional (LR) failures after parotid-sparing, Intensity modulated (IMRT) or 3D conformal radiotherapy for head and neck (HN) cancers were assessed. Patients and methods: One hundred and fifty-eight patients with mostly stages III-IV HN squamous cell carcinoma underwent curative bilateral neck irradiation aimed at sparing the parotid glands. Patient, tumor, and treatment factors were analyzed as predictive factors for LR failure. Results: Twenty-three patients had LR recurrence (19 in-field and four marginal). No differences were found in the doses delivered to the PTVs of patients with or without in-field recurrences. In univariate analysis, tumor site was highly predictive for LR failure in both postoperative and definitive RT patients. In postoperative RT patients, pathologic tumor size, margin status, extracapsular extension (ECE) and number of lymph node metastases, were also significantly predictive. Multivariate analysis showed tumor site (oropharynx vs. other sites) to be a significant predictor in all patients, and involved margins and number of involved lymph nodes in postoperative patients. Conclusions: Clinical rather than dosimetric factors predicted for LR failures in this series, and were similar to those reported following standard RT. These factors may aid in the selection of patients for studies of treatment intensification using IMRT

  2. Biologic Collagen Cylinder with Skate Flap Technique for Nipple Reconstruction

    Brian P. Tierney


    Full Text Available A surgical technique using local tissue skate flaps combined with cylinders made from a naturally derived biomaterial has been used effectively for nipple reconstruction. A retrospective review of patients who underwent nipple reconstruction using this technique was performed. Comorbidities and type of breast reconstruction were collected. Outcome evaluation included complications, surgical revisions, and nipple projection. There were 115 skate flap reconstructions performed in 83 patients between July 2009 and January 2013. Patients ranged from 32 to 73 years old. Average body mass index was 28.0. The most common comorbidities were hypertension (39.8% and smoking (16.9%. After breast reconstruction, 68.7% of the patients underwent chemotherapy and 20.5% underwent radiation. Seventy-one patients had immediate breast reconstruction with expanders and 12 had delayed reconstruction. The only reported complications were extrusions (3.5%. Six nipples (5.2% in 5 patients required surgical revision due to loss of projection; two patients had minor loss of projection but did not require surgical revision. Nipple projection at time of surgery ranged from 6 to 7 mm and average projection at 6 months was 3–5 mm. A surgical technique for nipple reconstruction using a skate flap with a graft material is described. Complications are infrequent and short-term projection measurements are encouraging.

  3. Biologic collagen cylinder with skate flap technique for nipple reconstruction.

    Tierney, Brian P; Hodde, Jason P; Changkuon, Daniela I


    A surgical technique using local tissue skate flaps combined with cylinders made from a naturally derived biomaterial has been used effectively for nipple reconstruction. A retrospective review of patients who underwent nipple reconstruction using this technique was performed. Comorbidities and type of breast reconstruction were collected. Outcome evaluation included complications, surgical revisions, and nipple projection. There were 115 skate flap reconstructions performed in 83 patients between July 2009 and January 2013. Patients ranged from 32 to 73 years old. Average body mass index was 28.0. The most common comorbidities were hypertension (39.8%) and smoking (16.9%). After breast reconstruction, 68.7% of the patients underwent chemotherapy and 20.5% underwent radiation. Seventy-one patients had immediate breast reconstruction with expanders and 12 had delayed reconstruction. The only reported complications were extrusions (3.5%). Six nipples (5.2%) in 5 patients required surgical revision due to loss of projection; two patients had minor loss of projection but did not require surgical revision. Nipple projection at time of surgery ranged from 6 to 7 mm and average projection at 6 months was 3-5 mm. A surgical technique for nipple reconstruction using a skate flap with a graft material is described. Complications are infrequent and short-term projection measurements are encouraging.

  4. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.


    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  5. Microsurgical reconstruction of extensive oncological scalp defects

    Ole eGoertz


    Full Text Available While most small to medium defects of the scalp can be covered by local flaps, large defects or complicating factors like a history of radiotherapy often require a microsurgical reconstruction.Several factors need to be considered in such procedures. A sufficient preoperative planning is based on adequate imaging of the malignancy and a multi-disciplinary concept. Several flaps are available for such reconstructions, of which the latissimus dorsi and anterior lateral thigh flaps are the most commonly used ones.In very large defects, combined flaps such as a parascapular / latissimus dorsi flaps can be highly useful or necessary. The most commonly used recipient vessels for microsurgical scalp reconstructions are the superficial temporal vessels, but various other feasible choices exist. If the concomitant veins are not sufficient, the jugular veins represent a safe backup alternative but require a vessel interposition or long pedicle. Postoperative care and patient positioning can be difficult in these patients but can be facilitated by various devices. Overall, microsurgical reconstruction of large scalp defects is a feasible undertaking if the mentioned key factors are taken into account.

  6. Algebraic reconstruction techniques for spectral reconstruction in diffuse optical tomography

    Brendel, Bernhard; Ziegler, Ronny; Nielsen, Tim


    Reconstruction in diffuse optical tomography (DOT) necessitates solving the diffusion equation, which is nonlinear with respect to the parameters that have to be reconstructed. Currently applied solving methods are based on the linearization of the equation. For spectral three-dimensional reconstruction, the emerging equation system is too large for direct inversion, but the application of iterative methods is feasible. Computational effort and speed of convergence of these iterative methods are crucial since they determine the computation time of the reconstruction. In this paper, the iterative methods algebraic reconstruction technique (ART) and conjugated gradients (CGs) as well as a new modified ART method are investigated for spectral DOT reconstruction. The aim of the modified ART scheme is to speed up the convergence by considering the specific conditions of spectral reconstruction. As a result, it converges much faster to favorable results than conventional ART and CG methods

  7. Arctic Sea Level Reconstruction

    Svendsen, Peter Limkilde

    Reconstruction of historical Arctic sea level is very difficult due to the limited coverage and quality of tide gauge and altimetry data in the area. This thesis addresses many of these issues, and discusses strategies to help achieve a stable and plausible reconstruction of Arctic sea level from...... 1950 to today.The primary record of historical sea level, on the order of several decades to a few centuries, is tide gauges. Tide gauge records from around the world are collected in the Permanent Service for Mean Sea Level (PSMSL) database, and includes data along the Arctic coasts. A reasonable...... amount of data is available along the Norwegian and Russian coasts since 1950, and most published research on Arctic sea level extends cautiously from these areas. Very little tide gauge data is available elsewhere in the Arctic, and records of a length of several decades,as generally recommended for sea...

  8. Reconstructing warm inflation

    Herrera, Ramón


    The reconstruction of a warm inflationary universe model from the scalar spectral index n_S(N) and the tensor to scalar ratio r( N) as a function of the number of e-folds N is studied. Under a general formalism we find the effective potential and the dissipative coefficient in terms of the cosmological parameters n_S and r considering the weak and strong dissipative stages under the slow roll approximation. As a specific example, we study the attractors for the index n_S given by nS-1∝ N^{-1} and for the ratio r∝ N^{-2}, in order to reconstruct the model of warm inflation. Here, expressions for the effective potential V(φ ) and the dissipation coefficient Γ (φ ) are obtained.

  9. Jet Vertex Charge Reconstruction

    Nektarijevic, Snezana; The ATLAS collaboration


    A newly developed algorithm called the jet vertex charge tagger, aimed at identifying the sign of the charge of jets containing $b$-hadrons, referred to as $b$-jets, is presented. In addition to the well established track-based jet charge determination, this algorithm introduces the so-called \\emph{jet vertex charge} reconstruction, which exploits the charge information associated to the displaced vertices within the jet. Furthermore, the charge of a soft muon contained in the jet is taken into account when available. All available information is combined into a multivariate discriminator. The algorithm has been developed on jets matched to generator level $b$-hadrons provided by $t\\bar{t}$ events simulated at $\\sqrt{s}$=13~TeV using the full ATLAS detector simulation and reconstruction.

  10. Segmentation-DrivenTomographic Reconstruction

    Kongskov, Rasmus Dalgas

    such that the segmentation subsequently can be carried out by use of a simple segmentation method, for instance just a thresholding method. We tested the advantages of going from a two-stage reconstruction method to a one stage segmentation-driven reconstruction method for the phase contrast tomography reconstruction......The tomographic reconstruction problem is concerned with creating a model of the interior of an object from some measured data, typically projections of the object. After reconstructing an object it is often desired to segment it, either automatically or manually. For computed tomography (CT...

  11. LHCb jet reconstruction

    Francisco, Oscar; Rangel, Murilo; Barter, William; Bursche, Albert; Potterat, Cedric; Coco, Victor


    Full text: The Large Hadron Collider (LHC) is the most powerful particle accelerator in the world. It has been designed to collide proton beams at an energy up to 14 TeV in the center of mass. In 2011, the data taking was done with a center of mass energy of 7 TeV, the instant luminosity has reached values greater than 4 X 10 32 cm -2 s -1 and the integrated luminosity reached the value of 1,02fb -1 on the LHCb. The jet reconstruction is fundamental to observe events that can be used to test perturbative QCD (pQCD). It also provides a way to observe standard model channels and searches for new physics like SUSY. The anti-kt algorithm is a jet reconstruction algorithm that is based on the distance of the particles on the space ηX φ and on the transverse momentum of particles. To maximize the energy resolution all information about the trackers and the colorimeters are used on the LHCb experiment to create objects called particle flow objects that are used as input to anti-kt algorithm. The LHCb is specially interesting for jets studies because its η region is complementary to the others main experiments on LHC. We will present the first results of jet reconstruction using 2011 LHCb data. (author)

  12. LHCb jet reconstruction

    Francisco, Oscar; Rangel, Murilo [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil); Barter, William [University of Cambridge, Cambridge (United Kingdom); Bursche, Albert [Universitat Zurich, Zurich (Switzerland); Potterat, Cedric [Universitat de Barcelona, Barcelona (Spain); Coco, Victor [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands)


    Full text: The Large Hadron Collider (LHC) is the most powerful particle accelerator in the world. It has been designed to collide proton beams at an energy up to 14 TeV in the center of mass. In 2011, the data taking was done with a center of mass energy of 7 TeV, the instant luminosity has reached values greater than 4 X 10{sup 32} cm{sup -2}s{sup -1} and the integrated luminosity reached the value of 1,02fb{sup -1} on the LHCb. The jet reconstruction is fundamental to observe events that can be used to test perturbative QCD (pQCD). It also provides a way to observe standard model channels and searches for new physics like SUSY. The anti-kt algorithm is a jet reconstruction algorithm that is based on the distance of the particles on the space {eta}X {phi} and on the transverse momentum of particles. To maximize the energy resolution all information about the trackers and the colorimeters are used on the LHCb experiment to create objects called particle flow objects that are used as input to anti-kt algorithm. The LHCb is specially interesting for jets studies because its {eta} region is complementary to the others main experiments on LHC. We will present the first results of jet reconstruction using 2011 LHCb data. (author)

  13. [Reconstructive methods after Fournier gangrene].

    Wallner, C; Behr, B; Ring, A; Mikhail, B D; Lehnhardt, M; Daigeler, A


    Fournier's gangrene is a variant of the necrotizing fasciitis restricted to the perineal and genital region. It presents as an acute life-threatening disease and demands rapid surgical debridement, resulting in large soft tissue defects. Various reconstructive methods have to be applied to reconstitute functionality and aesthetics. The objective of this work is to identify different reconstructive methods in the literature and compare them to our current concepts for reconstructing defects caused by Fournier gangrene. Analysis of the current literature and our reconstructive methods on Fournier gangrene. The Fournier gangrene is an emergency requiring rapid, calculated antibiotic treatment and radical surgical debridement. After the acute phase of the disease, appropriate reconstructive methods are indicated. The planning of the reconstruction of the defect depends on many factors, especially functional and aesthetic demands. Scrotal reconstruction requires a higher aesthetic and functional reconstructive degree than perineal cutaneous wounds. In general, thorough wound hygiene, proper pre-operative planning, and careful consideration of the patient's demands are essential for successful reconstruction. In the literature, various methods for reconstruction after Fournier gangrene are described. Reconstruction with a flap is required for a good functional result in complex regions as the scrotum and penis, while cutaneous wounds can be managed through skin grafting. Patient compliance and tissue demand are crucial factors in the decision-making process.

  14. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar


    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  15. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie


    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  16. Atmospheric inverse modeling via sparse reconstruction

    Hase, Nils; Miller, Scot M.; Maaß, Peter; Notholt, Justus; Palm, Mathias; Warneke, Thorsten


    Many applications in atmospheric science involve ill-posed inverse problems. A crucial component of many inverse problems is the proper formulation of a priori knowledge about the unknown parameters. In most cases, this knowledge is expressed as a Gaussian prior. This formulation often performs well at capturing smoothed, large-scale processes but is often ill equipped to capture localized structures like large point sources or localized hot spots. Over the last decade, scientists from a diverse array of applied mathematics and engineering fields have developed sparse reconstruction techniques to identify localized structures. In this study, we present a new regularization approach for ill-posed inverse problems in atmospheric science. It is based on Tikhonov regularization with sparsity constraint and allows bounds on the parameters. We enforce sparsity using a dictionary representation system. We analyze its performance in an atmospheric inverse modeling scenario by estimating anthropogenic US methane (CH4) emissions from simulated atmospheric measurements. Different measures indicate that our sparse reconstruction approach is better able to capture large point sources or localized hot spots than other methods commonly used in atmospheric inversions. It captures the overall signal equally well but adds details on the grid scale. This feature can be of value for any inverse problem with point or spatially discrete sources. We show an example for source estimation of synthetic methane emissions from the Barnett shale formation.

  17. Partial breast irradiation as second conservative treatment for local breast cancer recurrence

    Hannoun-Levi, Jean-Michel; Houvenaeghel, Gilles; Ellis, Steve; Teissier, Eric; Alzieu, Claude; Lallement, Michel; Cowen, Didier


    Purpose: Mastectomy is the treatment of reference for local relapse after breast cancer (BC). The aim of this study was to document the feasibility and the results of associating lumpectomy with partial breast irradiation by interstitial brachytherapy (IB) as local treatment for an isolated ipsilateral BC local recurrence (LR). Methods and materials: Between 1975 and 1996 at Marseille and Nice Cancer Institutes, 4026 patients received lumpectomy and radiotherapy (RT) (50-80 Gy) for a localized breast cancer of which 473 presented a LR. Among these patients, 69 (14.6%) received a second lumpectomy followed by IB, which delivered 30 Gy (Nice, n = 24) or 45-50 Gy (Marseille, n = 45) with 3 to 8 192 Ir wires in 1 or 2 planes on the 85% isodose. Results: Median age at LR was 58.2 years, median follow-up since primary BC was 10 years, and median follow-up after the second conservative treatment was 50.2 months (range, 2-139 months). Immediate tolerance was good in all cases. Grade 2 to 3 long-term complications (LTC) according to IB dose were 0%, 28%, and 32%, respectively, for 30 Gy, 45 to 46 Gy, and 50 Gy (p 0.01). Grade 2 to 3 LTC according to total dose were 4% and 30%, respectively, for total doses (initial RT plus IB) ≤ 100 Gy or >100 Gy (p = 0.008). Logistic regression showed that the only factor associated with Grade 2 to 3 complications was higher IB doses (p = 0.01). We noted 11 second LRs (LR2), 10 distant metastases (DM), and 5 specific deaths. LR2 occurred either in the tumor bed (50.8%) or close to the tumor bed (34.3%) or in another quadrant (14.9%). Kaplan-Meier 5-year freedom from (FF) LR2 (FFLR2), FFDM, and DFS were 77.4%, 86.7%, and 68.9%, respectively. Overall 5-year survival (OS) was 91.8%. Univariate analysis showed the following factors associated with a higher FFLR2: (1) number of wires used for IB (3-4 vs. 5-8 wires, p = 0.006), (2) IB doses (30-45 Gy vs. 46-60 Gy, p = 0.05), (3) number of planes (1 vs. 2, p = 0.05), (4) interval between

  18. Software compensation in Particle Flow reconstruction

    Lan Tran, Huong; Sefkow, Felix; Green, Steven; Marshall, John; Thomson, Mark; Simon, Frank


    The Particle Flow approach to calorimetry requires highly granular calorimeters and sophisticated software algorithms in order to reconstruct and identify individual particles in complex event topologies. The high spatial granularity, together with analog energy information, can be further exploited in software compensation. In this approach, the local energy density is used to discriminate electromagnetic and purely hadronic sub-showers within hadron showers in the detector to improve the energy resolution for single particles by correcting for the intrinsic non-compensation of the calorimeter system. This improvement in the single particle energy resolution also results in a better overall jet energy resolution by improving the energy measurement of identified neutral hadrons and improvements in the pattern recognition stage by a more accurate matching of calorimeter energies to tracker measurements. This paper describes the software compensation technique and its implementation in Particle Flow reconstruct...

  19. Hopfield neural network in HEP track reconstruction

    Muresan, R.; Pentia, M.


    In experimental particle physics, pattern recognition problems, specifically for neural network methods, occur frequently in track finding or feature extraction. Track finding is a combinatorial optimization problem. Given a set of points in Euclidean space, one tries the reconstruction of particle trajectories, subject to smoothness constraints.The basic ingredients in a neural network are the N binary neurons and the synaptic strengths connecting them. In our case the neurons are the segments connecting all possible point pairs.The dynamics of the neural network is given by a local updating rule wich evaluates for each neuron the sign of the 'upstream activity'. An updating rule in the form of sigmoid function is given. The synaptic strengths are defined in terms of angle between the segments and the lengths of the segments implied in the track reconstruction. An algorithm based on Hopfield neural network has been developed and tested on the track coordinates measured by silicon microstrip tracking system

  20. Photometric Lunar Surface Reconstruction

    Nefian, Ara V.; Alexandrov, Oleg; Morattlo, Zachary; Kim, Taemin; Beyer, Ross A.


    Accurate photometric reconstruction of the Lunar surface is important in the context of upcoming NASA robotic missions to the Moon and in giving a more accurate understanding of the Lunar soil composition. This paper describes a novel approach for joint estimation of Lunar albedo, camera exposure time, and photometric parameters that utilizes an accurate Lunar-Lambertian reflectance model and previously derived Lunar topography of the area visualized during the Apollo missions. The method introduced here is used in creating the largest Lunar albedo map (16% of the Lunar surface) at the resolution of 10 meters/pixel.

  1. Penile surgery and reconstruction.

    Perovic, Sava V; Djordjevic, Miroslav L J; Kekic, Zoran K; Djakovic, Nenad G


    This review will highlight recent advances in the field of penile reconstructive surgery in the paediatric and adult population. It is based on the work published during the year 2001. Besides the anatomical and histological studies of the penis, major contributions have been described in congenital and acquired penile anomalies. Also, a few new techniques and modifications of old procedures are described in order to improve the final functional and aesthetic outcome. The techniques for penile enlargement present a trend in the new millennium, but are still at the stage of investigation.

  2. Progressive Reconstruction: A Methodology for Stabilization and Reconstruction Operations

    Rohr, Karl C


    ... these nations in accordance with stated United States' goals. The argument follows closely current and developing United States military doctrine on stabilization, reconstruction, and counterinsurgency operations...

  3. The reconstruction of male hair-bearing facial regions.

    Ridgway, Emily B; Pribaz, Julian J


    Loss of hair-bearing regions of the face caused by trauma, tumor resection, or burn presents a difficult reconstructive task for plastic surgeons. The ideal tissue substitute should have the same characteristics as the facial area affected, consisting of thin, pliable tissue with a similar color match and hair-bearing quality. This is a retrospective study of 34 male patients who underwent reconstruction of hair-bearing facial regions performed by the senior author (J.J.P.). Local and pedicled flaps were used primarily to reconstruct defects after tumor extirpation, trauma, infections, and burns. Two patients had irradiation before reconstruction. Two patients had prior facial reconstruction with free flaps. The authors found that certain techniques of reconstructing defects in hair-bearing facial regions were more successful than others in particular facial regions and in different sizes of defects. The authors were able to develop a simple algorithm for management of facial defects involving the hair-bearing regions of the eyebrow, sideburn, beard, and mustache that may prospectively aid the planning of reconstructive strategy in these cases.

  4. Reconstructing Global-scale Ionospheric Outflow With a Satellite Constellation

    Liemohn, M. W.; Welling, D. T.; Jahn, J. M.; Valek, P. W.; Elliott, H. A.; Ilie, R.; Khazanov, G. V.; Glocer, A.; Ganushkina, N. Y.; Zou, S.


    The question of how many satellites it would take to accurately map the spatial distribution of ionospheric outflow is addressed in this study. Given an outflow spatial map, this image is then reconstructed from a limited number virtual satellite pass extractions from the original values. An assessment is conducted of the goodness of fit as a function of number of satellites in the reconstruction, placement of the satellite trajectories relative to the polar cap and auroral oval, season and universal time (i.e., dipole tilt relative to the Sun), geomagnetic activity level, and interpolation technique. It is found that the accuracy of the reconstructions increases sharply from one to a few satellites, but then improves only marginally with additional spacecraft beyond 4. Increased dwell time of the satellite trajectories in the auroral zone improves the reconstruction, therefore a high-but-not-exactly-polar orbit is most effective for this task. Local time coverage is also an important factor, shifting the auroral zone to different locations relative to the virtual satellite orbit paths. The expansion and contraction of the polar cap and auroral zone with geomagnetic activity influences the coverage of the key outflow regions, with different optimal orbit configurations for each level of activity. Finally, it is found that reconstructing each magnetic latitude band individually produces a better fit to the original image than 2-D image reconstruction method (e.g., triangulation). A high-latitude, high-altitude constellation mission concept is presented that achieves acceptably accurate outflow reconstructions.

  5. Long-term outcome after mastectomy with immediate breast reconstruction

    Stralman, K.; Mollerup, C.L.; Kristoffersen, U.S.


    INTRODUCTION: The purpose of this study was to investigate long term outcome for women who had undergone mastectomy and immediate breast reconstruction. MATERIAL AND METHODS: Patient files of 167 immediately reconstructed breast cancer patients were reviewed for late surgical complications....... Furthermore, information of local recurrence rate, radiotherapy and death was obtained from the Danish Breast Cancer Cooperative Group register. Histopatological high and low risk patients were compared with respect to locoregional recurrence rate, recurrence free survival and death. Unpaired t...... found no increase in the occurrence of capsular contracture in our study group in patients who received radiotherapy. CONCLUSION: Immediate breast reconstruction seems to be oncologically safe. Breast reconstruction performed with implants was associated with a higher risk of late complications...

  6. Iterative image reconstruction in ECT

    Chintu Chen; Ordonez, C.E.; Wernick, M.N.; Aarsvold, J.N.; Gunter, D.L.; Wong, W.H.; Kapp, O.H.; Xiaolong Ouyang; Levenson, M.; Metz, C.E.


    A series of preliminary studies has been performed in the authors laboratories to explore the use of a priori information in Bayesian image restoration and reconstruction. One piece of a priori information is the fact that intensities of neighboring pixels tend to be similar if they belong to the same region within which similar tissue characteristics are exhibited. this property of local continuity can be modeled by the use of Gibbs priors, as first suggested by German and Geman. In their investigation, they also included line sites between each pair of neighboring pixels in the Gibbs prior and used discrete binary numbers to indicate the absence or presence of boundaries between regions. These two features of the a priori model permit averaging within boundaries of homogeneous regions to alleviate the degradation caused by Poisson noise. with the use of this Gibbs prior in combination with the technique of stochastic relaxation, German and Geman demonstrated that noise levels can be reduced significantly in 2-D image restoration. They have developed a Bayesian method that utilizes a Gibbs prior to describe the spatial correlation of neighboring regions and takes into account the effect of limited spatial resolution as well. The statistical framework of the proposed approach is based on the data augmentation scheme suggested by Tanner and Wong. Briefly outlined here, this Bayesian method is based on Geman and Geman's approach

  7. Synchronized dynamic dose reconstruction

    Litzenberg, Dale W.; Hadley, Scott W.; Tyagi, Neelam; Balter, James M.; Ten Haken, Randall K.; Chetty, Indrin J.


    Variations in target volume position between and during treatment fractions can lead to measurable differences in the dose distribution delivered to each patient. Current methods to estimate the ongoing cumulative delivered dose distribution make idealized assumptions about individual patient motion based on average motions observed in a population of patients. In the delivery of intensity modulated radiation therapy (IMRT) with a multi-leaf collimator (MLC), errors are introduced in both the implementation and delivery processes. In addition, target motion and MLC motion can lead to dosimetric errors from interplay effects. All of these effects may be of clinical importance. Here we present a method to compute delivered dose distributions for each treatment beam and fraction, which explicitly incorporates synchronized real-time patient motion data and real-time fluence and machine configuration data. This synchronized dynamic dose reconstruction method properly accounts for the two primary classes of errors that arise from delivering IMRT with an MLC: (a) Interplay errors between target volume motion and MLC motion, and (b) Implementation errors, such as dropped segments, dose over/under shoot, faulty leaf motors, tongue-and-groove effect, rounded leaf ends, and communications delays. These reconstructed dose fractions can then be combined to produce high-quality determinations of the dose distribution actually received to date, from which individualized adaptive treatment strategies can be determined

  8. LHCb; LHCb Jet Reconstruction

    Augusto, O


    The Large Hadron Collider (LHC) is the most powerful particle accelerator in the world. It has been designed to collide proton beams at an energy up to 14 TeV in the center of mass. In 2011, the data taking was done with a center of mass energy of 7 TeV, the instant luminosity has reached values greater than $4 \\times 10^{32} cm^{-2} s^{-1}$ and the integrated luminosity reached the value of 1.02 $fb^{-1}$ on the LHCb. The jet reconstruction is fundamental to observe events that can be used to test pertubative QCD (pQCD). It also provides a way to observe standard model channels and searches for new physics like SUSY. The anti-kt algorithm is a jet reconstruction algorithm that is based on the distance of the particles on the space $\\eta \\times \\phi$ and on the transverse momentum of particles. To maximize the energy resolution all information about the trackers and the calo...

  9. Three-dimensional ICT reconstruction

    Zhang Aidong; Li Ju; Chen Fa; Sun Lingxia


    The three-dimensional ICT reconstruction method is the hot topic of recent ICT technology research. In the context, qualified visual three-dimensional ICT pictures are achieved through multi-piece two-dimensional images accumulation by, combining with thresholding method and linear interpolation. Different direction and different position images of the reconstructed pictures are got by rotation and interception respectively. The convenient and quick method is significantly instructive to more complicated three-dimensional reconstruction of ICT images. (authors)

  10. Three-dimensional ICT reconstruction

    Zhang Aidong; Li Ju; Chen Fa; Sun Lingxia


    The three-dimensional ICT reconstruction method is the hot topic of recent ICT technology research. In the context qualified visual three-dimensional ICT pictures are achieved through multi-piece two-dimensional images accumulation by order, combining with thresholding method and linear interpolation. Different direction and different position images of the reconstructed pictures are got by rotation and interception respectively. The convenient and quick method is significantly instructive to more complicated three-dimensional reconstruction of ICT images. (authors)

  11. Virtual 3-D Facial Reconstruction

    Martin Paul Evison


    Full Text Available Facial reconstructions in archaeology allow empathy with people who lived in the past and enjoy considerable popularity with the public. It is a common misconception that facial reconstruction will produce an exact likeness; a resemblance is the best that can be hoped for. Research at Sheffield University is aimed at the development of a computer system for facial reconstruction that will be accurate, rapid, repeatable, accessible and flexible. This research is described and prototypical 3-D facial reconstructions are presented. Interpolation models simulating obesity, ageing and ethnic affiliation are also described. Some strengths and weaknesses in the models, and their potential for application in archaeology are discussed.

  12. Entropy and transverse section reconstruction

    Gullberg, G.T.


    A new approach to the reconstruction of a transverse section using projection data from multiple views incorporates the concept of maximum entropy. The principle of maximizing information entropy embodies the assurance of minimizing bias or prejudice in the reconstruction. Using maximum entropy is a necessary condition for the reconstructed image. This entropy criterion is most appropriate for 3-D reconstruction of objects from projections where the system is underdetermined or the data are limited statistically. This is the case in nuclear medicine time limitations in patient studies do not yield sufficient projections

  13. An alternative to the crystallographic reconstruction of austenite in steels

    Bernier, Nicolas; Bracke, Lieven; Malet, Loïc; Godet, Stéphane


    An alternative crystallographic austenite reconstruction programme written in Matlab is developed by combining the best features of the existing models: the orientation relationship refinement, the local pixel-by-pixel analysis and the nuclei identification and spreading strategy. This programme can be directly applied to experimental electron backscatter diffraction mappings. Its applicability is demonstrated on both quenching and partitioning and as-quenched lath-martensite steels. - Highlights: • An alternative crystallographic austenite reconstruction program is developed. • The method combines a local analysis and a nuclei identification/spreading strategy. • The validity of the calculated orientation relationship is verified on a Q and P steel. • The accuracy of the reconstructed microtexture is investigated on a martensite steel

  14. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.


    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  15. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias


    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  16. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling


    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  17. The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

    Jeong Byung-Hoon


    Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

  18. Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

    Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong


    The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

  19. Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

    Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J


    While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Quantitative SPECT reconstruction of iodine-123 data

    Gilland, D.R.; Jaszczak, R.J.; Greer, K.L.; Coleman, R.E.


    Many clinical and research studies in nuclear medicine require quantitation of iodine-123 ( 123 I) distribution for the determination of kinetics or localization. The objective of this study was to implement several reconstruction methods designed for single-photon emission computed tomography (SPECT) using 123 I and to evaluate their performance in terms of quantitative accuracy, image artifacts, and noise. The methods consisted of four attenuation and scatter compensation schemes incorporated into both the filtered backprojection/Chang (FBP) and maximum likelihood-expectation maximization (ML-EM) reconstruction algorithms. The methods were evaluated on data acquired of a phantom containing a hot sphere of 123 I activity in a lower level background 123 I distribution and nonuniform density media. For both reconstruction algorithms, nonuniform attenuation compensation combined with either scatter subtraction or Metz filtering produced images that were quantitatively accurate to within 15% of the true value. The ML-EM algorithm demonstrated quantitative accuracy comparable to FBP and smaller relative noise magnitude for all compensation schemes

  1. Aortic reconstruction with bovine pericardial grafts

    Silveira Lindemberg Mota


    Full Text Available INTRODUCTION: Glutaraldehyde-treated crimped bovine pericardial grafts are currently used in aortic graft surgery. These conduits have become good options for these operations, available in different sizes and shapes and at a low cost. OBJECTIVE:To evaluate the results obtained with bovine pericardial grafts for aortic reconstruction, specially concerning late complications. METHOD: Between January 1995 and January 2002, 57 patients underwent different types of aortic reconstruction operations using bovine pericardial grafts. A total of 29 (50.8% were operated on an urgent basis (mostly acute Stanford A dissection and 28 electively. Thoracotomy was performed in three patients for descending aortic replacement (two patients and aortoplasty with a patch in one. All remaining 54 underwent sternotomy, cardiopulmonary bypass and aortic resection. Deep hypothermia and total circulatory arrest was used in acute dissections and arch operations. RESULTS: Hospital mortality was 17.5%. Follow-up was 24.09 months (18.5 to 29.8 months confidence interval and complication-free actuarial survival curve was 92.3% (standard deviation ± 10.6. Two patients lately developed thoracoabdominal aneurysms following previous DeBakey II dissection and one died from endocarditis. One "patch" aortoplasty patient developed local descending aortic pseudoaneurysm 42 months after surgery. All other patients are asymptomatic and currently clinically evaluated with echocardiography and CT scans, showing no complications. CONCLUSION: Use of bovine pericardial grafts in aortic reconstruction surgery is adequate and safe, with few complications related to the conduits.

  2. Reconstructive dosimetry for cutaneous radiation syndrome

    Lima, C.M.A.; Lima, A.R.; Degenhardt, Ä.L.; Da Silva, F.C.A., E-mail: [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Valverde, N.J. [Fundacao Eletronuclear de Assistencia Medica, Rio de Janeiro, RJ (Brazil)


    According to the International Atomic Energy Agency (IAEA), a relatively significant number of radiological accidents have occurred in recent years mainly because of the practices referred to as potentially high-risk activities, such as radiotherapy, large irradiators and industrial radiography, especially in gammagraphy assays. In some instances, severe injuries have occurred in exposed persons due to high radiation doses. In industrial radiography, 80 cases involving a total of 120 radiation workers, 110 members of the public including 12 deaths have been recorded up to 2014. Radiological accidents in industrial practices in Brazil have mainly resulted in development of cutaneous radiation syndrome (CRS) in hands and fingers. Brazilian data include 5 serious cases related to industrial gammagraphy, affecting 7 radiation workers and 19 members of the public; however, none of them were fatal. Some methods of reconstructive dosimetry have been used to estimate the radiation dose to assist in prescribing medical treatment. The type and development of cutaneous manifestations in the exposed areas of a person is the first achievable gross dose estimation. This review article presents the state-of-the-art reconstructive dosimetry methods enabling estimation of local radiation doses and provides guidelines for medical handling of the exposed individuals. The review also presents the Chilean and Brazilian radiological accident cases to highlight the importance of reconstructive dosimetry. (author)

  3. Complete Lower Lip Reconstruction with a Large Lip Switch Flap and a Composite Modiolus Advancement Flap

    Gunnarsson, Gudjon L.; Demmissie, Meheret Beferkadu; Havemann, Ingemar


    Total loss of the lower lip is debilitating and poses a reconstructive challenge. Aiming to restore oral continence and function and also cosmetic appearance, a successful reconstruction has a huge impact on the quality of life for the individual patient. Early sources of local tissue rearrangement...

  4. Reconstructing the velocity field beyond the local universe

    Johnston, R


    Full Text Available an estimate of the velocity field derived from the galaxy over-density d(sub g) and the second makes use of the matter linear density power spectrum P(sub k). Using N-body simulations we find, with an SDSS-like sample (N(sub gal) 33 per deg(sup 2...

  5. Weight Multispectral Reconstruction Strategy for Enhanced Reconstruction Accuracy and Stability With Cerenkov Luminescence Tomography.

    Hongbo Guo; Xiaowei He; Muhan Liu; Zeyu Zhang; Zhenhua Hu; Jie Tian


    Cerenkov luminescence tomography (CLT) provides a novel technique for 3-D noninvasive detection of radiopharmaceuticals in living subjects. However, because of the severe scattering of Cerenkov light, the reconstruction accuracy and stability of CLT is still unsatisfied. In this paper, a modified weight multispectral CLT (wmCLT) reconstruction strategy was developed which split the Cerenkov radiation spectrum into several sub-spectral bands and weighted the sub-spectral results to obtain the final result. To better evaluate the property of the wmCLT reconstruction strategy in terms of accuracy, stability and practicability, several numerical simulation experiments and in vivo experiments were conducted and the results obtained were compared with the traditional multispectral CLT (mCLT) and hybrid-spectral CLT (hCLT) reconstruction strategies. The numerical simulation results indicated that wmCLT strategy significantly improved the accuracy of Cerenkov source localization and intensity quantitation and exhibited good stability in suppressing noise in numerical simulation experiments. And the comparison of the results achieved from different in vivo experiments further indicated significant improvement of the wmCLT strategy in terms of the shape recovery of the bladder and the spatial resolution of imaging xenograft tumors. Overall the strategy reported here will facilitate the development of nuclear and optical molecular tomography in theoretical study.

  6. Optimal reconstruction angles

    Cook, G.O. Jr.; Knight, L.


    The question of optimal projection angles has recently become of interest in the field of reconstruction from projections. Here, studies are concentrated on the n x n pixel space, where literative algorithms such as ART and direct matrix techniques due to Katz are considered. The best angles are determined in a Gauss--Markov statistical sense as well as with respect to a function-theoretical error bound. The possibility of making photon intensity a function of angle is also examined. Finally, the best angles to use in an ART-like algorithm are studied. A certain set of unequally spaced angles was found to be preferred in several contexts. 15 figures, 6 tables

  7. Aberrant patterns of local and long-range functional connectivity densities in schizophrenia.

    Liu, Chuanxin; Zhang, Wei; Chen, Guangdong; Tian, Hongjun; Li, Jie; Qu, Hongru; Cheng, Langlang; Zhu, Jingjing; Zhuo, Chuanjun


    Schizophrenia is a disorder of brain dysconnectivity, and both the connection strength and connection number are disrupted in patients with schizophrenia. The functional connectivity density (FCD) can reflect alterations in the connection number. Alterations in the global FCD (gFCD) in schizophrenia were previously demonstrated; however, alterations in two other indices of the pathological characteristics of the brain, local FCD (lFCD) and long-range FCD (lrFCD), have not been revealed. To investigate lFCD and lrFCD alterations in patients with schizophrenia, 95 patients and 93 matched healthy controls were examined using structural and resting-state functional magnetic resonance imaging scanning. lFCD and lrFCD were measured using FCD mapping, and differences were identified using a two-sample t-test in a voxel-wise manner, with age and gender considered to increase variability. Multiple comparisons were performed using a false discovery rate method with a corrected threshold of Pschizophrenia is a disorder of brain dysconnectivity, particularly affecting the local functional connectivity network, and support the hypothesis that schizophrenia is associated with a widespread cortical functional connectivity/activity deficit, with hyper- and/or hypo-connectivity/activity coexisting in some cortical or subcortical regions.


    A. V. Korolev


    Full Text Available Purpose: To evaluate long-term results of meniscal repair during arthroscopic ACL reconstruction.Materials and methods: 45 patients who underwent meniscal repair during arthroscopic ACL reconstruction between 2007 and 2013 by the same surgeon were included in the study. In total, fifty meniscus were repaired (26 medial and 24 lateral. Procedures included use of one up to four Fast-Fix implants (Smith & Nephew. In five cases both medial and lateral meniscus were repaired. Cincinnati, IKDC and Lysholm scales were used for long-term outcome analysis.Results: 19 male and 26 female patients were included in the study aging from 15 to 59 years (mean age 33,2±1,5. Median time from injury to surgical procedure was zero months (ranging zero to one. Mean time from surgery to scale analysis was 55,9±3 months (ranged 20-102. Median Cincinnati score was 97 (ranged 90-100, with excellent results in 93% of cases (43 patients and good results in 7% (3 patients. Median IKDC score was 90,8 (ranged 86,2-95,4, with excellent outcomes in 51% of cases (23 patients, good in 33% (15 patients and satisfactory in 16% (7 patients. Median Lysholm score was 95 (ranged 90-100, with excellent outcomes in 76% of cases (34 patients and good in 24% (11 patients. Authors identified no statistical differences when comparing survey results in age, sex and time from trauma to surgery.Conclusions: Results of the present study match the data from orthopedic literature that prove meniscal repair as a safe and efficient procedure with good and excellent outcomes. All-inside meniscal repair can be used irrespectively of patients' age and is efficient even in case of delayed procedures.

  9. Scrotal Reconstruction with a Pedicled Gracilis Muscle Flap after ...

    Several scrotal reconstructive options are available including split thickness skin grafts, scrotal advancement flaps, local fasciocutaneous, muscle or myocutaneous flaps, and free tissue transfer. We report a case of a 34 year old African male who presented as a referral from a district hospital with a scrotal defect and ...

  10. Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

    Huang, Eng-Yen; Chanchien, Chan-Chao; Lin, Hao; Wang, Chung-Chi; Wang, Chong-Jong; Huang, Chao-Cheng


    Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer

  11. Galectin-1 Is an Independent Prognostic Factor for Local Recurrence and Survival After Definitive Radiation Therapy for Patients With Squamous Cell Carcinoma of the Uterine Cervix

    Huang, Eng-Yen [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); School of Traditional Chinese Medicine, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Chanchien, Chan-Chao; Lin, Hao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Wang, Chung-Chi; Wang, Chong-Jong [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Huang, Chao-Cheng, E-mail: [Department of Pathology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)


    Purpose: To investigate the role of galectin-1 in patients with cervical cancer after definitive radiation therapy. Methods and Materials: We reviewed 154 patients with International Federation of Gynecology and Obstetrics stage I-II squamous cell carcinoma. Patients underwent curative-intent radiation therapy. Paraffin-embedded tissues were analyzed using immunohistochemistry staining for galectin-1. The rates of cancer-specific survival (CSS), local recurrence (LR), and distant metastasis were compared among patient tissue samples with no, weak, and strong galectin-1 expression. The Kaplan-Meier method and the Cox proportional hazard model with hazard ratios and 95% confidence intervals (CIs) were used for univariate and multivariate analyses, respectively. Results: The areas under the curve for the intracellular expression scores of galectin-1 for both LR and CSS were significantly higher than those for stromal expression. There were no significant differences in the demographic data, such as stage and serum tumor markers, between patients with and without intracellular expression of galectin-1 in cancer tissue samples. Using multivariate analyses, the hazard ratios of LR and CSS were 2.60 (95% CI 1.50-4.52) (P=.001) and 1.94 (95% CI 1.18-3.19) (P=.010), respectively. Conclusion: Galectin-1 is an independent prognostic factor associated with LR and CSS in stage I-II cervical cancer patients undergoing definitive radiation therapy. Further studies targeting galectin-1 may improve the local control of cervical cancer.

  12. Reconstruction of electric systems (ELE)

    Kohutovic, P.


    The original design of WWER-230 units consisted of a single common system EEPS (essential electric power supply system) per unit. The establishment of redundancy 2 x 100% EEPS was a global task. The task was started during the 'Small reconstruction' - MR V1, continued in 'Gradual reconstruction' and finished in the year 2000. (author)

  13. Breast Reconstruction Following Cancer Treatment.

    Gerber, Bernd; Marx, Mario; Untch, Michael; Faridi, Andree


    About 8000 breast reconstructions after mastectomy are per - formed in Germany each year. It has become more difficult to advise patients because of the wide variety of heterologous and autologous techniques that are now available and because of changes in the recommendations about radiotherapy. This article is based on a review of pertinent articles (2005-2014) that were retrieved by a selective search employing the search terms "mastectomy" and "breast reconstruction." The goal of reconstruction is to achieve an oncologically safe and aestically satisfactory result for the patient over the long term. Heterologous, i.e., implant-based, breast reconstruction (IBR) and autologous breast reconstruction (ABR) are complementary techniques. Immediate reconstruction preserves the skin of the breast and its natural form and prevents the psychological trauma associated with mastectomy. If post-mastectomy radiotherapy (PMRT) is not indicated, implant-based reconstruction with or without a net/acellular dermal matrix (ADM) is a common option. Complications such as seroma formation, infection, and explantation are significantly more common when an ADM is used (15.3% vs. 5.4% ). If PMRT is performed, then the complication rate of implant-based breast reconstruction is 1 to 48% ; in particular, Baker grade III/IV capsular fibrosis occurs in 7 to 22% of patients, and the prosthesis must be explanted in 9 to 41% . Primary or, preferably, secondary autologous reconstruction is an alternative. The results of ABR are more stable over the long term, but the operation is markedly more complex. Autologous breast reconstruction after PMRT does not increase the risk of serious complications (20.5% vs. 17.9% without radiotherapy). No randomized controlled trials have yet been conducted to compare the reconstructive techniques with each other. If radiotherapy will not be performed, immediate reconstruction with an implant is recommended. On the other hand, if post-mastectomy radiotherapy

  14. Local food:

    Sundbo, Donna Isabella Caroline


    are identified and then categorised according to whether they pertain to the food product itself or the production methods and facilities and whether they describe physical or social properties of local food. From this a model with four categories is developed. It is found that properties of the product are more......Recently there has been more focus on food in general and local food in particular. But what is local food? And what are the perceptions of this concept according to theory and to providers and consumers of local food? This article first summarises and compares three different theoretical...... perspectives on local food, namely experience economy, local food systems and what is termed pro-industrialism. These have differing and sometimes opposite conceptualisations and aims for the concept of local food. Using the perspective of experience economy as theoretical background, the concept of local food...

  15. Acellular dermal matrix based nipple reconstruction: A modified technique

    Raghavan Vidya


    Full Text Available Nipple areolar reconstruction (NAR has evolved with the advancement in breast reconstruction and can improve self-esteem and, consequently, patient satisfaction. Although a variety of reconstruction techniques have been described in the literature varying from nipple sharing, local flaps to alloplastic and allograft augmentation, over time, loss of nipple projection remains a major problem. Acellular dermal matrices (ADM have revolutionised breast reconstruction more recently. We discuss the use of ADM to act as a base plate and strut to give support to the base and offer nipple bulk and projection in a primary procedure of NAR with a local clover shaped dermal flap in 5 breasts (4 patients. We used 5-point Likert scales (1 = highly unsatisfied, 5 = highly satisfied to assess patient satisfaction. Median age was 46 years (range: 38–55 years. Nipple projection of 8 mm, 7 mm, and 7 mms were achieved in the unilateral cases and 6 mm in the bilateral case over a median 18 month period. All patients reported at least a 4 on the Likert scale. We had no post-operative complications. It seems that nipple areolar reconstruction [NAR] using ADM can achieve nipple projection which is considered aesthetically pleasing for patients.

  16. Nonimaging aspects of follow-up in breast cancer reconstruction.

    Wood, W C


    Follow-up of patients with breast cancer is directed to the early detection of recurrent or metastatic disease and the detection of new primary breast cancer. The survival benefit of early detection is limited to some patients with local failure or new primary tumors. That imaging is not used in follow-up of patients who have had breast cancer reconstruction is related to possible interference with this putative benefit by the reconstructive procedure. Such follow-up is accomplished by the patient's own surveillance, clinical examination, and laboratory testing supplemented by imaging studies. Clinical follow-up trials of women who have undergone breast reconstructive surgery show no evidence that locally recurrent breast carcinoma is masked when compared with follow-up of women who did not undergo reconstructive procedures. Reshaping of the contralateral breast to match the reconstructed breast introduces the possibility of interference with palpation as well as mammographic distortion in some women. This is an uncommon practical problem except when complicated by fat necrosis.

  17. Block Compressed Sensing of Images Using Adaptive Granular Reconstruction

    Ran Li


    Full Text Available In the framework of block Compressed Sensing (CS, the reconstruction algorithm based on the Smoothed Projected Landweber (SPL iteration can achieve the better rate-distortion performance with a low computational complexity, especially for using the Principle Components Analysis (PCA to perform the adaptive hard-thresholding shrinkage. However, during learning the PCA matrix, it affects the reconstruction performance of Landweber iteration to neglect the stationary local structural characteristic of image. To solve the above problem, this paper firstly uses the Granular Computing (GrC to decompose an image into several granules depending on the structural features of patches. Then, we perform the PCA to learn the sparse representation basis corresponding to each granule. Finally, the hard-thresholding shrinkage is employed to remove the noises in patches. The patches in granule have the stationary local structural characteristic, so that our method can effectively improve the performance of hard-thresholding shrinkage. Experimental results indicate that the reconstructed image by the proposed algorithm has better objective quality when compared with several traditional ones. The edge and texture details in the reconstructed image are better preserved, which guarantees the better visual quality. Besides, our method has still a low computational complexity of reconstruction.

  18. Nonlocal Regularized Algebraic Reconstruction Techniques for MRI: An Experimental Study

    Xin Li


    Full Text Available We attempt to revitalize researchers' interest in algebraic reconstruction techniques (ART by expanding their capabilities and demonstrating their potential in speeding up the process of MRI acquisition. Using a continuous-to-discrete model, we experimentally study the application of ART into MRI reconstruction which unifies previous nonuniform-fast-Fourier-transform- (NUFFT- based and gridding-based approaches. Under the framework of ART, we advocate the use of nonlocal regularization techniques which are leveraged from our previous research on modeling photographic images. It is experimentally shown that nonlocal regularization ART (NR-ART can often outperform their local counterparts in terms of both subjective and objective qualities of reconstructed images. On one real-world k-space data set, we find that nonlocal regularization can achieve satisfactory reconstruction from as few as one-third of samples. We also address an issue related to image reconstruction from real-world k-space data but overlooked in the open literature: the consistency of reconstructed images across different resolutions. A resolution-consistent extension of NR-ART is developed and shown to effectively suppress the artifacts arising from frequency extrapolation. Both source codes and experimental results of this work are made fully reproducible.

  19. Fast Dictionary-Based Reconstruction for Diffusion Spectrum Imaging

    Bilgic, Berkin; Chatnuntawech, Itthi; Setsompop, Kawin; Cauley, Stephen F.; Yendiki, Anastasia; Wald, Lawrence L.; Adalsteinsson, Elfar


    Diffusion Spectrum Imaging (DSI) reveals detailed local diffusion properties at the expense of substantially long imaging times. It is possible to accelerate acquisition by undersampling in q-space, followed by image reconstruction that exploits prior knowledge on the diffusion probability density functions (pdfs). Previously proposed methods impose this prior in the form of sparsity under wavelet and total variation (TV) transforms, or under adaptive dictionaries that are trained on example datasets to maximize the sparsity of the representation. These compressed sensing (CS) methods require full-brain processing times on the order of hours using Matlab running on a workstation. This work presents two dictionary-based reconstruction techniques that use analytical solutions, and are two orders of magnitude faster than the previously proposed dictionary-based CS approach. The first method generates a dictionary from the training data using Principal Component Analysis (PCA), and performs the reconstruction in the PCA space. The second proposed method applies reconstruction using pseudoinverse with Tikhonov regularization with respect to a dictionary. This dictionary can either be obtained using the K-SVD algorithm, or it can simply be the training dataset of pdfs without any training. All of the proposed methods achieve reconstruction times on the order of seconds per imaging slice, and have reconstruction quality comparable to that of dictionary-based CS algorithm. PMID:23846466

  20. Plastic surgery in chest wall reconstruction: relevant aspects - case series

    Diogo Franco

    Full Text Available Objective: to discuss the participation of Plastic Surgery in the reconstruction of the chest wall, highlighting relevant aspects of interdisciplinaryness. Methods: we analyzed charts from 20 patients who underwent extensive resection of the thoracic integument, between 2000 and 2014, recording the indication of resection, the extent and depth of the raw areas, types of reconstructions performed and complications. Results: among the 20 patients, averaging 55 years old, five were males and 15 females. They resections were: one squamous cell carcinoma, two basal cell carcinomas, five chondrosarcomas and 12 breast tumors. The extent of the bloody areas ranged from 4x9 cm to 25x40 cm. In 12 patients the resection included the muscular plane. In the remaining eight, the tumor removal achieved a total wall thickness. For reconstruction we used: one muscular flap associated with skin grafting, nine flaps and ten regional fasciocutaneous flaps. Two patients undergoing reconstruction with fasciocutaneous flaps had partially suffering of the flap, solved with employment of a myocutaneous flap. The other patients displayed no complications with the techniques used, requiring only one surgery. Conclusion: the proper assessment of local tissues and flaps available for reconstruction, in addition to the successful integration of Plastic Surgery with the specialties involved in the treatment, enable extensive resections of the chest wall and reconstructions that provide patient recovery.

  1. Validation of Magnetic Reconstruction Codes for Real-Time Applications

    Mazon, D.; Murari, A.; Boulbe, C.; Faugeras, B.; Blum, J.; Svensson, J.; Quilichini, T.; Gelfusa, M.


    The real-time reconstruction of the plasma magnetic equilibrium in a tokamak is a key point to access high-performance regimes. Indeed, the shape of the plasma current density profile is a direct output of the reconstruction and has a leading effect for reaching a steady-state high-performance regime of operation. The challenge is thus to develop real-time methods and algorithms that reconstruct the magnetic equilibrium from the perspective of using these outputs for feedback control purposes. In this paper the validation of the JET real-time equilibrium reconstruction codes using both a Bayesian approach and a full equilibrium solver named Equinox will be detailed, the comparison being performed with the off-line equilibrium code EFIT (equilibrium fitting) or the real-time boundary reconstruction code XLOC (X-point local expansion). In this way a significant database, a methodology, and a strategy for the validation are presented. The validation of the results has been performed using a validated database of 130 JET discharges with a large variety of magnetic configurations. Internal measurements like polarimetry and motional Stark effect have been also used for the Equinox validation including some magnetohydrodynamic signatures for the assessment of the reconstructed safety profile and current density. (authors)

  2. Fast dictionary-based reconstruction for diffusion spectrum imaging.

    Bilgic, Berkin; Chatnuntawech, Itthi; Setsompop, Kawin; Cauley, Stephen F; Yendiki, Anastasia; Wald, Lawrence L; Adalsteinsson, Elfar


    Diffusion spectrum imaging reveals detailed local diffusion properties at the expense of substantially long imaging times. It is possible to accelerate acquisition by undersampling in q-space, followed by image reconstruction that exploits prior knowledge on the diffusion probability density functions (pdfs). Previously proposed methods impose this prior in the form of sparsity under wavelet and total variation transforms, or under adaptive dictionaries that are trained on example datasets to maximize the sparsity of the representation. These compressed sensing (CS) methods require full-brain processing times on the order of hours using MATLAB running on a workstation. This work presents two dictionary-based reconstruction techniques that use analytical solutions, and are two orders of magnitude faster than the previously proposed dictionary-based CS approach. The first method generates a dictionary from the training data using principal component analysis (PCA), and performs the reconstruction in the PCA space. The second proposed method applies reconstruction using pseudoinverse with Tikhonov regularization with respect to a dictionary. This dictionary can either be obtained using the K-SVD algorithm, or it can simply be the training dataset of pdfs without any training. All of the proposed methods achieve reconstruction times on the order of seconds per imaging slice, and have reconstruction quality comparable to that of dictionary-based CS algorithm.

  3. Local Content

    Gibberd, Jeremy


    Full Text Available Local content refers to materials and products made in a country as opposed those that are imported. There is an increasing interest in the concept of local content as a means of supporting local economies and providing jobs (Belderbos & Sleuwaegen...

  4. Anesthesia Approach in Endovascular Aortic Reconstruction

    Ayşin Alagöl


    Full Text Available Introduction: We have analyzed our initial results of our anesthesia techniques in our new-onset endovascular aortic reconstruction cases.Patients and Methods: The perioperative data of 15 elective and emergent endovascular aortic reconstruction cases that were operated in 2010-2011 were collected in a database. The choice of anesthesia was made by the risk factors, surgical team’s preferences, type and location of the aortic pathology and by the predicted operation duration. The data of local and general anesthesia cases were compared.Results: Thirteen (86.7% cases were male and 2 (13.3% female. Eleven patients were in ASA Class III. The demographic parameters, ASA classifications, concurrent diseases were similar in both groups. Thirteen (86.7% cases had infrarenal abdominal aortic aneurysm and 2 (13.3% had Type III aortic dissection. The diastolic arterial pressures were lower in general anesthesia group in 20th and 40th minutes’ measurements just like the mean arterial pressure measurements at the 40th, 100th minutes and during the deployment of the graft. Postoperative mortality occurred in 3 (20.0% patients and they all had general anesthesia and they were operated on emergency basis. Postoperative morbidity occurred in four patients that had general anesthesia (acute renal failure, multi-organ failure and pneumonia. The other patient had atrial fibrillation on the 1st postoperative day and was converted to sinus rhythm with amiodarone infusion.Conclusion: Edovascular aortic reconstruction procedures can safely be performed with both general and local anesthesia less invasively compared to open surgery. General anesthesia may be preferred for the better hemodynamic control.

  5. Local Recurrence in Women With Stage I Breast Cancer: Declining Rates Over Time in a Large, Population-Based Cohort

    Canavan, Joycelin, E-mail: [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Truong, Pauline T.; Smith, Sally L. [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Lu, Linghong; Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, British Columbia (Canada); Olivotto, Ivo A. [Department of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary (Canada)


    Purpose: To evaluate whether local recurrence (LR) risk has changed over time among women with stage I breast cancer treated with breast-conserving therapy. Methods and Materials: Subjects were 5974 women aged ≥50 years diagnosis with pT1N0 breast cancer from 1989 to 2006, treated with breast-conserving surgery and radiation therapy. Clinicopathologic characteristics, treatment, and LR outcomes were compared among 4 cohorts stratified by year of diagnosis: 1989 to 1993 (n=1077), 1994 to 1998 (n=1633), 1999 to 2002 (n=1622), and 2003 to 2006 (n=1642). Multivariable analysis was performed, with year of diagnosis as a continuous variable. Results: Median follow-up time was 8.6 years. Among patients diagnosed in 1989 to 1993, 1994 to 1998, 1999 to 2002, and 2003 to 2006, the proportions of grade 1 tumors increased (16% vs 29% vs 40% vs 39%, respectively, P<.001). Surgical margin clearance rates increased from 82% to 93% to 95% and 88%, respectively (P<.001). Over time, the proportions of unknown estrogen receptor (ER) status decreased (29% vs 10% vs 1.2% vs 0.5%, respectively, P<.001), whereas ER-positive tumors increased (56% vs 77% vs 86% vs 86%, respectively, P<.001). Hormone therapy use increased (23% vs 23% vs 62% vs 73%, respectively, P<.001), and chemotherapy use increased (2% vs 5% vs 10% vs 13%, respectively, P<.001). The 5-year cumulative incidence rates of LR over the 4 time periods were 2.8% vs 1.7% vs 0.9% vs 0.8%, respectively (Gray's test, P<.001). On competing risk multivariable analysis, year of diagnosis was significantly associated with decreased LR (hazard ratio, 0.92 per year, P=.0003). Relative to grade 1 histology, grades 2, 3, and unknown were associated with increased LR. Hormone therapy use was associated with reduced LR. Conclusion: Significant changes in the multimodality management of stage I breast cancer have occurred over the past 2 decades. More favorable-risk tumors were diagnosed, and margin clearance and systemic therapy use

  6. Local Recurrence in Women With Stage I Breast Cancer: Declining Rates Over Time in a Large, Population-Based Cohort

    Canavan, Joycelin; Truong, Pauline T.; Smith, Sally L.; Lu, Linghong; Lesperance, Mary; Olivotto, Ivo A.


    Purpose: To evaluate whether local recurrence (LR) risk has changed over time among women with stage I breast cancer treated with breast-conserving therapy. Methods and Materials: Subjects were 5974 women aged ≥50 years diagnosis with pT1N0 breast cancer from 1989 to 2006, treated with breast-conserving surgery and radiation therapy. Clinicopathologic characteristics, treatment, and LR outcomes were compared among 4 cohorts stratified by year of diagnosis: 1989 to 1993 (n=1077), 1994 to 1998 (n=1633), 1999 to 2002 (n=1622), and 2003 to 2006 (n=1642). Multivariable analysis was performed, with year of diagnosis as a continuous variable. Results: Median follow-up time was 8.6 years. Among patients diagnosed in 1989 to 1993, 1994 to 1998, 1999 to 2002, and 2003 to 2006, the proportions of grade 1 tumors increased (16% vs 29% vs 40% vs 39%, respectively, P<.001). Surgical margin clearance rates increased from 82% to 93% to 95% and 88%, respectively (P<.001). Over time, the proportions of unknown estrogen receptor (ER) status decreased (29% vs 10% vs 1.2% vs 0.5%, respectively, P<.001), whereas ER-positive tumors increased (56% vs 77% vs 86% vs 86%, respectively, P<.001). Hormone therapy use increased (23% vs 23% vs 62% vs 73%, respectively, P<.001), and chemotherapy use increased (2% vs 5% vs 10% vs 13%, respectively, P<.001). The 5-year cumulative incidence rates of LR over the 4 time periods were 2.8% vs 1.7% vs 0.9% vs 0.8%, respectively (Gray's test, P<.001). On competing risk multivariable analysis, year of diagnosis was significantly associated with decreased LR (hazard ratio, 0.92 per year, P=.0003). Relative to grade 1 histology, grades 2, 3, and unknown were associated with increased LR. Hormone therapy use was associated with reduced LR. Conclusion: Significant changes in the multimodality management of stage I breast cancer have occurred over the past 2 decades. More favorable-risk tumors were diagnosed, and margin clearance and systemic therapy use

  7. Evidence-Based ACL Reconstruction



    Full Text Available There is controversy in the literature regarding a number of topics related to anterior cruciate ligament (ACLreconstruction. The purpose of this article is to answer the following questions: 1 Bone patellar tendon bone (BPTB reconstruction or hamstring reconstruction (HR; 2 Double bundle or single bundle; 3 Allograft or authograft; 4 Early or late reconstruction; 5 Rate of return to sports after ACL reconstruction; 6 Rate of osteoarthritis after ACL reconstruction. A Cochrane Library and PubMed (MEDLINE search of systematic reviews and meta-analysis related to ACL reconstruction was performed. The key words were: ACL reconstruction, systematic reviews and meta-analysis. The main criteria for selection were that the articles were systematic reviews and meta-analysesfocused on the aforementioned questions. Sixty-nine articles were found, but only 26 were selected and reviewed because they had a high grade (I-II of evidence. BPTB-R was associated with better postoperative knee stability but with a higher rate of morbidity. However, the results of both procedures in terms of functional outcome in the long-term were similar. The double-bundle ACL reconstruction technique showed better outcomes in rotational laxity, although functional recovery was similar between single-bundle and double-bundle. Autograft yielded better results than allograft. There was no difference between early and delayed reconstruction. 82% of patients were able to return to some kind of sport participation. 28% of patients presented radiological signs of osteoarthritis with a follow-up of minimum 10 years.

  8. Reconstructing human evolution



    One can reconstruct human evolution using modern genetic data and models based on the mathematical theory of evolution and its four major factors : mutation, natural selection, statistical fluctuations in finite populations (random genetic drift), and migration. Archaeology gives some help on the major dates and events of the process. Chances of studying ancient DNA are very limited but there have been a few successful results. Studying DNA instead of proteins, as was done until a few years ago, and in particular the DNA of mitochondria and of the Y chromosome which are transmitted, respectively, by the maternal line and the paternal line, has greatly simplified the analysis. It is now possible to carry the analysis on individuals, while earlier studies were of necessity based on populations. Also the evolution of ÒcultureÓ (i.e. what we learn from others), in particular that of languages, gives some help and can be greatly enlightened by genetic studies. Even though it is largely based on mechanisms of mut...

  9. 3D noise power spectrum applied on clinical MDCT scanners: effects of reconstruction algorithms and reconstruction filters

    Miéville, Frédéric A.; Bolard, Gregory; Benkreira, Mohamed; Ayestaran, Paul; Gudinchet, François; Bochud, François; Verdun, Francis R.


    The noise power spectrum (NPS) is the reference metric for understanding the noise content in computed tomography (CT) images. To evaluate the noise properties of clinical multidetector (MDCT) scanners, local 2D and 3D NPSs were computed for different acquisition reconstruction parameters. A 64- and a 128-MDCT scanners were employed. Measurements were performed on a water phantom in axial and helical acquisition modes. CT dose index was identical for both installations. Influence of parameters such as the pitch, the reconstruction filter (soft, standard and bone) and the reconstruction algorithm (filtered-back projection (FBP), adaptive statistical iterative reconstruction (ASIR)) were investigated. Images were also reconstructed in the coronal plane using a reformat process. Then 2D and 3D NPS methods were computed. In axial acquisition mode, the 2D axial NPS showed an important magnitude variation as a function of the z-direction when measured at the phantom center. In helical mode, a directional dependency with lobular shape was observed while the magnitude of the NPS was kept constant. Important effects of the reconstruction filter, pitch and reconstruction algorithm were observed on 3D NPS results for both MDCTs. With ASIR, a reduction of the NPS magnitude and a shift of the NPS peak to the low frequency range were visible. 2D coronal NPS obtained from the reformat images was impacted by the interpolation when compared to 2D coronal NPS obtained from 3D measurements. The noise properties of volume measured in last generation MDCTs was studied using local 3D NPS metric. However, impact of the non-stationarity noise effect may need further investigations.

  10. Reconstructing Topological Graphs and Continua

    Gartside, Paul; Pitz, Max F.; Suabedissen, Rolf


    The deck of a topological space $X$ is the set $\\mathcal{D}(X)=\\{[X \\setminus \\{x\\}] \\colon x \\in X\\}$, where $[Z]$ denotes the homeomorphism class of $Z$. A space $X$ is topologically reconstructible if whenever $\\mathcal{D}(X)=\\mathcal{D}(Y)$ then $X$ is homeomorphic to $Y$. It is shown that all metrizable compact connected spaces are reconstructible. It follows that all finite graphs, when viewed as a 1-dimensional cell-complex, are reconstructible in the topological sense, and more genera...

  11. Tomographic reconstruction of binary fields

    Roux, Stéphane; Leclerc, Hugo; Hild, François


    A novel algorithm is proposed for reconstructing binary images from their projection along a set of different orientations. Based on a nonlinear transformation of the projection data, classical back-projection procedures can be used iteratively to converge to the sought image. A multiscale implementation allows for a faster convergence. The algorithm is tested on images up to 1 Mb definition, and an error free reconstruction is achieved with a very limited number of projection data, saving a factor of about 100 on the number of projections required for classical reconstruction algorithms.

  12. Macrodystrophia lipomatosa: a reconstructive approach to gigantism of the foot.

    Watt, Andrew J; Chung, Kevin C


    Localized gigantism poses a challenging surgical dilemma, and it may be treated with amputation. This case report documents the application of a reconstructive approach to a severe case of pedal macrodystrophia lipomatosa in a 1-year-old girl. A series of 3 surgeries were designed to reduce the length, width, height, and overall bulk of the congenitally enlarged foot. The 3 procedures debulked the foot for normal ambulation and same-size shoe wear for both feet. The resulting functional and aesthetic improvements achieved through reconstructive treatment provided a desirable alternative to amputation.

  13. Inference-Based Surface Reconstruction of Cluttered Environments

    Biggers, K.


    We present an inference-based surface reconstruction algorithm that is capable of identifying objects of interest among a cluttered scene, and reconstructing solid model representations even in the presence of occluded surfaces. Our proposed approach incorporates a predictive modeling framework that uses a set of user-provided models for prior knowledge, and applies this knowledge to the iterative identification and construction process. Our approach uses a local to global construction process guided by rules for fitting high-quality surface patches obtained from these prior models. We demonstrate the application of this algorithm on several example data sets containing heavy clutter and occlusion. © 2012 IEEE.

  14. Reconstruction of soft tissue after complicated calcaneal fractures.

    Koski, E Antti; Kuokkanen, Hannu O M; Koskinen, Seppo K; Tukiainen, Erkki J


    A total of 35 flap reconstructions were done to cover exposed calcaneal bones in 31 patients. All patients had calcaneal fractures, 19 of which were primarily open. Soft tissue reconstruction for the closed fractures was indicated by a postoperative wound complication. A microvascular flap was used for reconstruction in 21 operations (gracilis, n = 11; anterolateral thigh, n = 5; rectus abdominis, n = 3; and latissimus dorsi, n = 2). A suralis neurocutaneous flap was used in eight, local muscle flaps in three, and local skin flaps in three cases. The mean follow-up time was 14 months (range 3 months-4 years). One suralis flap failed and was replaced by a latissimus dorsi flap. Necrosis of the edges that required revision affected three flaps. Deep infection developed in two patients and delayed wound healing in another four. During the follow-up the soft tissues healed in all patients and there were no signs of calcaneal osteitis. Flaps were considered too bulky in five patients. Soft tissues heal most rapidly with microvascular flaps. In the long term, gracilis muscle covered with free skin grafts gives a good contour to the foot. The suralis flap is reliable and gives a good final aesthetic outcome. Local muscles can be transposed for reconstruction in small defects.

  15. Reconstructive breast implantation after mastectomy for breast cancer

    Henriksen, Trine F; Fryzek, Jon P; Hölmich, Lisbet R


    BACKGROUND: Clinical reports have raised concern about local complications following breast implantation used in reconstructive or cosmetic surgery, but there is a shortage of epidemiological studies in this area. OBJECTIVE: To assess in a prospective epidemiological manner the occurrence of short......-term local complications in a nationwide implantation registry. DESIGN, SETTING, AND PARTICIPANTS: The Danish Registry for Plastic Surgery of the Breast prospectively collects preoperative, perioperative, and postoperative information on Danish women undergoing breast augmentation. Through the registry, we...... collected data on short-term local complications among 574 women who underwent postmastectomy reconstruction with breast implants from June 1, 1999, through July 24, 2003. MAIN OUTCOME MEASURES: Complication incidence rates. RESULTS: Thirty-one percent of the women who underwent initial implantation...

  16. Study of DNA reconstruction enzymes

    Sekiguchi, M [Kyushu Univ., Fukuoka (Japan). Faculty of Science


    Description was made of the characteristics and mechanism of 3 reconstructive enzymes which received from M. luteus or E. coli or T4, and of which natures were clarified as reconstructive enzymes of DNA irradiated with ultraviolet rays. As characteristics, the site of breaking, reaction, molecular weight, electric charge in the neutrality and a specific adhesion to DNA irradiated with ultraviolet rays were mentioned. As to mutant of ultraviolet ray sensitivity, hereditary control mechanism of removal and reconstruction by endo-nuclease activation was described, and suggestion was referred to removal and reconstruction of cells of xedoderma pigmentosum which is a hereditary disease of human. Description was also made as to the mechanism of exonuclease activation which separates dimer selectively from irradiated DNA.

  17. Quantum Logic and Quantum Reconstruction

    Stairs, Allen


    Quantum logic understood as a reconstruction program had real successes and genuine limitations. This paper offers a synopsis of both and suggests a way of seeing quantum logic in a larger, still thriving context.

  18. Reconstructing see-saw models

    Ibarra, Alejandro


    In this talk we discuss the prospects to reconstruct the high-energy see-saw Lagrangian from low energy experiments in supersymmetric scenarios. We show that the model with three right-handed neutrinos could be reconstructed in theory, but not in practice. Then, we discuss the prospects to reconstruct the model with two right-handed neutrinos, which is the minimal see-saw model able to accommodate neutrino observations. We identify the relevant processes to achieve this goal, and comment on the sensitivity of future experiments to them. We find the prospects much more promising and we emphasize in particular the importance of the observation of rare leptonic decays for the reconstruction of the right-handed neutrino masses

  19. Breast Reconstruction with Flap Surgery

    ... augmented with a breast implant to achieve the desired breast size. Surgical methods Autologous tissue breast reconstruction ... as long as a year or two before feeling completely healed and back to normal. Future breast ...

  20. Rational reconstructions of modern physics

    Mittelstaedt, Peter


    Newton’s classical physics and its underlying ontology are loaded with several metaphysical hypotheses that cannot be justified by rational reasoning nor by experimental evidence. Furthermore, it is well known that some of these hypotheses are not contained in the great theories of Modern Physics, such as the theory of Special Relativity and Quantum Mechanics. This book shows that, on the basis of Newton’s classical physics and by rational reconstruction, the theory of Special Relativity as well as Quantum Mechanics can be obtained by partly eliminating or attenuating the metaphysical hypotheses. Moreover, it is shown that these reconstructions do not require additional hypotheses or new experimental results. In the second edition the rational reconstructions are completed with respect to General Relativity and Cosmology. In addition, the statistics of quantum objects is elaborated in more detail with respect to the rational reconstruction of quantum mechanics. The new material completes the approach of t...

  1. Animated Reconstruction of Forensic Animation

    Hala, Albert; Unver, Ertu


    An animated accident display in court can be significant evidentiary tool. Computer graphics animation reconstructions which can be shown in court are cost effective, save valuable time and illustrate complex and technical issues, are realistic and can prove or disprove arguments or theories with reference to the perplexing newtonian physics involved in many accidents: this technology may well revolutionise accident reconstruction, thus enabling prosecution and defence to be more effective in...

  2. Equilibrium Reconstruction in EAST Tokamak

    Qian Jinping; Wan Baonian; Shen Biao; Sun Youwen; Liu Dongmei; Xiao Bingjia; Ren Qilong; Gong Xianzu; Li Jiangang; Lao, L. L.; Sabbagh, S. A.


    Reconstruction of experimental axisymmetric equilibria is an important part of tokamak data analysis. Fourier expansion is applied to reconstruct the vessel current distribution in EFIT code. Benchmarking and testing calculations are performed to evaluate and validate this algorithm. Two cases for circular and non-circular plasma discharges are presented. Fourier expansion used to fit the eddy current is a robust method and the real time EFIT can be introduced to the plasma control system in the coming campaign. (magnetically confined plasma)

  3. Differences in the dose-volume metrics with heterogeneity correction status and its influence on local control in stereotactic body radiation therapy for lung cancer

    Ueki, Nami; Matsuo, Yukinori; Nakamura, Mitsuhiro; Narabayashi, Masaru; Sakanaka, Katsuyuki; Norihisa, Yoshiki; Mizowaki, Takashi; Hiraoka, Masahiro; Shibuya, Keiko


    The purpose of this study is to evaluate the dose-volume metrics under different heterogeneity corrections and the factors associated with local recurrence (LR) after stereotactic body radiation therapy (SBRT) for non-small-cell lung cancer (NSCLC). Eighty-three patients who underwent SBRT for pathologically proven stage I NSCLC were reviewed retrospectively. The prescribed dose was 48 Gy in four fractions at the isocenter (IC) under heterogeneity correction with the Batho power law (BPL). The clinical plans were recalculated with Eclipse (Varian) for the same monitor units under the BPL and anisotropic analytical algorithm (AAA) and with no heterogeneity correction (NC). The dose at the IC, dose that covers 95% of the volume (D95), minimum dose (Min), and mean dose (Mean) of the planning target volume (PTV) were compared under each algorithm and between patients with local lesion control (LC) and LR. The IC doses under NC were significantly lower than those under the BPL and AAA. Under the BPL, the mean PTV D95, Min and Mean were 8.0, 9.4 and 7.4% higher than those under the AAA, and 9.6, 9.2 and 4.6% higher than those under NC, respectively. Under the AAA, all dose-volumetric parameters were significantly lower in T1a patients than in those with T1b and T2a. With a median follow-up of 35.9 months, LR occurred in 18 patients. Between the LC and LR groups, no significant differences were observed for any of the metrics. Even after stratification according to T-stage, no significant difference was observed between LC and LR. (author)

  4. Secondary reconstruction of maxillofacial trauma.

    Castro-Núñez, Jaime; Van Sickels, Joseph E


    Craniomaxillofacial trauma is one of the most complex clinical conditions in contemporary maxillofacial surgery. Vital structures and possible functional and esthetic sequelae are important considerations following this type of trauma and intervention. Despite the best efforts of the primary surgery, there are a group of patients that will have poor outcomes requiring secondary reconstruction to restore form and function. The purpose of this study is to review current concepts on secondary reconstruction to the maxillofacial complex. The evaluation of a posttraumatic patient for a secondary reconstruction must include an assessment of the different subunits of the upper face, middle face, and lower face. Virtual surgical planning and surgical guides represent the most important innovations in secondary reconstruction over the past few years. Intraoperative navigational surgery/computed-assisted navigation is used in complex cases. Facial asymmetry can be corrected or significantly improved by segmentation of the computerized tomography dataset and mirroring of the unaffected side by means of virtual surgical planning. Navigational surgery/computed-assisted navigation allows for a more precise surgical correction when secondary reconstruction involves the replacement of extensive anatomical areas. The use of technology can result in custom-made replacements and prebent plates, which are more stable and resistant to fracture because of metal fatigue. Careful perioperative evaluation is the key to positive outcomes of secondary reconstruction after trauma. The advent of technological tools has played a capital role in helping the surgical team perform a given treatment plan in a more precise and predictable manner.

  5. Technical basis for dose reconstruction

    Anspaugh, L.R.


    The purpose of this paper is to consider two general topics: Technical considerations of why dose-reconstruction studies should or should not be performed and methods of dose reconstruction. The first topic is of general and growing interest as the number of dose-reconstruction studies increases, and one asks the question whether it is necessary to perform a dose reconstruction for virtually every site at which, for example, the Department of Energy (DOE) has operated a nuclear-related facility. And there is the broader question of how one might logically draw the line at performing or not performing dose-reconstruction (radiological and chemical) studies for virtually every industrial complex in the entire country. The second question is also of general interest. There is no single correct way to perform a dose-reconstruction study, and it is important not to follow blindly a single method to the point that cheaper, faster, more accurate, and more transparent methods might not be developed and applied. 90 refs., 4 tabs

  6. Technical basis for dose reconstruction

    Anspaugh, L.R.


    The purpose of this paper is to consider two general topics: technical considerations of why dose-reconstruction studies should or should not be performed and methods of dose reconstruction. The first topic is of general and growing interest as the number of dose-reconstruction studies increases, and one asks the question whether it is necessary to perform a dose reconstruction for virtually every site at which, for example, the Department of Energy (DOE) has operated a nuclear-related facility. And there is the broader question of how one might logically draw the line at performing or not performing dose-reconstruction (radiological and chemical) studies for virtually every industrial complex in the entire country. The second question is also of general interest. There is no single correct way to perform a dose-reconstruction study, and it is important not to follow blindly a single method to the point that cheaper, faster, more accurate, and more transparent methods might not be developed and applied

  7. Pedicle Anterolateral Thigh Flap Reconstruction after Pelvic Tumor Resection: A Case Report

    Robert M. Whitfield


    Full Text Available A 47-year-old female with a locally advanced urologic malignancy previously managed with resection, diversion, and postoperative radiation therapy presented for management of her recurrent cancer that had eroded through the soft tissues of the left inner thigh and vulva. On all staging studies the tumor involved the left common femoral artery, and vein, both above and below the inguinal ligament. The difficulty with such tumors is the availability of tissue to reconstruct the defect. The patient had a history of deep venous thrombosis in the femoral venous system. A local flap was the most logical type of reconstruction. The patient had a right lower quadrant ureterostomy with a large parastomal hernia which further limited the local flap options. An anterolateral thigh flap from the opposite thigh was used to reconstruct the soft tissue deficit in this patient. This resurfaced the defect and provided coverage for the vascular reconstruction.

  8. 3D Reconstruction of human bones based on dictionary learning.

    Zhang, Binkai; Wang, Xiang; Liang, Xiao; Zheng, Jinjin


    An effective method for reconstructing a 3D model of human bones from computed tomography (CT) image data based on dictionary learning is proposed. In this study, the dictionary comprises the vertices of triangular meshes, and the sparse coefficient matrix indicates the connectivity information. For better reconstruction performance, we proposed a balance coefficient between the approximation and regularisation terms and a method for optimisation. Moreover, we applied a local updating strategy and a mesh-optimisation method to update the dictionary and the sparse matrix, respectively. The two updating steps are iterated alternately until the objective function converges. Thus, a reconstructed mesh could be obtained with high accuracy and regularisation. The experimental results show that the proposed method has the potential to obtain high precision and high-quality triangular meshes for rapid prototyping, medical diagnosis, and tissue engineering. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

  9. Pathological Predictors for Site of Local Recurrence After Radiotherapy for Prostate Cancer

    Chopra, Supriya [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Toi, Ants [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Medical Imaging, University of Toronto, Toronto (Canada); Taback, Nathan [Division of Biostatistics, Dalla Lana School of Public Health, University of Toronto, Toronto (Canada); Evans, Andrew [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Pathology, University of Toronto, Toronto (Canada); Haider, Masoom A. [Princess Margaret Hospital, University Health Network, Toronto (Canada); Department of Medical Imaging, University of Toronto, Toronto (Canada); Sunnybrook Health Sciences Center, Toronto (Canada); Milosevic, Michael; Bristow, Robert G.; Chung, Peter; Bayley, Andrew [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Morton, Gerard; Vesprini, Danny [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Odette Cancer Center, Sunnybrook Health Sciences Center, Toronto (Canada); Warde, Padraig; Catton, Charles [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada); Menard, Cynthia, E-mail: [Department of Radiation Oncology, University of Toronto, Toronto (Canada); Princess Margaret Hospital, University Health Network, Toronto (Canada)


    Purpose: Rational design of targeted radiotherapy (RT) in prostate cancer (Pca) hinges on a better understanding of spatial patterns of recurrence. We sought to identify pathological factors predictive for site of local recurrence (LR) after external beam RT. Methods and Materials: Prospective databases were reviewed to identify men with LR after RT from 1997 through 2009. Patients with biochemical failure and biopsy-confirmed Pca more than 2 years after RT were evaluated. Prediction for site of recurrence based on the following pretreatment factors was determined on independent and cluster-sextant basis: presence of malignancy, dominant vs. nondominant percentage core length (PCL) involvement, PCL {>=} or <40%, and Gleason score. Sites of dominant PCL were defined as sextants with peak PCL involvement minus 10%, and >5% for each patient. Results: Forty-one patients with low-intermediate risk Pca constituted the study cohort. Median time to biopsy after RT was 51 months (range, 24-145). Of 246 sextants, 74 were involved with tumor at baseline. When sextants are treated as independent observations the presence of malignancy (77% vs. 22%, p = 0.0001), dominant PCL (90% vs. 46%, p = 0.0001), and PCL {>=}40% (89% vs. 68 %, p = 0.04) were found to be significant predictors for LR, although PCL {>=}40% did not retain statistical significance if sextants were considered correlated. The vast majority of patients (95%) recurred at the original site of dominant PCL or PCL {>=}40%, and 44% also recurred in regions of nondominant PCL <40% (n = 8) and/or benign sampling (n = 14) at baseline. Conclusions: LR after RT predominantly occurs in regions bearing higher histological tumor burden but are not isolated to these sites. Our data highlights the value of spatially resolved baseline pathological sampling and may assist in the design of clinical trials tailoring RT dose prescriptions to subregions of the prostate gland.

  10. Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

    Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel


    The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. 48Ca+249Bk fusion reaction leading to element Z = 117: long-lived α-decaying 270Db and discovery of 266Lr.

    Khuyagbaatar, J; Yakushev, A; Düllmann, Ch E; Ackermann, D; Andersson, L-L; Asai, M; Block, M; Boll, R A; Brand, H; Cox, D M; Dasgupta, M; Derkx, X; Di Nitto, A; Eberhardt, K; Even, J; Evers, M; Fahlander, C; Forsberg, U; Gates, J M; Gharibyan, N; Golubev, P; Gregorich, K E; Hamilton, J H; Hartmann, W; Herzberg, R-D; Heßberger, F P; Hinde, D J; Hoffmann, J; Hollinger, R; Hübner, A; Jäger, E; Kindler, B; Kratz, J V; Krier, J; Kurz, N; Laatiaoui, M; Lahiri, S; Lang, R; Lommel, B; Maiti, M; Miernik, K; Minami, S; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Pang, G K; Papadakis, P; Renisch, D; Roberto, J; Rudolph, D; Runke, J; Rykaczewski, K P; Sarmiento, L G; Schädel, M; Schausten, B; Semchenkov, A; Shaughnessy, D A; Steinegger, P; Steiner, J; Tereshatov, E E; Thörle-Pospiech, P; Tinschert, K; Torres De Heidenreich, T; Trautmann, N; Türler, A; Uusitalo, J; Ward, D E; Wegrzecki, M; Wiehl, N; Van Cleve, S M; Yakusheva, V


    The superheavy element with atomic number Z=117 was produced as an evaporation residue in the (48)Ca+(249)Bk fusion reaction at the gas-filled recoil separator TASCA at GSI Darmstadt, Germany. The radioactive decay of evaporation residues and their α-decay products was studied using a detection setup that allowed measuring decays of single atomic nuclei with half-lives between sub-μs and a few days. Two decay chains comprising seven α decays and a spontaneous fission each were identified and are assigned to the isotope (294)117 and its decay products. A hitherto unknown α-decay branch in (270)Db (Z = 105) was observed, which populated the new isotope (266)Lr (Z = 103). The identification of the long-lived (T(1/2) = 1.0(-0.4)(+1.9) h) α-emitter (270)Db marks an important step towards the observation of even more long-lived nuclei of superheavy elements located on an "island of stability."

  12. Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

    Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.


    General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

  13. Long-term determination of airborne concentrations of unattached and attached radon progeny using stacked LR 115 detector with multi-step etching

    Nikezic, D.; Yu, K.N.


    We developed the theoretical basis for long-term determination of airborne concentrations of unattached and attached radon progeny. The work was separated into two parts. First, we showed that (stacked and multiply etched) LR 115 detectors could be used to determine airborne concentrations of the short-lived radon progeny, 218 Po and 214 Bi. The equilibrium factor F between radon and its progeny could then be determined through the use of the reduced equilibrium factor F red . The airborne concentrations of 214 Pb could then be determined. Second, we developed a method based on the airborne concentrations of 218 Po, 214 Pb and 214 Bi to determine the parameters of the Jacobi room model, viz., the ventilation rate λ v , aerosol attachment rate λ a , deposition rate of unattached progeny λ d u and the deposition rate of attached progeny λ d u . With these parameters, the unattached fraction f p of the potential alpha energy concentration could also be determined. Knowledge of f p , together with F, would enable more accurate determination of the effective dose in the human lung.

  14. Review of Nipple Reconstruction Techniques and Introduction of V to Y Technique in a Bilateral Wise Pattern Mastectomy or Reduction Mammaplasty

    Riccio, Charles A.; Zeiderman, Matthew R.; Chowdhry, Saeed; Wilhelmi, Bradon J.


    Introduction: Nipple-areola complex reconstruction (NAR) is the final procedure in breast reconstruction after the majority of mastectomies. Many methods of NAR have been described, each with inherent advantages and disadvantages depending on local healthy tissue availability, previous scarring and procedures, and the operative morbidity of the NAR technique. Nipple reconstructions may be complicated by scars or previous nipple reconstruction, making the procedure more challenging. We propose...

  15. Beard reconstruction: A surgical algorithm.

    Ninkovic, M; Heidekrueger, P I; Ehrl, D; von Spiegel, F; Broer, P N


    Facial defects with loss of hair-bearing regions can be caused by trauma, infection, tumor excision, or burn injury. The presented analysis evaluates a series of different surgical approaches with a focus on male beard reconstruction, emphasizing the role of tissue expansion of regional and free flaps. Locoregional and free flap reconstructions were performed in 11 male patients with 14 facial defects affecting the hair-bearing bucco-mandibular or perioral region. In order to minimize donor-site morbidity and obtain large amounts of thin, pliable, hair-bearing tissue, pre-expansion was performed in five of 14 patients. Eight of 14 patients were treated with locoregional flap reconstructions and six with free flap reconstructions. Algorithms regarding pre- and intraoperative decision making are discussed and long-term (mean follow-up 1.5 years) results analyzed. Major complications, including tissue expander infection with the need for removal or exchange, partial or full flap loss, occurred in 0% (0/8) of patients with locoregional flaps and in 17% (1/6) of patients undergoing free flap reconstructions. Secondary refinement surgery was performed in 25% (2/8) of locoregional flaps and in 67% (4/6) of free flaps. Both locoregional and distant tissue transfers play a role in beard reconstruction, while pre-expansion remains an invaluable tool. Paying attention to the presented principles and considering the significance of aesthetic facial subunits, range of motion, aesthetics, and patient satisfaction were improved long term in all our patients while minimizing donor-site morbidity. Copyright © 2016 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.


    Atishkumar B.
