WorldWideScience

Sample records for lr fields present

  1. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    Science.gov (United States)

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  2. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Directory of Open Access Journals (Sweden)

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  3. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  4. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  5. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  6. Study of the weekly irrigation cycle of a cultivated field in a semi-arid area (Marrakech region, Morocco) by using CR-39 and LR-115 II track detectors and radon as a natural tracer

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Essaouif, Z.

    2007-01-01

    Uranium ( 238 U) and thorium ( 232 Th) concentrations were measured in the soil of a cultivated field situated in a semi-arid area (Marrakech, Morocco) by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The same track detectors were used for measuring alpha- and beta-activities due to radon and thoron gases emanating from the soil of the studied irrigated agricultural field. The influence of the humidity (soil water content), soil depth and climate conditions on the weekly irrigation cycle of the studied cultivated field was investigated by exploiting radon measurements

  7. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  8. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  9. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  10. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  11. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  12. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  13. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  14. Bulk etch rate of LR-115 cellulose nitrate film

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  15. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  16. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  17. Field endocrinology of nonhuman primates: past, present, and future.

    Science.gov (United States)

    Higham, James P

    2016-08-01

    In the past few decades, research on nonhuman primate endocrinology has moved from the lab to the field, leading to a huge increase in both the breadth and depth of primate field studies. Here, I discuss the past, present, and future of primate field endocrinology. I review the history of the field, and go on to discuss methodological developments and the issues that they sometimes entail. Next, I consider ways in which we might conceptualize the role of hormones, and focus on the need to distinguish proximate from ultimate levels of explanation. Current potentially problematic issues in the field include: 1) an inability to obtain noninvasive measurements of Central Nervous System (CNS) rather than peripheral hormone concentrations; 2) research questions that become stuck (e.g., questions regarding sexual swelling expression mechanisms); 3) data dredging and post-hoc linking of hormones to any plausible variable, leading to a lack of clarity on their role in animal ecology and behavior. I finish by discussing several unanswered questions that might benefit from further research. These are how we might: 1) best obtain measurements for CNS hormone concentrations non-invasively; 2) measure hormone receptor expression alongside hormone concentrations; 3) consider the human endocrinology literature more thoroughly and perhaps take more multimarker approaches; 4) better consider the social environment, including audience and dyadic familiarity effects; and 5) apply our findings to conservation issues. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Reactor prospects and present status of field-reversed configurations

    International Nuclear Information System (INIS)

    Hoffman, A.L.

    1995-01-01

    Field-Reversed Configurations (FRC) have an ideal geometry for a reactor, combining high beta toroidal confinement, with a linear external geometry. Present small diameter FRCs are thought to be stabilized by kinetic effects, but recent experiments in the Large s Experiment (LSX) have demonstrated stability as well into the MHD regime. Present empirical transport coefficients are already sufficient for a small pulsed reactor, but small steady state reactors will require about an order of magnitude reduction in plasma diffusivity. 13 refs., 4 figs., 1 tab

  19. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  20. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  1. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  2. Nanomaterials in the field of design ergonomics: present status.

    Science.gov (United States)

    Chowdhury, Anirban; Sanjog, J; Reddy, Swathi Matta; Karmakar, Sougata

    2012-01-01

    Application of nanotechnology and nanomaterials is not new in the field of design, but a recent trend of extensive use of nanomaterials in product and/or workplace design is drawing attention of design researchers all over the world. In the present paper, an attempt has been made to describe the diverse use of nanomaterials in product and workplace design with special emphasis on ergonomics (occupational health and safety; thermo-regulation and work efficiency, cognitive interface design; maintenance of workplace, etc.) to popularise the new discipline 'nanoergonomics' among designers, design users and design researchers. Nanoergonomics for sustainable product and workplace design by minimising occupational health risks has been felt by the authors to be an emerging research area in coming years. Use of nanomaterials in the field of design ergonomics is less explored till date. In the present review, an attempt has been made to extend general awareness among ergonomists/designers about applications of nanomaterials/nanotechnology in the field of design ergonomics and about health implications of nanomaterials during their use.

  3. History and present status of field application of radiotracers, (2)

    International Nuclear Information System (INIS)

    Koyama, Takeo; Shimizu, Makoto.

    1988-01-01

    In the field of agriculture, radiotracers were first used in 1957 in studies for improvement in fertilizing techniques. Techniques were established for accurate measurement of extremely low radioactivity in crops and for the separate determination of the phosphorus in crops of the fertilizer origin and soil origin. Then, RI or stable isotope tracing test methods were developed using 32 P or 15 N to determine the flow and absorption of fertilizers. Other techniques using radiotracers developed in this period served for the construction of maps of the root activity of crops, investigation of the effects of different fertilizers in farms where double-cropping was practised, identification of suitable fertilizers for orange cultivation, development of new fertilizing techniques for Japanese persimmon cultivation, etc. Practically, no field use of radiotracers has been found since 1970. At present, it is prohibited and replaced by other techniques using stable isotopes, etc. In the field fishery, radiotracers have been used for studies of various dynamic phenomena including the flow of water and deposits in the sea, behaviors of fish, food, chain, circulation of chemical substances in the ecological system, etc. (Nogami, K.)

  4. Biodegradação da hepatotoxina(D-Leu1-microcistina-LR por bactérias presentes em filtros biológicos de carvão

    Directory of Open Access Journals (Sweden)

    Alessandro Minillo

    2013-09-01

    Full Text Available A persistência das microcistinas (MCs em ambientes aquáticos e sua difícil remoção no tratamento convencional de água representam um desafio às companhias de saneamento. Contudo, as MCs são susceptíveis à degradação por bactérias presentes na água, sedimentos e efluentes de esgotos. Neste estudo, avaliou-se a biodegradação de MCs por microrganismos presentes em filtros de carvão com atividade biológica (CAB e sua identificação filogenética pelo sequenciamento do gene 16S RNA. Foi utilizada uma água de estudo contendo MCs com diferentes composições, acrescida de efluente de filtros CAB. Os resultados demonstraram que as MCs foram biodegradadas por microrganismos presentes no biofilme. Este estudo infere sobre a capacidade de biodegradação de MCs por bactérias presentes em filtros CAB e o possível uso destes microorganismos como alternativa de remoção de MCs no tratamento de água potável.

  5. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  6. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  7. Medium and Heavy Duty Vehicle Field Evaluations (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Walkowicz, K.

    2014-06-01

    This presentation discusses field evaluations of medium- and heavy-duty vehicles performed by NREL. The project provides medium-duty (MD) and heavy-duty (HD) test results, aggregated data, and detailed analysis, including 3rd party unbiased data (data that would not normally be shared by industry in an aggregated and detailed manner). Over 5.6 million miles of advanced technology MD and HD truck data have been collected, documented, and analyzed on over 240 different vehicles since 2002. Data, analysis, and reports are shared within DOE, national laboratory partners, and industry for R&D planning and strategy. The results help guide R&D for new technology development, help define intelligent usage of newly developed technology, and help fleets/users understand all aspects of advanced technology.

  8. LR1: a candidate RNA virus of Leishmania.

    OpenAIRE

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  9. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  10. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  11. History and present status of field application of radiotracers, 3

    International Nuclear Information System (INIS)

    Kimura, Shigehiko; Sato, Otomaru.

    1988-01-01

    The history and present status of the utilization of RI tracers for hydrology are described by dividing into surface water and groundwater. By the birth of nuclear reactors, the availability of RIs became easy, and the utilization of tracers for hydrology has been attempted worldwide. The large scale development of water resources is required for increasing agricultural production, and the analysis of the actual condition of hydrological phenomena is indispensable for the purpose. The hydrology committee of IAEA aided the development of new techniques in the peaceful use of atomic energy, and let developing countries use the developed techniques together with researchers. The research on the field application of RI tracers in Japan began in agriculture, and the investigation of water leak in dams, the measurement of flow rate and flow velocity in rivers, the detection of the state of sand movement on sea bottom, the analysis of groundwater flow and so on have been carried out. Also the recent situation in foreign countries is reported about the measurement of flow rate, the measurement of flowing-down time and diffusion, the analysis of the behavior of lake water, the movement of mud and sediment, and the analysis of groundwater flow. (Kako, I.)

  12. History and present status of field application of radiotracers, 3

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Shigehiko; Sato, Otomaru

    1988-06-01

    The history and present status of the utilization of RI tracers for hydrology are described by dividing into surface water and groundwater. By the birth of nuclear reactors, the availability of RIs became easy, and the utilization of tracers for hydrology has been attempted worldwide. The large scale development of water resources is required for increasing agricultural production, and the analysis of the actual condition of hydrological phenomena is indispensable for the purpose. The hydrology committee of IAEA aided the development of new techniques in the peaceful use of atomic energy, and let developing countries use the developed techniques together with researchers. The research on the field application of RI tracers in Japan began in agriculture, and the investigation of water leak in dams, the measurement of flow rate and flow velocity in rivers, the detection of the state of sand movement on sea bottom, the analysis of groundwater flow and so on have been carried out. Also the recent situation in foreign countries is reported about the measurement of flow rate, the measurement of flowing-down time and diffusion, the analysis of the behavior of lake water, the movement of mud and sediment, and the analysis of groundwater flow. (Kako, I.).

  13. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  14. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  15. Short presentation on some researches activities about near field earthquakes

    International Nuclear Information System (INIS)

    Donald, John

    2002-01-01

    The major hazard posed by earthquakes is often thought to be due to moderate to large magnitude events. However, there have been many cases where earthquakes of moderate and even small magnitude have caused very significant destruction when they have coincided with population centres. Even though the area of intense ground shaking caused by such events is generally small, the epicentral motions can be severe enough to cause damage even in well-engineered structures. Two issues are addressed here, the first being the identification of the minimum earthquake magnitude likely to cause damage to engineered structures and the limits of the near-field for small-to-moderate magnitude earthquakes. The second issue addressed is whether features of near-field ground motions such as directivity, which can significantly enhance the destructive potential, occur in small-to-moderate magnitude events. The accelerograms from the 1986 San Salvador (El Salvador) earthquake indicate that it may be non conservative to assume that near-field directivity effects only need to be considered for earthquakes of moment magnitude M 6.5 and greater. (author)

  16. WWER safety investigations on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  17. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  18. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  19. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  20. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  1. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  2. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  3. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  4. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  5. Survey of Viruses Present in Radish Fields in 2014

    Directory of Open Access Journals (Sweden)

    Jinsoo Chung

    2015-09-01

    Full Text Available A 2014 nationwide survey in radish fields investigated the distribution of common viruses and possible emerging viruses. Radish leaves with virus-like symptoms were collected and 108 samples assayed by RT-PCR using specific primers for Radish mosaic virus (RaMV, Cucumber mosaic virus (CMV, and Turnip mosaic virus (TuMV; 47 samples were TuMV positive, and RaMV and CMV were detected in 3 and 2 samples, respectively. No samples showed double infection of TuMV/RaMV, or RaMV/CMV, but two double infections of TuMV/CMV were detected. TuMV isolates were sorted by symptom severity, and three isolates (R007-mild; R041 and R065-severe selected for BLAST and phylogenetic analysis, which indicated that the coat protein (CP of these isolates (R007, R041, and R065 have approx. 98-99% homology to a previously reported TuMV isolate. RaMV CP showed approx. 99% homology to a previously reported isolate, and the CMV CP is identical to a previously reported Korean isolate (GenBank : GU327368. Three isolates of TuMV showing different pathogenicity (degree of symptom severity will be valuable to study determinants of pathogenicity.

  6. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  7. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Absolute Transition Rates in {sup 188}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  9. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  10. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  12. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  13. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  14. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  15. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  16. Presentation

    Directory of Open Access Journals (Sweden)

    Eduardo Vicente

    2013-06-01

    Full Text Available In the present edition of Significação – Scientific Journal for Audiovisual Culture and in the others to follow something new is brought: the presence of thematic dossiers which are to be organized by invited scholars. The appointed subject for the very first one of them was Radio and the invited scholar, Eduardo Vicente, professor at the Graduate Course in Audiovisual and at the Postgraduate Program in Audiovisual Media and Processes of the School of Communication and Arts of the University of São Paulo (ECA-USP. Entitled Radio Beyond Borders the dossier gathers six articles and the intention of reuniting works on the perspectives of usage of such media as much as on the new possibilities of aesthetical experimenting being build up for it, especially considering the new digital technologies and technological convergences. It also intends to present works with original theoretical approach and original reflections able to reset the way we look at what is today already a centennial media. Having broadened the meaning of “beyond borders”, four foreign authors were invited to join the dossier. This is the first time they are being published in this country and so, in all cases, the articles where either written or translated into Portuguese.The dossier begins with “Radio is dead…Long live to the sound”, which is the transcription of a thought provoking lecture given by Armand Balsebre (Autonomous University of Barcelona – one of the most influential authors in the world on the Radio study field. It addresses the challenges such media is to face so that it can become “a new sound media, in the context of a new soundscape or sound-sphere, for the new listeners”. Andrew Dubber (Birmingham City University regarding the challenges posed by a Digital Era argues for a theoretical approach in radio studies which can consider a Media Ecology. The author understands the form and discourse of radio as a negotiation of affordances and

  17. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  18. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  19. Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The presented materials consist of presentations of international workshop which held in Warsaw from 4 to 5 October 2007. Main subject of the meeting was progress in manufacturing as well as research program development for neutron detector which is planned to be placed at GANIL laboratory and will be used in nuclear spectroscopy research

  20. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  1. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  2. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The PARIS meeting held in Cracow, Poland from 14 to 15 May 2007. The main subjects discussed during this meeting were the status of international project dedicated to gamma spectroscopy research. The scientific research program includes investigations of giant dipole resonance, probe of hot nuclei induced in heavy reactions, Jacobi shape transitions, isospin mixing and nuclear multifragmentation. The mentioned programme needs Rand D development such as new scintillations materials as lanthanum chlorides and bromides as well as new photo detection sensors as avalanche photodiodes - such subjects are also subjects of discussion. Additionally results of computerized simulations of scintillation detectors properties by means of GEANT- 4 code are presented

  4. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  5. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    International Nuclear Information System (INIS)

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  6. Visual Fields at Presentation and after Trans-sphenoidal Resection of Pituitary Adenomas

    Directory of Open Access Journals (Sweden)

    Renu Dhasmana

    2011-01-01

    Full Text Available Purpose: To evaluate visual field changes in patients with pituitary adenomas following trans-sphenoidal surgery. Methods: Eighteen patients with pituitary adenomas underwent a complete ophthalmic assessment and visual field analysis using the Humphrey Field Analyzer 30-2 program before and after trans-sphenoidal surgical resection at the Himalayan Institute of Medical Sciences over a one year period. Visual acuity, duration of symptoms, optic nerve head changes, pattern of visual field defects, and variables such as mean deviation and visual field index were compared. Results: Thirty-six eyes of 18 patients including 10 male and 8 female subjects with mean age of 35.1±9.9 years and histologically proven pituitary adenoma were included. Mean visual acuity at presentation was 0.29 logMAR which improved to 0.21 logMAR postoperatively (P = 0.305. Of 36 eyes, 24 (66.7% had visual field defects including temporal defects in 12 eyes (33.3%, non-specific defects in 10 eyes (27.8%, and peripheral field constriction in 2 eyes (5.6%. Mean deviation of visual fields at presentation was -14.28 dB which improved to -11.32 dB postoperatively. The visual field index improved from 63.5% to 75% postoperatively. Favorable visual field outcomes were correlated with shorter duration of symptoms and absence of optic nerve head changes at presentation. Conclusion: Visual field defects were present in two thirds of patients at presentation. An overall improvement in vision and visual fields was noted after surgical resection. An inverse correlation was found between the duration of symptoms and postoperative visual field recovery, signifying the importance of early surgical intervention.

  7. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  8. Effect of Visual Field Presentation on Action Planning (Estimating Reach) in Children

    Science.gov (United States)

    Gabbard, Carl; Cordova, Alberto

    2012-01-01

    In this article, the authors examined the effects of target information presented in different visual fields (lower, upper, central) on estimates of reach via use of motor imagery in children (5-11 years old) and young adults. Results indicated an advantage for estimating reach movements for targets placed in lower visual field (LoVF), with all…

  9. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    International Nuclear Information System (INIS)

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  10. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  11. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  12. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  14. Visual half-field presentations of incongruent color words: effects of gender and handedness.

    Science.gov (United States)

    Franzon, M; Hugdahl, K

    1986-09-01

    Right-handed (dextral) and left-handed (sinistral) males and females (N = 15) were compared for language lateralization in a visual half-field (VHF) incongruent color-words paradigm. The paradigm consists of repeated brief (less than 200 msec) presentations of color-words written in an incongruent color. Presentations are either to the right or to the left of center fixation. The task of the subject is to report the color the word is written in on each trial, ignoring the color-word. Color-bars and congruent color-words were used as control stimuli. Vocal reaction time (VRT) and error frequency were used as dependent measures. The logic behind the paradigm is that incongruent color-words should lead to a greater cognitive conflict when presented in the half-field contralateral to the dominant hemisphere. The results showed significantly longer VRTs in the right half-field for the dextral subjects. Furthermore, significantly more errors were observed in the male dextral group when the incongruent stimuli were presented in the right half-field. There was a similar trend in the data for the sinistral males. No differences between half-fields were observed for the female groups. It is concluded that the present results strengthen previous findings from our laboratory (Hugdahl and Franzon, 1985) that the incongruent color-words paradigm is a useful non-invasive technique for the study of lateralization in the intact brain.

  15. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  16. Recognition of emotion in hemifaces presented to the left and right visual fields.

    Science.gov (United States)

    Wedding, D; Cyrus, P

    1986-09-01

    Thirty-two right-handed subjects (16 males and 16 females) participated in a choice reaction time experiment replicating two previous studies which demonstrated the superiority of the left hemisphere in rapidly identifying facial emotion as either positive or negative. Slides of hemifaces split along the vertical axis, showing either positive (happiness, surprise) or negative (anger, disgust, or sadness) affect were presented tachistoscopically to either the left or right visual field. A 2 X 2 X 2 mixed ANOVA revealed main effects for visual field and type of affect. In contrast to earlier studies which presented full face stimuli, presentation of hemifaces produced a strong left visual field advantage and, as expected, positive faces produced faster reaction times than negative faces.

  17. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    International Nuclear Information System (INIS)

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  18. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  19. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  20. Application of the LR-56 at DOE Facilities in the United States

    International Nuclear Information System (INIS)

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  1. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    tomato Solanum lycopersicum cv. MicroTom, maintained 48 h in hydroponic growing system with "1"4C-MC-LR at 23 mg L"− "1. - Highlights: • Transfer of MCs from soil to tomato tissues is observed • MCs are present in all tissues of the tomato except in the fruit • The bioconcentration factor of the MC-LR is much more important in the tomato roots • Bound fraction of MC-LR was higher than that of free fraction in roots and leaves

  3. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    factors in organs of the tomato Solanum lycopersicum cv. MicroTom, maintained 48 h in hydroponic growing system with {sup 14}C-MC-LR at 23 mg L{sup −} {sup 1}. - Highlights: • Transfer of MCs from soil to tomato tissues is observed • MCs are present in all tissues of the tomato except in the fruit • The bioconcentration factor of the MC-LR is much more important in the tomato roots • Bound fraction of MC-LR was higher than that of free fraction in roots and leaves.

  4. Visual field defect as a presenting sign for hemorrhagic stroke caused by sildenafil

    Directory of Open Access Journals (Sweden)

    Mehdizadeh Morteza

    2008-01-01

    Full Text Available Herein, we describe the presenting symptoms, history, ophthalmic examination, visual fields and brain magnetic resonance imaging of a patient who developed left homonymous hemianopia due to right occipital lobe hemorrhage after ingestion of sildenafil citrate (Novagra Forte. To the best of our knowledge, association of homonymous hemianopia with sildenafil usage has not been reported before.

  5. Mean field theory of nuclei and shell model. Present status and future outlook

    International Nuclear Information System (INIS)

    Nakada, Hitoshi

    2003-01-01

    Many of the recent topics of the nuclear structure are concerned on the problems of unstable nuclei. It has been revealed experimentally that the nuclear halos and the neutron skins as well as the cluster structures or the molecule-like structures can be present in the unstable nuclei, and the magic numbers well established in the stable nuclei disappear occasionally while new ones appear. The shell model based on the mean field approximation has been successfully applied to stable nuclei to explain the nuclear structure as the finite many body system quantitatively and it is considered as the standard model at present. If the unstable nuclei will be understood on the same model basis or not is a matter related to fundamental principle of nuclear structure theories. In this lecture, the fundamental concept and the framework of the theory of nuclear structure based on the mean field theory and the shell model are presented to make clear the problems and to suggest directions for future researches. At first fundamental properties of nuclei are described under the subtitles: saturation and magic numbers, nuclear force and effective interactions, nuclear matter, and LS splitting. Then the mean field theory is presented under subtitles: the potential model, the mean field theory, Hartree-Fock approximation for nuclear matter, density dependent force, semiclassical mean field theory, mean field theory and symmetry, Skyrme interaction and density functional, density matrix expansion, finite range interactions, effective masses, and motion of center of mass. The subsequent section is devoted to the shell model with the subtitles: beyond the mean field approximation, core polarization, effective interaction of shell model, one-particle wave function, nuclear deformation and shell model, and shell model of cross shell. Finally structure of unstable nuclei is discussed with the subtitles: general remark on the study of unstable nuclear structure, asymptotic behavior of wave

  6. Time evolution of primordial magnetic fields and present day extragalactic magnetism

    International Nuclear Information System (INIS)

    Saveliev, Andrey

    2014-05-01

    The topic of the present thesis is the time evolution of Primordial Magnetic Fields which have been generated in the Early Universe. Assuming this so-called Cosmological Scenario of magnetogenesis to be true, it is shown in the following that this would account for the present day Extragalactic Magnetic Fields. This is particularly important in light of recent gamma ray observations which are used to derive a lower limit for the corresponding magnetic field strength, even though also an alternative approach, claiming instead that these observations are due to interactions with the Intergalactic Medium, is possible and will be tested here with Monte Carlo simulations. In order to describe the aforementioned evolution of Primordial Magnetic Fields, a set of general Master Equations for the spectral magnetic, kinetic and helical components of the system are derived and then solved numerically for the Early Universe. This semianalytical method allows it to perform a full quantitative study for the time development of the power spectra, in particular by fully taking into account the backreaction of the turbulent medium onto the magnetic fields. Applying the formalism to non-helical Primordial Magnetic Fields created on some characteristic length measure, it is shown that on large scales L their spectrum 5 builds up a slope which behaves as B∝L -(5)/(2) and governs the evolution of the coherence (or integral) scale. In addition, the claim of equipartition between the magnetic and the kinetic energy is found to be true. Extending the analysis to helical magnetic fields, it is observed that the time evolution changes dramatically, hence confirming quantitatively that an Inverse Cascade, i.e. an efficient transport of energy from small to large scales, as predicted in previous works, indeed does take place.

  7. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  8. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  9. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  10. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  11. Lexicographical structuring: the number and types of fields, data distribution, searching and data presentation

    DEFF Research Database (Denmark)

    Bergenholtz, Henning; Pedersen, Heidi Agerbo

    2015-01-01

    This contribution will not describe the structure in existing dictionaries. Instead, it will focus on the decisions that lexicographers make when they draw up the concept for and carry out the production of one or more new dictionaries, or when they consider making changes in the data presentation...... in an existing dictionary. This part of the lexicographical work is what we call structuring, which encompasses a number of various lexicographical decisions. One of these is choosing the fields that a database should contain. Typically, for some of these field types, it will be easy to distribute data......, but for other fields it will require long considerations as there are several distribution options with different outcomes of varying usefulness. A second type of lexicographical decision to be made by the lexicographer is the predefined searching, which involves in what order searches are to be made...

  12. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  14. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  15. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  16. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  17. Emotion separation is completed early and it depends on visual field presentation.

    Directory of Open Access Journals (Sweden)

    Lichan Liu

    Full Text Available It is now apparent that the visual system reacts to stimuli very fast, with many brain areas activated within 100 ms. It is, however, unclear how much detail is extracted about stimulus properties in the early stages of visual processing. Here, using magnetoencephalography we show that the visual system separates different facial expressions of emotion well within 100 ms after image onset, and that this separation is processed differently depending on where in the visual field the stimulus is presented. Seven right-handed males participated in a face affect recognition experiment in which they viewed happy, fearful and neutral faces. Blocks of images were shown either at the center or in one of the four quadrants of the visual field. For centrally presented faces, the emotions were separated fast, first in the right superior temporal sulcus (STS; 35-48 ms, followed by the right amygdala (57-64 ms and medial pre-frontal cortex (83-96 ms. For faces presented in the periphery, the emotions were separated first in the ipsilateral amygdala and contralateral STS. We conclude that amygdala and STS likely play a different role in early visual processing, recruiting distinct neural networks for action: the amygdala alerts sub-cortical centers for appropriate autonomic system response for fight or flight decisions, while the STS facilitates more cognitive appraisal of situations and links appropriate cortical sites together. It is then likely that different problems may arise when either network fails to initiate or function properly.

  18. The role of packaging size on contamination rates during simulated presentation to a sterile field.

    Directory of Open Access Journals (Sweden)

    Tony Trier

    Full Text Available The objective of this study was to assess the impact of package size on the contact between medical devices and non-sterile surfaces (i.e. the hands of the practitioner and the outside of the package during aseptic presentation to a simulated sterile field. Rationale for this objective stems from the decades-long problem of hospital-acquired infections. This work approaches the problem from a unique perspective, namely packaging size.Randomized complete block design with subsampling.Research study conducted at professional conferences for surgical technologists and nursing professionals.Ninety-seven healthcare providers, primarily surgical technologists and nurses.Participants were gloved and asked to present the contents of six pouches of three different sizes to a simulated sterile field. The exterior of pouches and gloves of participants were coated with a simulated contaminant prior to each opening trial. After presentation to the simulated sterile field, the presence of the contaminant on package contents was recorded as indicative of contact with non-sterile surfaces and analyzed in a binary fashion using a generalized linear mixed model.Recruited subjects were 26-64 years of age (81 females, 16 males, with 2.5-44 years of professional experience. Results indicated a significant main effect of pouch size on contact rate of package contents (P = 0.0108, whereby larger pouches induced greater rates of contact than smaller pouches (estimates±SEM: 14.7±2.9% vs. 6.0±1.7%, respectively.This study utilized novel methodologies which simulate contamination in aseptic presentation. Results of this work indicate that increased contamination rates are associated with larger pouches when compared to smaller pouches. The results add to a growing body of research which investigate packaging's role in serving as a pathway for product contamination during aseptic presentation. Future work should investigate other packaging design factors (e

  19. Perturbation measurements in reactor LR-0 and their evaluation

    International Nuclear Information System (INIS)

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  20. Augmented reality on poster presentations, in the field and in the classroom

    Science.gov (United States)

    Hawemann, Friedrich; Kolawole, Folarin

    2017-04-01

    Augmented reality (AR) is the direct addition of virtual information through an interface to a real-world environment. In practice, through a mobile device such as a tablet or smartphone, information can be projected onto a target- for example, an image on a poster. Mobile devices are widely distributed today such that augmented reality is easily accessible to almost everyone. Numerous studies have shown that multi-dimensional visualization is essential for efficient perception of the spatial, temporal and geometrical configuration of geological structures and processes. Print media, such as posters and handouts lack the ability to display content in the third and fourth dimensions, which might be in space-domain as seen in three-dimensional (3-D) objects, or time-domain (four-dimensional, 4-D) expressible in the form of videos. Here, we show that augmented reality content can be complimentary to geoscience poster presentations, hands-on material and in the field. In the latter example, location based data is loaded and for example, a virtual geological profile can be draped over a real-world landscape. In object based AR, the application is trained to recognize an image or object through the camera of the user's mobile device, such that specific content is automatically downloaded and displayed on the screen of the device, and positioned relative to the trained image or object. We used ZapWorks, a commercially-available software application to create and present examples of content that is poster-based, in which important supplementary information is presented as interactive virtual images, videos and 3-D models. We suggest that the flexibility and real-time interactivity offered by AR makes it an invaluable tool for effective geoscience poster presentation, class-room and field geoscience learning.

  1. The Archeomagnetic field in South America: Present status and perspectives (Invited)

    Science.gov (United States)

    Hartmann, G. A.; Trindade, R. I.; Gallet, Y.; Poletti, W.; Begnini, G. S.; Genevey, A.; Legoff, M.

    2013-12-01

    Geomagnetic field variations over decadal to millennial timescales can be determined from direct (i.e. observatory) and indirect (e.g. from archeological artifacts and volcanics) sources. Before the observatory era, the recovery of these variations is however still strongly penalized by the very uneven both geographical and temporal distributions of the available archeo/paleomagnetic dataset. In particular, the southern hemisphere contributes with only ~3% of the global archeomagnetic database. Moreover, most of these data present restrictions due to their poor experimental reliability and to the lack of good age control. Therefore, new intensity and directional data from the southern hemisphere are strongly requested for the next generation of archeomagnetic field models. In this presentation, we will report on intensity and inclination results obtained from different regions in Brazil. A collection of twenty-three site-mean archeointensity data were obtained by our team from architectural brick fragments dated to the past 500 years from Northeast and Southeast Brazil. This dataset was complemented by a series of new results from South Brazil. In addition, we also obtained inclination data, after reconstructing the firing position of the ancient bricks from modern analogs of historical brickyards. Thirteen site-mean inclination results dated to between 1790 AD and 1950 AD and five inclination results spanning the 1590-1920 AD time interval were so determined from Southeast and Northeast Brazil, respectively. Altogether, our data, which are geographically distributed over more than 20 degrees in latitude, allow us to discuss the large-scale influence in Brazil and South America of non-dipolar features of the geomagnetic field during the past few centuries.

  2. Central and Divided Visual Field Presentation of Emotional Images to Measure Hemispheric Differences in Motivated Attention.

    Science.gov (United States)

    O'Hare, Aminda J; Atchley, Ruth Ann; Young, Keith M

    2017-11-16

    Two dominant theories on lateralized processing of emotional information exist in the literature. One theory posits that unpleasant emotions are processed by right frontal regions, while pleasant emotions are processed by left frontal regions. The other theory posits that the right hemisphere is more specialized for the processing of emotional information overall, particularly in posterior regions. Assessing the different roles of the cerebral hemispheres in processing emotional information can be difficult without the use of neuroimaging methodologies, which are not accessible or affordable to all scientists. Divided visual field presentation of stimuli can allow for the investigation of lateralized processing of information without the use of neuroimaging technology. This study compared central versus divided visual field presentations of emotional images to assess differences in motivated attention between the two hemispheres. The late positive potential (LPP) was recorded using electroencephalography (EEG) and event-related potentials (ERPs) methodologies to assess motivated attention. Future work will pair this paradigm with a more active behavioral task to explore the behavioral impacts on the attentional differences found.

  3. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  4. Present status and needs of human resource development in nuclear field in Korea

    International Nuclear Information System (INIS)

    Choi, Young-Myung; Lee, Eui-Jin

    2000-01-01

    The Nuclear Training Center (NTC) of KAERI (Korea Atomic Energy Research Institute) began training technical personnel in the field of radioisotope utilization and radiation protection during the 1960's. During the first stage of the nation's nuclear power project in the 1970's, the main effort of the Center focused on training those in nuclear power and nuclear engineering. During a stage of increased technical self-reliance in the 1980's, the Center extended its training role to implement more specific training courses on nuclear power and safety fields. Since 1983, the Center has been empowered at the request of government to provide retraining courses for nuclear-related license holders and qualified engineers. The Center has offered IAEA regional training course annually for Asia and Pacific region member states since 1988. Since 1967, the total number of trainees is up to 27,777 as of the end of 1998. KEPCO (Korea Electric Power Corporation) started Nuclear Power Education Center (NPEC) in 1990. The outlines of KEPCO's in-house training programs are presented in the report. The reactor operators, and the persons engaged in nuclear fuel materials, radioisotope or radiation generating devices need particular licenses in accordance with Korean Atomic Energy Laws and Regulation. NTC/KAERI and NPEC/KEPCO should report annual retraining programs for licensed personnel to Ministry Of Science and Technology (MOST) every year. The outlines of projects, which are directly related to human resources development in nuclear field in Korea, are described in the paper. The International Atomic Energy Agency (IAEA) has made efforts to provide training programs for technical personnel of developing countries for the peaceful uses of nuclear energy. Korea has also received lots of assistance for her manpower development from the Agency. Korea is now on the verge of transforming herself from a technology recipient country in some practical and fundamental fields. The

  5. Present status and needs of human resource development in nuclear field in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Young-Myung; Lee, Eui-Jin [Nuclear Training Center, Korea Atomic Energy Research Institute, Taejon (Korea)

    2000-12-01

    The Nuclear Training Center (NTC) of KAERI (Korea Atomic Energy Research Institute) began training technical personnel in the field of radioisotope utilization and radiation protection during the 1960's. During the first stage of the nation's nuclear power project in the 1970's, the main effort of the Center focused on training those in nuclear power and nuclear engineering. During a stage of increased technical self-reliance in the 1980's, the Center extended its training role to implement more specific training courses on nuclear power and safety fields. Since 1983, the Center has been empowered at the request of government to provide retraining courses for nuclear-related license holders and qualified engineers. The Center has offered IAEA regional training course annually for Asia and Pacific region member states since 1988. Since 1967, the total number of trainees is up to 27,777 as of the end of 1998. KEPCO (Korea Electric Power Corporation) started Nuclear Power Education Center (NPEC) in 1990. The outlines of KEPCO's in-house training programs are presented in the report. The reactor operators, and the persons engaged in nuclear fuel materials, radioisotope or radiation generating devices need particular licenses in accordance with Korean Atomic Energy Laws and Regulation. NTC/KAERI and NPEC/KEPCO should report annual retraining programs for licensed personnel to Ministry Of Science and Technology (MOST) every year. The outlines of projects, which are directly related to human resources development in nuclear field in Korea, are described in the paper. The International Atomic Energy Agency (IAEA) has made efforts to provide training programs for technical personnel of developing countries for the peaceful uses of nuclear energy. Korea has also received lots of assistance for her manpower development from the Agency. Korea is now on the verge of transforming herself from a technology recipient country in some practical and

  6. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  8. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  9. Country report present status and need of human resource development in nuclear field in Vietnam

    International Nuclear Information System (INIS)

    Ngo Qui Viet; Vu Dang Ninh

    2000-01-01

    Vietnam Atomic Energy Commission (VAEC) was officially established in 1976, and is a national research and development organization in the field of nuclear science and technology for peaceful purposes in Vietnam. Under the VAEC, there are three institutes and one center. Status of main facilities, such as TRIGA MARK II, neutron generator, electron accelerator MT-17, and irradiation facilities are outlined in the paper. At present, the VAEC has a total staff of about 540 persons. The number of staff appears adequate to fulfill the present task on application of isotopes and nuclear techniques. When Vietnam decides to develop nuclear power program, the demand for human resources will be significantly high. During the last five years, Vietnam has been developing and implementing a national regulatory program on Radiation Protection and Nuclear Safety. The Ministry of Science, Technology and Environment (MOSTE) have established independent Vietnam Radiation Protection and Nuclear Safety Authority (VRPA) in 1994. If the Vietnamese Government approves the proposed nuclear power program, human resources training should be a key point for all research and development directions at all revel of personnel. When looking back in the history of formation and development of nuclear science and technology in Vietnam, the international cooperation has played an extremely important role in promoting the program. The exchange of information and direct participation in concrete cooperation activities under the framework of the Forum are expected. (Tanaka, Y.)

  10. Country report present status and need of human resource development in nuclear field in Vietnam

    Energy Technology Data Exchange (ETDEWEB)

    Ngo Qui Viet [Department of Organization and Scientific Human Resource Development, The Ministry of Science, Technology and Environment, Hanoi (Viet Nam); Vu Dang Ninh [Department of Administration and Personnel, The Vietnam Atomic Energy Commission, Hanoi (Viet Nam)

    2000-12-01

    Vietnam Atomic Energy Commission (VAEC) was officially established in 1976, and is a national research and development organization in the field of nuclear science and technology for peaceful purposes in Vietnam. Under the VAEC, there are three institutes and one center. Status of main facilities, such as TRIGA MARK II, neutron generator, electron accelerator MT-17, and irradiation facilities are outlined in the paper. At present, the VAEC has a total staff of about 540 persons. The number of staff appears adequate to fulfill the present task on application of isotopes and nuclear techniques. When Vietnam decides to develop nuclear power program, the demand for human resources will be significantly high. During the last five years, Vietnam has been developing and implementing a national regulatory program on Radiation Protection and Nuclear Safety. The Ministry of Science, Technology and Environment (MOSTE) have established independent Vietnam Radiation Protection and Nuclear Safety Authority (VRPA) in 1994. If the Vietnamese Government approves the proposed nuclear power program, human resources training should be a key point for all research and development directions at all revel of personnel. When looking back in the history of formation and development of nuclear science and technology in Vietnam, the international cooperation has played an extremely important role in promoting the program. The exchange of information and direct participation in concrete cooperation activities under the framework of the Forum are expected. (Tanaka, Y.)

  11. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    International Nuclear Information System (INIS)

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  12. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  13. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  14. International co-operation in the nuclear field - past, present and prospects

    International Nuclear Information System (INIS)

    Goldschmidt, B.

    1978-01-01

    On the occasion of the 20th anniversary of its creation, the Nuclear Energy Agency of the Organization for Economic Co-operation and Development (NEA/OECD) held a symposium in Paris on 1 and 2 February 1978. Some 200 participants from the 23 Member countries of the NEA as well as representatives of the Commission of European Communities, FORATOM and the IAEA attended the symposium. At a panel discussion at the symposium, led by Dr. Sigvard Eklund, Director General of the IAEA, the future of international co-operation between advanced nations in the nuclear field was discussed. While recognizing that nuclear energy is at present going through a period of uncertainty pending resolution of the intertwined problems of gaining public confidence and of non-proliferation, the panel expressed its strong confidence in the future of nuclear power, and the vital contribution it would make, particularly between now and the end of the century. During the meeting, a critical review was made of the way in which international co-operation has evolved since the early stages of peaceful nuclear development, and of the influence on this co-operation of the changing relationship between government and industry. The contribution of international co-operation - and its limitations - was carefully scrutinized, notably in the crucial area of the nuclear fuel cycle

  15. The Present Situation and Trend of Wearable Equipment in Electric Field Application

    OpenAIRE

    Guangwei Shao; Zhongjun Ji; Bing Liu

    2017-01-01

    With the innovation of mobile internet technology and intelligent terminal technology, the wearable equipment has been gradually applied in various industries. Through the typical application of wearable equipment, the characteristics of wearable equipment technology and application are summarized. Based on the analysis of power field business application and technology, combined with the demand of electric field management, the design situation of the wearable equipment in electric field ser...

  16. The Present Situation and Trend of Wearable Equipment in Electric Field Application

    Directory of Open Access Journals (Sweden)

    Guangwei Shao

    2017-01-01

    Full Text Available With the innovation of mobile internet technology and intelligent terminal technology, the wearable equipment has been gradually applied in various industries. Through the typical application of wearable equipment, the characteristics of wearable equipment technology and application are summarized. Based on the analysis of power field business application and technology, combined with the demand of electric field management, the design situation of the wearable equipment in electric field service is designed, and the future development direction of electric field wear can be forecasted.

  17. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Nurturing Diversity in STEM Fields through Geography: The Past, the Present, and the Future

    Science.gov (United States)

    Oyana, Tonny J.; Garcia, Sonia J.; Haegele, Jennifer A.; Hawthorne, Timothy L.; Morgan, Joe; Young, Nekya Jenise

    2015-01-01

    To date, there has been a wealth of research on participation in science, technology, engineering, and mathematics (STEM) fields, but most research focuses on the implementation of programs and whether these programs work. Such research can be expanded and enhanced by considering geographic perspectives on participation in the STEM fields and by…

  19. High impact ionization rate in silicon by sub-picosecond THz electric field pulses (Conference Presentation)

    DEFF Research Database (Denmark)

    Tarekegne, Abebe Tilahun; Iwaszczuk, Krzysztof; Hirori, Hideki

    2017-01-01

    Summary form only given. Metallic antenna arrays fabricated on high resistivity silicon are used to localize and enhance the incident THz field resulting in high electric field pulses with peak electric field strength reaching several MV/cm on the silicon surface near the antenna tips. In such high...... electric field strengths high density of carriers are generated in silicon through impact ionization process. The high density of generated carriers induces a change of refractive index in silicon. By measuring the change of reflectivity of tightly focused 800 nm light, the local density of free carriers...... near the antenna tips is measured. Using the NIR probing technique, we observed that the density of carriers increases by over 8 orders of magnitude in a time duration of approximately 500 fs with an incident THz pulse of peak electric field strength 700 kV/cm. This shows that a single impact...

  20. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  1. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  2. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  3. Magnetic moments in present relativistic nuclear theories: a mean-field problem

    International Nuclear Information System (INIS)

    Desplanques, B.

    1986-07-01

    We show that the magnetic moments of LS closed shell nuclei plus or minus one nucleon derived from non-relativistic Hartree-Fock mean-fields are as bad as those obtained in relativistic approaches of nuclear structure. Deviations with respect to more complete results in both cases are ascribed to the mean-field approximation which neglects some degrees of freedom in the nucleus description. 18 refs

  4. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  5. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  6. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  7. Depth-resolved incoherent and coherent wide-field high-content imaging (Conference Presentation)

    Science.gov (United States)

    So, Peter T.

    2016-03-01

    Recent advances in depth-resolved wide-field imaging technique has enabled many high throughput applications in biology and medicine. Depth resolved imaging of incoherent signals can be readily accomplished with structured light illumination or nonlinear temporal focusing. The integration of these high throughput systems with novel spectroscopic resolving elements further enable high-content information extraction. We will introduce a novel near common-path interferometer and demonstrate its uses in toxicology and cancer biology applications. The extension of incoherent depth-resolved wide-field imaging to coherent modality is non-trivial. Here, we will cover recent advances in wide-field 3D resolved mapping of refractive index, absorbance, and vibronic components in biological specimens.

  8. Recent advances in head-mounted light field displays for virtual and augmented reality (Conference Presentation)

    Science.gov (United States)

    Hua, Hong

    2017-02-01

    Head-mounted light field displays render a true 3D scene by sampling either the projections of the 3D scene at different depths or the directions of the light rays apparently emitted by the 3D scene and viewed from different eye positions. They are capable of rendering correct or nearly correct focus cues and addressing the very well-known vergence-accommodation mismatch problem in conventional virtual and augmented reality displays. In this talk, I will focus on reviewing recent advancements of head-mounted light field displays for VR and AR applications. I will demonstrate examples of HMD systems developed in my group.

  9. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  10. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  11. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  12. Presentation and interpretation of field experiments of gaseous UF6 releases in the atmosphere

    International Nuclear Information System (INIS)

    Crabol, B.; Boulaud, D.; Deville-Cavelin, G.

    1992-01-01

    An experimental programme concerning the behaviour of UF 6 released in gaseous phase in the atmosphere has been conducted in the years 1986-1989 by the french Atomic Energy Commission and Eurodif. Three field tests have been performed on the CEA/CESTA experimental site. These experiments permitted to get informations about the kinetics of the hydrolysis reaction of the UF 6 , the behaviour of the hydrolysis products in the atmosphere and the granulometry of the solid particles

  13. Presentation and interpretation of field experiments of gaseous UF6 releases in the atmosphere

    Energy Technology Data Exchange (ETDEWEB)

    Crabol, B.; Boulaud, D.; Deville-Cavelin, G. [CEA Centre d`Etudes de Fontenay-aux-Roses, 92 (France). Dept. de Protection de l`Environnement et des Installations; Geisse, C.; Iacona, L. [EURODIF, 26 - Pierrelatte (France)

    1992-12-31

    An experimental programme concerning the behaviour of UF{sub 6} released in gaseous phase in the atmosphere has been conducted in the years 1986-1989 by the french Atomic Energy Commission and Eurodif. Three field tests have been performed on the CEA/CESTA experimental site. These experiments permitted to get informations about the kinetics of the hydrolysis reaction of the UF{sub 6}, the behaviour of the hydrolysis products in the atmosphere and the granulometry of the solid particles.

  14. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  15. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Science.gov (United States)

    Siuly; Li, Yan; Paul Wen, Peng

    2014-03-01

    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. The International Gravity Field Service (IGFS): Present Day Activities And Future Plans

    Science.gov (United States)

    Barzaghi, R.; Vergos, G. S.

    2016-12-01

    IGFS is a unified "umbrella" IAG service that coordinates the servicing of the geodetic and geophysical community with gravity field related data, software and information. The combined data of the IGFS entities will include global geopotential models, terrestrial, airborne, satellite and marine gravity observations, Earth tide data, GPS/levelling data, digital models of terrain and bathymetry, as well as ocean gravity field and geoid from satellite altimetry. The IGFS structure is based on the Gravity Services, the "operating arms" of IGFS. These Services related to IGFS are: BGI (Bureau Gravimetrique International), Toulouse, France ISG (International Service for the Geoid), Politecnico di Milano, Milano, Italy IGETS (International Geodynamics and Earth Tides Service), EOST, Strasbourg, France ICGEM (International Center for Global Earth Models), GFZ, Potsdam, Germany IDEMS (International Digital Elevation Model Service), ESRI, Redlands, CA, USA The Central Bureau, hosted at the Aristotle Thessaloniki University, is in charge for all the interactions among the services and the other IAG bodies, particularly GGOS. In this respect, connections with the GGOS Bureaus of Products and Standards and of Networks and Observations have been recently strengthened in order to align the Gravity services to the GGOS standards. IGFS is also strongly involved in the most relevant projects related to the gravity field such as the establishment of the new Global Absolute Gravity Reference System and of the International Height Reference System. These projects, along with the organization of Geoid Schools devoted to methods for gravity and geoid estimate, will play a central role in the IGFS future actions in the framework of GGOS.

  17. Speckle correlation resolution enhancement of wide-field fluorescence imaging (Conference Presentation)

    Science.gov (United States)

    Yilmaz, Hasan

    2016-03-01

    Structured illumination enables high-resolution fluorescence imaging of nanostructures [1]. We demonstrate a new high-resolution fluorescence imaging method that uses a scattering layer with a high-index substrate as a solid immersion lens [2]. Random scattering of coherent light enables a speckle pattern with a very fine structure that illuminates the fluorescent nanospheres on the back surface of the high-index substrate. The speckle pattern is raster-scanned over the fluorescent nanospheres using a speckle correlation effect known as the optical memory effect. A series of standard-resolution fluorescence images per each speckle pattern displacement are recorded by an electron-multiplying CCD camera using a commercial microscope objective. We have developed a new phase-retrieval algorithm to reconstruct a high-resolution, wide-field image from several standard-resolution wide-field images. We have introduced phase information of Fourier components of standard-resolution images as a new constraint in our algorithm which discards ambiguities therefore ensures convergence to a unique solution. We demonstrate two-dimensional fluorescence images of a collection of nanospheres with a deconvolved Abbe resolution of 116 nm and a field of view of 10 µm × 10 µm. Our method is robust against optical aberrations and stage drifts, therefore excellent for imaging nanostructures under ambient conditions. [1] M. G. L. Gustafsson, J. Microsc. 198, 82-87 (2000). [2] H. Yilmaz, E. G. van Putten, J. Bertolotti, A. Lagendijk, W. L. Vos, and A. P. Mosk, Optica 2, 424-429 (2015).

  18. Presentation and interpretation of field experiments of gaseous UF{sub 6} releases in the atmosphere

    Energy Technology Data Exchange (ETDEWEB)

    Crabol, B.; Boulaud, D.; Deville-Cavelin, G. [CEA/Inst. de Protection et de Surete Nucleaire, Dept. de Protection de l' Environnement et des Installations, Fontenay-aux-Roses (France); Geisse, C.; Iacona, L. [EURODIF/Production, Site de Tricastin, Pierrelatte Cedex (France)

    1992-07-01

    An experimental programme concerning the behaviour of UF{sub 6} released in gaseous phase in the atmosphere has been conducted in the years 1986-1989 by the French Atomic Energy Commission and EURODIF. Three field tests have been performed on the CEA/CESTA experimental site. These experiments permitted to get information about the kinetics of the hydrolysis reaction of the UF{sub 6}, the behaviour of the hydrolysis products in the atmosphere and the granulometry of the solid particles. (author)

  19. Fano coil-type resonances: a plasmonic tool for the magnetic field manipulation (Conference Presentation)

    Science.gov (United States)

    Panaro, Simone; Proietti Zaccaria, Remo; Toma, Andrea

    2017-02-01

    Spintronics and spin-based technology rely on the ultra-fast unbalance of the electronic spin population in quite localized spatial regions. However, as a matter of fact, the low susceptibility of conventional materials at high frequencies strongly limits these phenomena, rendering the efficiency of magnetically active devices insufficient for application purposes. Among the possible strategies which can be envisaged, plasmonics offers a direct approach to increase the effect of local electronic unbalancing processes. By confining and enhancing free radiation in nm-size spatial regions, plasmonic nano-assemblies have demonstrated to support very intense electric and magnetic hot-spots. In particular, very recent studies have proven the fine control of magnetic fields in Fano resonance condition. The near-field-induced out-of-phase oscillation of localized surface plasmons has manifested itself with the arising of magnetic sub-diffractive hot-spots. Here, we show how this effect can be further boosted in the mid-infrared regime via the introduction of higher order plasmonic modes. The investigated system, namely Moon Trimer Resonator (MTR), combines the high efficiency of a strongly coupled nano-assembly in Fano interferential condition with the elevated tunability of the quadrupolar resonance supported by a moon-like geometry. The fine control of the apical gap in this unique nanostructure, characterizes a plasmonic device able to tune its resonance without any consequence on the magnetic hot-spot size, thus enabling an efficient squeezing in the infrared.

  20. Low-cost, smartphone based frequency doubling technology visual field testing using virtual reality (Conference Presentation)

    Science.gov (United States)

    Alawa, Karam A.; Sayed, Mohamed; Arboleda, Alejandro; Durkee, Heather A.; Aguilar, Mariela C.; Lee, Richard K.

    2017-02-01

    Glaucoma is the leading cause of irreversible blindness worldwide. Due to its wide prevalence, effective screening tools are necessary. The purpose of this project is to design and evaluate a system that enables portable, cost effective, smartphone based visual field screening based on frequency doubling technology. The system is comprised of an Android smartphone to display frequency doubling stimuli and handle processing, a Bluetooth remote for user input, and a virtual reality headset to simulate the exam. The LG Nexus 5 smartphone and BoboVR Z3 virtual reality headset were used for their screen size and lens configuration, respectively. The system is capable of running the C-20, N-30, 24-2, and 30-2 testing patterns. Unlike the existing system, the smartphone FDT tests both eyes concurrently by showing the same background to both eyes but only displaying the stimulus to one eye at a time. Both the Humphrey Zeiss FDT and the smartphone FDT were tested on five subjects without a history of ocular disease with the C-20 testing pattern. The smartphone FDT successfully produced frequency doubling stimuli at the correct spatial and temporal frequency. Subjects could not tell which eye was being tested. All five subjects preferred the smartphone FDT to the Humphrey Zeiss FDT due to comfort and ease of use. The smartphone FDT is a low-cost, portable visual field screening device that can be used as a screening tool for glaucoma.

  1. Indonesia's present status and needs of human resource development in nuclear field

    International Nuclear Information System (INIS)

    Ruslan, Jeni; Sagala, F.P.

    2000-01-01

    BATAN, started out as a governmental committee established in 1954, has a new organizational structure, based on Presidential Decree of 1998. BATAN has developed its researches in almost practically all-nuclear fields. The situation in Indonesia has been much influenced by the economic crisis, which still being faced by Indonesia. BATAN's strategic planning is described in four areas, those are: 1. Basic human needs, 2. Energy, natural resources and environment, 3. Industry, 4. Socio-cultural and institution. Priority has been given to fulfill, as well as to promote agriculture, health and the industry related to people's welfare, which may develop and improve the immediate needs of the people. In the meantime, we have made considerable investments in manpower development in anticipation of the introduction of nuclear power. BATAN, as of September 1999, has 3889 employees, 26 % of them have bachelor degree, 6 % hold master degrees, and only 2% hold doctoral degree, a total of 34 % employees with university education. Others 11 % have either non-vocational or vocational education beyond High School. The rest of 55 % have high school education or lower, they are administrative clerks (25 %) or technicians (30 %). In the human resources development, BATAN's Education and Training Center, in collaboration with some universities and other national/international institutions, is managing education and training programs for employees. To date, there are 43 BATAN employees studying in various universities in Japan, while another 42 employees are studying in six different countries. Research and Development that have more direct impact to the community will become a priority in the coming years. Without undermining the importance of basic research in advanced fields, we will expect to have more research on application to optimize utilization of research reactors and related facilities for the benefit of both the energy and non-energy sectors. (Tanaka, Y.)

  2. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  4. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    International Nuclear Information System (INIS)

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  5. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Directory of Open Access Journals (Sweden)

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  6. A new full-field interferometry approach for counting and differentiating aquatic biotic nanoparticles (Conference Presentation)

    Science.gov (United States)

    Boccara, A. Claude; Fedala, Yasmina; Voronkoff, Justine; Paffoni, Nina; Boccara, Martine

    2017-03-01

    Due to the huge abundance and the major role that viruses and membrane vesicles play in the seas or rivers ecosystems it is necessary to develop simple, sensitive, compact and reliable methods for their detection and characterization. Our approach is based on the measurement of the weak light level scattered by the biotic nanoparticles. We describe a new full-field, incoherently illuminated, shot-noise limited, common-path interferometric detection method coupled with the analysis of Brownian motion to detect, quantify, and differentiate biotic nanoparticles. The last developments take advantage of a new fast (700 Hz) camera with 2 Me- full well capacity that improves the signal to noise ratio and increases the precision of the Brownian motion characterization. We validated the method with calibrated nanoparticles and homogeneous DNA or RNA.viruses. The smallest virus size that we characterized with a suitable signal-to-noise ratio was around 30 nm in diameter with a target towards the numerous 20 nm diameter viruses. We show for the first time anisotropic trajectories for myoviruses meaning that there is a memory of the initial direction of their Brownian motions. Significant improvements have been made in the handling of the sample as well as in the statistical analysis for differentiating the various families of vesicles and virus. We further applied the method for vesicles detection and for analysis of coastal and oligotrophic samples from Tara Oceans circumnavigation as well of various rivers.

  7. Skin cancer margin analysis within minutes with full-field OCT (Conference Presentation)

    Science.gov (United States)

    Dalimier, Eugénie; Ogrich, Lauren; Morales, Diego; Cusack, Carrie Ann; Abdelmalek, Mark; Boccara, Claude; Durkin, John

    2017-02-01

    Non-melanoma skin cancer (NMSC) is the most common cancer. Treatment consists of surgical removal of the skin cancer. Traditional excision involves the removal of the visible skin cancer with a significant margin of normal skin. On cosmetically sensitive areas, Mohs micrographic tissue is the standard of care. Mohs uses intraoperative microscopic margin assessment which minimizes the surgical defect and can help reduce the recurrence rate by a factor of 3. The current Mohs technique relies on frozen section tissue slide preparation which significantly lengthens operative time and requires on-site trained histotechnicians. Full-Field Optical Coherence Tomography (FFOCT) is a novel optical imaging technique which provides a quick and efficient method to visualize cancerous areas in minutes, without any preparation or destruction of the tissue. This study aimed to evaluate the potential of FFOCT for the analysis of skin cancer margins during Mohs surgery. Over 150 images of Mohs specimens were acquired intraoperatively with FFOCT before frozen section analysis. The imaging procedure took less than 5 minutes for each specimen. No artifacts on histological preparation were found arising from FFOCT manipulation; however frozen section artifact was readily seen on FFOCT. An atlas was established with FFOCT images and corresponding histological slides to reveal FFOCT reading criteria of normal and cancerous structures. Blind analysis showed high concordance between FFOCT and histology. FFOCT can potentially reduce recurrence rates while maintaining short surgery times, optimize clinical workflow, and decrease healthcare costs. For the patient, this translates into smaller infection risk, decreased stress, and better comfort.

  8. Clinical Presentation Resembling Mucosal Disease Associated with 'HoBi'-like Pestivirus in a Field Outbreak.

    Science.gov (United States)

    Weber, M N; Mósena, A C S; Simões, S V D; Almeida, L L; Pessoa, C R M; Budaszewski, R F; Silva, T R; Ridpath, J F; Riet-Correa, F; Driemeier, D; Canal, C W

    2016-02-01

    The genus Pestivirus of the family Flaviviridae consists of four recognized species: Bovine viral diarrhoea virus 1 (BVDV-1), Bovine viral diarrhoea virus 2 (BVDV-2), Classical swine fever virus (CSFV) and Border disease virus (BDV). Recently, atypical pestiviruses ('HoBi'-like pestiviruses) were identified in batches of contaminated foetal calf serum and in naturally infected cattle with and without clinical symptoms. Here, we describe the first report of a mucosal disease-like clinical presentation (MD) associated with a 'HoBi'-like pestivirus occurring in a cattle herd. The outbreak was investigated using immunohistochemistry, antibody detection, viral isolation and RT-PCR. The sequence and phylogenetic analysis of 5'NCR, N(pro) and E2 regions of the RT-PCR positive samples showed that four different 'HoBi'-like strains were circulating in the herd. The main clinical signs and lesions were observed in the respiratory and digestive systems, but skin lesions and corneal opacity were also observed. MD characteristic lesions and a pestivirus with cytopathic biotype were detected in one calf. The present study is the first report of a MD like presentation associated with natural infection with 'HoBi'-like pestivirus. This report describes the clinical signs and provides a pathologic framework of an outbreak associated with at least two different 'HoBi'-like strains. Based on these observations, it appears that these atypical pestiviruses are most likely underdiagnosed in Brazilian cattle. © 2014 Blackwell Verlag GmbH.

  9. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Science.gov (United States)

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  10. Present status and needs of human resource development in the nuclear field in the Philippines

    Energy Technology Data Exchange (ETDEWEB)

    Bernido, Corazon C.; Roceles, Pilar C. [Philippine Nuclear Research Institute, Commonwealth Avenue, Diliman, Quezon (Philippines)

    2000-12-01

    The first nuclear power plant was nearing completion. However, due to change in political climate and support for the nuclear power program, this has been mothballed. There is a possibility for the introduction of nuclear power plant in the country's projected energy sources by the year 2020. The country has one research reactor, but at the present time it is undergoing repair and is not operational. The Philippine Nuclear Research Institute (PNRI), an Institute under the Department of Science and Technology (DOST), is the sole government agency mandated by the law to take charge of all matters pertaining to nuclear science and technology, and the regulation of nuclear energy. There is one another government agency, the Radiation Health Service (RHS) of the Department of Health, which is responsible for regulating the use and application of X-rays and non-ionizing radiation. The PNRI conducts national training courses in nuclear science and technology, and radiation protection to users of radioisotopes. Individual courses are outlined in the paper. Up to the present time, around 7,300 have participated in national training courses conducted by PNRI. Distributions of PNRI trainees are: 53 % for industrial, 12 % medical, 12 % for academe, and 23 % for others. Nuclear science and technology education in schools and universities are presented. The International Atomic Energy Agency (IAEA) training activities availed 77 % of the total foreign training from 1993 to 1998; Japan follows next at 20 %; and others comprise the remaining 3 %. An approach to training and human resources development, which could reach out to more target trainees, is Distance Learning. In 1998, as a part of a Regional Cooperative Agreement (RCA) and IAEA project, the Philippines participated in the trial of distance learning modules in radiation protection. The distance learning modules were developed at the Australian Nuclear Science and Technology Organization (ANSTO). These modules will

  11. Present status and needs of human resource development in the nuclear field in the Philippines

    International Nuclear Information System (INIS)

    Bernido, Corazon C.; Roceles, Pilar C.

    2000-01-01

    The first nuclear power plant was nearing completion. However, due to change in political climate and support for the nuclear power program, this has been mothballed. There is a possibility for the introduction of nuclear power plant in the country's projected energy sources by the year 2020. The country has one research reactor, but at the present time it is undergoing repair and is not operational. The Philippine Nuclear Research Institute (PNRI), an Institute under the Department of Science and Technology (DOST), is the sole government agency mandated by the law to take charge of all matters pertaining to nuclear science and technology, and the regulation of nuclear energy. There is one another government agency, the Radiation Health Service (RHS) of the Department of Health, which is responsible for regulating the use and application of X-rays and non-ionizing radiation. The PNRI conducts national training courses in nuclear science and technology, and radiation protection to users of radioisotopes. Individual courses are outlined in the paper. Up to the present time, around 7,300 have participated in national training courses conducted by PNRI. Distributions of PNRI trainees are: 53 % for industrial, 12 % medical, 12 % for academe, and 23 % for others. Nuclear science and technology education in schools and universities are presented. The International Atomic Energy Agency (IAEA) training activities availed 77 % of the total foreign training from 1993 to 1998; Japan follows next at 20 %; and others comprise the remaining 3 %. An approach to training and human resources development, which could reach out to more target trainees, is Distance Learning. In 1998, as a part of a Regional Cooperative Agreement (RCA) and IAEA project, the Philippines participated in the trial of distance learning modules in radiation protection. The distance learning modules were developed at the Australian Nuclear Science and Technology Organization (ANSTO). These modules will be

  12. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  13. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  14. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  15. A new method of presentation the large-scale magnetic field structure on the Sun and solar corona

    Science.gov (United States)

    Ponyavin, D. I.

    1995-01-01

    The large-scale photospheric magnetic field, measured at Stanford, has been analyzed in terms of surface harmonics. Changes of the photospheric field which occur within whole solar rotation period can be resolved by this analysis. For this reason we used daily magnetograms of the line-of-sight magnetic field component observed from Earth over solar disc. We have estimated the period during which day-to-day full disc magnetograms must be collected. An original algorithm was applied to resolve time variations of spherical harmonics that reflect time evolution of large-scale magnetic field within solar rotation period. This method of magnetic field presentation can be useful enough in lack of direct magnetograph observations due to sometimes bad weather conditions. We have used the calculated surface harmonics to reconstruct the large-scale magnetic field structure on the source surface near the sun - the origin of heliospheric current sheet and solar wind streams. The obtained results have been compared with spacecraft in situ observations and geomagnetic activity. We tried to show that proposed technique can trace shon-time variations of heliospheric current sheet and short-lived solar wind streams. We have compared also our results with those obtained traditionally from potential field approximation and extrapolation using synoptic charts as initial boundary conditions.

  16. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Directory of Open Access Journals (Sweden)

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  17. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  18. Dynamic full field OCT: metabolic contrast at subcellular level (Conference Presentation)

    Science.gov (United States)

    Apelian, Clement; Harms, Fabrice; Thouvenin, Olivier; Boccara, Claude A.

    2016-03-01

    Cells shape or density is an important marker of tissues pathology. However, individual cells are difficult to observe in thick tissues frequently presenting highly scattering structures such as collagen fibers. Endogenous techniques struggle to image cells in these conditions. Moreover, exogenous contrast agents like dyes, fluorophores or nanoparticles cannot always be used, especially if non-invasive imaging is required. Scatterers motion happening down to the millisecond scale, much faster than the still and highly scattering structures (global motion of the tissue), allowed us to develop a new approach based on the time dependence of the FF-OCT signals. This method reveals hidden cells after a spatiotemporal analysis based on singular value decomposition and wavelet analysis concepts. It does also give us access to local dynamics of imaged scatterers. This dynamic information is linked with the local metabolic activity that drives these scatterers. Our technique can explore subcellular scales with micrometric resolution and dynamics ranging from the millisecond to seconds. By this mean we studied a wide range of tissues, animal and human in both normal and pathological conditions (cancer, ischemia, osmotic shock…) in different organs such as liver, kidney, and brain among others. Different cells, undetectable with FF-OCT, were identified (erythrocytes, hepatocytes…). Different scatterers clusters express different characteristic times and thus can be related to different mechanisms that we identify with metabolic functions. We are confident that the D-FFOCT, by accessing to a new spatiotemporal metabolic contrast, will be a leading technique on tissue imaging and for better medical diagnosis.

  19. From research to production: field induced electro-mechanical polymer-transducer (Conference Presentation)

    Science.gov (United States)

    Kovacs, Gabor M.

    2017-04-01

    In the past decades the development of compliant dielectric materials, capable of storing high electric energy density, is the object of considerable research efforts for commercial applications. Compared to the widely used soft dielectrics as compliant insulators, only a small variety of commercially products based on dielectric polymer transducers are available on the market up to date. A whole bunch of research activities worldwide has created a lot of very useful knowledge; but many researchers have been faced to different obstacles to manufacture devices for demonstrations. However, building handy demonstrators is one of the most relevant action in order to attract the interest of decision makers of industrial companies. Moreover, low cost devices strictly require highly efficient production methods and facilities to become competitive on the market. This aspect contains the ultimate requirement especially for very high output rates and represents one of the major topic at most negotiations. All technological problems linked to this issue have been addressed only a little in the past R+D activities and are still widely not satisfactory solved. The present talk will provide an overview of the options for opening the door of industrial production of polymer transducers and the remaining obstacles to be solved for the next step. In particular, the most relevant actions to be taken for enabling high capacity production at very low cost will be discussed, which have an essential impact on the direction of future research activities.

  20. AN ANALYSIS OF THE RAPID GROWTH FACTORS PRESENTED IN THE LITERATURE OF THE FIELD

    Directory of Open Access Journals (Sweden)

    ALB MARIA

    2015-03-01

    Full Text Available This paper presents the main rapid growth factors, as encountered in literature and discusses the importance and contribution of these factors in achieving the rapid growth, respectively if this growth phenomenon may be achieved in the absence of the aforesaid factors. The paper examines the factors and subfactors considered or found by scholars to have an effect on or be in connection with the rapid growth. A comparative analysis was performed on several studies concerning the rapid growth companies. Among the main factors influencing the rapid growth are those related to the human resources management, the entrepreneur characteritics and the characteristics of the business. The paper also discusses several issues related to the will of the manager or the entrepreneur, repectively the need to understand the role of the factors that intervene when the growth is not wanted and still obtained or when the growth is targeted but not achieved. The conclusion is in agreement with other scholars’ findings reported in the literature. Certain factors correlated with the appropriate actions may lead to the rapid growth. The paper represents a starting point for the study of those management related aspects enabling companies to grow rapidly in the Romanian business environment.

  1. Subcellular metabolic contrast in living tissue using dynamic full field OCT (D-FFOCT) (Conference Presentation)

    Science.gov (United States)

    Apelian, Clement; Harms, Fabrice; Thouvenin, Olivier; Boccara, Claude A.

    2016-03-01

    Cells shape or density is an important marker of tissues pathology. However, individual cells are difficult to observe in thick tissues frequently presenting highly scattering structures such as collagen fibers. Endogenous techniques struggle to image cells in these conditions. Moreover, exogenous contrast agents like dyes, fluorophores or nanoparticles cannot always be used, especially if non-invasive imaging is required. Scatterers motion happening down to the millisecond scale, much faster than the fix and highly scattering structures (global motion of the tissue), allowed us to develop a new approach based on the time dependence of the FF-OCT signals. This method reveals hidden cells after a spatiotemporal analysis based on singular value decomposition and wavelet analysis concepts. It does also give us access to local dynamics of imaged scatterers. This dynamic information is linked with the local metabolic activity that drives these scatterers. Our technique can explore subcellular scales with micrometric resolution and dynamics ranging from the millisecond to seconds. By this mean we studied a wide range of tissues, animal and human in both normal and pathological conditions (cancer, ischemia, osmotic shock…) in different organs such as liver, kidney, and brain among others. Different cells, undetectable with FF-OCT, were identified (erythrocytes, hepatocytes…). Different scatterer clusters express different characteristic times and thus can be related to different mechanisms that we identify with metabolic functions. We are confident that the D-FFOCT, by accessing to a new spatiotemporal metabolic contrast, will be a leading technique on tissue imaging and could lead to better medical diagnosis.

  2. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    OpenAIRE

    Jacobs, Loraine Cristina do Valle

    2011-01-01

    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  3. Field Test Results of Using a Nacelle-Mounted Lidar for Improving Wind Energy Capture by Reducing Yaw Misalignment (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Fleming, P.; Scholbrock, A.; Wright, A.

    2014-11-01

    Presented at the Nordic Wind Power Conference on November 5, 2014. This presentation describes field-test campaigns performed at the National Wind Technology Center in which lidar technology was used to improve the yaw alignment of the Controls Advanced Research Turbine (CART) 2 and CART3 wind turbines. The campaigns demonstrated that whether by learning a correction function to the nacelle vane, or by controlling yaw directly with the lidar signal, a significant improvement in power capture was demonstrated.

  4. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  5. Present Situation of Field Training for the Students of Accounting in Saudi Universities: A Field Study on Female Students of the Accounting Department – Princess Nora University

    Directory of Open Access Journals (Sweden)

    Mhasen Ali Khalil Alhaj

    2017-12-01

    Full Text Available This study aimed to explore the present situation of field training for the students of the accounting education in Saudi Universities, so as to raise its level and make the best use of it to gain practical experience and professional skills in accounting and other relevant field skills. To achieve this, a field study was conducted on trainee students of the Accounting Department – Princess Nourah University. To collect data for the study, a questionnaire consisting of two parts was used and distributed to groups of female students who were selected through the stratified random method. The sample represented students who were expected to graduate from the department, and who were registered in the Field Training Program. The sample involved students from different three academic levels, and various training days. The results showed statistically significant differences at (α =0.05 in the type of training for building accounting knowledge and skills of the students in the accounting department. This is attributed to the different training institutions. The results also revealed that writing graduation research simultaneously with the training program, whose allotted time is inadequate, would reduce the chance of gaining the desired experiences of field training. It was also clear that discontinuous training would hinder the students from getting the appropriate training opportunities, and that conducting training during the summer semester seemed sufficient and appropriate. Keywords: Accounting education, Field training.

  6. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  7. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  8. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  9. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Landau ghost pole problem in quantum field theory: From 50th of last century to the present day

    Energy Technology Data Exchange (ETDEWEB)

    Jafarov, Rauf G., E-mail: rauf-jafarov@hotmail.com [Institute for Physical Problems, Baku State University, Baku (Azerbaijan); Mutallimov, Mutallim M. [Institute of Applied Mathematics, Baku State University, Baku (Azerbaijan)

    2016-03-25

    In this paper we present our results of the investigation of asymptotical behavior of amplitude at short distances in four-dimensional scalar field theory with ϕ{sup 4} interaction. To formulate of our calculating model – two-particle approximation of the mean-field expansion we have used an Rochev’s iteration scheme of solution of the Schwinger-Dyson equations with the fermion bilocal source. We have considered the nonlinear integral equations in deep-inelastic region of momenta. As result we have a non-trivial behavior of amplitude at large momenta.

  11. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  12. alpha-particle radioactivity from LR 115 by two methods of analysis

    CERN Document Server

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  13. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  14. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    CERN Document Server

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  15. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Science.gov (United States)

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  16. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  17. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  18. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  19. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Science.gov (United States)

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

    2018-07-01

    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  20. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  1. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    NARCIS (Netherlands)

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  2. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  3. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  4. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    International Nuclear Information System (INIS)

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  5. From Mahan excitons to Landau levels at high magnetic fields: 2DFT spectroscopy reveals hidden quantum correlations (Conference Presentation)

    Science.gov (United States)

    Karaiskaj, Denis

    2017-02-01

    Two-dimensional electron gases have been the subject of research for decades. Modulation doped GaAs quantum wells in the absence of magnetic fields exhibit interesting many-body physics such as the Fermi edge singularity or Mahan exciton and can be regarded as a collective excitation of the system. Under high magnetic fields Landau levels form which have been studied using transport and optical measurements. Nonlinear coherent two-dimensional Fourier transform (2DFT) spectroscopy however provides new insights into these systems. We present the 2DFT spectra of Mahan Excitons associated with the heavy-hole and light-hole resonances observed in a modulation doped GaAs/AlGaAs single quantum well [1]. These resonances are observed to be strongly coupled through many-body interactions. The 2DFT spectra were measured using co-linear, cross-linear, and co-circular polarizations and reveal striking differences. Furthermore, 2DFT spectra at high magnetic fields performed at the National High Magnetic Field Lab (NHMFL) in Tallahassee, Florida will be discussed. The spectra exhibit new features and peculiar line shapes suggesting interesting underlying physics. [1] J. Paul, C. E. Stevens, C. Liu, P. Dey, C. McIntyre, V. Turkowski, J. L. Reno, D. J. Hilton, and D. Karaiskaj, Phys. Rev. Lett.116, 157401 (2016).

  6. Present scenery of cuban legislation in the field of legal verification of dosimetric instruments used in radiological protection

    International Nuclear Information System (INIS)

    Salas G, Walwyn; Morales Monzon, J.A.; Hernandez Blanche, E.

    2001-01-01

    The main objective of legal metrology is to ensure the public guaranty from the point of view of safety, and the suitable accuracy of the measurements that are made on health, environmental applications, and trade. The International Organization of Legal Metrology included the ionizing radiation field on those for which the use of the verified measuring instruments are suggested. . The paper presents the advances of Cuban legislation in this field, promoted by issue of the Decree-Law 183 of Metrology. As part of such advances, the Cuban standards for verification NC 44:1999 'X and Gamma Radiation Measuring Instruments. Verification methods' is discussed. This standard was elaborated in the Cuban Secondary Standard Dosimetry Laboratory, and it is based on the available relevant international standards. Results from verification service during the year 2000 are also provided.(author)

  7. The present status of international training and education in nuclear field held in Japan for Asian countries

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-11-01

    This report summarizes the training and educational courses for Asian countries carried out in Japan by the related institutions. The 2nd Workshop on Human Resources Development in the Nuclear Field was held on 27 and 28 of November 2000, based on FNCA (Forum for Nuclear Cooperation in Asia) organized by the Nuclear Energy Commission, and then the following day ''The Present Status of the International Training and Education in Japan for Asian Countries'' was reported for Asian participants on 29, November. This report is the Japanese edition of the handout distributed at the meeting. I believe it can be helpful for the related institutions in Japan to support the human resources development in the nuclear field efficiently and effectively in future. (author)

  8. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  9. Reducing Attendance Time in LR-EPONs With Differentiated Services

    KAUST Repository

    Elrasad, Amr

    2015-04-09

    This work presents a novel on-the-fly void filling scheme for Long-Reach EPON called Size Controlled Batch Void Filling (SCBVF). SCBVF aims at reducing the time between consecutive bandwidth grants (attendance time) and hence reducing the average delay for delay-sensitive traffic.

  10. Quantitative comparison of clustered microcalcifications in for-presentation and for-processing mammograms in full-field digital mammography.

    Science.gov (United States)

    Wang, Juan; Nishikawa, Robert M; Yang, Yongyi

    2017-07-01

    Mammograms acquired with full-field digital mammography (FFDM) systems are provided in both "for-processing'' and "for-presentation'' image formats. For-presentation images are traditionally intended for visual assessment by the radiologists. In this study, we investigate the feasibility of using for-presentation images in computerized analysis and diagnosis of microcalcification (MC) lesions. We make use of a set of 188 matched mammogram image pairs of MC lesions from 95 cases (biopsy proven), in which both for-presentation and for-processing images are provided for each lesion. We then analyze and characterize the MC lesions from for-presentation images and compare them with their counterparts in for-processing images. Specifically, we consider three important aspects in computer-aided diagnosis (CAD) of MC lesions. First, we quantify each MC lesion with a set of 10 image features of clustered MCs and 12 textural features of the lesion area. Second, we assess the detectability of individual MCs in each lesion from the for-presentation images by a commonly used difference-of-Gaussians (DoG) detector. Finally, we study the diagnostic accuracy in discriminating between benign and malignant MC lesions from the for-presentation images by a pretrained support vector machine (SVM) classifier. To accommodate the underlying background suppression and image enhancement in for-presentation images, a normalization procedure is applied. The quantitative image features of MC lesions from for-presentation images are highly consistent with that from for-processing images. The values of Pearson's correlation coefficient between features from the two formats range from 0.824 to 0.961 for the 10 MC image features, and from 0.871 to 0.963 for the 12 textural features. In detection of individual MCs, the FROC curve from for-presentation is similar to that from for-processing. In particular, at sensitivity level of 80%, the average number of false-positives (FPs) per image region is 9

  11. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  12. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  13. Top-down freezing in a Fe-FeS core and Ganymede's present-day magnetic field

    Science.gov (United States)

    Rückriemen, Tina; Breuer, Doris; Spohn, Tilman

    2018-06-01

    Ganymede's core most likely possesses an active dynamo today, which produces a magnetic field at the surface of ∼ 719 nT. Thermochemical convection triggered by cooling of the core is a feasible power source for the dynamo. Experiments of different research groups indicate low pressure gradients of the melting temperatures for Fe-FeS core alloys at pressures prevailing in Ganymede's core ( < 10 GPa). This may entail that the core crystallizes from the top instead of from the bottom as is expected for Earth's core. Depending on the core sulfur concentration being more iron- or more sulfur-rich than the eutectic concentration either snowing iron crystals or a solid FeS layer can form at the top of the core. We investigate whether these two core crystallization scenarios are capable of explaining Ganymede's present magnetic activity. To do so, we set up a parametrized one-dimensional thermal evolution model. We explore a wide range of parameters by running a large set of Monte Carlo simulations. Both freezing scenarios can explain Ganymede's present-day magnetic field. Dynamos of iron snow models are rather young ( < 1 Gyr), whereas dynamos below the FeS layer can be both young and much older ( ∼ 3.8 Gyr). Successful models preferably contain less radiogenic heat sources in the mantle than the chondritic abundance and show a correlation between the reference viscosity in the mantle and the initial core sulfur concentration.

  14. Recent IAEA Achievements in the Field of Fast Reactors and Presentation of the Scope and Objectives of the Meeting

    International Nuclear Information System (INIS)

    Monti, Stefano

    2013-01-01

    Scope of the Technical Meeting: • Fast reactors deployment scenario are intensely being assessed worldwide, taking into consideration the main technical aspects and requirements, the different marked drivers including resource utilization, fuel cycle options, waste management, economic competitiveness and proliferation issues. • The theme of fast reactor deployment, scenarios and economics has been largely debated during the recent IAEA FR13 conference; Several papers discussed the economics of fast reactors from different national and regional perspectives. • This technical meeting addresses Member States’ expressed need for information exchange in the field, with the aim of identifying the main open issues and launching possible activities under the IAEA’s aegis. Main Objectives of the Meeting: • Identify issues and technical features that affect capital and energy production costs of fast reactors and related fuel cycle facilities. • Present FR concepts with enhanced economic characteristics, as well as innovative technical solutions that have the potential to reduce the capital costs of FR and related fuel cycle facilities. • Present energy models and advanced tools for the cost assessment of innovative fast reactors and associated nuclear fuel cycles. • Discuss the results of studies and on-going R&D activities that address cost reduction and the future economic competitiveness of fast reactors; and • Identify R&DT needs in the field, also in view of new IAEA initiatives to help and support Member States in improving the economic competitiveness of fast reactors and associated nuclear fuel cycles

  15. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  16. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  17. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Directory of Open Access Journals (Sweden)

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  18. Direct determination of bulk etching rate for LR-115-II solid state ...

    Indian Academy of Sciences (India)

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  19. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  20. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  1. A code of ethics for health care ethics consultants: journey to the present and implications for the field.

    Science.gov (United States)

    Tarzian, Anita J; Wocial, Lucia D

    2015-01-01

    For decades a debate has played out in the literature about who bioethicists are, what they do, whether they can be considered professionals qua bioethicists, and, if so, what professional responsibilities they are called to uphold. Health care ethics consultants are bioethicists who work in health care settings. They have been seeking guidance documents that speak to their special relationships/duties toward those they serve. By approving a Code of Ethics and Professional Responsibilities for Health Care Ethics Consultants, the American Society for Bioethics and Humanities (ASBH) has moved the professionalization debate forward in a significant way. This first code of ethics focuses on individuals who provide health care ethics consultation (HCEC) in clinical settings. The evolution of the code's development, implications for the field of HCEC and bioethics, and considerations for future directions are presented here.

  2. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  3. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    International Nuclear Information System (INIS)

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  4. Analysis of quench-vent pressures for present design of ITER [International Thermonuclear Experimental Reactor] TF [toroidal field] coils

    International Nuclear Information System (INIS)

    Slack, D.S.

    1989-01-01

    The International Thermonuclear Experimental Reactor (ITER) is a new tokamak design project with joint participation from Japan, the European Community, the Union of the Soviet Union, and the United States. This paper examines the effects of a quench within the toroidal field (TF) coils based on current ITER design. It is a preliminary, rough analysis. Its intent is to assist ITER designers while more accurate computer codes are being developed and to provide a check against these more rigorous solutions. Rigorous solutions to the quench problem are very complex involving three-dimensional heat transfer, extreme changes in heat capacities and copper resistivity, and varying flow dynamics within the conductors. This analysis addresses all these factors in an approximate way. The result is much less accurate than a rigorous analysis. Results here could be in error as much as 30 to 40 percent. However, it is believed that this paper can still be very useful to the coil designer. Coil pressures and temperatures vs time into a quench are presented. Rate of helium vent, energy deposition in the coil, and depletion of magnetic stored energy are also presented. Peak pressures are high (about 43 MPa). This is due to the very long vent path length (446 m), small hydraulic diameters, and high current densities associated with ITER's cable-in-conduit design. The effects of these pressures as well as the ability of the coil to be self protecting during a quench are discussed. 3 refs., 3 figs., 1 tab

  5. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  6. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  7. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    International Nuclear Information System (INIS)

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

    2010-01-01

    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  8. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    International Nuclear Information System (INIS)

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  9. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    International Nuclear Information System (INIS)

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  10. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  11. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    International Nuclear Information System (INIS)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  12. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  13. School Psychology Research and Practice in East Asia: Perspectives on the Past, Present, and Future Directions of the Field

    Science.gov (United States)

    Brown, Jacqueline A.; Watanabe, Yayoi; Lee, Dong Hun; McIntosh, Kent

    2016-01-01

    To engage in a comparison of school psychology research and practice in eastern and western countries, the current study sought to identify key themes that have influenced the field of school psychology in East Asian countries. Forty-six leading school psychology professionals in Japan, Hong Kong, South Korea, Thailand, and Taiwan provided their…

  14. Information Services; A Survey of the History and Present Status of the Field. MOREL Regional Information System for Educators.

    Science.gov (United States)

    Grimes, George

    This document is one of a series describing the background, functions, and utilization of the Regional Information System (RIS) developed by the Michigan-Ohio Regional Educational Laboratory (MOREL). The continuing history of the field of librarianship and information services is reviewed in this report. The first part covers ancient times to the…

  15. Product-services as a research field: past, present and future. Reflections from a decade of research

    NARCIS (Netherlands)

    Tukker, A.; Tischner, U.

    2006-01-01

    In the last decade many researchers, institutes and programs in the EU paid attention to product-service systems (PSS). Given this massive effort, it is time to take stock. Is PSS research a theoretical field in its own right? Is the PSS concept indeed the road to the Factor 10 world? Is it the road

  16. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Science.gov (United States)

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  17. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Science.gov (United States)

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

    2017-01-01

    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  18. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  20. Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

    Science.gov (United States)

    Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

    2011-05-15

    Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. The left visual-field advantage in rapid visual presentation is amplified rather than reduced by posterior-parietal rTMS

    DEFF Research Database (Denmark)

    Verleger, Rolf; Möller, Friderike; Kuniecki, Michal

    2010-01-01

    ) either as effective or as sham stimulation. In two experiments, either one of these two factors, hemisphere and effectiveness of rTMS, was varied within or between participants. Again, T2 was much better identified in the left than in the right visual field. This advantage of the left visual field......In the present task, series of visual stimuli are rapidly presented left and right, containing two target stimuli, T1 and T2. In previous studies, T2 was better identified in the left than in the right visual field. This advantage of the left visual field might reflect dominance exerted...... by the right over the left hemisphere. If so, then repetitive transcranial magnetic stimulation (rTMS) to the right parietal cortex might release the left hemisphere from right-hemispheric control, thereby improving T2 identification in the right visual field. Alternatively or additionally, the asymmetry in T2...

  2. New phenomena results presented at the 1996 A.P.S. Division of Particles and Fields meeting

    International Nuclear Information System (INIS)

    Abachi, S.

    1996-10-01

    This paper is a compendium of the D0 papers submitted to the 1996 Division of Particles and Fields meeting in Minneapolis/St. Paul, Minnesota. Each paper is reproduced here in full. The papers are: (1) a search for squarks and gluinos in the dielectron channel; (2) search for excited quarks decaying to two-jets with the D0 detector; (3) search for di-jet resonances produced in association with W bosons at D0; (4) search for first generation scalar leptoquarks at D0 detector; (5) search for SUSY gaugino production through the trilepton signature; (6) search for heavy neutral gauge bosons at D0

  3. Electric and magnetic fields related to industrial current (50-60 Hz). Medical data and present day risk assessment

    International Nuclear Information System (INIS)

    Lambrozo, J.

    2008-01-01

    The questions about the possible health impacts of electric and magnetic fields from industrial current with a 50-60 Hz frequency have led to a remarkable risk assessment approach carried out at the international scale. Pluri-disciplinary and regularly revised collective expertises (US, UK, Sweden, France, Canada, International Agency for Research on Cancer (IARC), World Health Organization..) have integrated the results of epidemiological studies and experiments on animals and biological material. The synthesis of these works is a reassuring consensus which led to the publication in June 2007 of the monograph no 238 of the 'Environmental Health Criteria' collection of the World Health Organization in Geneva. (J.S.)

  4. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  5. Neurite outgrowth is significantly increased by the simultaneous presentation of Schwann cells and moderate exogenous electric fields

    Science.gov (United States)

    Koppes, Abigail N.; Seggio, Angela M.; Thompson, Deanna M.

    2011-08-01

    Axonal extension is influenced by a variety of external guidance cues; therefore, the development and optimization of a multi-faceted approach is probably necessary to address the intricacy of functional regeneration following nerve injury. In this study, primary dissociated neonatal rat dorsal root ganglia neurons and Schwann cells were examined in response to an 8 h dc electrical stimulation (0-100 mV mm-1). Stimulated samples were then fixed immediately, immunostained, imaged and analyzed to determine Schwann cell orientation and characterize neurite outgrowth relative to electric field strength and direction. Results indicate that Schwann cells are viable following electrical stimulation with 10-100 mV mm-1, and retain a normal morphology relative to unstimulated cells; however, no directional bias is observed. Neurite outgrowth was significantly enhanced by twofold following exposure to either a 50 mV mm-1 electric field (EF) or co-culture with unstimulated Schwann cells by comparison to neurons cultured alone. Neurite outgrowth was further increased in the presence of simultaneously applied cues (Schwann cells + 50 mV mm-1 dc EF), exhibiting a 3.2-fold increase over unstimulated control neurons, and a 1.2-fold increase over either neurons cultured with unstimulated Schwann cells or the electrical stimulus alone. These results indicate that dc electric stimulation in combination with Schwann cells may provide synergistic guidance cues for improved axonal growth relevant to nerve injuries in the peripheral nervous system.

  6. ACTINET-I3 Summer School on Analytical Innovation in the field of actinide recycling - Slides of the presentations

    International Nuclear Information System (INIS)

    Poinssot, Ch.; Nash, K.L.; Puget, P.; Szabo, Z.; Vallet, V.; Berthon, L.; Duhamet, J.; Wipff, G.; Dufreche, J.F.; Walter, P.; Thiebaut, D.; Toulhoat, P.; Aupiais, J.; Amatore, C.

    2011-01-01

    This conference dealt with 3 main topics: analytical innovation in separation processes (hyphenated techniques, analytical chips,...), actinide recycling (extraction, interfaces, processes,...) and chemistry and thermodynamics of actinides. This document is composed of the slides of the presentations

  7. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  8. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  9. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    International Nuclear Information System (INIS)

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  10. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    International Nuclear Information System (INIS)

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  11. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    International Nuclear Information System (INIS)

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  12. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  13. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    International Nuclear Information System (INIS)

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  14. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    International Nuclear Information System (INIS)

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  15. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    International Nuclear Information System (INIS)

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  16. Present status and future plans of web site ''NUCPAL'' for school education in the field of nuclear radiation and energy

    International Nuclear Information System (INIS)

    Sumita, Kenji

    2005-01-01

    ''NUCPAL'', a newly combined word of ''nuclear'' and ''pal'', means the fellows having common information for school education in the field of radiation and energy and is actively serving Japanese web-site for internet systems since 2002. The web-site offers basic knowledge information as IT materials for education about energy and environment in elementary, junior-high, and high schools. The kids corner opens since 2003, where people, for instance, call ''Trip to Seek where electricity comes from, '' the sequential game starts from the home electric tool to arrive the power line through terminal spots, and after several steps finally arrive the generator. Following activities are already on: Arrangement of lectures for school education on energy, radiation, and environment; Free charge releasing of video-tape and DVD for education; Issuing the text based on latest information; Introducing of typical example of practical cases for class rooms. (S. Ohno)

  17. Proceedings of the African Field Epidemiology Network (AFENET) Scientific Conference 17-22 November 2013 Addis Ababa, Ethiopia: plenaries and oral presentations

    OpenAIRE

    Gitta, Sheba Nakacubo; Mwesiga, Allan; Kamadjeu, Raoul; Stanley, Claire; Borchert, Jeff; Mensah, George; Bejtullahu, Armand; Kamadjeu, Raoul; Kebede, Amha; Berhane, Yemane; Jocker, Mathew Lado; Ebontane, Ndode Corlins; Feyissa, Daba; Yeshitila, Kidanie; Mehari, Goitom

    2015-01-01

    Biennially, trainees and graduates of Field Epidemiology and Laboratory Training Programs (FELTPs) are presented with a platform to share investigations and projects undertaken during their two-year training in Applied Epidemiology. The African Field Epidemiology Network (AFENET) Scientific Conference, is a perfect opportunity for public health professionals from various sectors and organizations to come together to discuss issues that impact on public health in Africa. This year's conference...

  18. Proceedings of the CISDEN meeting on present problems in Community and international law in the nuclear field

    International Nuclear Information System (INIS)

    1981-06-01

    These proceedings of the meeting of the Italian Nuclear Law Study Centre reproduce in full the three papers presented, together with the ensuing discussions. The papers respectively deal with the recent Constitutional Court Decision opposing a referendum on nuclear power plant site selection; international contracts -private autonomy and State law- and the incidence of recent trends on nuclear contracts; problems in relation to the entry into force of the 1980 Euratom radiation protection directive and the revision of relevant Italian regulations. (NEA) [fr

  19. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  1. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  2. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  3. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    DEFF Research Database (Denmark)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  4. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  5. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

    Directory of Open Access Journals (Sweden)

    Valentina Kubale

    2016-07-01

    Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

  6. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  7. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  8. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Being present with the patient-A critical investigation of bodily sensitivity and presence in the field of physiotherapy.

    Science.gov (United States)

    Engelsrud, Gunn; Øien, Ingvil; Nordtug, Birgit

    2018-04-12

    This article advocates integrating ideas from phenomenological theory regarding the body with a psychoanalytical theory of language to enrich our understanding of the meaning of bodily presence in the practice of physiotherapy. The authors use this theoretical framework to explore bodily presence as a source for physiotherapists' professional development. They are using research on children as moving and meaning-producing subjects 1 1 The concept of subject is used in different ways in phenomenology and psychoanalysis, and also in varying ways in each of the two traditions. However, here the concept is used more in line with ordinary language, in the sense that it emphasizes the child's active position in her/his being in the world. to illustrate the relevance of their perspectives. They argue that the perspectives might contribute to a physiotherapeutic practice that incorporates bodily presence in the professional language in addition to specific methods and techniques. Understanding bodily presence involves the physiotherapist recognizing the Other (i.e., the patient/child) in the present moment and trusting her/his own capacity to become aware of her/his own bodily presence. The authors assert that being aware of one's own bodily presence enables therapists to develop an appreciation of their own bodies and the bodies of their patients as they are and move in mutual relation to each other. Applying the article's theoretical framework, the authors consider the body as the starting point for speech, 2 2 The concept of speech is used in a wide sense, including voice, tone, and rhythm in line with the article's psychoanalytical framework of Kristeva and the late Lacan. Thus, the call for being present for the child (as a patient) in the here and now includes participating in the speech of the child, even though the child does not use words. and suggest that introducing a richer professional language encourages practitioners to become more aware of the dialectic

  10. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

    2015-01-01

    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  11. Present stage of the use of radioactive tracers in studies carried out at Companhia de Tecnologia de Saneamento Ambiental, SP, Brazil, in the field of environmental engineering

    International Nuclear Information System (INIS)

    Sanchez, W.; Agudo, E.G.

    1979-01-01

    Studies using radioactive tracers in the field of environmental engineering, carried out at Companhia de Tecnologia de Saneamento Ambiental, SP, Brazil, from 1975 to 1978 are presented. Future research to be developed in this area is also discussed. (M.A.) [pt

  12. Lexical Decision with Left, Right and Center Visual Field Presentation: A Comparison between Dyslexic and Regular Readers by Means of Electrophysiological and Behavioral Measures

    Science.gov (United States)

    Shaul, Shelley

    2012-01-01

    This study examined the differences in processing between regular and dyslexic readers in a lexical decision task in different visual field presentations (left, right, and center). The research utilized behavioral measures that provide information on accuracy and reaction time and electro-physiological measures that permit the examination of brain…

  13. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  14. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  15. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  16. fields

    Directory of Open Access Journals (Sweden)

    Brad J. Arnold

    2014-07-01

    Full Text Available Surface irrigation, such as flood or furrow, is the predominant form of irrigation in California for agronomic crops. Compared to other irrigation methods, however, it is inefficient in terms of water use; large quantities of water, instead of being used for crop production, are lost to excess deep percolation and tail runoff. In surface-irrigated fields, irrigators commonly cut off the inflow of water when the water advance reaches a familiar or convenient location downfield, but this experience-based strategy has not been very successful in reducing the tail runoff water. Our study compared conventional cutoff practices to a retroactively applied model-based cutoff method in four commercially producing alfalfa fields in Northern California, and evaluated the model using a simple sensor system for practical application in typical alfalfa fields. These field tests illustrated that the model can be used to reduce tail runoff in typical surface-irrigated fields, and using it with a wireless sensor system saves time and labor as well as water.

  17. Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

    Science.gov (United States)

    Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

    2013-11-01

    While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  19. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  20. Consciousness wanted, attention found: Reasons for the advantage of the left visual field in identifying T2 among rapidly presented series.

    Science.gov (United States)

    Verleger, Rolf; Śmigasiewicz, Kamila

    2015-09-01

    Everyday experience suggests that people are equally aware of events in both hemi-fields. However, when two streams of stimuli are rapidly presented left and right containing two targets, the second target is better identified in the left than in the right visual field. This might be considered evidence for a right-hemisphere advantage in generating conscious percepts. However, this putative asymmetry of conscious perception cannot be measured independently of participants' access to their conscious percepts, and there is actually evidence from split-brain patients for the reverse, left-hemisphere advantage in having access to conscious percepts. Several other topics were studied in search of the responsible mechanism, among others: Mutual inhibition of hemispheres, cooperation of hemispheres in perceiving midline stimuli, and asymmetries in processing various perceptual inputs. Directing attention by salient cues turned out to be one of the few mechanisms capable of modifying the left visual-field advantage in this paradigm. Thus, this left visual-field advantage is best explained by the notion of a right-hemisphere advantage in directing attention to salient events. Dovetailing with the pathological asymmetries of attention after right-hemisphere lesions and with asymmetries of brain activation when healthy participants shift their attention, the present results extend that body of evidence by demonstrating unusually large and reliable behavioral asymmetries for attention-directing processes in healthy participants. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Science.gov (United States)

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  2. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  3. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Lecture Presentations

    International Nuclear Information System (INIS)

    2008-01-01

    The Symposium on Physics of Elementary Interactions in the LHC Era held in Warsaw from 21 to 22 April 2008. The main subject of the workshop was to present the progress in CERN LHC collider project. Additionally some satellite activities in field of education, knowledge and technology transfer in the frame of CERN - Poland cooperation were shown

  5. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  6. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    OpenAIRE

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  7. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Directory of Open Access Journals (Sweden)

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  8. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  9. Proceedings of the African Field Epidemiology Network (AFENET) Scientific Conference 17-22 November 2013 Addis Ababa, Ethiopia: plenaries and oral presentations.

    Science.gov (United States)

    Gitta, Sheba Nakacubo; Mwesiga, Allan; Kamadjeu, Raoul

    2015-01-01

    Biennially, trainees and graduates of Field Epidemiology and Laboratory Training Programs (FELTPs) are presented with a platform to share investigations and projects undertaken during their two-year training in Applied Epidemiology. The African Field Epidemiology Network (AFENET) Scientific Conference, is a perfect opportunity for public health professionals from various sectors and organizations to come together to discuss issues that impact on public health in Africa. This year's conference was organized by the Ethiopian Health and Nutrition Research Institute in collaboration with the Ethiopia Ministry of Health, Ethiopian Public Health Association (EPHA), Ethiopia Field Epidemiology Training Program (EFETP), Addis Ababa University (AAU), Training Programs in Epidemiology and Public Health Interventions Network (TEPHINET) and AFENET. Participants at this year's conference numbered 400 from over 20 countries including; Angola, Burkina Faso, Cameroon, Central African Republic, Democratic Republic of the Congo, Ethiopia, Ghana, Indonesia, Kenya, Mozambique, Namibia, Nigeria, Rwanda, South Africa, Sudan, Tanzania, Uganda, Yemen and Zimbabwe. The topics covered in the 144 oral presentations included: global health security, emergency response, public health informatics, vaccine preventable diseases, immunization, outbreak investigation, Millennium Development Goals, Non-Communicable Diseases, and public health surveillance. The theme for the 5th AFENET Scientific Conference was; "Addressing Public Health Priorities in Africa through FELTPs." Previous AFENET Scientific conferences have been held in: Accra, Ghana (2005), Kampala, Uganda (2007), Mombasa, Kenya (2009) and Dar es Salaam, Tanzania (2011).

  10. More than a century of bathymetric observations and present-day shallow sediment characterization in Belfast Bay, Maine, USA: implications for pockmark field longevity

    Science.gov (United States)

    Brothers, Laura L.; Kelley, Joseph T.; Belknap, Daniel F.; Barnhardt, Walter A.; Andrews, Brian D.; Maynard, Melissa Landon

    2011-08-01

    Mechanisms and timescales responsible for pockmark formation and maintenance remain uncertain, especially in areas lacking extensive thermogenic fluid deposits (e.g., previously glaciated estuaries). This study characterizes seafloor activity in the Belfast Bay, Maine nearshore pockmark field using (1) three swath bathymetry datasets collected between 1999 and 2008, complemented by analyses of shallow box-core samples for radionuclide activity and undrained shear strength, and (2) historical bathymetric data (report and smooth sheets from 1872, 1947, 1948). In addition, because repeat swath bathymetry surveys are an emerging data source, we present a selected literature review of recent studies using such datasets for seafloor change analysis. This study is the first to apply the method to a pockmark field, and characterizes macro-scale (>5 m) evolution of tens of square kilometers of highly irregular seafloor. Presence/absence analysis yielded no change in pockmark frequency or distribution over a 9-year period (1999-2008). In that time pockmarks did not detectably enlarge, truncate, elongate, or combine. Historical data indicate that pockmark chains already existed in the 19th century. Despite the lack of macroscopic changes in the field, near-bed undrained shear-strength values of less than 7 kPa and scattered downcore 137Cs signatures indicate a highly disturbed setting. Integrating these findings with independent geophysical and geochemical observations made in the pockmark field, it can be concluded that (1) large-scale sediment resuspension and dispersion related to pockmark formation and failure do not occur frequently within this field, and (2) pockmarks can persevere in a dynamic estuarine setting that exhibits minimal modern fluid venting. Although pockmarks are conventionally thought to be long-lived features maintained by a combination of fluid venting and minimal sediment accumulation, this suggests that other mechanisms may be equally active in

  11. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Science.gov (United States)

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  12. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    OpenAIRE

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  13. Analysis of a Permo-Triassic polarity transition in different absolute reconstructions of Pangaea, considering a model with features of the present Earth magnetic field

    Directory of Open Access Journals (Sweden)

    M. A. Van Zele

    2007-06-01

    Full Text Available The main objective of this paper is to show that the distribution of transitional palaeomagnetic data recorded at 250 Ma are in agreement with simulated data that depend on the sampling site, using a model that considers features of the Present Earth magnetic field. The analysis was performed comparing simulated reversals with the Permo-Triassic polarity transition recorded in the Siberian Trap Basalts. The palaeomagnetic data were corrected according to the Palaeo-latitude and Palaeo-longitude of Siberia (absolute reconstruction at 250 Ma using hotspot tracks. To obtain the motion of Siberia relative to hotspots from the Present time back to 250 Ma, three different Pangaea models were considered (Pangaea A, Pangaea A2, Pangaea B. In spite of the uncertainties associated with the use of hotspot frameworks and Pangaea configurations, both the modelled and recorded data show a remarkable fit when absolute reconstructions of Pangaea A and A2 configurations are performed. The agreement between both simulated and recorded data suggests that similar features to that of the Present Earth magnetic field could have been involved in reversals since the Permo-Triassic.

  14. Enhanced microactuation with magnetic field curing of ...

    Indian Academy of Sciences (India)

    ples have been enhanced by two times when compared with that of zero field cured samples. The effect of .... Gauge of wire ... electrolitic-300 mesh (84.67 µm) LR, Product No. ... be in the body centered cubic phase with a lattice parameter.

  15. Scientific days on electromagnetic fields: from dosimetry to human health - Conference proceedings; Journees scientifiques - Champs electromagnetiques: de la dosimetrie a la sante humaine - Recueil des resumes et presentations

    Energy Technology Data Exchange (ETDEWEB)

    Wiart, J.; Ghanmi, A.; Picon, O.; Conil, E.; Varsier, N.; Hadjem, A.; Sudret, B.; Magne, I.; Souques, M.; Gaudaire, F.; De Seze, R.; Jawad, O.; Lautru, D.; Dricot, J.M.; Horlin, F.; De Doncker, P.; Drissaoui, A.; Musy, F.; Nicolas, L.; Perrussel, R.; Scorretti, R.; Voyer, D.; Jala, M.; Moulines, E.; Levy-Leduc, C.; Mahfouz, Z.; Gati, A.; Fouad Hanna, V.; Leveque, P.; Arnaud-Cormos, D.; Zhadobov, M.; Jarrige, P.; Gaborit, G.; Kohler, S.; Ticaud, N.; Duvillaret, L.; Guelilia, Z.; Loison, R.; Gillard, R.; Laisne, A.; Favet, D.; Benadhira, R.; Mir, L.; Nadi, M.; Kourtiche, D.; Gazeau, F.; Wilhelm, C.; Delemotte, L.; Breton, M.; Tarek, M.; Marc-Vergnes, J.P.; Yardin, C.; Perrin, A.; Le Drean, Y.; Sauleau, R.; Lambrozo, J.; Selmaoui, B.; Ghosn, R.; Thuroczy, G.; Villegier, A.S.; Loos, N.; Brenet-Dufour, V.; Liabeuf, S.; Bach, V.; Moretti, D.; Lewis, N.; Garenne, A.; Poulletier De Gannes, F.; Haro, E.; Lagroye, I.; Bornat, Y.; Boutaib, Y.; Saighi, S.; Renaud, S.; Veyre, B.; Schuz, J.; Deltour, I.; Van Deventer, E.; Vecchia, P.; Merckel, O.; Bellaouel, A.; Demaret, P.; Donati, P.; Jovanovic, D.; Chauvin, S.; Desreumaux, J.P.; Fouquet, L.; Picard, D.; Massardier-Pilonchery, A.; Hours, M.; Bergeret, A.; Person, C.; Toutain, Y.; Butet, R.; Berrahma, K.; Balderelli, I.; Stelmaszyk, V.; Cretallaz, C.; Lamproglou, I.; Amourette, C.; Diserbo, M.; Fauquette, W.; Martigne, P.; Collin, A.; Lagroye, I.; Ait Aissa, S.; Hurtier, A.; Taxile, M.; Le Montagner, L.; Athane, A.; Duleu, S.; Percherancier, Y.; Geffard, M.; Ruffie, G.; Billaudel, B.; Veyret, B.; Pelletier, A.; Delanaud, S.; Libert, J.P.; Schunck, T.; Bieth, F.; Soubere Mahamoud, Y.; Le Quement, C.; Ferrand, G.; Le Guevel, R.; Carton, P.H.; Luong, M.; Tanvir, S.; Selmaoui, B.; Silva Pires-Antonietti, V.; Sonnet, P.; Pulvin, S.; Kuster, O.; Tetelin, C.

    2012-04-15

    This document brings together the available presentations (articles and slides) given at the URSI scientific days on electromagnetic fields: dosimetry, peoples' exposure, biological and health risks, risk management, and medical uses. 48 presentations are compiled in this document and deal with: 1 - Stochastic dosimetry: variability challenge; 2 - How to estimate the exposure to 50/60 Hz magnetic field in an epidemiological study?; 3 - Joint analysis of population exposure and radio coverage of GSM and UMTS mobile phone networks; 4 - Study of the specific energy absorption rate (SAR) sensitiveness to phone positions near the head for 2 GSM mobile phones; 5 - Statistical Study of SAR under Wireless Channel - Exposure in Indoor Environment; 6 - Uncertainty propagation in numerical dosimetry: how to reduce calculation costs?; 7 - Use of a simplified pregnant woman model for foetus exposure analysis; 8 - SAR estimation using multi-exposure with a mobile phone; 9 - State-of-the-art in experimental dosimetry (RF and pulses); 10 - Mm-waves dosimetry: issues, stakes and actual solutions; 11 - Use of DG-FDTD for a dosimetry calculation in a strongly multi-scale problem: determination of the eye-SAR near a HF/VHF vehicle-borne source; 12 - Dosimetric measurements with a fiber-type electro-optical sensor; 13 - Partial experimental evaluation of basic restrictions in the HF/VHF range; 14 - Repetitive trans-cranial magnetic stimulation Stimulation (rTMS) in psychiatry: present day situation and perspectives; 15 - Medical applications of electric fields; 16 - Measurements for life: new perspectives? 17 - Nano-particles and magnetic stimuli for medical imaging and therapy; 18 - Molecular Insights into electroporation and siRNA electro-transfer through model cell membranes; 19 - State of knowledge on electromagnetic fields hypersensitivity (HS-CEM); 20 - Experimentation methodology: from results to interpretation; 22 - Mm waves - update on biological effects at 40-60 GHz; 23

  16. Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

    International Nuclear Information System (INIS)

    Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

    2005-01-01

    Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

  17. Neutron and photon spectrometry in mixed radiation fields

    International Nuclear Information System (INIS)

    Jancar, A.; Kopecky, Z.; Veskrna, M.

    2014-01-01

    Spectrometric measurements of the mixed fields of neutron and photon radiation in the workplaces with the L-R-0 research reactor located in the UJV Rez and with the Van de Graaff accelerator, located in the UTEF laboratories Prague, are presented in this paper. The experimental spectrometric measurements were performed using a newly developed digital measuring system, based on the technology of analog-digital converters with a very high sampling frequency (up to 2 GHz), in connection with organic scintillation detector, type BC-501A, and stilbene detector. The results of experimental measurements show high quality of spectrometry mixed fields of neutron and photon radiation across the wide dynamic range of measured energy. (authors)

  18. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    Directory of Open Access Journals (Sweden)

    R. Greco

    2013-09-01

    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  19. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

    Science.gov (United States)

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  1. CERN Library | Cecilia Jarlskog presents "Portrait of Gunnar Källén: a physics shooting star and poet of early quantum field theory" | 16 September

    CERN Multimedia

    2014-01-01

    Wolfgang Pauli referred to him as 'my discovery', Robert Oppenheimer described him as 'one of the most gifted theorists' and Niels Bohr found him enormously stimulating. Who was the man in question, Gunnar Källén (1926-1968)?   His appearance in the physics sky was like a shooting star. His contributions to the scientific debate caused excitement among young and old. Similar to his friend and mentor, Wolfgang Pauli, he demanded honesty and rigour in physics - a distinct dividing line between fact and speculation. In his obituary, Arthur S. Wightman would write: "Gunnar Källén was a proud continuer of the tradition in quantum field theory established by Wolfgang Pauli. His papers on quantum electrodynamics in the period 1950-1954 carried the non-perturbative approach to quantum electrodynamics forward to a point beyond which very little essential progress has been made up to the present day. At the time I was trying ...

  2. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    International Nuclear Information System (INIS)

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  3. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  4. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  5. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Science.gov (United States)

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

    2012-10-01

    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  6. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  7. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Science.gov (United States)

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

    2016-01-01

    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  8. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  9. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  11. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  12. Effect of electrical field strength applied by PEF processing and storage temperature on the outgrowth of yeasts and moulds naturally present in a fresh fruit smoothie

    NARCIS (Netherlands)

    Timmermans, R.A.H.; Nederhoff, A.L.; Nierop Groot, M.N.; Boekel, van M.A.J.S.; Mastwijk, H.C.

    2016-01-01

    Pulsed electrical field (PEF) technology offers an alternative to thermal pasteurisation of high-acid fruit juices, by extending the shelf life of food products, while retaining its fresh taste and nutritional value. Substantial research has been performed on the effect of electrical field

  13. Presentation of a Modified Boustrophedon Decomposition Algorithm for Optimal Configuration of Flat Fields to use in Path Planning Systems of Agricultural Vehicles

    Directory of Open Access Journals (Sweden)

    R Goudarzi

    2018-03-01

    Full Text Available Introduction The demand of pre-determined optimal coverage paths in agricultural environments have been increased due to the growing application of field robots and autonomous field machines. Also coverage path planning problem (CPP has been extensively studied in robotics and many algorithms have been provided in many topics, but differences and limitations in agriculture lead to several different heuristic and modified adaptive methods from robotics. In this paper, a modified and enhanced version of currently used decomposition algorithm in robotics (boustrophedon cellular decomposition has been presented as a main part of path planning systems of agricultural vehicles. Developed algorithm is based on the parallelization of the edges of the polygon representing the environment to satisfy the requirements of the problem as far as possible. This idea is based on "minimum facing to the cost making condition" in turn, it is derived from encounter concept as a basis of cost making factors. Materials and Methods Generally, a line termed as a slice in boustrophedon cellular decomposition (BCD, sweeps an area in a pre-determined direction and decomposes the area only at critical points (where two segments can be extended to top and bottom of the point. Furthermore, sweep line direction does not change until the decomposition finish. To implement the BCD for parallelization method, two modifications were applied in order to provide a modified version of the boustrophedon cellular decomposition (M-BCD. In the first modification, the longest edge (base edge is targeted, and sweep line direction is set in line with the base edge direction (sweep direction is set perpendicular to the sweep line direction. Then Sweep line moves through the environment and stops at the first (nearest critical point. Next sweep direction will be the same as previous, If the length of those polygon's newly added edges, during the decomposition, are less than or equal to the

  14. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  15. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    International Nuclear Information System (INIS)

    Cerrada, Lucia; San Martin, Jesus

    2011-01-01

    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  16. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  17. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  18. ASTRO Research Fellow Presentation - A comparison of the comet assay and pulsed-field gel electrophoresis as a predictive assay for radiosensitivity in human fibroblasts

    International Nuclear Information System (INIS)

    Sarkaria, Jann N.; Eady, John J.; Peacock, John H.; Steel, G. Gordon

    1996-01-01

    Purpose/Objective: To determine whether neutral lysis single-cell gel electrophoresis (comet assay) or pulsed-field gel electrophoresis (PFGE) can be used as a predictive assay for tissue response to radiotherapy as an alternative to clonogenic survival measurements. Materials and Methods: The comet assay has been widely used to measure DNA double strand breaks (dsb) in individual cells, and it has been suggested that it could be used as an alternative to clonogenic assays to measure radiosensitivity. Previous studies in this lab have demonstrated the ability of pulsed-field gel electrophoresis, which also measures DNA dsb, to accurately predict the radiosensitivity of a panel of fibroblasts based on determination of residual DNA dsb. As part of an ongoing study examining the relationship between fibroblast radiosensitivity and normal-tissue radiation reactions, we have compared the sensitivity and accuracy of the comet assay and PFGE on a different panel of non-transformed fibroblasts derived from breast cancer patients who developed severe radiation late effects and from case-matched controls. For the measurement of initial damage, cells were suspended in PBS and irradiated on ice for the comet assay and irradiated in agarose plugs on ice for pFGE. Residual damage was measured following irradiation of confluent cultures at 37 degree sign C and subsequent incubation for four hours prior to preparation of agarose slides and plugs. All irradiations were performed with a 59 TBq 60 Co source at a dose rate of 1.7 Gy/min. Electrophoresis was performed following neutral pH cell lysis. Comet images were captured and analyzed using Optimas software with DNA damage quantitated by the comet moment. PFGE gels were analyzed using a phosphor-image analysis system and damage was quantitated based on the percent of activity released from the well. Results: The comet assay was able to detect initial DNA damage at a threshold of 5 Gy and exhibited a linear dose

  19. Bendrininkavimo formos LR BK ir jų baudžiamasis teisinis vertinimas

    OpenAIRE

    Sabašinskas, Vytautas

    2006-01-01

    Summary The master thesis presents legal analysis of forms of complicity in the Criminal Code of Republic of Lithuania. The institute of complicity presents rather complicated structure within the Criminal Law. The modern system of forms of complicity consists of three members: group of accomplices, organized group and criminal association. The theory of Criminal Law is trying to find ways of justifying the construction, presented by the legislator. The forms of complicity as a topic of...

  20. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

    2018-03-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  1. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  2. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Science.gov (United States)

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  3. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    International Nuclear Information System (INIS)

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

    1998-01-01

    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  4. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

    2014-04-18

    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  5. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    NARCIS (Netherlands)

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

    2016-01-01

    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  6. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  7. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  8. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Science.gov (United States)

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

    2013-05-01

    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  9. Chemical profiling with cytokine stimulating investigations of Sutherlandia frutescens L.R. (Br.) (Fabaceae)

    CSIR Research Space (South Africa)

    Faleschini, MT

    2013-03-01

    Full Text Available gave the best performance in recruiting various inflammatory cytokines to the site of infection upon stimulation with phorbol 12-myristate 13-acetate, where essentially the non-polar compounds present in the ethanol extract contributed to most...

  10. Reducing loss in lateral charged-particle equilibrium due to air cavities present in x-ray irradiated media by using longitudinal magnetic fields

    International Nuclear Information System (INIS)

    Naqvi, Shahid A.; Li, X. Allen; Ramahi, Shada W.; Chu, James C.; Ye, Sung-Joon

    2001-01-01

    The underdosing of lesions distal to air cavities, such as those found in upper respiratory passages, occurs due to the loss in lateral charged-particle equilibrium (CPE). The degree of underdosing worsens for smaller field sizes, resulting in more frequent recurrence of the cancer treated. Higher photon energies further aggravate the outcome by producing longer second build-up regions beyond the cavity. Besides underdosing, the larger lateral spread of secondary electron fluence in the air cavity produces diffuse dose distributions at the tissue-air interface for shaped or intensity modulated fields. These disequilibrium effects create undesirable deviations from the intended treatment. The clinical concern is further intensified by the failure of traditional treatment planning systems to even account for such defects. In this work, the use of longitudinal magnetic fields on the order of 0.5 T is proposed for alleviating lateral electronic disequilibrium due to the presence of air cavities in the irradiated volume. The magnetic field enforces lateral CPE by restricting the lateral range of electrons in the air cavity. The problem is studied in a simple water-air-water slab geometry using EGS4 Monte Carlo simulations for 6 MV photons. Electronic disequilibrium is evaluated for beams of various sizes, shapes and intensity distributions constructed by linear superposition of the dose distributions for 0.5x0.5 cm 2 beamlets. Comparison is also made with 60 Co irradiation. The results indicate that the lateral confinement of secondary electrons in the air cavity by sub-MRI strength longitudinal fields is effective in reducing deterioration of dose distributions near tissue-air interfaces. This can potentially reduce recurrence rates of cancers such as the larynx carcinoma

  11. View presentation

    Indian Academy of Sciences (India)

    ABCD

    ... molecular electronics, such as molecular rectifiers, organic memory, electrical bistability, negative differential resistance (NDR). Data storage in quantum dots. Nanodiodes, nanowire diodes. Magnetic field assisted assembly of organic molecules – orientation in a monolayer. Surface passivated substrates & transport gap.

  12. Evaluation Of Silicon Diodes As IN-SITU Cryogenic Field Emission Detectors For SRF Cavity Development

    International Nuclear Information System (INIS)

    Palczewski, Ari; Geng, Rongli

    2012-01-01

    We performed in-situ cryogenic testing of four silicon diodes as possible candidates for field emission (FE) monitors of superconducting radio frequency (SRF) cavities during qualification testing and in accelerator cryo-modules. We evaluated diodes from 2 companies - from Hamamatsu corporation model S1223-01; and from OSI Optoelectronics models OSD35-LR-A, XUV-50C, and FIL-UV20. The measurements were done by placing the diodes in superfluid liquid helium near the top of a field emitting 9-cell cavity during its vertical test. For each diode, we will discuss their viability as a 2K cryogenic detector for FE mapping of SRF cavities and the directionality of S1223-01 in such environments. We will also present calibration curves between the diodes and JLab's standard radiation detector placed above the Dewar's top plate.

  13. Lecture Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The main subjects of this conference are: dark energy and dark mater problem, role of neutrinos and the neutrino oscillations, different aspects of Einstein field equation with special attention given to black holes and field singularities, structure of neutron stars and dense nuclear matter transition into quark-gluon plasma. Some methods of measuring of physical values as well as measuring instruments are also discussed

  14. The relationship between the presence and extent of lobular carcinoma in situ (LCIS) and the risk of local recurrence (LR) in patients with infiltrating cancer of the breast treated with conservative surgery (CS) and radiation therapy (RT)

    International Nuclear Information System (INIS)

    Abner, A.; Schnitt, S.; Connolly, J.; Recht, A.; Bornstein, B.; Nixon, A.; Hetelekidis, S.; Silver, B.; Harris, J.R.

    1997-01-01

    Purpose: Lobular carcinoma in situ, when found in an otherwise benign breast biopsy, is associated with an increased risk of developing a subsequent invasive breast cancer. Among patients with an infiltrating cancer resected without margin assessment, the extent of ductal carcinoma in situ is an established risk factor for LR after CS and RT. However, the association between the presence and extent of LCIS and the risk of recurrence in patients treated with CS and RT for infiltrating breast cancer remains at issue. Materials and Methods: Between 1968 and 1986, 1625 patients with clinical stage T1 and T2 invasive breast cancer were treated at the Joint Center for Radiation Therapy with complete gross tumor excision and RT to a total of ≥60 Gy. Of these, 1160 had infiltrating ductal cancer (IDC), infiltrating lobular cancer (ILC), or mixed IDC/ILC (IMC) and sufficient pathologic material for review by the study pathologists (SS and JC) to establish the presence or absence of LCIS and were evaluable at 10 years. LCIS was present adjacent to the invasive cancer in (43(1027)) IDC (4%), and either within or adjacent to the infiltrating tumor in (70(82)) ILC (85%) and (26(51)) IMC (51%). Margins were evaluable in 35% of LCIS-positive patients and 33% of LCIS-negative patients. The median follow-up time was 153 months for surviving patients. Results: The 10-year crude risk of recurrence by first site of failure for all patients was as follows: Furthermore, there was no significant relationship between the extent of the LCIS adjacent to the invasive tumor and the LR risk: The 10-year crude risk of contralateral breast cancer was 7% for the patients with LCIS and 7% for those without LCIS. CONCLUSION: We conclude that neither the presence nor the extent of LCIS is related to the risk of LR in patients with invasive breast cancer treated with CS and RT. Thus, LCIS should not be considered a contraindication to breast conservation with CS and RT

  15. Aging and magnetism: Presenting a possible new holistic paradigm for ameliorating the aging process and the effects thereof, through externally applied physiologic PicoTesla magnetic fields.

    Science.gov (United States)

    Jacobson, Jerry; Sherlag, Benjamin

    2015-09-01

    A new holistic paradigm is proposed for slowing our genomic-based biological clocks (e.g. regulation of telomere length), and decreasing heat energy exigencies for maintenance of physiologic homeostasis. Aging is considered the result of a progressive slow burn in small volumes of tissues with increase in the quantum entropic states; producing desiccation, microscopic scarring, and disruption of cooperative coherent states. Based upon piezoelectricity, i.e. photon-phonon transductions, physiologic PicoTesla range magnetic fields may decrease the production of excessive heat energy through target specific, bio molecular resonant interactions, renormalization of intrinsic electromagnetic tissue profiles, and autonomic modulation. Prospectively, we hypothesize that deleterious effects of physical trauma, immunogenic microbiological agents, stress, and anxiety may be ameliorated. A particle-wave equation is cited to ascertain magnetic field parameters for application to the whole organism thereby achieving desired homeostasis; secondary to restoration of structure and function on quantum levels. We hypothesize that it is at the atomic level that physical events shape the flow of signals and the transmission of energy in bio molecular systems. References are made to experimental data indicating the aspecific efficacy of non-ionizing physiologic magnetic field profiles for treatment of various pathologic states. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Delivery presentations

    Science.gov (United States)

    Pregnancy - delivery presentation; Labor - delivery presentation; Occiput posterior; Occiput anterior; Brow presentation ... The mother can walk, rock, and try different delivery positions during labor to help encourage the baby ...

  17. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  18. Jorge A. Swieca's contributions to quantum field theory in the 60s and 70s and their relevance in present research

    Energy Technology Data Exchange (ETDEWEB)

    Schroer, Bert [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rio de Janeiro, RJ (Brazil); Freie Universitaet, Berlin (Germany). Inst. fuer Theoretische Physik

    2010-02-15

    After revisiting some high points of particle physics and QFT of the two decades from 1960 to 1980, I comment on the work by Jorge Andre Swieca. I explain how it fits into the quantum field theory during these two decades and draw attention to its relevance to the ongoing particle physics research. A particular aim of this article is to draw attention to the relevance of what at the time of Swieca was called 'the Schwinger Higgs screening mechanism'. which, together with recent ideas which generalize the concept of gauge theories, have all the ingredients to revolutionize the issue of gauge theories and the standard model. (author)

  19. Jorge A. Swieca's contributions to quantum field theory in the 60s and 70s and their relevance in present research

    Energy Technology Data Exchange (ETDEWEB)

    Schroer, Bert [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rio de Janeiro, RJ (Brazil); Freie Universitaet, Berlin (Germany). Inst. fuer Theoretische Physik

    2010-02-15

    After revisiting some high points of particle physics and QFT of the two decades from 1960 to 1980, I comment on the work by Jorge Andre Swieca. I explain how it fits into the quantum field theory during these two decades and draw attention to its relevance to the ongoing particle physics research. A particular aim of this article is to draw attention to the relevance of what at the time of Swieca was called 'the Schwinger Higgs screening mechanism'. which, together with recent ideas which generalize the concept of gauge theories, have all the ingredients to revolutionize the issue of gauge theories and the standard model. (author)

  20. Jorge A. Swieca's contributions to quantum field theory in the 60's and 70's and their relevance in present research

    International Nuclear Information System (INIS)

    Schroer, Bert

    2010-01-01

    After revisiting some high points of particle physics and QFT of the two decades from 1960 to 1980, I comment on the work by Jorge Andre Swieca. I explain how it fits into the quantum field theory during these two decades and draw attention to its relevance to the ongoing particle physics research. A particular aim of this article is to draw attention to the relevance of what at the time of Swieca was called t he Schwinger Higgs screening mechanism . which, together with recent ideas which generalize the concept of gauge theories, have all the ingredients to revolutionize the issue of gauge theories and the standard model. (author)

  1. Jorge A. Swieca's contributions to quantum field theory in the 60s and 70s and their relevance in present research

    International Nuclear Information System (INIS)

    Schroer, Bert; Freie Universitaet, Berlin

    2010-02-01

    After revisiting some high points of particle physics and QFT of the two decades from 1960 to 1980, I comment on the work by Jorge Andre Swieca. I explain how it fits into the quantum field theory during these two decades and draw attention to its relevance to the ongoing particle physics research. A particular aim of this article is to draw attention to the relevance of what at the time of Swieca was called 'the Schwinger Higgs screening mechanism'. which, together with recent ideas which generalize the concept of gauge theories, have all the ingredients to revolutionize the issue of gauge theories and the standard model. (author)

  2. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Directory of Open Access Journals (Sweden)

    Maya Safira Dewi

    2011-05-01

    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  3. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    International Nuclear Information System (INIS)

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  4. Critical Role of Endoplasmic Reticulum Stress in Cognitive Impairment Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Fei Cai

    2015-11-01

    Full Text Available Recent studies showed that cyanobacteria-derived microcystin-leucine-arginine (MCLR can cause hippocampal pathological damage and trigger cognitive impairment; but the underlying mechanisms have not been well understood. The objective of the present study was to investigate the mechanism of MCLR-induced cognitive deficit; with a focus on endoplasmic reticulum (ER stress. The Morris water maze test and electrophysiological study demonstrated that MCLR caused spatial memory injury in male Wistar rats; which could be inhibited by ER stress blocker; tauroursodeoxycholic acid (TUDCA. Meanwhile; real-time polymerase chain reaction (real-time PCR and immunohistochemistry demonstrated that the expression level of the 78-kDa glucose-regulated protein (GRP78; C/EBP homologous protein (CHOP and caspase 12 were significantly up-regulated. These effects were rescued by co-administration of TUDCA. In agreement with this; we also observed that treatment of rats with TUDCA blocked the alterations in ER ultrastructure and apoptotic cell death in CA1 neurons from rats exposed to MCLR. Taken together; the present results suggested that ER stress plays an important role in potential memory impairments in rats treated with MCLR; and amelioration of ER stress may serve as a novel strategy to alleviate damaged cognitive function triggered by MCLR.

  5. Introduction into a two-dimensional model of the photochemistry of the stratosphere of precipitations of galactic and solar protons: case of the present terrestrial magnetic field and of field reversal

    International Nuclear Information System (INIS)

    Brard, D.

    1982-11-01

    In the aim of studying the climatic variations related to the reversal of the geomagnetic field, an analysis has been made of the effects of precipitations of galactic and solar protons, on oxide of nitrogen (NOsub(x) and NO) and ozone. Modifications are introduced into the one- and two-dimensional models which take into account the structure of the magnetic field. In situ measurements after the solar event of August 1972 enable changes due to the solar cycles to be introduced and the use of a 2D model to be justified [fr

  6. Wide-field synovial fluid imaging using polarized lens-free on-chip microscopy for point-of-care diagnostics of gout (Conference Presentation)

    Science.gov (United States)

    Zhang, Yibo; Lee, Seung Yoon; Zhang, Yun; Furst, Daniel; Fitzgerald, John; Ozcan, Aydogan

    2016-03-01

    Gout and pseudogout are forms of crystal arthropathy caused by monosodium urate (MSU) and calcium pyrophosphate dehydrate (CPPD) crystals in the joint, respectively, that can result in painful joints. Detecting the unique-shaped, birefringent MSU/CPPD crystals in a synovial fluid sample using a compensated polarizing microscope has been the gold-standard for diagnosis since the 1960's. However, this can be time-consuming and inaccurate, especially if there are only few crystals in the fluid. The high-cost and bulkiness of conventional microscopes can also be limiting for point-of-care diagnosis. Lens-free on-chip microscopy based on digital holography routinely achieves high-throughput and high-resolution imaging in a cost-effective and field-portable design. Here we demonstrate, for the first time, polarized lens-free on-chip imaging of MSU and CPPD crystals over a wide field-of-view (FOV ~ 20.5 mm2, i.e., gout and pseudogout. Circularly polarizer partially-coherent light is used to illuminate the synovial fluid sample on a glass slide, after which a quarter-wave-plate and an angle-mismatched linear polarizer are used to analyze the transmitted light. Two lens-free holograms of the MSU/CPPD sample are taken, with the sample rotated by 90°, to rule out any non-birefringent objects within the specimen. A phase-recovery algorithm is also used to improve the reconstruction quality, and digital pseudo-coloring is utilized to match the color and contrast of the lens-free image to that of a gold-standard microscope image to ease the examination by a rheumatologist or a laboratory technician, and to facilitate computerized analysis.

  7. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Vanessa de Farias

    2009-06-01

    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  8. Excavating and (Re)Presenting Stories: Narrative Inquiry as an Emergent Methodology in the Field of Adult Vocational Education and Technology

    Science.gov (United States)

    Zimmerman, Aaron Samuel; Kim, Jeong-Hee

    2017-01-01

    Narrative inquiry has been a popular methodology in different disciplines for the last few decades. Using stories, narrative inquiry illuminates lived experience, serving as a valuable complement to research methodologies that are rooted in positivist epistemologies. In this article, we present a brief introduction to narrative inquiry including…

  9. Investigations in the field electron emission at the Siemens research laboratory directed by Gustav Hertz between 1935 and 1945 and their significance for the present-day surface physics

    International Nuclear Information System (INIS)

    Haefer, R.A.

    1987-01-01

    The author, who was a co-worker of Gustav Hertz, describes briefly the early history of field emission research and the fundamental results, i.e. the invention of the field electron microscope by E. W. Mueller and the first confirmation of the quantum mechanical Fowler-Nordheim theory by R. A. Haefer, and points out their significance for present-day surface physics and technology. (author)

  10. Technical presentation

    CERN Multimedia

    GS Department

    2010-01-01

    10 March 2010 DYNEOS 10:00 – 12:00 - Main Building, Room B, 61-1-009 Dyneos AG is active in the fields of photonics, laser and high-precision positioning. Our highly qualified engineer team has more than 30 years of experience in electro-optical solutions sales. The engineers are supported by a technical and administrative team. We are focused on the Swiss market and represent six suppliers (Coherent, PI Physik Instrumente, SIOS, Nanonics Imaging, APE, Ekspla) in order to give a qualified sales and service support to our customers. Our products are dedicated to the research field as well as to industry. In addition to standard catalog products, we offer custom designs to fulfill the specific needs of OEM customers or specific applications.

  11. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    International Nuclear Information System (INIS)

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

    1987-01-01

    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  12. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    International Nuclear Information System (INIS)

    Vallejo Delgado, L.R.

    1989-01-01

    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  13. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  14. Present activities of the Nuclear Energy Commission in the field of safety of radiation sources and security of radioactive materials in Mongolia

    International Nuclear Information System (INIS)

    Oyuntulkhuur, N.

    2001-01-01

    The Radiation Safety Department of the Nuclear Energy Commission (NEC) is a regulatory body in Mongolia established in 1997. The paper gives a general overview of the main activities of the NEC on regulatory control of radiation sources in Mongolia. Mongolia declared itself a nuclear-weapon-free zone in 1992. Legal framework and waste management issues are described. The regulatory authority's co-operation with other agencies in radiation protection is also presented in this paper. (author)

  15. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  16. Field-testing of a cost-effective mobile-phone based microscope for screening of Schistosoma haematobium infection (Conference Presentation)

    Science.gov (United States)

    Ceylan Koydemir, Hatice; Bogoch, Isaac I.; Tseng, Derek; Ephraim, Richard K. D.; Duah, Evans; Tee, Joseph; Andrews, Jason R.; Ozcan, Aydogan

    2016-03-01

    Schistosomiasis is a parasitic and neglected tropical disease, and affects mobile-phone microscope, a custom-designed 3D printed opto-mechanical attachment (~150g) is placed in contact with the smartphone camera-lens, creating an imaging-system with a half-pitch resolution of ~0.87µm. This unit includes an external lens (also taken from a mobile-phone camera), a sample tray, a z-stage to adjust the focus, two light-emitting-diodes (LEDs) and two diffusers for uniform illumination of the sample. In our field-testing, 60 urine samples, collected from children, were used, where the prevalence of the infection was 72.9%. After concentration of the sample with centrifugation, the sediment was placed on a glass-slide and S. haematobium eggs were first identified/quantified using conventional benchtop microscopy by an expert diagnostician, and then a second expert, blinded to these results, determined the presence/absence of eggs using our mobile-phone microscope. Compared to conventional microscopy, our mobile-phone microscope had a diagnostic sensitivity of 72.1%, specificity of 100%, positive-predictive-value of 100%, and a negative-predictive-value of 57.1%. Furthermore, our mobile-phone platform demonstrated a sensitivity of 65.7% and 100% for low-intensity infections (≤50 eggs/10 mL urine) and high-intensity infections (mobile-phone microscope may play an important role in the diagnosis of schistosomiasis and various other global health challenges.

  17. Lecture Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The Heavy-Ion Collisions in the LHC workshop held in Cracow from 18 to 18 May 2007. The main subject of the workshop was to present the newest results of research provided at CERN LHC collider. Additionally some theoretical models and methods used for presented data analysis were discussed

  18. CATCHY PRESENTATIONS

    DEFF Research Database (Denmark)

    Eriksen, Kaare; Tollestrup, Christian; Ovesen, Nis

    2011-01-01

    An important competence for designers is the ability to communicate and present ideas and proposals for customers, partners, investors and colleagues. The Pecha Kucha principle, developed by Astrid Klein and Mark Dytham, has become a widely used and easy format for the presentation of new concepts...

  19. Prognostic value of high-field proton magnetic resonance spectroscopy in patients presenting with clinically isolated syndromes suggestive of multiple sclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Wattjes, Mike P. [University of Bonn, Department of Radiology/Neuroradiology, Bonn (Germany); VU University Medical Center, MS Center Amsterdam, Department of Radiology, Amsterdam (Netherlands); Harzheim, Michael; Schmidt, Stephan [University of Bonn, Department of Neurology, Bonn (Germany); Lutterbey, Goetz G.; Schild, Hans H.; Traeber, Frank [University of Bonn, Department of Radiology/Neuroradiology, Bonn (Germany); Bogdanow, Manuela [University of Bonn, Department of Medical Biometrics, Informatics and Epidemiology, Bonn (Germany)

    2008-02-15

    The aim of this study was to determine the prognostic value of metabolic alterations in the normal-appearing white matter (NAWM) of patients presenting with clinically isolated syndromes (CIS) suggestive of multiple sclerosis (MS) with special regard to the prediction of conversion to definite MS. Using a 3T whole-body MR system, a multisequence conventional MRI protocol and single-voxel proton MR spectroscopy (PRESS, repetition time 2000 ms, echo times 38 ms and 140 ms) of the parietal NAWM were performed in 25 patients presenting with CIS at baseline and in 20 controls. Absolute concentrations of N-acetyl-aspartate (tNAA), myo-inositol (Ins), choline (Cho) and creatine (tCr) as well as metabolite ratios were determined. Follow-up including neurological assessment and conventional MRI was performed 3-4 and 6-7 months after the initial event. Nine patients converted to definite MS during the follow-up period. Compared to controls, those patients who converted to MS also showed significantly lower tNAA concentrations in the NAWM (-13.4%, P = 0.002) whereas nonconverters (-6.5%, P = 0.052) did not. The Ins concentration was 20.2% higher in the converter group and 1.9% higher in the nonconverter group, but these differences did not reach significance. No significant differences could be observed for tCr and Cho in either patient group. Axonal damage at baseline in patients presenting with CIS was more prominent in those who subsequently converted to definite MS in the short term follow-up, indicating that tNAA might be a sufficient prognostic marker for patients with a higher risk of conversion to early definite MS. (orig.)

  20. Prognostic value of high-field proton magnetic resonance spectroscopy in patients presenting with clinically isolated syndromes suggestive of multiple sclerosis

    International Nuclear Information System (INIS)

    Wattjes, Mike P.; Harzheim, Michael; Schmidt, Stephan; Lutterbey, Goetz G.; Schild, Hans H.; Traeber, Frank; Bogdanow, Manuela

    2008-01-01

    The aim of this study was to determine the prognostic value of metabolic alterations in the normal-appearing white matter (NAWM) of patients presenting with clinically isolated syndromes (CIS) suggestive of multiple sclerosis (MS) with special regard to the prediction of conversion to definite MS. Using a 3T whole-body MR system, a multisequence conventional MRI protocol and single-voxel proton MR spectroscopy (PRESS, repetition time 2000 ms, echo times 38 ms and 140 ms) of the parietal NAWM were performed in 25 patients presenting with CIS at baseline and in 20 controls. Absolute concentrations of N-acetyl-aspartate (tNAA), myo-inositol (Ins), choline (Cho) and creatine (tCr) as well as metabolite ratios were determined. Follow-up including neurological assessment and conventional MRI was performed 3-4 and 6-7 months after the initial event. Nine patients converted to definite MS during the follow-up period. Compared to controls, those patients who converted to MS also showed significantly lower tNAA concentrations in the NAWM (-13.4%, P = 0.002) whereas nonconverters (-6.5%, P = 0.052) did not. The Ins concentration was 20.2% higher in the converter group and 1.9% higher in the nonconverter group, but these differences did not reach significance. No significant differences could be observed for tCr and Cho in either patient group. Axonal damage at baseline in patients presenting with CIS was more prominent in those who subsequently converted to definite MS in the short term follow-up, indicating that tNAA might be a sufficient prognostic marker for patients with a higher risk of conversion to early definite MS. (orig.)

  1. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  2. Presented papers

    International Nuclear Information System (INIS)

    2002-01-01

    This International Conference on Nutrition and Cancer is endorsed for a hundred international institutions so much clinical as of investigation in the area of the vitamins, nutrition and cancer. It has a main objective to offer to students and professionals so much inside the area of the health, like to the community what is happening in the field of the nutrients related with the cancer, and this way to be able to be expressed correctly and security like the human being it cares for their own body

  3. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  4. Workshop presentations

    International Nuclear Information System (INIS)

    Sanden, Per-Olof; Edland, Anne; Reiersen, Craig; Mullins, Peter; Ingemarsson, Karl-Fredrik; Bouchard, Andre; Watts, Germaine; Johnstone, John; Hollnagel, Erik; Ramberg, Patric; Reiman, Teemu

    2009-01-01

    An important part of the workshop was a series of invited presentations. The presentations were intended to both provide the participants with an understanding of various organisational approaches and activities as well as to stimulate the exchange of ideas during the small group discussion sessions. The presentation subjects ranged from current organisational regulations and licensee activities to new organisational research and the benefits of viewing organisations from a different perspective. There were more than a dozen invited presentations. The initial set of presentations gave the participants an overview of the background, structure, and aims of the workshop. This included a short presentation on the results from the regulatory responses to the pre-workshop survey. Representatives from four countries (Sweden, Canada, Finland, and the United Kingdom) expanded upon their survey responses with detailed presentations on both regulatory and licensee safety-related organisational activities in their countries. There were also presentations on new research concerning how to evaluate safety critical organisations and on a resilience engineering perspective to safety critical organisations. Below is the list of the presentations, the slides of which being available in Appendix 2: 1 - Workshop Welcome (Per-Olof Sanden); 2 - CSNI Working Group on Human and Organisational Factors (Craig Reiersen); 3 - Regulatory expectations on justification of suitability of licensee organisational structures, resources and competencies (Anne Edland); 4 - Justifying the suitability of licensee organisational structures, resources and competencies (Karl-Fredrik Ingemarsson); 5 - Nuclear Organisational Suitability in Canada (Andre Bouchard); 6 - Designing and Resourcing for Safety and Effectiveness (Germaine Watts); 7 - Organisational Suitability - What do you need and how do you know that you've got it? (Craig Reiersen); 8 - Suitability of Organisations - UK Regulator's View (Peter

  5. CERN presentations

    CERN Multimedia

    CERN. Geneva

    2011-01-01

    Presentation by CERN (10 minutes each) Rolf Landua - Education and Outreach Salvatore Mele - Open Access Jean-Yves Le Meur - Digital Library in Africa Francois Fluckiger - Open Source/Standards (tbc) Tim Smith - Open Data for Science Tullio Basiglia - tbc

  6. Delivery presentations

    Science.gov (United States)

    ... has entered the pelvis. If the presenting part lies above the ischial spines, the station is reported ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  7. Potential risk levels of invasive Neoleucinodes elegantalis (small tomato borer) in areas optimal for open-field Solanum lycopersicum (tomato) cultivation in the present and under predicted climate change.

    Science.gov (United States)

    da Silva, Ricardo Siqueira; Kumar, Lalit; Shabani, Farzin; Picanço, Marcelo Coutinho

    2017-03-01

    Neoleucinodes elegantalis is one of the major insect pests of Solanum lycopersicum. Currently, N. elegantalis is present only in America and the Caribbean, and is a threat in the world's largest S. lycopersicum-producing countries. In terms of potential impact on agriculture, the impact of climate change on insect invasions must be a concern. At present, no research exists regarding the effects of climatic change on the risk level of N. elegantalis. The purpose of this study was to develop a model for S. lycopersicum and N. elegantalis, utilizing CLIMEX to determine risk levels of N. elegantalis in open-field S. lycopersicum cultivation in the present and under projected climate change, using the global climate model CSIRO-Mk3.0. Large areas are projected to be suitable for N. elegantalis and optimal for open-field S. lycopersicum cultivation at the present time. However, in the future these areas will become unsuitable for both species. Conversely, other regions in the future may become optimal for open-field S. lycopersicum cultivation, with a varying risk level for N. elegantalis. The risk level results presented here provide a useful tool to design strategies to prevent the introduction and establishment of N. elegantalis in open-field S. lycopersicum cultivation. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. Information Presentation

    Science.gov (United States)

    Holden, K.L.; Boyer, J.L.; Sandor, A.; Thompson, S.G.; McCann, R.S.; Begault, D.R.; Adelstein, B.D.; Beutter, B.R.; Stone, L.S.

    2009-01-01

    The goal of the Information Presentation Directed Research Project (DRP) is to address design questions related to the presentation of information to the crew. The major areas of work, or subtasks, within this DRP are: 1) Displays, 2) Controls, 3) Electronic Procedures and Fault Management, and 4) Human Performance Modeling. This DRP is a collaborative effort between researchers at Johnson Space Center and Ames Research Center.

  9. The Electric Field in an MHD Duct with Permeable Electrodes when the Hall Effect is Present in the Flow of the Moving Medium; 042d 041b 0414

    Energy Technology Data Exchange (ETDEWEB)

    Emec, Ju. P.; Panasevich, L. L. [Institut Elektrodinamiki AN USSR, Kiev, USSR (Ukraine)

    1968-11-15

    The authors provide a solution to the problem of current distribution in a magnetohydrodynamic duct with permeable electrodes in which the conductivity of the moving medium is assumed to have a tensorial character. Permeable electrodes strongly influence the current distribution in the neighbourhood of the conducting walls of the duct. By appropriate blowing or sucking of the electrically conducting medium, we can suppress the end effects on the electrodes (due to the Hall effect in the flow and to the geometry of the duct); in this way the current distribution can be evened out. The authors find in their paper the necessary and sufficient conditions for which the current density takes on limited values near both ends of a permeable electrode. The velocity distribution on the conducting wall will be variable in sign as in some places there will be a blowing effect, mothers a sucking one. Another effect associated with the use of permeable electrodes is related to the integral characteristics of MHD converters. Thus, given anisotropic conductivity (due to the Hall effect) in a linear MHD duct with two permeable electrodes, the properties of Hall and Faraday energy converters will be combined if the conducting medium is blown through one electrode and sucked through the second. A flow scheme of this kind is studied in the paper. Mathematically, when the electric field is found a solution is obtained to the Riemann-Gilbert heterogeneous boundary value problem with discontinuous coefficients. This problem reduces to the Riemann boundary value problem (in the case of a zone belonging to a class of automorphic functions) and its solution, based on the properties of Cauchy integrals, is obtained in closed form. (author) [Russian] Daetsja reshenie zadachi o raspredelenii toka v magnitogidrodinamicheskom kanale s pronicaemymi jelektrodami pri tenzornom haraktere provodimosti dvizhushhejsja sredy. Nalichie pronicaemyh jelektrodov okazyvaet sushhestvennoe vlijanie na

  10. Voting Present

    Directory of Open Access Journals (Sweden)

    James Lo

    2013-12-01

    Full Text Available During his time as a state senator in Illinois, Barack Obama voted “Present” 129 times, a deliberate act of nonvoting that subsequently became an important campaign issue during the 2008 presidential elections. In this article, I examine the use of Present votes in the Illinois state senate. I find evidence that Present votes can largely be characterized as protest votes used as a legislative tool by the minority party. Incorporating information from Present votes into a Bayesian polytomous item-response model, I find that this information increases the efficiency of ideal point estimates by approximately 35%. There is little evidence of significant moderation by Obama when Present votes are accounted for, though my results suggest that Obama’s voting record may have moderated significantly before his subsequent election to the U.S. Senate. My results also suggest that because legislative nonvoting may occur for a variety of reasons, naive inclusion of nonvoting behavior into vote choice models may lead to biased results.

  11. Presentation Technique

    International Nuclear Information System (INIS)

    Froejmark, M.

    1992-10-01

    The report presents a wide, easily understandable description of presentation technique and man-machine communication. General fundamentals for the man-machine interface are illustrated, and the factors that affect the interface are described. A model is presented for describing the operators work situation, based on three different levels in the operators behaviour. The operator reacts routinely in the face of simple, known problems, and reacts in accordance with predetermined plans in the face of more complex, recognizable problems. Deep fundamental knowledge is necessary for truly complex questions. Today's technical status and future development have been studied. In the future, the operator interface will be based on standard software. Functions such as zooming, integration of video pictures, and sound reproduction will become common. Video walls may be expected to come into use in situations in which several persons simultaneously need access to the same information. A summary of the fundamental rules for the design of good picture ergonomics and design requirements for control rooms are included in the report. In conclusion, the report describes a presentation technique within the Distribution Automation and Demand Side Management area and analyses the know-how requirements within Vattenfall. If different systems are integrated, such as geographical information systems and operation monitoring systems, strict demands are made on the expertise of the users for achieving a user-friendly technique which is matched to the needs of the human being. (3 figs.)

  12. Technical presentation

    CERN Document Server

    FI Department

    2008-01-01

    RADIOSPARES, the leading catalogue distributor of components (electronic, electrical, automation, etc.) and industrial supplies will be at CERN on Friday 3 October 2008 (Main Building, Room B, from 9.00 a.m. to 3.00 p.m.) to introduce its new 2008/2009 catalogue. This will be the opportunity for us to present our complete range of products in more detail: 400 000 part numbers available on our web site (Radiospares France, RS International, extended range of components from other manufacturers); our new services: quotations, search for products not included in the catalogue, SBP products (Small Batch Production: packaging in quantities adapted to customers’ requirements); partnership with our focus manufacturers; demonstration of the on-line purchasing tool implemented on our web site in conjunction with CERN. RADIOSPARES will be accompanied by representatives of FLUKE and TYCO ELECTRONICS, who will make presentations, demonstrate materials and answer any technical questio...

  13. Magnetic field dependence observed by {sup 27} Al NMR of species contained in alumina colloidal dispersions; Dependencia de campo magnetico observada por RMN {sup 27} Al de especies presentes em dispersoes coloidais de alumina

    Energy Technology Data Exchange (ETDEWEB)

    Morgado Junior, Edisson; Menezes, Sonia M.C. [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas; San Gil, Rosane [Universidade Federal, Rio de Janeiro, RJ (Brazil). Inst. de Quimica

    1995-12-31

    The behaviour of some aluminium species front a magnetic field have been investigated by {sup 27} Al NMR analysis, this method was used for characterization of an octahedric aluminium specie from sols prepared by bohemite acid peptization. X-ray diffraction data have identified the mineral structure. The results have been shown and discussed, and NMR spectra were also presented and studied. Concluding this work, the nature of a colloidal specie of alumina was clarified through the dependence research of magnetic field by {sup 27} Al NMR 12 refs., 4 figs., 2 tabs.

  14. Editorial Presentation

    Directory of Open Access Journals (Sweden)

    Ilan Avrichir

    2017-01-01

    , theoretical model proposals that expand perspectives in mature fields, results that contradict consecrated theories, and various suggestions for promising fields for further research. Enjoy your reading Ilan Avrichir.

  15. Technical presentation

    CERN Document Server

    FP Department

    2009-01-01

    07 April 2009 Technical presentation by Leuze Electronics: 14.00 – 15.00, Main Building, Room 61-1-017 (Room A) Photoelectric sensors, data identification and transmission systems, image processing systems. We at Leuze Electronics are "the sensor people": we have been specialising in optoelectronic sensors and safety technology for accident prevention for over 40 years. Our dedicated staff are all highly customer oriented. Customers of Leuze Electronics can always rely on one thing – on us! •\tFounded in 1963 •\t740 employees •\t115 MEUR turnover •\t20 subsidiaries •\t3 production facilities in southern Germany Product groups: •\tPhotoelectric sensors •\tIdentification and measurements •\tSafety devices

  16. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  17. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  18. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    Science.gov (United States)

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

    2002-01-01

    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  19. The Dopants and Doping Level Dependence of the Structure and Magnetic Properties of the Eu (BA1-xLRx)2Cu3O7+δ

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Yu [Iowa State Univ., Ames, IA (United States)

    2002-12-31

    Eu(Ba1-xLRx)2Cu3O7+δ were systematically studied in order to understand how the valence of the rear earth elements, ionic sizes and magnetic moment affect the crystal structure and magnetic and electrical properties. Differential thermal analyses were carried out to check the phase purity, X-ray data were least-squares fitted to determine the lattice parameters, and DC-SQUID magnetometry was used to characterize the superconducting properties. These results showed that the crystallography is consistent with other EuLR123ss series, LR = La, Pr, Eu. The lattice parameters vary with the ionic radii of the rare earth ions. Unlike the uniform change in lattice parameter, the superconducting transition did not vary systematically with the ionic size of the dopants. Although the general trend was for Tc to decrease with decreasing ionic size of the dopant, for the same doping level, Pr was anomalous, depressing Tc faster. Although the exact mechanism is not clear, this result is consistent with the depression of Tc for Pr substitution for the rare earth in R123. The critical current Jc was determined using the Bean model from magnetization versus field measurements as a function of temperature and field. The effect of the dopants on Jc with the increasing of temperature or applied field was determined. For T < 77 K and small values of x, the value of Jc was increased over that of the x = 0 sample. In addition, the smaller the substituting atom, the higher the Jc becomes. For instance, at x = 0.025, Eu123 < EuLa.025 < EuPr.025 < EuNd.025 < EuEu.025. The enhancement of Jc disappears for x > 0.05 and T > 0.5Tc.

  20. Presentation of CEA

    International Nuclear Information System (INIS)

    Graf, J.J.

    1976-01-01

    The organization of the CEA, its missions and means are presented. Its activities in the field of light water reactors, fast neutron reactors and PWR reactors of small and medium power for electricity and/or heat generation are emphasized [fr

  1. Present-day stress fields of the Gulf of Suez (Egypt) based on exploratory well data: Non-uniform regional extension and its relation to inherited structures and local plate motion

    Science.gov (United States)

    Bosworth, William; Durocher, Scott

    2017-12-01

    The Gulf of Suez is the prototype model of a failed or aborted continental rift. However, the basin is seismically active and the footwalls of several major extensional faults continue to rise at the present time. Furthermore, decadal-length Global Positioning System (GPS) datasets demonstrate that the Sinai micro-plate continues to separate from Africa in a northerly direction at ∼0.15 cm/yr with a Gulf of Suez rift-normal component of ∼0.05 cm/yr. Geologic and GPS observations both indicate that the rift is now undergoing highly-oblique extension. Previous interpretations of borehole breakouts in industry exploration wells suggested that the minimum horizontal stress (Shmin) in the southern Gulf of Suez is presently aligned ∼015°. New subsurface data from the accommodation zone boundary between the Central and Darag (northern) sub-basins similarly identifies an extension direction of approximately N-S. By contrast, in the Central sub-basin itself breakout and drilling-induced fracture (DIF) data indicate NE-SW extension, or rift-normal movement that is similar to the documented older Miocene history of the entire basin. Based on these observations the present-day stress field of the Gulf of Suez is spatially non-uniform. Variations are also present in local and teleseismic datasets. The northern Gulf of Suez shows relatively less seismicity, with very few events greater than M = 3. The central sub-basin is very active, with 17 events M ≥ 3 during the past 45 years, and these suggest NE-SW extension similar to the breakout data. The southern Gulf of Suez is the most seismically active and merges with an area of significant seismicity in the northern Red Sea. In the southern Gulf of Suez the seismicity is complex but focal plane analyses of the two largest historical events indicated NNE-SSW extension, in agreement with the breakout data. Differing interpretations have been proposed for the smaller magnitude seismicity. We suggest that each of the three

  2. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.

    2000-01-01

    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  3. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    Science.gov (United States)

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

    2011-01-01

    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  4. The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

    Directory of Open Access Journals (Sweden)

    Jeong Byung-Hoon

    2011-08-01

    Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

  5. Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

    Science.gov (United States)

    Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

    2017-03-01

    The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

  6. Recent progress in photoactive organic field-effect transistors.

    Science.gov (United States)

    Wakayama, Yutaka; Hayakawa, Ryoma; Seo, Hoon-Seok

    2014-04-01

    Recent progress in photoactive organic field-effect transistors (OFETs) is reviewed. Photoactive OFETs are divided into light-emitting (LE) and light-receiving (LR) OFETs. In the first part, LE-OFETs are reviewed from the viewpoint of the evolution of device structures. Device performances have improved in the last decade with the evolution of device structures from single-layer unipolar to multi-layer ambipolar transistors. In the second part, various kinds of LR-OFETs are featured. These are categorized according to their functionalities: phototransistors, non-volatile optical memories, and photochromism-based transistors. For both, various device configurations are introduced: thin-film based transistors for practical applications, single-crystalline transistors to investigate fundamental physics, nanowires, multi-layers, and vertical transistors based on new concepts.

  7. Recent progress in photoactive organic field-effect transistors

    International Nuclear Information System (INIS)

    Wakayama, Yutaka; Hayakawa, Ryoma; Seo, Hoon-Seok

    2014-01-01

    Recent progress in photoactive organic field-effect transistors (OFETs) is reviewed. Photoactive OFETs are divided into light-emitting (LE) and light-receiving (LR) OFETs. In the first part, LE-OFETs are reviewed from the viewpoint of the evolution of device structures. Device performances have improved in the last decade with the evolution of device structures from single-layer unipolar to multi-layer ambipolar transistors. In the second part, various kinds of LR-OFETs are featured. These are categorized according to their functionalities: phototransistors, non-volatile optical memories, and photochromism-based transistors. For both, various device configurations are introduced: thin-film based transistors for practical applications, single-crystalline transistors to investigate fundamental physics, nanowires, multi-layers, and vertical transistors based on new concepts. (review)

  8. Imagined futures, present lives

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Line; Wildermuth, Norbert

    2006-01-01

    The article is focused thematically on the uses and meanings of media for (some) young people in Recife, a million-inhabitant city in the northeast of Brazil. The article brings together the perspective of Anne Line Dalsgaard, a long-term anthropological field researcher who is familiar with the ......The article is focused thematically on the uses and meanings of media for (some) young people in Recife, a million-inhabitant city in the northeast of Brazil. The article brings together the perspective of Anne Line Dalsgaard, a long-term anthropological field researcher who is familiar...... is discussed centrally in this attempt to contribute to an empirically grounded understanding of the role that media play for youth in their striving to ‘find a place in life'. In the empirical context presented in the article, imaginations, expanded and circulated by a globalized media circuit...

  9. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  10. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  11. Presenting Newtonian gravitation

    International Nuclear Information System (INIS)

    Counihan, Martin

    2007-01-01

    The basic principles of the Newtonian theory of gravitation are presented in a way which students may find more logically coherent, mathematically accessible and physically interesting than other approaches. After giving relatively simple derivations of the circular hodograph and the elliptical orbit from the inverse-square law, the concept of gravitational energy is developed from vector calculus. It is argued that the energy density of a gravitational field may reasonably be regarded as -g 2 /8πG, and that the inverse-square law may be replaced by a Schwarzschild-like force law without the need to invoke non-Euclidean geometry

  12. Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

    Science.gov (United States)

    Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

    2014-02-01

    The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. 48Ca+249Bk fusion reaction leading to element Z = 117: long-lived α-decaying 270Db and discovery of 266Lr.

    Science.gov (United States)

    Khuyagbaatar, J; Yakushev, A; Düllmann, Ch E; Ackermann, D; Andersson, L-L; Asai, M; Block, M; Boll, R A; Brand, H; Cox, D M; Dasgupta, M; Derkx, X; Di Nitto, A; Eberhardt, K; Even, J; Evers, M; Fahlander, C; Forsberg, U; Gates, J M; Gharibyan, N; Golubev, P; Gregorich, K E; Hamilton, J H; Hartmann, W; Herzberg, R-D; Heßberger, F P; Hinde, D J; Hoffmann, J; Hollinger, R; Hübner, A; Jäger, E; Kindler, B; Kratz, J V; Krier, J; Kurz, N; Laatiaoui, M; Lahiri, S; Lang, R; Lommel, B; Maiti, M; Miernik, K; Minami, S; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Pang, G K; Papadakis, P; Renisch, D; Roberto, J; Rudolph, D; Runke, J; Rykaczewski, K P; Sarmiento, L G; Schädel, M; Schausten, B; Semchenkov, A; Shaughnessy, D A; Steinegger, P; Steiner, J; Tereshatov, E E; Thörle-Pospiech, P; Tinschert, K; Torres De Heidenreich, T; Trautmann, N; Türler, A; Uusitalo, J; Ward, D E; Wegrzecki, M; Wiehl, N; Van Cleve, S M; Yakusheva, V

    2014-05-02

    The superheavy element with atomic number Z=117 was produced as an evaporation residue in the (48)Ca+(249)Bk fusion reaction at the gas-filled recoil separator TASCA at GSI Darmstadt, Germany. The radioactive decay of evaporation residues and their α-decay products was studied using a detection setup that allowed measuring decays of single atomic nuclei with half-lives between sub-μs and a few days. Two decay chains comprising seven α decays and a spontaneous fission each were identified and are assigned to the isotope (294)117 and its decay products. A hitherto unknown α-decay branch in (270)Db (Z = 105) was observed, which populated the new isotope (266)Lr (Z = 103). The identification of the long-lived (T(1/2) = 1.0(-0.4)(+1.9) h) α-emitter (270)Db marks an important step towards the observation of even more long-lived nuclei of superheavy elements located on an "island of stability."

  14. Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

    International Nuclear Information System (INIS)

    Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

    2011-01-01

    General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

  15. Long-term determination of airborne concentrations of unattached and attached radon progeny using stacked LR 115 detector with multi-step etching

    International Nuclear Information System (INIS)

    Nikezic, D.; Yu, K.N.

    2010-01-01

    We developed the theoretical basis for long-term determination of airborne concentrations of unattached and attached radon progeny. The work was separated into two parts. First, we showed that (stacked and multiply etched) LR 115 detectors could be used to determine airborne concentrations of the short-lived radon progeny, 218 Po and 214 Bi. The equilibrium factor F between radon and its progeny could then be determined through the use of the reduced equilibrium factor F red . The airborne concentrations of 214 Pb could then be determined. Second, we developed a method based on the airborne concentrations of 218 Po, 214 Pb and 214 Bi to determine the parameters of the Jacobi room model, viz., the ventilation rate λ v , aerosol attachment rate λ a , deposition rate of unattached progeny λ d u and the deposition rate of attached progeny λ d u . With these parameters, the unattached fraction f p of the potential alpha energy concentration could also be determined. Knowledge of f p , together with F, would enable more accurate determination of the effective dose in the human lung.

  16. Seismicity and seismogenic structures of Central Apennines (Italy): constraints on the present-day stress field from focal mechanisms - The SLAM (Seismicity of Lazio-Abruzzo and Molise) project

    Science.gov (United States)

    Frepoli, Alberto; Battista Cimini, Giovanni; De Gori, Pasquale; De Luca, Gaetano; Marchetti, Alessandro; Montuori, Caterina; Pagliuca, Nicola

    2016-04-01

    We present new results for the microseismic activity in the Central Apennines recorded from a total of 81seismic stations. The large number of recording sites derives from the combination of temporary and permanent seismic networks operating in the study region. Between January 2009 and October 2013 we recorded 6923 earthquakes with local magnitudes ML ranging from 0.1 to 4.8. We located hypocentres by using a refined 1D crustal velocity model. The majority of the hypocenters are located beneath the axes of the Apenninic chain, while the seismic activity observed along the peri-Tyrrhenian margin is lower. The seismicity extends to a depth of 32 km; the hypocentral depth distribution exhibits a pronounced peak of seismic energy release in the depth range between 8 and 20 km. During the observation period we recorded two major seismic swarms and one seismic sequence in the Marsica-Sorano area in which we have had the largest detected magnitude (ML = 4.8). Fault plane solutions for a total of 600 earthquakes were derived from P-polarities. This new data set consists of a number of focal plane solutions that is about four times the data so far available for regional stress field study. The majority of the focal mechanisms show predominantly normal fault solutions. T-axis trends are oriented NE-SW confirming that the area is in extension. We also derived the azimuths of the principal stress axes by inverting the fault plane solutions and calculated the direction of the maximum horizontal stress, which is mainly sub-vertical oriented. The study region has been historically affected by many strong earthquakes, some of them very destructive. This work can give an important contribution to the seismic hazard assessment in an area densely populated as the city of Rome which is distant around 60 km from the main seismogenic structures of Central Apennine.

  17. O conceito de campo: polissemia nos manuais, significados na física do passado e da atualidade The field concept: multiple character within textbooks, meanings in past and present Physics

    Directory of Open Access Journals (Sweden)

    Sonia Krapas

    2008-01-01

    Full Text Available Este trabalho objetiva evidenciar o caráter polissêmico do termo campo em livros didáticos de ensino médio; estudar seus significados em textos históricos; mostrar que a polissemia desse conceito tem raízes nos significados atribuídos tanto no passado como na atualidade. Sob a luz do marco teórico atual da física e de textos históricos, analisaram-se sete manuais de ensino médio em circulação que, quando oportuno, foram cotejados com livros didáticos universitários e manuais antigos. Destacam-se as seguintes atribuições de significado, algumas na forma de definições explícitas, outras implicitamente apresentadas: é espaço; é um vetor; propaga-se, é suporte para a propagação de energia; é curvatura do espaço; armazena energia; interage com partículas, media a interação entre partículas; preenche o espaço. A polissemia pode ser creditada, em parte, à forma velada de introdução da física moderna nos manuais. Faz-se uma tentativa de compreender essa introdução segundo a perspectiva da transposição didática de Chevallard.This paper aims at: evidencing the polissemic character of the term field within High School textbooks; studying its meanings in historical texts; showing that the roots of such meaning variety are found in both past and present days. Considering as reference the current theoretical mark of Physics and historical texts, seven secondary education manuals were analyzed. When appropriate, such manuals were compared to those found in old education and undergraduate textbooks. Meaning differences could be pointed out, both implicitly and explicitly. Such meanings are: space; vector; something that propagates itself and supports energy propagation; space curvature; energy resevoir; it interacts with particles and mediates their interaction; it fills space. Partly, this polissemy can be credited to the concealed form of introducing Modern Physics in manuals. An attempt is made to understand this

  18. Validity of Madras Diabetes Research Foundation: Indian Diabetes Risk Score for Screening of Diabetes Mellitus among Adult Population of Urban Field Practice Area, Indira Gandhi Medical College, Shimla, Himachal Pradesh, India.

    Science.gov (United States)

    Kaushal, Kanica; Mahajan, Anjali; Parashar, Anupam; Dhadwal, Dineshwar Singh; Jaswal, V M S; Jaret, Pramod; Mazta, Salig Ram

    2017-01-01

    IDRS is based on four simple parameters derived from known risk factors for diabetes; two modifiable risk factors (waist circumference and physical inactivity) and two non-modifiable risk factors (age and family history of diabetes), which may be amenable to intervention. The present study has been planned as the region specific validation is important before it can be used for screening in this part of the country. The aim of the present study was to validate MDRF-IDRS for screening of diabetes mellitus among adult population of urban field practice area, IGMC, Shimla, Himachal Pradesh, India. The present community based cross sectional study was conducted among 417 adults fulfilling the eligibility criteria using a two stage sampling design. In the present study IDRS value ≥70 had an optimum sensitivity of 61.33% and specificity of 56.14% for detecting undiagnosed type 2 diabetes in the community. At an IDRS score of ≥70, the PPV was 23.47%, NPV as 86.88%, the diagnostic accuracy as 57.07%, LR for positive test as 1.398, LR for negative test as 0.69 and Youden's index as 0.17. However Youden's index was 0.19 at a cut of ≥60 i.e. higher than what was at ≥70. Higher IDRS scores increased the specificity but the sensitivity dramatically decreased. Conversely, lower IDRS values increased the sensitivity but the specificity drastically decreased. Area under the curve = 0.630 and a P value < 0.001. MDRF IDRS is user friendly screening tool but the criteria of including the parameter of physical activity for the calculation of the risk score needs to be clearly defined. In the present study the maximum sensitivity of 100% was seen at a cut off of ≥30. Hence we would recommend that all those in the medium and high risk group should be screened for type 2 Diabetes.

  19. Effect of a uniform magnetic induction field upon the flow of an electrically conducting fluid placed in a straight rectangular cross section, one of the walls of which, characterized by an infinite conductivity, presents uniform translation movement

    International Nuclear Information System (INIS)

    Herve, Patrick

    1975-01-01

    This is a theoretical study of an electrically viscous fluid flowing in a straight rectangular cross section channel, a wall of which, infinitely conducting, is placed perpendicularly to the direction of a uniform magnetic induction field. The three other walls of the channel being electrically insulating, remain motionless. Formulas giving velocity distribution law in the straight section of the flow in relation to the Hartmann's number, curves illustrating the accelerating effect produced across the whole section, by the application of the magnetic induction field, and example for the distribution of the electric current lines in case of a square section are given [fr

  20. Preliminary results from a field experiment on e-bike safety : speed choice and mental workload for middle-aged and elderly cyclists. Paper presented at the International Cycling Safety Conference 2013, Helmond, The Netherland, 20-21 November 2013.

    NARCIS (Netherlands)

    Twisk, D.A.M. Boele, M.J. Vlakveld, W.P. Christoph, M. Sikkema, R. Remij, R. & Schwab, A.L.

    2014-01-01

    To study the safety of e-bikes for the elderly, an experimental field study was conducted, using instrumented bicycles and comparing two age groups: older cyclists, n= 29, mean age = 70, SD = 4.2 and middle-aged cyclists, n = 29, mean age = 38, SD = 4.3. All were regular cyclists. They rode a fixed

  1. Antagonism of yeasts to Xanthomonas campestris pv. campestris on cabbage phylloplane in field Antagonismo de leveduras a Xanthomonas campestris pv. campestris no filoplano de repolho em condições de campo

    Directory of Open Access Journals (Sweden)

    Sayonara M.P. Assis

    1999-07-01

    Full Text Available Twenty yeast isolates, obtained from cabbage phylloplane, were evaluated for antagonistic activity against Xanthomonas campestris pv. campestris, in field. Plants of cabbage cv. Midori were pulverized simultaneously with suspensions of antagonists and pathogen. After 10 days, plants were evaluated through percentage of foliar area with lesions. Percentage of disease severity reduction (DSR% was also calculated. Yeast isolates LR32, LR42 and LR19 showed, respectively, 72, 75 and 79% of DSR. These antagonists were tested in seven different application periods in relation to pathogen inoculation (T1=4 d before; T2=simultaneously; T3=4 d after; T4=4 d before + simultaneously; T5=4 d after + simultaneously; T6=4 d before + 4 d after; T7=4 d before + simultaneously + 4 d after. The highest DSRs were showed by LR42 (71%, LR42 (67%, LR35 (69% and LR19 (68% in the treatments T7, T4, T5 and T6, which significantly differed from the others. The same yeast antagonists were also tested for black rot control using different cabbage cultivars (Fuyutoyo, Master-325, Matsukaze, Midori, Sekai I and Red Winner. The DSRs varied from 58 to 61%, and there was no significant difference among cultivars.Vinte isolados de leveduras, obtidos a partir do filoplano de repolho foram avaliados pela atividade antagônica contra Xanthomonas campestris pv. campestris, em condições de campo. Plantas de repolho cv. Midori foram pulverizadas simultaneamente com suspensões do antagonista e do patógeno. Após 10 dias, as plantas foram avaliadas através da porcentagem de área foliar infectada. A porcentagem de redução da severidade da doença (DSR%, também foi calculada. Os isolados de leveduras LR32, LR42 e LR19 apresentaram, respectivamente, 72, 75 e 79% de DSR. Estes isolados foram testados em sete diferentes períodos de aplicação dos antagonistas em relação a inoculação do patógeno. (T1=4d antes; T2=simultaneamente; T3=4 d após; T4=4 d antes + simultaneamente; T5

  2. Virtual Presenters: Towards Interactive Virtual Presentations

    NARCIS (Netherlands)

    Nijholt, Antinus; Cappellini, V.; Hemsley, J.

    2005-01-01

    We discuss having virtual presenters in virtual environments that present information to visitors of these environments. Some current research is surveyed and we will look in particular to our research in the context of a virtual meeting room where a virtual presenter uses speech, gestures, pointing

  3. Analysis of oil content and oil quality in oilseeds by low-field NMR; Analise do teor e da qualidade dos lipideos presentes em sementes de oleaginosas por RMN de baixo campo

    Energy Technology Data Exchange (ETDEWEB)

    Constantino, Andre F.; Lacerda Junior, Valdemar; Santos, Reginaldo B. dos; Greco, Sandro J.; Silva, Renzo C.; Neto, Alvaro C.; Barbosa, Lucio L.; Castro, Eustaquio V.R. de [Universidade Federal do Espirito Santo (UFES), Vitoria, ES (Brazil). Departamento de Quimica; Freitas, Jair C.C. [Universidade Federal do Espirito Santo (UFES), Vitoria, ES (Brazil). Departamento de Fisica

    2014-07-01

    To choose among the variety of oleaginous plants for biodiesel production, the oil content of several matrices was determined through different low-field {sup 1}H nuclear magnetic resonance (NMR) experiments with varied pulse sequences, namely single-pulse, spin-echo, CPMG, and CWFP. The experiments that involved the first three sequences showed high correlation with each other and with the solvent extraction method. The quality of the vegetable oils was also evaluated on the basis of the existing correlation between the T{sub 2} values of the oils and their properties, such as viscosity, iodine index, and cetane index. These analyses were performed using HCA and PCA chemometric tools. The results were sufficiently significant to allow separation of the oleaginous matrices according to their quality. Thus, the low-field {sup 1}H NMR technique was confirmed as an important tool to aid in the selection of oleaginous matrices for biodiesel production. (author)

  4. Radon studies for extending Los Azufres geothermal energy field in Mexico

    International Nuclear Information System (INIS)

    Tavera, L.; Balcazar, M.; Camacho, M.E.; Chavez, A.; Perez, H.; Gomez, J.

    1999-01-01

    Los Azufres is a 98 MW producing geothermal energy field situated in the Mexican volcanic belt at the west part of the country. Recently, hydrothermal activity and geochemical analysis of geothermal fluids from the north part of the geothermal field gave indications of a possible geothermal-production area, similar to the already producing field. In order to investigate the activity of geological structures, which are considered the means of geothermal fluids transporters, radon mapping was carried out using sets of 240 LR-115 detectors in the area of interest. Radon values higher than 10 kBq m -3 were considered anomalous and indicative of geothermal anomalies

  5. Radon studies for extending Los Azufres geothermal energy field in Mexico

    CERN Document Server

    Tavera, L; Camacho, M E; Chavez, A; Pérez, H; Gómez, J

    1999-01-01

    Los Azufres is a 98 MW producing geothermal energy field situated in the Mexican volcanic belt at the west part of the country. Recently, hydrothermal activity and geochemical analysis of geothermal fluids from the north part of the geothermal field gave indications of a possible geothermal-production area, similar to the already producing field. In order to investigate the activity of geological structures, which are considered the means of geothermal fluids transporters, radon mapping was carried out using sets of 240 LR-115 detectors in the area of interest. Radon values higher than 10 kBq m sup - sup 3 were considered anomalous and indicative of geothermal anomalies.

  6. Making your presentation fun: creative presentation techniques

    Energy Technology Data Exchange (ETDEWEB)

    KEENEN,MARTHA JANE

    2000-05-18

    What possesses someone to volunteer and go through hoops and red tape to make a presentation at a conference? For that matter, why does anyone ever present anything to anyone? Actually, presentations are a fact of life and there are many reasons for doing a presentation and doing it well. New and existing staff need training and orientation to the way things are done here. Handing all of them a manual and hoping they read it is pretty much a waste of paper. On the other hand, an effective, entertaining and upbeat presentation on the relevant topics is more likely to stick with those people. They will even have a name and face to remember and seek out when they have an issue on or with that topic. This can be a very effective beginning for networking with new peers. The presenter is seen as knowledgeable, as a source of information on company topics and possibly evaluated as a potential mentor or future manager. Project staff and/or peers benefit from clear, concise, presentations of topical knowledge. This is one way that a group working on various aspects of the same project or program can stay in touch and in step with each other. Most importantly, presentations may be the best or only door into the minds (and budgets) of management and customers. These presentations are a wonderful opportunity to address legal and compliance issues, budget, staffing, and services. Here is a chance, maybe the only one, to demonstrate and explain the wonderfulness of a program and the benefit they get by using the services offered most effectively. An interactive presentation on legal and compliance issues can be an effective tool in helping customers and/or management make good risk management decisions.

  7. [Antibiotics: present and future].

    Science.gov (United States)

    Bérdy, János

    2013-04-14

    The author discuss the up to date interpretation of the concept of antibiotics and antibiotic research, as well as the present role of various natural, semisynthetic and synthetic antibiotic compounds in various areas of the human therapy. The origin and the total number of all antibiotics and applied antibiotics in the practice, as well as the bioactive microbial metabolites (antibiotics) in other therapeutical, non-antibiotic fields (including agriculture) are also reviewed. The author discusses main problems, such as increasing (poly)resistance, virulence of pathogens and the non-scientific factors (such as a decline of research efforts and their sociological, economic, financial and regulatory reasons). A short summary of the history of Hungarian antibiotic research is also provided. The author briefly discusses the prospects in the future and the general advantages of the natural products over synthetic compounds. It is concluded that new approaches for the investigation of the unlimited possibilities of the living world are necessary. The discovery of new types or simply neglected (micro)organisms and their biosynthetic capabilities, the introduction of new biotechnological and genetic methods (genomics, metagenom, genome mining) are absolutely required in the future.

  8. Selfdecomposable Fields

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole E.; Sauri, Orimar; Szozda, Benedykt

    In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master Lévy measure and the associated Lévy-Itô representation. We give the dilation criterion for selfdecomposa......In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master Lévy measure and the associated Lévy-Itô representation. We give the dilation criterion...... for selfdecomposability analogous to the classical one. Next, we give necessary and sufficient conditions (in terms of the kernel functions) for a Volterra field driven by a Lévy basis to be selfdecomposable. In this context we also study the so-called Urbanik classes of random fields. We follow this with the study...... of existence and selfdecomposability of integrated Volterra fields. Finally, we introduce infinitely divisible field-valued Lévy processes, give the Lévy-Itô representation associated with them and study stochastic integration with respect to such processes. We provide examples in the form of Lévy...

  9. Selfdecomposable Fields

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole E.; Sauri, Orimar; Szozda, Benedykt

    In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master L\\'evy measure and the associated L\\'evy-It\\^o representation. We give the dilation criterion for selfdec......In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master L\\'evy measure and the associated L\\'evy-It\\^o representation. We give the dilation criterion...... for selfdecomposability analogous to the classical one. Next, we give necessary and sufficient conditions (in terms of the kernel functions) for a Volterra field driven by a L\\'evy basis to be selfdecomposable. In this context we also study the so-called Urbanik classes of random fields. We follow this with the study...... of existence and selfdecomposability of integrated Volterra fields. Finally, we introduce infinitely divisible field-valued L\\'evy processes, give the L\\'evy-It\\^o representation associated with them and study stochastic integration with respect to such processes. We provide examples in the form of L...

  10. Como poderia a Gerontologia, um campo multidisciplinar do saber, estar presente na Tabela das Áreas do Conhecimento do CNPq? How could Gerontology, a multidisciplinary field of knowledge, be included in CNPq's Table of Knowledge Areas?

    Directory of Open Access Journals (Sweden)

    Shirley Donizete Prado

    2007-12-01

    , due either to problems related to concepts, interests and political projects in its establishment as a field of knowledge, or because this taxonomy would be not be compatible with its multidisciplinary nature. We conclude that it is possible to draw up a new Fields of Knowledge and Expertise Table, addressing studies of aging - as well as all and any Fields of Knowledge and Expertise - in their full multidisciplinarity, together with their transformations over time.

  11. Controlled thermonuclear fusion. Present state and prospective

    International Nuclear Information System (INIS)

    Consoli, T.

    1976-01-01

    The interest of thermonuclear fusion for energy production is underlined. The present state of the research in this field is presented, emphasis being given to Tokamak configurations. The problems concerning confinement and additional heating in these devices are presented [fr

  12. Neutrino astronomy: Present and future

    Indian Academy of Sciences (India)

    Abstract. I briefly review the present and future status of the burgeoning field of neu- ... near future build upon previous results. ... novel radio and acoustic techniques utilized by, for example, experiments such as. GLUE ... Left: Schematic of νµ-induced muon track in detector. Right: .... an eye toward the galactic center).

  13. Gauge fields

    International Nuclear Information System (INIS)

    Itzykson, C.

    1978-01-01

    In these notes the author provides some background on the theory of gauge fields, a subject of increasing popularity among particle physicists (and others). Detailed motivations and applications which are covered in the other lectures of this school are not presented. In particular the application to weak interactions is omitted by referring to the introduction given by J. Ilipoulos a year ago (CERN Report 76-11). The aim is rather to stress those aspects which suggest that gauge fields may play some role in a future theory of strong interactions. (Auth.)

  14. Develop your presentation skills

    CERN Document Server

    Theobald, Theo

    2016-01-01

    Going beyond handling nerves and presenting PowerPoint slides, the third edition of "Develop Your Presentation Skills "offers practical advice on developing a captivating presentation, constructing compelling content, and boosting self-confidence. The book includes three new chapters on delivering a "stripped down"presentation, using new media to engage with the audience, and handling being asked to present on short notice."

  15. Subpart DD Training Presentations

    Science.gov (United States)

    EPA has produced the following training presentation(s) for reporters subject to this subpart. Generally, these presentations explain the rule or show how to use the reporting system e-GGRT to submit annual GHG reports to EPA.

  16. Subpart AA Training Presentations

    Science.gov (United States)

    EPA has produced the following training presentation(s) for reporters subject to this subpart. Generally, these presentations explain how to use the reporting system e-GGRT to submit annual GHG reports to EPA.

  17. Subpart W Training Presentations

    Science.gov (United States)

    EPA has produced the following training presentation(s) for reporters subject to this subpart. Generally, these presentations explain the rule or show how to use the reporting system e-GGRT to submit annual GHG reports to EPA.

  18. Texts of presentation

    Energy Technology Data Exchange (ETDEWEB)

    Magnin, G.; Vidolov, K.; Dufour-Fallot, B.; Dewarrat, Th.; Rose, T.; Favatier, A.; Gazeley, D.; Pujol, T.; Worner, D.; Van de Wel, E.; Revaz, J.M.; Clerfayt, G.; Creedy, A.; Moisan, F.; Geissler, M.; Isbell, P.; Macaluso, M.; Litzka, V.; Gillis, W.; Jarvis, I.; Gorg, M.; Bebie, B.

    2004-07-01

    Implementing a sustainable local energy policy involves a long term reflection on the general interest, energy efficiency, distributed generation and environmental protection. Providing services on a market involves looking for activities that are profitable, if possible in the 'short-term'. The aim of this conference is to analyse the possibility of reconciling these apparently contradictory requirements and how this can be achieved. This conference brings together the best specialists from European municipalities as well as important partners for local authorities (energy agencies, service companies, institutions, etc.) in order to discuss the public-private partnerships concerning the various functions that municipalities may perform in the energy field as consumers and customers, planners and organizers of urban space and rousers as regards inhabitants and economic players of their areas. This document contains the summaries of the following presentations: 1 - Performance contracting: Bulgarian municipalities use private capital for energy efficiency improvement (K. VIDOLOV, Varna (BG)), Contracting experiences in Swiss municipalities: consistent energy policy thanks to the Energy-city label (B. DUFOUR-FALLOT and T. DEWARRAT (CH)), Experience of contracting in the domestic sector (T. ROSE (GB)); 2 - Public procurement: Multicolor electricity (A. FAVATIER (CH)), Tendering for new green electricity capacity (D. GAZELEY (GB)), The Barcelona solar thermal ordinance (T. PUJOL (ES)); 3 - Urban planning and schemes: Influencing energy issues through urban planning (D. WOERNER (DE)), Tendering for the supply of energy infrastructure (E. VAN DE WEL (NL)), Concessions and public utility warranty (J.M. REVAZ (CH)); 4 - Certificate schemes: the market of green certificates in Wallonia region in a liberalized power market (G. CLERFAYT (BE)), The Carbon Neutral{sup R} project: a voluntary certification scheme with opportunity for implementation in other European

  19. Application of municipal biosolids to dry-land wheat fields - A monitoring program near Deer Trail, Colorado (USA). A presentation for an international conference: "The Future of Agriculture: Science, Stewardship, and Sustainability", August 7-9, 2006, Sacramento, CA

    Science.gov (United States)

    Crock, James G.; Smith, David B.; Yager, Tracy J.B.

    2006-01-01

    Since late 1993, Metro Wastewater Reclamation District of Denver (Metro District), a large wastewater treatment plant in Denver, Colorado, has applied Grade I, Class B biosolids to about 52,000 acres of non-irrigated farmland and rangeland near Deer Trail, Colorado. In cooperation with the Metro District in 1993, the U.S. Geological Survey (USGS) began monitoring ground water at part of this site. In 1999, the USGS began a more comprehensive study of the entire site to address stakeholder concerns about the chemical effects of biosolids applications. This more comprehensive monitoring program has recently been extended through 2010. Monitoring components of the more comprehensive study included biosolids collected at the wastewater treatment plant, soil, crops, dust, alluvial and bedrock ground water, and stream bed sediment. Streams at the site are dry most of the year, so samples of stream bed sediment deposited after rain were used to indicate surface-water effects. This presentation will only address biosolids, soil, and crops. More information about these and the other monitoring components are presented in the literature (e.g., Yager and others, 2004a, b, c, d) and at the USGS Web site for the Deer Trail area studies at http://co.water.usgs.gov/projects/CO406/CO406.html. Priority parameters identified by the stakeholders for all monitoring components, included the total concentrations of nine trace elements (arsenic, cadmium, copper, lead, mercury, molybdenum, nickel, selenium, and zinc), plutonium isotopes, and gross alpha and beta activity, regulated by Colorado for biosolids to be used as an agricultural soil amendment. Nitrogen and chromium also were priority parameters for ground water and sediment components. In general, the objective of each component of the study was to determine whether concentrations of priority parameters (1) were higher than regulatory limits, (2) were increasing with time, or (3) were significantly higher in biosolids

  20. Observation of field-induced long-range order in disordered Sr14Cu24O41

    International Nuclear Information System (INIS)

    Ohsugi, S.; Matsumoto, S.; Kitaoka, Y.; Matsuda, M.; Uehara, M.; Nagata, T.; Akimitsu, J.

    2004-01-01

    Field-induced magnetic order in a structural disordered single-crystal Sr 14 Cu 24 O 41 (Sr 14 -B) has been observed in the Cu-nuclear magnetic resonance (NMR) measurements for the ladder sites below 20 K under the magnetic field H∼11 T. For the Zhang Rice (ZR) sites in the chains, the spectrum splits below 20 K due to an appearance of the internal field, whereas that of less disordered Sr 14 -A does not. This gives an evidence of three-dimensional (3D) long-range (LR) ordering in Sr 14 -B below T N ∼20 K under H∼11 T

  1. Gravitation and vacuum field

    International Nuclear Information System (INIS)

    Tevikyan, R.V.

    1986-01-01

    This paper presents equations that describe particles with spins s = 0, 1/2, 1 completely and which also describe 2s + 2 limiting fields as E → ∞. It is shown that the ordinary Hilbert-Einstein action for the gravitation field must be augmented by the action for the Bose vacuum field. This means that one must introduce in the gravitational equations a cosmological term proportional to the square of the strength of the Bose vacuum field. It is shown that the theory of gravitation describes three realities: matter, field, and vacuum field. A new form of matter--the vacuum field--is introduced into field theory

  2. Rotating Poster Presentations

    Science.gov (United States)

    Lagares, Manuel; Reisenleutner, Sandra

    2017-01-01

    Oral presentations are a common practice in foreign language classes, often used to assess students' speaking skills. Usually, the presentations are delivered by students in front of the class, often with PowerPoint slides or Prezi as support. However, frequently the audience does not engage with the presentation and thus, the benefits of this…

  3. Presenting Food Science Effectively

    Science.gov (United States)

    Winter, Carl K.

    2016-01-01

    While the need to present food science information effectively is viewed as a critical competency for food scientists by the Institute of Food Technologists, most food scientists may not receive adequate training in this area. Effective presentations combine both scientific content and delivery mechanisms that demonstrate presenter enthusiasm for…

  4. Innovative presentations for dummies

    CERN Document Server

    Anthony, Ray

    2014-01-01

    Be the speaker they follow with breakthrough innovative presentations Innovative Presentations For Dummies is a practical guide to engaging your audience with superior, creative, and ultra-compelling presentations. Using clear language and a concise style, this book goes way beyond PowerPoint to enable you to reimagine, reinvent, and remake your presentations. Learn how to stimulate, capture, and hold your audience in the palm of your hand with sound, sight, and touch, and get up to speed on the latest presentation design methods that make you a speaker who gets audiences committed and acting

  5. Alarm filtering and presentation

    International Nuclear Information System (INIS)

    Bray, M.A.

    1989-01-01

    This paper discusses alarm filtering and presentation in the control room of nuclear and other process control plants. Alarm generation and presentation is widely recognized as a general process control problem. Alarm systems often fail to provide meaningful alarms to operators. Alarm generation and presentation is an area in which computer aiding is feasible and provides clear benefits. Therefore, researchers have developed several computerized alarm filtering and presentation approaches. This paper discusses problems associated with alarm generation and presentation. Approaches to improving the alarm situation and installation issues of alarm system improvements are discussed. The impact of artificial intelligence (AI) technology on alarm system improvements is assessed. (orig.)

  6. Understanding Vector Fields.

    Science.gov (United States)

    Curjel, C. R.

    1990-01-01

    Presented are activities that help students understand the idea of a vector field. Included are definitions, flow lines, tangential and normal components along curves, flux and work, field conservation, and differential equations. (KR)

  7. Behavioural present value

    OpenAIRE

    Krzysztof Piasecki

    2013-01-01

    Impact of chosen behavioural factors on imprecision of present value is discussed here. The formal model of behavioural present value is offered as a result of this discussion. Behavioural present value is described here by fuzzy set. These considerations were illustrated by means of extensive numerical case study. Finally there are shown that in proposed model the return rate is given, as a fuzzy probabilistic set.

  8. Conns' syndrome - atypical presentations

    International Nuclear Information System (INIS)

    Kumar, K V S Hari; Modi, K D; Jha, Sangeeta; Jha, Ratan

    2009-01-01

    Primary hyperaldosteronism (Conns' syndrome) commonly presents with a combination of clinical features of hypokalemia and hypertension. Atypical presentations like normotension, normokalemia and neurological ailments are described in few cases. We encountered two such cases, the first presenting with acute neurological complaint and second case having insignificant hypertension. Both the patients had a characteristic biochemical and imaging profile consistent with primary hyperaldosteronism and responded to surgical resection of adrenal adenoma. (author)

  9. CERN Electronics Pool presentations

    CERN Multimedia

    2011-01-01

    The CERN Electronics Pool has organised a series of presentations in collaboration with oscilloscope manufacturers. The last one will take place according to the schedule below.   Time will be available at the end of the presentation to discuss your personal needs. The Agilent presentation had to be postponed and will be organised later. -     Lecroy: Thursday, 24 November 2011, in 530-R-030, 14:00 to 16:30.

  10. Presentation skills for nurses.

    Science.gov (United States)

    Foulkes, Mark

    2015-02-20

    This article emphasises the importance of effective presentation skills. Such skills allow nurses to share knowledge and expertise and to communicate clearly in a range of workplace scenarios. Nurses are increasingly being asked to present in formal and informal situations, such as conferences, poster presentations, job interviews, case reports and ward-based teaching. This article explores the principles underpinning the development of these skills, discusses the situations in which they could be applied and demonstrates how nurses might improve and develop as presenters.

  11. Crystallography: past and present

    Science.gov (United States)

    Hodeau, J.-L.; Guinebretiere, R.

    2007-12-01

    structure (chemical order, anisotropy, charge transfer, magnetic order) versus an external parameter like temperature, pressure, magnetic or electric field. Modern crystallography is also extended to the study of very small crystals, powders, ill-ordered or non-crystallized materials. Thus presently, crystallography is concerned with any solid that “scatters” an incident beam. Nevertheless, as quoted by A. Guinier, “the problems facing crystallographers have only changed, ... new ones have appeared which require reflection and imagination, ... and which in turn may still bring much joy to all those who like crystallography” [4]. Such developments open up crystallography to modern materials like artificial ones and nanostructures with low- and/or multi-scaled-periodicities and/or extremely small “crystal size” and to materials of the “real world”, with mixtures of phases and/or amorphous contribution and/or defects, a common characteristic of ancient materials analysed in patrimonial research. In our contribution we will show by selected examples that these improvements were allowed (i) by the use of powerful sources, apparatus and detectors which allow micro-diffraction, in-situ diffraction, spectroscopy, resonant scattering, inelastic scattering, coherent scattering, (ii) by the development of methods like diffraction anomalous fine structure (DAFS), pair distribution function (PDF), simulated annealing, single object reconstruction, (iii) by combination of scattering and spectroscopy and by combination of scattering and microscopy. Such combination of different approaches is very efficient and, as said by H. Curien at the IUCr Bordeaux Congress in 1990, “in crystallography, there is a constant alternation between the crystal space and its associated reciprocal space, ... the alternation between experiment and model building is another feature of crystallography activity ..., the crystallographer relies both on his computer and on his diffractometer

  12. Creating meaningful multimedia presentations

    NARCIS (Netherlands)

    Hardman, H.L.; Ossenbruggen, van J.R.

    2006-01-01

    Finding relevant information is one step in the chain of understanding information. Presenting material to a user in a suitable way is a further step. Our research focuses on using semantic annotations of multimedia elements to increase the "presentability" of retrieved information. We investigate

  13. Unusual presentation of sunburn.

    Science.gov (United States)

    Verma, Gopalkrishna G; Dave, Dhaval; Byrne, Eileen

    2008-10-01

    We present three cases of sunburn to the head, presenting with oedema of the face in children aged 6, 9 and 13 years. Oedema was predominantly on the forehead and temporal region; a direct effect of gravity was associated with erythema of the scalp. Sunburn healed without any complications.

  14. Presentation to the symposium

    International Nuclear Information System (INIS)

    Goodhead, D.

    1997-01-01

    A novel theory, the Second Event theory, advanced by Chris Busby, suggested that certain man-made radioisotopes could bypass cellular genetic repair mechanisms and cause cancer at very low dose. The present paper, after some introductory comments on the effects of particle tracks on cells, goes on to present the author's own perception of this Second Event theory. (UK)

  15. Conjugando el presente

    Directory of Open Access Journals (Sweden)

    Héctor Rojas Herazo

    1968-06-01

    Full Text Available La añoranza suele ser, casi siempre, la línea critica de menor resistencia. El lema de que "todo tiempo pasado fue mejor" tiene un poco la culpa. En cualquier orden del conocimiento el pasado sigue el verdadero presente. Ese presente en que nos gusta respirar y vivir. Nada de compromiso circundante. Nada de inmediatez.

  16. Nanotechnology Presentation Agenda

    Science.gov (United States)

    2005-01-01

    Working at the atomic, molecular and supra-molecular levels, in the length scale of approximately 1 - 100 nm range, in order to understand, create and use materials, devices and systems with fundamentally new properties and functions because of their small structure. NNI definition encourages new contributions that were not possible.before. Novel phenomena, properties and functions at nanoscale,which are non scalable outside of the nm domain. The ability to measure / control / manipulate matter at the nanoscale in order to change those properties and functions. Integration along length scales, and fields of application.

  17. Pulmonary hyalinizing granuloma presenting with dysphagia: a rare presentation.

    Science.gov (United States)

    Khan, Fazal; Hamid, Arsalan; Fatima, Benish; Hashmi, Shiraz; Fatimi, Saulat

    2017-01-01

    A 25-year-old man presented with a 2-month history of dysphagia and past history of pulmonary and intestinal tuberculosis. A barium swallow showed a point of constriction 42 mm above the gastroesophageal junction. Computed tomography revealed large opacities in bilateral lung fields, encroaching more on the esophagus. The lesion progressively compressed the esophagus as it moved inferiorly. A right posterolateral thoracotomy was performed for sub-anatomical resection of the mass. A biopsy revealed homogenous whirling hyalinized collagen fibers, highly suggestive of pulmonary hyalinizing granuloma, with no evidence of malignancy. Pulmonary hyalinizing granuloma should be considered in the differential diagnosis of longstanding dysphagia.

  18. Remoção de microcistina-LR da Microcystis aeruginosa utilizando bagaço de cana-de-açúcar in natura e carvão ativado

    OpenAIRE

    Almeida,Aline Rafaela de; Passig,Fernando Hermes; Pagioro,Thomaz Aurélio; Nascimento,Priscila Tiemi Higuti do; Carvalho,Karina Querne de

    2016-01-01

    Resumo Microcistina-LR é um tipo de toxina liberada pela cianobactéria Microcystis aeruginosa encontrada em mananciais de água usados para abastecimento humano que pode causar doenças e até mesmo a mortandade do homem se não for totalmente removida no tratamento convencional da água. A retenção desta toxina é muitas vezes realizada através do processo de adsorção em carvão ativado nas estações de tratamento de água. Neste estudo foi avaliada a utilização do bagaço de cana-de-açúcar in natura ...

  19. The presentation and treatment

    African Journals Online (AJOL)

    user

    tion of single collocations proposals are made for an implicit presentation of complex ... function lexicographers often include items to illustrate the typical use of the ... they have no items explicitly addressed at them to elevate them to treatment.

  20. PRESENT STATUS IN INDIA

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. PRESENT STATUS IN INDIA. FIXED LINES – 36 MILLION. MOBILE CONNECTIONS – 14 MILLION. TELEDENSITY APPROXIMATELY 5. INTERNET CONNECTIONS – 5 MILLION. INTERNET USERS NEARLY – 25 MILLION.

  1. Fostering oral presentation performance

    NARCIS (Netherlands)

    Ginkel, van Stan; Gulikers, Judith; Biemans, Harm; Mulder, Martin

    2017-01-01

    Previous research revealed significant differences in the effectiveness of various feedback sources for encouraging students’ oral presentation performance. While former studies emphasised the superiority of teacher feedback, it remains unclear whether the quality of feedback actually differs

  2. Present status of dibaryons

    International Nuclear Information System (INIS)

    Locher, M.P.

    1981-01-01

    In the present notes the author tries to assess the situation regarding dibaryons in the various channels with baryon number two, emphasizing the problems and discussing in greater detail the most recent developments since the Versailles Conference. One of the motivations for the present search of B=2 states is the possibility of colored subclusters for systems with six quarks which cannot occur for ordinary baryons or mesons. (Auth.)

  3. Presenting New Grammar

    Institute of Scientific and Technical Information of China (English)

    WU Cai-ling; WANG Xi

    2015-01-01

    More and more researchers have now agreed upon the necessity of teaching grammar, but it still remains controversial as how to teach the forms, with the central consideration of not to harm the meaning-focused communicative teaching method. In this essay, one of the issues in grammar teaching will be discussed as how to present new grammar to learners, through evaluating and modifying a particular presentation activity in a grammar-teaching textbook.

  4. Complete Sensitivity/Uncertainty Analysis of LR-0 Reactor Experiments with MSRE FLiBe Salt and Perform Comparison with Molten Salt Cooled and Molten Salt Fueled Reactor Models

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mueller, Don [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-12-01

    In September 2016, reactor physics measurements were conducted at Research Centre Rez (RC Rez) using the FLiBe (2 7LiF + BeF2) salt from the Molten Salt Reactor Experiment (MSRE) in the LR-0 low power nuclear reactor. These experiments were intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems using FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL), in collaboration with RC Rez, performed sensitivity/uncertainty (S/U) analyses of these experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objectives of these analyses were (1) to identify potential sources of bias in fluoride salt-cooled and salt-fueled reactor simulations resulting from cross section uncertainties, and (2) to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a final report on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. In the future, these S/U analyses could be used to inform the design of additional FLiBe-based experiments using the salt from MSRE. The key finding of this work is that, for both solid and liquid fueled fluoride salt reactors, radiative capture in 7Li is the most significant contributor to potential bias in neutronics calculations within the FLiBe salt.

  5. Stellar Presentations (Abstract)

    Science.gov (United States)

    Young, D.

    2015-12-01

    (Abstract only) The AAVSO is in the process of expanding its education, outreach and speakers bureau program. powerpoint presentations prepared for specific target audiences such as AAVSO members, educators, students, the general public, and Science Olympiad teams, coaches, event supervisors, and state directors will be available online for members to use. The presentations range from specific and general content relating to stellar evolution and variable stars to specific activities for a workshop environment. A presentation—even with a general topic—that works for high school students will not work for educators, Science Olympiad teams, or the general public. Each audience is unique and requires a different approach. The current environment necessitates presentations that are captivating for a younger generation that is embedded in a highly visual and sound-bite world of social media, twitter and U-Tube, and mobile devices. For educators, presentations and workshops for themselves and their students must support the Next Generation Science Standards (NGSS), the Common Core Content Standards, and the Science Technology, Engineering and Mathematics (STEM) initiative. Current best practices for developing relevant and engaging powerpoint presentations to deliver information to a variety of targeted audiences will be presented along with several examples.

  6. Lecture and Poster Presentations

    International Nuclear Information System (INIS)

    2008-01-01

    The motivation for this conference is the growing interest of the astrophysical community in the application of kinetic plasma methods to the problems of modern astrophysics. The intent of the meeting is therefore to review the recent progress in this field in wide range of astrophysical applications and to confront the results with observations. The main emphasis of the meeting will be on kinetic plasma methods - numerical (Particle-In-Cell and hybrid simulations) as well as analytical. However, the progress in the MHD modeling of astrophysical plasmas will also be reviewed to enable comparison with kinetic methods and stimulate discussion on what approach is the most appropriate tool to study astrophysical sources. All main topics will also be reviewed from observational perspective

  7. Presentation at Innoventure Annual Competition

    Energy Technology Data Exchange (ETDEWEB)

    None

    2010-03-31

    This report documents the components of the workshop presented at the recent annual competition for the Innoventure program. The goal of the workshop was to focus on the delivery of science, technology, engineering, and math (STEM) concepts in a hands-on experiential learning format to increase interest in national security careers at NNSA, most of which are in the STEM fields. This work is a part of the National Security Preparedness Project (NSPP), being performed under a Department of Energy (DOE)/National Nuclear Security Administration (NNSA) grant.

  8. Milk: Past and Present

    Science.gov (United States)

    Bulajić, S.; Đorđević, J.; Ledina, T.; Šarčević, D.; Baltić, M. Ž.

    2017-09-01

    Although milk/dairy consumption is part of many cultures and is recommended in most dietary guidelines around the world, its contribution to overall diet quality remains a matter of controversy, leading to a highly polarized debate within the scientific community, media and public sector. The present article, at first, describes the evolutionary roots of milk consumption, then reviews the milk-derived bioactive peptides as health-promoting components. The third part of the article, in general, presents the associations between milk nutrients, disease prevention, and health promotion.

  9. Book Presentation | 27 February

    CERN Multimedia

    The CERN Library

    2013-01-01

    "A caccia del bosone di Higgs. Magneti, governi, scienziati e particelle nell'impresa scientifica del secolo" by Luciano Maiani and Romeo Bassoli, published by Mondadori. On Wednesday 27 February Luciano Maiani will present the book "A caccia del bosone di Higgs. Magneti, governi, scienziati e particelle nell'impresa scientifica del secolo". More information here. The presentation will take place in the Council Chamber at 16.00 and will be followed by a debate and book signing. The book will be on sale. You are cordially invited.

  10. Renewable Electricity Futures (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Mai, T.

    2012-08-01

    This presentation library summarizes findings of NREL's Renewable Electricity Futures study, published in June 2012. RE Futures investigated the challenges and impacts of achieving very high renewable electricity generation levels in the contiguous United States by 2050. It was presented at the 2012 RE AMP Annual Meeting. RE-AMP is an active network of 144 nonprofits and foundations across eight Midwestern states working on climate change and energy policy with the goal of reducing global warming pollution economy-wide 80% by 2050.

  11. Hera presentation generator (Poster)

    NARCIS (Netherlands)

    Frasincar, F.; Houben, G.J.P.M.; Barna, P.; Ellis, A.; Hagino, T.

    2005-01-01

    Semantic Web Information Systems (SWIS) are Web Information Systems that use Semantic Web technologies. Hera is a model-driven design methodology for SWIS. In Hera, models are represented in RDFS and model instances in RDF. The Hera Presentation Generator (HPG) is an integrated development

  12. Creating Meaningful Multimedia Presentations

    NARCIS (Netherlands)

    L. Hardman (Lynda); J.R. van Ossenbruggen (Jacco)

    2006-01-01

    textabstractFinding relevant information is one step in the chain of understanding information. Presenting material to a user in a suitable way is a further step. Our research focuses on using semantic annotations of multimedia elements to increase the ”presentability” of

  13. AECL present and future

    International Nuclear Information System (INIS)

    Foster, J.S.

    The history and present activities of the Crown corporation AECL are described. AECL owns limited interests in nuclear power plants and a Manitoba transmission system. AECL is the world's foremost producer of heavy water, and exports CANDU type reactors and radiation processing equipment. AECL backs up the Canadian nuclear power program wherever there is no conflict with private enterprise. (E.C.B.)

  14. Econophysics: Past and present

    Science.gov (United States)

    de Area Leão Pereira, Eder Johnson; da Silva, Marcus Fernandes; Pereira, H. B. B.

    2017-05-01

    This paper provides a brief historical review of the relationship between economics and physics, beginning with Adam Smith being influenced by Isaac Newton's ideas up to the present day including the new econophysics discipline and some of the tools applied to the economy. Thus, this work is expected to motivate new researchers who are interested in this new discipline.

  15. Present State Examination

    DEFF Research Database (Denmark)

    Pedersen, Kamilla; Bertelsen, Aksel

    Present State Examination (PSE) 5. udgave er en revideret version af speciallæge i psykiatri Aksel Bertelsens oprindelige materiale. Aksel Bertelsen er ophavsmand til PSE og til den danske udgave af ICD-10. Revisionen omfatter et forbedret layout, en modernisering af sproget, tilføjelse af...

  16. Going beyond methodological presentism

    DEFF Research Database (Denmark)

    Schmidt, Garbi

    2017-01-01

    Denmark is an example of a country where the idea of historical ethnic homogeneity stands strong. This article challenges this historical presentism: the scholarly and societal tendency to understand social phenomena within a limited contemporary framework, neglecting possible effects and similar...

  17. Analyzing in the present

    DEFF Research Database (Denmark)

    Revsbæk, Line; Tanggaard, Lene

    2015-01-01

    The article presents a notion of “analyzing in the present” as a source of inspiration in analyzing qualitative research materials. The term emerged from extensive listening to interview recordings during everyday commuting to university campus. Paying attention to the way different parts of vari...

  18. Presentation on ecoenergetic assessment

    International Nuclear Information System (INIS)

    Fournelle, C.

    1998-01-01

    The development of a tool to assess the quality of indoor air for buildings in the residential and commercial sector was presented. The computer software program was designed to allow a building operator to set an optimal target to reflect the greatest economies in energy consumption. Air quality was assessed in terms of carbon dioxide, volatile organic compounds, and other common indoor pollutants

  19. Keynote presentation : SAR systems

    NARCIS (Netherlands)

    Halsema, D. van; Otten, M.P.G.; Maas, A.P.M.; Bolt, R.J.; Anitori, L.

    2011-01-01

    Synthetic Aperture Radar (SAR) systems are becoming increasingly important sensors in as well the military environment as in the civilian market. In this keynote presentation an overview will be given over more than 2 decades of SAR system∼ and SAR application development at TNO in the Netherlands.

  20. Agriculture Oral Presentations

    International Nuclear Information System (INIS)

    1997-01-01

    This publication contains 23 papers related to the use of nuclear techniques in plant breeding in Turkey, effect of gamma irradiations on growing various plants, mutations and soil chemistry, etc., presented at 4. International Congress of Nuclear Agriculture and Animal Science in Bursa, Turkey, 25-27 Sep 1996. A separate abstract was prepared for each paper

  1. Imagined futures, present lives

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Line; Wildermuth, Norbert

    2006-01-01

    is discussed centrally in this attempt to contribute to an empirically grounded understanding of the role that media play for youth in their striving to ‘find a place in life'. In the empirical context presented in the article, imaginations, expanded and circulated by a globalized media circuit...

  2. Presentation of 2004 earnings

    International Nuclear Information System (INIS)

    2005-03-01

    This presentation offers financial information on the AREVA Group earnings for the year 2004. With manufacturing facilities in over 40 countries and a sales network in over 100, Areva offers customers technological solutions for nuclear power generation and electricity transmission and distribution. The Group also provides interconnect systems to the telecommunications, computer and automotive markets. (A.L.B.)

  3. Structural effects on fusion reactor blankets due to liquid metals in magnetic fields

    International Nuclear Information System (INIS)

    Lehner, J.R.; Reich, M.; Powell, J.R.

    1976-01-01

    The transient stress distribution caused in the blanket structure when the plasma current suddenly switches off in a time short compared to the L/R decay time of the liquid metal blanket was studied. Poloidal field of the plasma will induce a current to flow in the liquid metal and blanket walls. Since the resistance of the liquid lithium will be much less than that of the metal walls, the current can be considered as flowing around the blanket near the cross section perimeter, but in the lithium

  4. Summary of the presentations

    International Nuclear Information System (INIS)

    2002-01-01

    This part summarizes the content of the six following presentations: 1. IAEA requirements/guidance for the decommissioning safety case (Mike Bell, IAEA); 2. Safety case in an EIA context (Patrick O'SULLIVAN, The Netherlands); 3. Plant configuration and the D and D licensing process (Eugenio GIL LOPEZ and Pedro CARBONERAS, Spain); 4. Accident assessment (Ivo TRIPPUTI, Italy; Ingmar LUND, Sweden); 5. Balancing radiological and industrial risk in the safety case (Pascal DEBOODT, Belgium); 6. The safety case for safe store and dormancy periods (Paul WOOLLAM, UK). Following the six presentations, the WPDD members discussed the safety case in an open discussion led by the Topical Session Chair, Frances Taylor. The discussion was wide-ranging, and topics varied from the standards that apply to releases to the environment during safe store, to decommissioning parallels with other major processing industries and facilities (such as oil rigs). Frances Taylor steered the discussion toward addressing the questions that the WPDD Core Group had proposed for the topical session. The Chair, the Rapporteur, and some members of the group sensed that the presentations had covered such an wide variety of issues, and that the content of the presentations themselves differed so greatly, that it would be difficult to distill a position paper from the information gathered, as had been the mandate from the Core Group. In addition, the meaning of the term 'Safety Case' differed greatly among participants in the topical session. Some took the term to mean the analysis and document that the implementor provides to the regulator, describing how operations will be performed safely. Others considered the term to mean the overall safety and risk conditions inherent in a nuclear facility during operations or decommissioning. With the differences in presentations and with the meaning of the terminology remaining unclear, the WPDD participants did not reach consensus conclusions on December 5, 2001

  5. Plenary presentations - opening remarks

    Energy Technology Data Exchange (ETDEWEB)

    Simon, R.M.

    1993-12-31

    I am pleased to be here today as one of the U.S. Co-Chairs for the Second U.S./Japan Workshop on Global Change. This series of workshops is an outgrowth of the 1988 bilateral agreement between the U.S. and Japanese governments on scientific and technological cooperation. That agreement called for comparable access to, and exchange of, information in scientific and technological fields, as well as the joint undertaking of cooperative activities for peaceful purposes in nationally important areas of science and technology. Meetings such as this were envisioned under the agreement to allow experts from both sides to discuss and exchange information on scientific and technological aspects of important problems and to identify research and development projects that might usefully be undertaken on a cooperative basis. The first U.S./Japan Workshop on Global Change focused on research needed to better understand how the global climate system operates, what the interactions are between the climate system and marine and terrestrial ecosystems, and how Earth systems might respond to global climatic changes.

  6. Unified field theory

    International Nuclear Information System (INIS)

    Prasad, R.

    1975-01-01

    Results of researches into Unified Field Theory over the past seven years are presented. The subject is dealt with in chapters entitled: the choice of affine connection, algebraic properties of the vector fields, field laws obtained from the affine connection based on the path integral method, application to quantum theory and cosmology, interpretation of physical theory in terms of geometry. (U.K.)

  7. Omnigenous magnetic fields

    International Nuclear Information System (INIS)

    Stupakov, G.V.

    1982-01-01

    In omnigenous magnetic fields particles' drift surfaces coincide with plasma magnetic surfaces. In this paper we formulate equations of omnigenous magnetic fields in natural curvilinear coordinates. An analysis of fields which are omnigenous only in the paraxial approximation is presented. (author)

  8. [Metachromatic Leukodystrophy. Case Presentation].

    Science.gov (United States)

    Espejo, Lina María; de la Espriella, Ricardo; Hernández, José Fernando

    Metachromatic leukodystrophy (MLD) is a rare demyelinating disease (prevalence 1:40 000), also called arylsulfatase A deficiency (ARS-A), which may present with neurological and psychiatric symptoms. Clinical assessment may be difficult, due to unspecific signs and symptoms. A case is presented of a 16 year-old female patient seen in psychiatry due to behavioural changes, psychosis, and with impaired overall performance. She was initially diagnosed with schizophrenia, but the Nuclear Magnetic Resonance (NMR) scan and laboratory tests lead to the diagnosis of MLD. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  9. Sirenomelia: A Rare Presentation

    Science.gov (United States)

    Srinivas, S; Kumar, Shiva; Reddy, Surweshwar; Prasad, Hari; Irfan, G M

    2012-01-01

    We are presenting two cases of Sirenomelia (Mermaid Syndrome), which is an extreme example of the caudal regression syndrome. It invariably presents with lower limb fusion, sacral and pelvic bony anomalies, absent external genitalia, imperforate anus, and renal agenesis or dysgenesis. There are approximately 300 cases reported in the literature, 15% of which are associated with twinning, most often monozygotic. The syndrome of caudal regression is thought to be the result of injury to the caudal mesoderm early in gestation. One of our cases survived for 12 days after birth. This new born had an unusually high anorectal anomaly in which the colon was ending at the level of mid transverse colon, fused lower limbs and genital anomalies. Ultrasound of the abdomen revealed horseshoe kidney. Colostomy was performed on day 2 of life. The second case encountered was a stillborn baby on whom an autopsy was performed. PMID:26023366

  10. Sirenomelia: a rare presentation.

    Science.gov (United States)

    Reddy, K Ramesh; Srinivas, S; Kumar, Shiva; Reddy, Surweshwar; Prasad, Hari; Irfan, G M

    2012-01-01

    We are presenting two cases of Sirenomelia (Mermaid Syndrome), which is an extreme example of the caudal regression syndrome. It invariably presents with lower limb fusion, sacral and pelvic bony anomalies, absent external genitalia, imperforate anus, and renal agenesis or dysgenesis. There are approximately 300 cases reported in the literature, 15% of which are associated with twinning, most often monozygotic. The syndrome of caudal regression is thought to be the result of injury to the caudal mesoderm early in gestation. One of our cases survived for 12 days after birth. This new born had an unusually high anorectal anomaly in which the colon was ending at the level of mid transverse colon, fused lower limbs and genital anomalies. Ultrasound of the abdomen revealed horseshoe kidney. Colostomy was performed on day 2 of life. The second case encountered was a stillborn baby on whom an autopsy was performed.

  11. Organising and presenting information.

    Science.gov (United States)

    Kankanady, Raghavendra; Wells, Marilyn

    2013-01-01

    Information management can be a daunting process for clinicians, health care providers and policy makers within the health care industry. This chapter discusses the importance of information classification and information architecture in the information economy and specific challenges faced within the health care industry. The healthcare sector has industry specific requirements for information management, standards and specifications for information presentation. Classification of information based on information criticality and the value in the health care industry is discussed in this paper. Presentation of information with reference to eHealth standards and specifications for healthcare information systems and their key requirements are also discussed, as are information architecture for eHealth implementation in Australia. This chapter also touches on information management and clinical governance since the importance of information governance is discussed by various researchers and how this is becoming of value to healthcare information management.

  12. Atypical Presentations of Tularemia.

    Science.gov (United States)

    Odegaard, Karah; Boersma, Beth; Keegan, James

    2017-05-01

    Francisella tularensis is a gram-negative coccobacillus that causes a condition commonly referred to as tularemia. There has been a dramatic increase in tularemia cases reported in South Dakota, many of which were challenging to diagnose due to atypical clinical manifestations. We describe an interesting case of pneumonic tularemia and summarize six similar cases, several of which presented with lung nodules suggestive of malignancy. According to the literature, this is only the third outbreak of pneumonic tularemia reported in the U.S. We believe it is important for clinicians to be aware of the increased incidence of tularemia in the area and to be vigilant in the diagnosis and management of these atypically presenting cases. Copyright© South Dakota State Medical Association.

  13. Presentation = Speech + Slides

    Directory of Open Access Journals (Sweden)

    Derik Badman

    2008-12-01

    Full Text Available Back in October, Aaron Schmidt posted “HOWTO give a good presentation” to his blog walking paper. His second bullet point of “thoughts” on good presentations is: Please don’t fill your slides with words. Find some relevant and pretty pictures to support what you’re saying. You can use the pictures to remind yourself what you’re going [...

  14. Validation of General Electric Aviation DAPS2015 Digital Recording and 1/3 Octave Analysis System for Use in Support of Aircraft Noise Certification Efforts in Compliance with 14 CFR Part 36; Letter Report: V324-FA5JBQ-LR4 Rev. 1

    Science.gov (United States)

    2017-10-31

    NOTE: This is a revision of Letter Report V324-FA5JBQ-LR4. The purpose of the revision is to correctly identify the system designation for which the validation applies. The applicant originally identified the materials provided in support of this val...

  15. Present status of radiation processing in Japan

    International Nuclear Information System (INIS)

    Tabata, Y.

    1984-01-01

    Crosslinking of insulating materials including cables, tubes, sheets, pipes and polymer foam, curing of coating, surface treatment and other processes developed recently will be presented. Future prospects in this field will be discussed. (Author) [pt

  16. EPMA present and future

    International Nuclear Information System (INIS)

    Love, G.

    2002-01-01

    In electron probe microanalysis the objective has always been to gain the maximum information from a sample. To this end efforts have been directed at increasing detection efficiency, reducing the size of the excitation volume, analysing more difficult specimens and improving the accuracy of quantitative measurements whilst, at the same time, attempting to minimize the complexity of the analysis. The present paper comments on the progress that has been made in this areas, focuses on the latest hardware and software developments taking place and looks forward to how these may impact on the technique of EPMA. (author)

  17. Sarcoidosis Presenting Addison's Disease.

    Science.gov (United States)

    Takahashi, Kentaro; Kagami, Shin-Ichiro; Kawashima, Hirotoshi; Kashiwakuma, Daisuke; Suzuki, Yoshio; Iwamoto, Itsuo

    2016-01-01

    We herein describe a second Japanese case of sarcoidosis presenting Addison's disease. A 52-year-old man was diagnosed with sarcoidosis based on clinical and laboratory findings, including bilateral hilar lymphadenopathy and elevated levels of serum angiotensin-converting enzyme and lysozyme, as well as the presence of noncaseating epithelioid granulomas. The patient also exhibited general fatigue, pigmentation, weight loss, hypotension and hyponatremia, suggestive of chronic adrenocortical insufficiency. An endocrine examination confirmed primary adrenocortical insufficiency. This case suggests the direct involvement of sarcoid granuloma in the adrenal glands.

  18. Radwaste - Multimedia presentation

    International Nuclear Information System (INIS)

    2000-01-01

    Radioactivity is a part of the Nature since the creation of the Earth. We have learned how to use radioactivity in medicine, power industry, and in other areas of life. Similarly as in other activities, waste is generated. We offer you basic information about radioactivity and radioactive waste (radwaste) in four films: Radioactivity, Source of radwaste, Management of radwaste. In the glossary are video presentations: Container (Castor) for radioactive waste; Deep underground repository; Transport vehicle; WWER type reactor. Encyclopedic part of the program contains detailed theoretical and practical information about use of radioactivity and radioactive waste. You will find the explanation in the part Glossary. (authors)

  19. Presentation to the symposium

    International Nuclear Information System (INIS)

    Busby, C.

    1997-01-01

    This paper proposes that there is a major error in the present perception of cancer risk from exposure to low level radiation from internal man-made fission products like strontium-90. The author's Second Event theory is discussed which advances the basis that fission products are different in radiation risk terms. Since the scientific community has been so ready to dismiss this idea out of hand, the author also explores scientific culture and scientific revolutions. The evidence that the idea is broadly right is surveyed and finally some studies that could be undertaken to prove or disprove the author's contention are outlined. (UK)

  20. Radiation myelopathy (case presentation)

    International Nuclear Information System (INIS)

    Sangheli, M.; Lisnic, V.; Plesca, S.; Odainic, O.; Chetrari, L.

    2009-01-01

    The radiotherapy is one of the most widely spread and commonly used method in treating tumors of different localization. A detailed analysis of benefits and possible side effects along with evaluation of the risk factors allows preventing one of the most difficult complication, and namely the radiation myelopathy. The delayed form of such a disease is distinguished by a pronounced unfavorable prognosis. The presented case provoked the discussion of difficulties in performing differential diagnosis, as well as the importance of determining the localization of vulnerable tissues as regards the target organ exposed to radiotherapy. (authors)

  1. DOE financial assurance presentation

    International Nuclear Information System (INIS)

    Huck, R.

    1990-01-01

    The presentation topic is California's approach to license application review in meeting financial assurances for the proposed Ward Valley site. The purpose of the presentation is to provide information on specific financial assurance provisions contained in 10 CFR Part 61 and how California intends to satisfy those requirements. Also, as rate setter, California intends to demonstrate how it will assure allowable costs to the rate base though a financial prudency review. The key provisions of financial assurance are: 10 CFR Section 61.61 - This provision requires an applicant to demonstrate its ability to finance licensed activities; 10 CFR Section 61.62 - This provision requires an applicant to provide assurance that sufficient funds will be available for site closure and stabilization; and 10 CFR Section 61.63 - This provision requires an applicant to provide 'a copy of a binding arrangement, such as a lease, between the applicant and the disposal site owner, so that sufficient funds will be available to cover the costs of the institutional control period.' To assist California in its determination of financial assurance compliance to be demonstrated by the applicant for Part 61 requirements, is NUREG guidance document 1199 'Standard Format and Content of a License Application for a Low-Level Radioactive Waste (LLRW) Disposal Facility.' The detailed financial assurance provisions of NUREG 1199 are then embodied in NUREG 1200, 'Standard Review Plant for the Review of a License Application for a LLRW Disposal Facility.'

  2. Rett syndrome: EEG presentation.

    Science.gov (United States)

    Robertson, R; Langill, L; Wong, P K; Ho, H H

    1988-11-01

    Rett syndrome, a degenerative neurological disorder of girls, has a classical presentation and typical EEG findings. The electroencephalograms (EEGs) of 7 girls whose records have been followed from the onset of symptoms to the age of 5 or more are presented. These findings are tabulated with the Clinical Staging System of Hagberg and Witt-Engerström (1986). The records show a progressive deterioration in background rhythms in waking and sleep. The abnormalities of the background activity may only become evident at 4-5 years of age or during stage 2--the Rapid Destructive Stage. The marked contrast between waking and sleep background may not occur until stage 3--the Pseudostationary Stage. In essence EEG changes appear to lag behind clinical symptomatology by 1-3 years. An unexpected, but frequent, abnormality was central spikes seen in 5 of 7 girls. They appeared to be age related and could be evoked by tactile stimulation in 2 patients. We hypothesize that the prominent 'hand washing' mannerism may be self-stimulating and related to the appearance of central spike discharges.

  3. Bad (Re)Presentations

    CERN Multimedia

    Computer Security Team

    2013-01-01

    This time, we would like to address copyright violations (again) - but with a twist. While previous articles focussed on “Music, videos and the risk for CERN” or on software licences, the focus is now on using photos, music and images “found” on the Web for presentations, publications and web pages…   Just recently, a video produced for CERN and published on YouTube and Facebook used background music from a contemporary popular artist. However, the people responsible failed to obtain the appropriate permission to actually use that music. They thought that having bought it on iTunes was sufficient. But it was not: “buying” means you have the right to listen, but not the right for further distribution or re-publication. As a result, the videos were pulled from YouTube and Facebook. Similarly, how many of us integrate graphics and images “found” on the Web into our presentations?  How many of us...

  4. Field transformations to multivalued fields

    Energy Technology Data Exchange (ETDEWEB)

    Kleinert, H [Institut fuer Theoretische Physik, Arnimallee 14, D-14195 Berlin (Germany)

    2007-05-15

    Changes of field variables may lead to multivalued fields which do not satisfy the Schwarz integrability conditions. Their quantum field theory needs special care as is shown in an application to the superfluid and superconducting phase transitions.

  5. Quantum technology past, present, future: quantum energetics (Conference Presentation)

    Science.gov (United States)

    Choi, Sang H.

    2017-04-01

    Since the development of quantum physics in the early part of the 1900s, this field of study has made remarkable contributions to our civilization. Some of these advances include lasers, light-emitting diodes (LED), sensors, spectroscopy, quantum dots, quantum gravity and quantum entanglements. In 1998, the NASA Langley Research Center established a quantum technology committee to monitor the progress in this area and initiated research to determine the potential of quantum technology for future NASA missions. The areas of interest in quantum technology at NASA included fundamental quantum-optics materials associated with quantum dots and quantum wells, device-oriented photonic crystals, smart optics, quantum conductors, quantum information and computing, teleportation theorem, and quantum energetics. A brief review of the work performed, the progress made in advancing these technologies, and the potential NASA applications of quantum technology will be presented.

  6. Film Presentation: Die Urknallmaschine

    CERN Multimedia

    Carolyn Lee

    2010-01-01

    Die Urknallmaschine, an Austrian film by Gerd Baldauf, narrated by Norbert Frischauf (Alpha Österreich - ORF, 2009).  In CERN’s gigantic complex particles are accelerated to almost the speed of light, brought to collision and made to divide into even smaller particles. Public opinion of CERN’s research is also divided. Sceptics fear that black holes may be created. Might the goal to study the origin of the world lead to its destruction? The Austrian researcher Norbert Frischauf worked at CERN for many years. With his guidance it is possible to explore the world’s largest research centre, get a glimpse of the fascinating work the scientists do there and take a crash course in particle physics. Die Urknallmaschine will be presented on Friday, 25 June from 13:00 to 14:00 in the Main Auditorium. Language: German

  7. Abdominal pregnancy - Case presentation.

    Science.gov (United States)

    Bohiltea, R; Radoi, V; Tufan, C; Horhoianu, I A; Bohiltea, C

    2015-01-01

    Abdominal pregnancy, a rare diagnosis, belongs to the ectopic pregnancy group, the leading cause of pregnancy related exitus. The positive diagnosis is very difficult to establish most often in an acute setting, leading to a staggering percent of feto-maternal morbidity and mortality. We present the case of 26-weeks-old abdominal pregnancy with partial feto-placental detachment in a patient, after hysteroscopy and in vitro fertilization, which until the acute symptoms that led to emergency laparotomy went unrecognized. The patient recovered completely and satisfactorily after surgery and, due to the high risk of uterine rupture with regard to a second pregnancy, opted for a surrogate mother. Abdominal pregnancy can be regarded as a difficult to establish diagnosis, with a greater chance in case of increased awareness. It is compulsory to be well informed in order not to be surprised by the diagnosis and to apply the correct treatment immediately as the morbidity and mortality rate is elevated.

  8. Trichinosis - case presentation

    Directory of Open Access Journals (Sweden)

    Rajko Saletinger

    2007-03-01

    Full Text Available Background: Trichinosis is a widespread zoonosis acquired by ingestion of undercooked meat infected with the larvae of Trichinella parasites. The disease has variable clinical manifestations ranging from asymptomatic to fatal. Majority of infections is caused by Trichinella spiralis, although there are some cases caused by other species. The dramatic decline of trichinosis reflects changes in industrial practices and increased public awareness. The majority of human cases are now associated with wild game meat and noncommercial pork. The case of previously healthy, young man with trichinosis is presented. The disease was determined with serologic testing and cured with albendazole. The source of infection has not been determined.Conclusions: In patients with fever, mialgias and eosinophilia infection with tissue nematodes should always be taken in consideration. In those who have recently consumed raw or undercooked pork and wild game meat we should think about trichinosis. The disease is rare in Slovenia.

  9. Presenting practice financial information.

    Science.gov (United States)

    Webster, Lee Ann H

    2007-01-01

    Medical practice leadership teams, often consisting primarily of physicians with limited financial backgrounds, must make important business decisions and continuously monitor practice operations. In order to competently perform this duty, they need financial reports that are relevant and easy to understand. This article explores financial reporting and decision-making in a physician practice. It discusses reports and tools, such as ratios, graphs, and comparisons, that practices typically include in their reports. Because profitability and cash flow are often the most important financial considerations for physician practices, reports should generally focus on the impact of various activities and potential decisions upon these concerns. This article also provides communication tips for both those presenting practice financial information and those making the decisions. By communicating effectively, these leaders can best use financial information to improve decision-making and maximize financial performance.

  10. Wake fields and wake field acceleration

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Wilson, P.B.; Weiland, T.

    1984-12-01

    In this lecture we introduce the concepts of wake fields and wake potentials, examine some basic properties of these functions, show how they can be calculated, and look briefly at a few important applications. One such application is wake field acceleration. The wake field accelerator is capable of producing the high gradients required for future very high energy e + e - linear colliders. The principles of wake field acceleration, and a brief description of experiments in progress in this area, are presented in the concluding section. 40 references, 27 figures

  11. The Citizen Science Program "H2O SOS: Help Heal the Ocean—Student Operated Solutions: Operation Climate Change" teaches middle and high school students about ocean threats related to climate change through hands-on activities and learning experiences in the field. This is a continuation of the Program presented last year at the Poster Session.

    Science.gov (United States)

    Weiss, N. K.; Wood, J. H.

    2017-12-01

    TThe Citizen Science Program H2O SOS: Help Heal the Ocean—Student Operated Solutions: Operation Climate Change, teaches middle and high school students about ocean threats related to climate change through hands-on activities and learning experiences in the field. During each session (in-class or after-school as a club), students build an understanding about how climate change impacts our oceans using resources provided by ExplorOcean (hands-on activities, presentations, multi-media). Through a student leadership model, students present lessons to each other, interweaving a deep learning of science, 21st century technology, communication skills, and leadership. After participating in learning experiences and activities related to 6 key climate change concepts: 1) Introduction to climate change, 2) Increased sea temperatures, 3) Ocean acidification, 4) Sea level rise, 5) Feedback mechanisms, and 6) Innovative solutions. H2O SOS- Operation Climate change participants select one focus issue and use it to design a multi-pronged campaign to increase awareness about this issue in their local community. The campaign includes social media, an interactive activity, and a visual component. All participating clubs that meet participation and action goals earn a field trip to Ocean Quest where they dive deeper into their selected issue through hands-on activities, real-world investigations, and interviews or presentations with experts. In addition to self-selected opportunities to showcase their focus issue, teams will participate in one of several key events identified by Ocean Quest.

  12. Numerical reproduction of hemodynamics change by acupuncture on Taichong (LR-3 based on the lumped-parameter approximation model of the systemic arteries

    Directory of Open Access Journals (Sweden)

    Atsushi Shirai

    2015-09-01

    Conclusion: The present model has a potential to emulate hemodynamic change by acupuncture therapy by incorporating physiological correlation of stimulation of an acupoint and regulation of parameters that affect the hemodynamics.

  13. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  14. Presentation of Canada

    International Nuclear Information System (INIS)

    Hedley, Dianne E.

    1997-01-01

    In contingency of a nuclear emergency event, requiring application of intervention measures on a federal scale, Canada has of a plan ensuring the compatibility of the plans of different provinces and serving as interface between federal and provincial authorities. Exclusive of a nuclear attack against North America, by nuclear emergency it is understood an accident resulting in radionuclide release. This is called the Plan of federal intervention in case of nuclear emergency. 'Sante Canada' is the federal authority responsible for intervention in case of nuclear emergency and it has the task of preparing and coordinating the actions on a federal scale.Should the plan be set in action and if the emergency has repercussions upon the agricultural sector, the sustaining organism will be 'Agriculture and agroalimentaire Canada' which in case of emergency acts through the channels of the National System of intervention in the agro-alimentary sector (SNIUA). The paper presents the objectives, the principles of organization and operation, the responsibilities and the plans which SNIUA has in its charge to implement in case of emergency

  15. STS-69 postflight presentation

    Science.gov (United States)

    1995-10-01

    A postflight conference of the STS-69 mission is presented. The flightcrew ('The Dog Team') consisted of Cmdr. David Walker, Pilot Kenneth Cockrell, Payload Cmdr. James Voss, and Mission Specialists James Newman and Michael Gernhardt. The mission's primary objective was the deployment and retrieval of the SPARTAN-201 satellite, which investigated the interaction between the Sun and it's solar wind. Other secondary experiments and shuttle payloads included the Wake Shield Facility (WSF), which grew several layers of semiconductor films, the International Extreme Ultraviolet Hitchhiker (IEH-1), the Capillary Pumped Loop-2/Gas Bridge Assembly (CAPL-2/GBA), several Get Away Specials (GAS) experiments, the Electrolysis Performance Improvement Concept Study (EPICS), the Thermal Energy Storage (TES-2) experiment, the Commercial Generic Bioprocessing Apparatus-7 (CGBA-7), the National Institutes of Health-Cells 4 (NIH-C4) experiment, and the Biological Research in Canister-6 (BRIC-6) experiment. Earth views consisted of Saudi Arabia water wells, uncommon vortices over Oman, the Amazon River, the Bahamas, Somalia, a sunset over the Earth's horizon, and two hurricanes, Luis and Marilyn.

  16. Present energy status

    Energy Technology Data Exchange (ETDEWEB)

    Desprairies, P

    1988-04-01

    This paper reviews the past and present situation of the World Oil Market and assumes future trends and possible future evolution. Low oil prices between 1950 and 1973 have contributed to an exceptional growth of oil demand during more than 20 years which was more and more supplied by OPEC. The oil shocks of 1973 and 1979 have dramatically changed this situation. Some of the most important changes have been the emergence of non-OPEC new oil producers, the growth of substitute energies, especially natural gas and nuclear power, on the supply side; and substantial decrease of energy consumption in many industrialized countries which has greatly reduced oil demand to OPEC on the demand side. Today this situation seems somewhat stabilized (after the reversal of world oil prices in 1986) and OPEC is producing around 18 million b/day as against a producing capacity of about 30 million b/day. It is generally considered that in coming years oil prices will remain relatively low (or occasionally even become lower than today) due to excess oil production capacity and relative abundance of other types of energy. However, many experts think that these trends can be reversed when oil supply will more and more concentrate again in the Middle East; but it is hard to say if this will begin in 1995, 2000, 2010.

  17. The laryngocele; case presentation

    Directory of Open Access Journals (Sweden)

    Gabriel V. Berteșteanu

    2016-05-01

    Full Text Available Laryngocele is a rare pathology, but because of their clinical evolution and the symptoms they generate, they should always be considered as a differential diagnosis when investigating neck masses. A laryngocele is basically a herniation of the mucosa of the laryngeal ventricle (Morgagni's ventricle arising usually from the saccular region. This herniation may remain confined to the larynx - in which case the laryngocele is internal- or expand through the thyro-hyoid membrane into the structures of the neck - thus being called an external laryngocele. Usually the laryngocele has both an internal and external component thus being a mixed laryngocele. Diagnosis of laryngoceles still relies heavily on clinical signs such as tympanism, easily depressible neck mass, indirect laryngoscopy, but is now simplified by imagistic investigations (ultrasound, CT and MRI. However, the treatment of this condition is exclusively surgical and consists of total excision of the laryngocele, as well as proper identification of the point of origin from the saccule and also the final suture of the breach in order to prevent recurrence. Investigation of possible causes of obstruction of the laryngeal ventricle should always be performed (because of the possibility of an underlying malignancy as well as a follow-up protocol of the patient, given the risk of relapse. We present a recently diagnosed case of a 32 year old man with mixed laryngocele, which we have operated in our clinic.

  18. IKONOS: future and present

    Science.gov (United States)

    Schaap, Niek

    2003-04-01

    The IKONOS satellite has been operational since January 2000 and was the first commercial satellite collecting imagery with 1 meter resolution. The current life expectancy of the satellite is 10 years. Since the launch, Space Imaging Inc. (the owner of the satellite) supplied IKONOS imagery to users in many vertical markets, such as: agriculture, defense, oil & gas and telecommunications. This oral presentation will give comprehensive information about IKONOS and the future: * Block II, the successor of IKONOS. Space Imaging expects to launch in 2004 a new high-resolution satellite, ensuring both continuity and (for some years) a tandem operation with IKONOS, greatly improving the availability of imagery. * Space Imaging affiliates. IKONOS imagery collected, processed and sold by regional affiliates. These regional affiliates are strategically located around the world, like Japan Space Imaging (Tokyo), Space Imaging Middle East (Dubai) and Space Imaging Eurasia (Ankara, Turkey). * Technical briefing IKONOS. IKONOS (compared to other commercial high-resolution satellites) has superior collection capabilities. Due to, the higher orbit altitude, local reception of the imagery, bi-directional scanning and the high agility of the satellite, is the IKONOS satellite capable to collect the imagery relative quickly.

  19. Presentation of Pydio

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    **Pydio is an open-source platform for file sharing and synchronisation.** It is wildly used by enterprises and organizations worldwide, including major universities. Pydio comes with a rich web-based interface, native clients for both iOS and Android mobile devices, and lately a new sync client for desktop platforms. Pydio v6 is of great useability and introduces many new features that makes it the ultimate sharing machine. Its architecture makes it a perfect fit for either easily deploying an on-premise dropbox solution, or building more complicated solutions where the box feature is integrated as OEM. Storage-agnostic, Pydio is a simple layer that can be deployed on top of any storage backend, thus providing scalability and high-availability out-of-the-box. Charles du Jeu is the lead developer of the solution and will briefly present its feature and how it can fit for research and engineering purpose. See https://pyd.io/ for more information.

  20. Distinct Roles of Th17 and Th1 Cells in Inflammatory Responses Associated with the Presentation of Paucibacillary Leprosy and Leprosy Reactions.

    Science.gov (United States)

    Santos, M B; de Oliveira, D T; Cazzaniga, R A; Varjão, C S; Dos Santos, P L; Santos, M L B; Correia, C B; Faria, D R; Simon, M do V; Silva, J S; Dutra, W O; Reed, S G; Duthie, M S; de Almeida, R P; de Jesus, A R

    2017-07-01

    It is well established that helper T cell responses influence resistance or susceptibility to Mycobacterium leprae infection, but the role of more recently described helper T cell subsets in determining severity is less clear. To investigate the involvement of Th17 cells in the pathogenesis of leprosy, we determined the immune profile with variant presentations of leprosy. Firstly, IL-17A, IFN-γ and IL-10 were evaluated in conjunction with CD4 + T cell staining by confocal microscopy of lesion biopsies from tuberculoid (TT) and lepromatous leprosy (LL) patients. Secondly, inflammatory cytokines were measured by multiplex assay of serum samples from Multibacillary (MB, n = 28) and Paucibacillary (PB, n = 23) patients and household contacts (HHC, n = 23). Patients with leprosy were also evaluated for leprosy reaction occurrence: LR+ (n = 8) and LR- (n = 20). Finally, peripheral blood mononuclear cells were analysed by flow cytometry used to determine the phenotype of cytokine-producing cells. Lesions from TT patients were found to have more CD4 + IL-17A + cells than those from LL patients. Higher concentrations of IL-17A and IL-1β were observed in serum from PB than MB patients. The highest serum IFN-γ concentrations were, however, detected in sera from MB patients that developed leprosy reactions (MB LR + ). Together, these results indicate that Th1 cells were associated with both the PB presentation and also with leprosy reactions. In contrast, Th17 cells were associated with an effective inflammatory response that is present in the PB forms but were not predictive of leprosy reactions in MB patients. © 2017 The Foundation for the Scandinavian Journal of Immunology.

  1. THE UPSIDE OF PRESENTISM

    Directory of Open Access Journals (Sweden)

    Lynn Fendler

    2009-01-01

    Full Text Available El presentismo es visto generalmente como un mal necesario en historiografía. Este artículo explora lo positivo de esta inevitabilidad. Aplicando un enfoque filosófico al análisis discursivo en la tradición de la nueva historia cultural, se distingue -de una parte-¿ entre un uso estratégico del presentismo, y -de otra- un enfoque racionalista en historia. El artículo concluye considerando algunas implicaciones políticas en historiografía de las explicaciones racionalistas y de las explicaciones estratégicamente presentistas. Los modos de comprensión racionalistas inscriben las expectativas del pasado en las visiones del futuro; asignando al historiador el papel de profeta; y perpetuando nociones de agentes ahistóricos. En contraste, las historias estratégicamente presentistas incorporan una orientación que deliberadamente emplea las lentes y perspectivas del presente en orden a tener en cuenta supuestos y perspectivas actuales. Cuando las asunciones son examinadas en relación a las perspectivas presentistas, dichos presupuestos sueltan su rienda en el pensamiento. Dado que el presentismo es inevitable, no debe ser desestimado por completo, sino que debe ser una cuestión sondeada y examinada críticamente. Con dicho foco, el presentismo estratégico en la historiografía debe posibilitar una reflexión sobre los límites de lo que es posible pensar.

  2. Summary of presentations and discussions

    International Nuclear Information System (INIS)

    Takeuchi, Mitsuo

    2008-01-01

    In December 2007, the Forum on Stakeholder Confidence discussed its theme entitled 'Link between research, development and demonstration (RD and D) and stakeholder confidence'. It was remarked that regulators need a technical demonstration to aid in evaluating the safety case. Local stakeholders appreciate the opportunity to visualise technological arrangements. In both cases, demonstration adds to confidence in the feasibility of solutions. Some believe there is an important role for analogues in communication with stakeholders, if handled with integrity. To explore and benchmark current practices, it was decided to hold a topical session at the 9. regular meeting of the FSC on 4 June 2008 regarding the use of analogues for confidence building. The session opened with an introductory presentation by the session rapporteur. This incorporated input provided for the purpose by FSC members in cooperation with their country's representative to the NEA RWMC 'Integration Group on the Safety Case'. Three speakers then presented the various uses of analogues by implementers, regulators and scientists to build their own confidence; a fourth speaker dealt with the experience of using natural analogues in public information. The presentations addressed the use of analogues in the field of geological disposal of high-level waste (HLW) and long-lived intermediate level (ILW-LL) radioactive waste. Then the FSC participants split into two working groups for discussion. The outcome of these discussions was reported in plenary on 6 June 2008 and it was agreed to publish proceedings of the session. The present summary, prepared by the session rapporteur with input from the NEA Secretariat, captures the main points heard in the course of the event. It combines data from the formal presentations and remarks made in discussion. The latter represent viewpoints expressed by a group whose primary focus is not natural analogues but rather stakeholder interests. The summary and viewpoints

  3. Site selection: Past and present

    International Nuclear Information System (INIS)

    Tilford, N.R.

    1994-01-01

    Site selection has been going on since the earliest times. The process has evolved through the Industrial Revolution to the present period of exploding population and environmental awareness. Now the work must be done both with increasing sophistication and greater transparency. Modern techniques for site selection have been developed during the last two decades or so, utilizing a teachable body of knowledge and a growing literature. Many firms and individuals have contributed to this growing field. The driving force has been the need for such a process in siting and licensing of critical facilities such as nuclear power plants. A list of crucial, documented steps for identifying social impacts and acceptability are provided. A recent innovation is the self-selection method developed by government. The Superconducting Supercollider serves as an example of this approach. Geological or geologically dependent factors often dominate the process. The role as engineering and environmental geoscientists is to provide responsible leadership, consultation, and communication to the effort

  4. Circular Wilson loops in defect conformal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Aguilera-Damia, Jeremías; Correa, Diego H. [Instituto de Física La Plata, CONICET, Universidad Nacional de La Plata,C.C. 67, 1900 La Plata (Argentina); Giraldo-Rivera, Victor I. [International Centre for Theoretical Sciences (ICTS-TIFR),Shivakote, Hesaraghatta Hobli, Bengaluru 560089 (India)

    2017-03-06

    We study a D3-D5 system dual to a conformal field theory with a codimension-one defect that separates regions where the ranks of the gauge groups differ by k. With the help of this additional parameter, as observed by Nagasaki, Tanida and Yamaguchi, one can define a double scaling limit in which the quantum corrections are organized in powers of λ/k{sup 2}, which should allow to extrapolate results between weak and strong coupling regimes. In particular we consider a radius R circular Wilson loop placed at a distance L, whose internal space orientation is given by an angle χ. We compute its vacuum expectation value and show that, in the double scaling limit and for small χ and small L/R, weak coupling results can be extrapolated to the strong coupling limit.

  5. Applying Technology To Facilitate Poster Presentations.

    Science.gov (United States)

    Marek, Pam; Christopher, Andrew N.; Koenig, Cynthia S.

    2002-01-01

    Promotes the use of presentation software in psychology courses to teach students technological skills that prepare them for the future. Explains that many graduates in psychology are employed in other fields after graduation. Discusses the use of presentation software with a focus on poster preparation using Microsoft PowerPoint software. (CMK)

  6. WWNPQFT-2010 - Slides of the presentations

    International Nuclear Information System (INIS)

    Fried, H.M.; Huber, M.Q.; Grandou, T.; Bianchi, E.; Gracey, J.; Reys, V.; Jevicki, A.; Ferrante, D.; Bouakaz, K.; Spielmann, D.; Cucchieri, A.; Culetu, H.; Gelis, F.; Zwanziger, D.; Candelpergher, B.; Bender, C.

    2013-01-01

    This document is made up of the slides of the presentations. The object of this workshop is to consolidate and publicize new efforts in non-perturbative field theories. The main topics are quantum chromodynamics, Yang-Mills theory, effective locality, the Gribov-Zwanziger Lagrangian, and renormalization. A presentation is dedicated to the initial stages of high energy nucleus-nucleus collisions

  7. Quantum field theory

    International Nuclear Information System (INIS)

    Ryder, L.H.

    1985-01-01

    This introduction to the ideas and techniques of quantum field theory presents the material as simply as possible and is designed for graduate research students. After a brief survey of particle physics, the quantum theory of scalar and spinor fields and then of gauge fields, is developed. The emphasis throughout is on functional methods, which have played a large part in modern field theory. The book concludes with a bridge survey of ''topological'' objects in field theory and assumes a knowledge of quantum mechanics and special relativity

  8. Visual field

    Science.gov (United States)

    ... your visual field. How the Test is Performed Confrontation visual field exam. This is a quick and ... to achieve this important distinction for online health information and services. Learn more about A.D.A. ...

  9. Teratology - past, present and future.

    Science.gov (United States)

    Ujházy, Eduard; Mach, Mojmír; Navarová, Jana; Brucknerová, Ingrid; Dubovický, Michal

    2012-12-01

    Teratology is the science that studies the causes, mechanisms, and patterns of abnormal development. The authors present an updated overview of the most important milestones and stages of the development of modern teratology. Development of knowledge and society led to the recognition that causes of congenital developmental disorders (CDDs) might be caused by various mechanical effects, foetal diseases, and retarded or arrested development of the embryo and foetus. Based on the analysis of the historical development of hypotheses and theories representing a decisive contribution to this field, we present a survey of the six Wilson's fundamental principles of teratology. The aim of observing these principles is to get insight into developmental relations and to understand mechanisms of action on the level of cell populations (elementary morphogenetic processes), tissues and organs. It is important to realise that any negative intervention into the normal course of these processes, either on genetic or non-genetic basis, inevitably leads to a sequence of subsequent changes resulting in CDDs. Moreover, the classical toxicologic monotonic dose-response paradigm recently has been challenged by the so-called "low dose-hypothesis", particularly in the case of endocrine active substances. These include some pesticides, dioxins, polychlorobiphenyls (PCBs), and bisphenol A. Despite modern approaches of molecular biology and genetics, along with top diagnostic techniques, we are still not able to identify the actual cause in more than 65 to 70% of all congenital defects classified as having an unknown etiology. Today CDDs include any birth defect, either morphological, biochemical, or behavioural.

  10. Alteration in the Expression of Cytochrome P450s (CYP1A1, CYP2E1, and CYP3A11 in the Liver of Mouse Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Bangjun Zhang

    2015-03-01

    Full Text Available Microcystins (MCs are cyclic heptapeptide toxins and can accumulate in the liver. Cytochrome P450s (CYPs play an important role in the biotransformation of endogenous substances and xenobiotics in animals. It is unclear if the CYPs are affected by MCs exposure. The objective of this study was to evaluate the effects of microcystin-LR (MCLR on cytochrome P450 isozymes (CYP1A1, CYP2E1, and CYP3A11 at mRNA level, protein content, and enzyme activity in the liver of mice the received daily, intraperitoneally, 2, 4, and 8 µg/kg body weight of MCLR for seven days. The result showed that MCLR significantly decreased ethoxyresorufin-O-deethylase (EROD (CYP1A1 and erythromycin N-demthylase (ERND (CYP3A11 activities and increased aniline hydroxylase (ANH activity (CYP2E1 in the liver of mice during the period of exposure. Our findings suggest that MCLR exposure may disrupt the function of CYPs in liver, which may be partly attributed to the toxicity of MCLR in mice.

  11. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Science.gov (United States)

    Hrouzek, Pavel; Štys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036

  12. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Directory of Open Access Journals (Sweden)

    Jan Urban

    2013-01-01

    Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  13. Estimation of ion competition via correlated responsivity offset in linear ion trap mass spectrometry analysis: theory and practical use in the analysis of cyanobacterial hepatotoxin microcystin-LR in extracts of food additives.

    Science.gov (United States)

    Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  14. Present and future of kaon physics

    International Nuclear Information System (INIS)

    Bertini, R.

    1983-07-01

    The aim of this talk is to present experimental results that could provide a clue to decide whether the relativistic mean field approach or the quark picture is more appropriate to describe the nuclear phenomena dependent on short range interactions. I discuss Λ and Σ hypernucleus experiments, dibaryon strange resonances and strange baryon radiative decays. All these experiments belong to be a powerful tool to explore this challenging field at nuclear physics

  15. present

    African Journals Online (AJOL)

    as medium of instruction enhances concept formation, especially in science subjects as ... The study, on which this paper is based, was conducted to evaluate Malawi's ... corrected in the wake of information flowing from the evaluation phase (Kaplan .... concerning the background information and suggested activities (Thodi,.

  16. PRESENTATION

    OpenAIRE

    Editors, The

    2017-01-01

    To plan and to implement academic projects remain a systematic challenge for the team and the collaborators of the Electronic Journal. Each study published is an opportunity to strengthen the proposed goals and to add more value to the community involved and interested.

  17. Presentations

    International Nuclear Information System (INIS)

    2007-01-01

    The aim of the Exploratory Workshop is to encourage informal discussion and the exchange of expertise between scientists using random matrix theory in various areas of research ranging from fundamental physics: string theory, gravity, quantum chaos, information theory, complexity theory, combinatorics to applied research: biophysics, econophysics, quantitative finance and telecommunication. Such a discussion would be a first step towards creating a common European environment for researchers using this powerful theory

  18. Cosmic Magnetic Fields

    Science.gov (United States)

    Sánchez Almeida, J.; Martínez González, M. J.

    2018-05-01

    Magnetic fields play an important role in many astrophysical processes. They are difficult to detect and characterize since often their properties have to be inferred through interpreting the polarization of the light. Magnetic fields are also challenging to model and understand. Magnetized plasmas behave following highly non-linear differential equations having no general solution, so that every astrophysical problem represents a special case to be studied independently. Hence, magnetic fields are often an inconvenient subject which is overlooked or simply neglected (the elephant in the room, as they are dubbed in poster of the school). Such difficulty burdens the research on magnetic fields, which has evolved to become a very technical subject, with many small disconnected communities studying specific aspects and details. The school tried to amend the situation by providing a unifying view of the subject. The students had a chance to understand the behavior of magnetic fields in all astrophysical contexts, from cosmology to the Sun, and from starbursts to AGNs. The school was planed to present a balanced yet complete review of our knowledge, with excursions into the unknown to point out present and future lines of research. The subject of Cosmic Magnetic Fields was split into seven different topics: cosmic magnetic field essentials, solar magnetic fields, stellar magnetic fields, the role of magnetic fields on AGN feedback, magnetic fields in galaxies, magnetic fields in galaxy clusters and at larger scales, and primordial magnetic fields and magnetic fields in the early Universe. The corresponding lectures were delivered by seven well known and experienced scientists that have played key roles in the major advances of the field during the last years: F. Cattaneo, P. Judge, O. Kochukhov, R. Keppens, R. Beck, K. Dolag, and F. Finelli. Their lectures were recorded and are freely available at the IAC website: http://iactalks.iac.es/talks/serie/19.

  19. Avaliação do processo de adsorção da microcistina-LR por carvão ativado

    OpenAIRE

    Wagner Sampaio da Silva, Paulo

    2005-01-01

    Em virtude do aumento do número de relatos de intoxicações agudas e crônicas, tanto de animais como em seres humanos, por toxinas produzidas por cianobactérias presentes na água, já existe uma grande preocupação por parte das companhias responsáveis pelo tratamento e distribuição de água potável. A aplicação do processo de adsorção por carvão ativado em sistemas de tratamento de água vem sendo largamente utilizado para a remoção de contaminantes específicos. Neste trabalho ...

  20. Nonequilibrium quantum field theories

    International Nuclear Information System (INIS)

    Niemi, A.J.

    1988-01-01

    Combining the Feynman-Vernon influence functional formalism with the real-time formulation of finite-temperature quantum field theories we present a general approach to relativistic quantum field theories out of thermal equilibrium. We clarify the physical meaning of the additional fields encountered in the real-time formulation of quantum statistics and outline diagrammatic rules for perturbative nonequilibrium computations. We derive a generalization of Boltzmann's equation which gives a complete characterization of relativistic nonequilibrium phenomena. (orig.)