WorldWideScience

Sample records for lr demagnetizing fields

  1. Demagnetizing fields in active magnetic regenerators

    DEFF Research Database (Denmark)

    Nielsen, Kaspar Kirstein; Bahl, Christian R.H.; Smith, Anders

    2014-01-01

    A magnetic material in an externally applied magnetic field will in general experience a spatially varying internal magnetic field due to demagnetizing effects. When the performance of active magnetic regenerators (AMRs) is evaluated using numerical models the internal field is often assumed...... is in general both a function of the overall shape of the regenerator and its morphology (packed particles, parallel plates etc.) as well as the magnetization of the material. Due to the pronounced temperature dependence of the magnetization near the Curie temperature, the demagnetization field is also...... temperature dependent. We propose a relatively straightforward method to correct sufficiently for the demagnetizing field in AMR models. We discuss how the demagnetizing field behaves in regenerators made of packed spheres under realistic operation conditions....

  2. The demagnetizing field of a non-uniform rectangular prism

    DEFF Research Database (Denmark)

    Smith, Anders; Nielsen, Kaspar Kirstein; Christensen, Dennis

    2010-01-01

    The effect of demagnetization on the magnetic properties of a rectangular ferromagnetic prism under non-uniform conditions is investigated. A numerical model for solving the spatially varying internal magnetic field is developed, validated and applied to relevant cases. The demagnetizing field...... is solved by an analytical calculation and the coupling between applied field, the demagnetization tensor field and spatially varying temperature is solved through iteration. We show that the demagnetizing field is of great importance in many cases and that it is necessary to take into account the non...

  3. A 0.5 Tesla Transverse-Field Alternating Magnetic Field Demagnetizer

    Science.gov (United States)

    Schillinger, W. E.; Morris, E. R.; Finn, D. R.; Coe, R. S.

    2015-12-01

    We have built an alternating field demagnetizer that can routinely achieve a maximum field of 0.5 Tesla. It uses an amorphous magnetic core with an air-cooled coil. We have started with a 0.5 T design, which satisfies most of our immediate needs, but we can certainly achieve higher fields. In our design, the magnetic field is transverse to the bore and uniform to 1% over a standard (25 mm) paleomagnetic sample. It is powered by a 1 kW power amplifier and is compatible with our existing sample handler for automated demagnetization and measurement (Morris et al., 2009). It's much higher peak field has enabled us to completely demagnetize many of the samples that previously we could not with commercial equipment. This capability is especially needed for high-coercivity sedimentary and igneous rocks that contain magnetic minerals that alter during thermal demagnetization. It will also enable detailed automated demagnetization of high coercivity phases in extraterrestrial samples, such as native iron, iron-alloy and sulfide minerals that are common in lunar rocks and meteorites. Furthermore, it has opened the door for us to use the rock-magnetic technique of component analysis, using coercivity distributions derived from very detailed AF demagnetization of NRM and remanence produced in the laboratory to characterize the magnetic mineralogy of sedimentary rocks. In addition to the many benefits this instrument has brought to our own research, a much broader potential impact is to replace the transverse coils in automated AF demagnetization systems, which typically are limited to peak fields around 0.1 T.

  4. Analytic solution of field distribution and demagnetization function of ideal hollow cylindrical field source

    Science.gov (United States)

    Xu, Xiaonong; Lu, Dingwei; Xu, Xibin; Yu, Yang; Gu, Min

    2017-09-01

    The Halbach type hollow cylindrical permanent magnet array (HCPMA) is a volume compact and energy conserved field source, which have attracted intense interests in many practical applications. Here, using the complex variable integration method based on the Biot-Savart Law (including current distributions inside the body and on the surfaces of magnet), we derive analytical field solutions to an ideal multipole HCPMA in entire space including the interior of magnet. The analytic field expression inside the array material is used to construct an analytic demagnetization function, with which we can explain the origin of demagnetization phenomena in HCPMA by taking into account an ideal magnetic hysteresis loop with finite coercivity. These analytical field expressions and demagnetization functions provide deeper insight into the nature of such permanent magnet array systems and offer guidance in designing optimized array system.

  5. Influence of demagnetizing field on the permeability of soft magnetic composites

    International Nuclear Information System (INIS)

    Lin, G.Q.; Li, Z.W.; Chen, Linfeng; Wu, Y.P.; Ong, C.K.

    2006-01-01

    The influence of demagnetizing field on the effective permeability of magnetic composites has been investigated. A theoretical expression of the effective permeability has been obtained and discussed according to four typical composites with spheres, needles, flakes, and aligned prolate ellipsoidal particles. The results indicate that the demagnetizing field within the particles can reduce the effective permeability significantly. In order to increase the effective permeability, it is necessary to decrease the demagnetizing field within the particles. A linear relationship between effective permeability and volume fraction is also observed for composites filled with spherical particles at low volume fraction

  6. Role of internal demagnetizing field for the dynamics of a surface-modulated magnonic crystal

    Science.gov (United States)

    Langer, M.; Röder, F.; Gallardo, R. A.; Schneider, T.; Stienen, S.; Gatel, C.; Hübner, R.; Bischoff, L.; Lenz, K.; Lindner, J.; Landeros, P.; Fassbender, J.

    2017-05-01

    This work aims to demonstrate and understand the key role of local demagnetizing fields in hybrid structures consisting of a continuous thin film with a stripe modulation on top. To understand the complex spin dynamics of these structures, the magnonic crystal was reconstructed in two different ways—performing micromagnetic simulations based on the structural shape as well as based on the internal demagnetizing field, which both are mapped on the nanoscale using electron holography. The simulations yield the frequency-field dependence as well as the angular dependence revealing the governing role of the internal field landscape around the backward-volume geometry. Simple rules for the propagation vector and the mode localization are formulated in order to explain the calculated mode profiles. Treating internal demagnetizing fields equivalent to anisotropies, the complex angle-dependent spin-wave behavior is described for an in-plane rotation of the external field.

  7. On the computation of the demagnetization tensor field for an arbitrary particle shape using a Fourier space approach

    International Nuclear Information System (INIS)

    Beleggia, M.; Graef, M. de

    2003-01-01

    A method is presented to compute the demagnetization tensor field for uniformly magnetized particles of arbitrary shape. By means of a Fourier space approach it is possible to compute analytically the Fourier representation of the demagnetization tensor field for a given shape. Then, specifying the direction of the uniform magnetization, the demagnetizing field and the magnetostatic energy associated with the particle can be evaluated. In some particular cases, the real space representation is computable analytically. In general, a numerical inverse fast Fourier transform is required to perform the inversion. As an example, the demagnetization tensor field for the tetrahedron will be given

  8. Scanning SQUID microscope with an in-situ magnetization/demagnetization field for geological samples

    Science.gov (United States)

    Du, Junwei; Liu, Xiaohong; Qin, Huafeng; Wei, Zhao; Kong, Xiangyang; Liu, Qingsong; Song, Tao

    2018-04-01

    Magnetic properties of rocks are crucial for paleo-, rock-, environmental-magnetism, and magnetic material sciences. Conventional rock magnetometers deal with bulk properties of samples, whereas scanning microscope can map the distribution of remanent magnetization. In this study, a new scanning microscope based on a low-temperature DC superconducting quantum interference device (SQUID) equipped with an in-situ magnetization/demagnetization device was developed. To realize the combination of sensitive instrument as SQUID with high magnetizing/demagnetizing fields, the pick-up coil, the magnetization/demagnetization coils and the measurement mode of the system were optimized. The new microscope has a field sensitivity of 250 pT/√Hz at a coil-to-sample spacing of ∼350 μm, and high magnetization (0-1 T)/ demagnetization (0-300 mT, 400 Hz) functions. With this microscope, isothermal remanent magnetization (IRM) acquisition and the according alternating field (AF) demagnetization curves can be obtained for each point without transferring samples between different procedures, which could result in position deviation, waste of time, and other interferences. The newly-designed SQUID microscope, thus, can be used to investigate the rock magnetic properties of samples at a micro-area scale, and has a great potential to be an efficient tool in paleomagnetism, rock magnetism, and magnetic material studies.

  9. Analytical and computational study of magnetization switching in kinetic Ising systems with demagnetizing fields

    DEFF Research Database (Denmark)

    Richards, H.L.; Rikvold, P.A.

    1996-01-01

    particularly promising as materials for high-density magnetic recording media. In this paper we use analytic arguments and Monte Carlo simulations to quantitatively study the effects of the demagnetizing field on the dynamics of magnetization switching in two-dimensional, single-domain, kinetic Ising systems....... For systems in the weak-field ''stochastic region,'' where magnetization switching is on average effected by the nucleation and growth of a single droplet, the simulation results can be explained by a simple model in which the free energy is a function only of magnetization. In the intermediate......-field ''multidroplet region,'' a generalization of Avrami's law involving a magnetization-dependent effective magnetic field gives good agreement with the simulations. The effects of the demagnetizing field do not qualitatively change the droplet-theoretical picture of magnetization switching in highly anisotropic...

  10. Electron spin resonance study of the demagnetization fields of the ferromagnetic and paramagnetic films

    Directory of Open Access Journals (Sweden)

    I.I. Gimazov, Yu.I. Talanov

    2015-12-01

    Full Text Available The results of the electron spin resonance study of the La1-xCaxMnO3 manganite and the diphenyl-picrylhydrazyl thin films for the magnetic field parallel and perpendicular to plane of the films are presented. The temperature dependence of the demagnetizing field is obtained. The parameters of the Curie-Weiss law are estimated for the paramagnetic thin film.

  11. Demagnetization in photomagnetic films

    Energy Technology Data Exchange (ETDEWEB)

    Pajerowski, Daniel M., E-mail: daniel@pajerowski.com [NIST Center for Neutron Research, Gaithersburg, Maryland 20899 (United States); Hallock, Scott J. [NIST Center for Neutron Research, Gaithersburg, Maryland 20899 (United States); Winston Churchill High School, Potomac, Maryland 20854 (United States)

    2012-05-15

    We present a model for demagnetization in photomagnetic films, and investigate different regimes for the magnetizing process using finite element analysis. It is found that the demagnetizing factor may depend strongly upon the high-spin fraction of the film, and the specifics of the dependence are dictated by the microscopic morphology of the photomagnetic domains. This picture allows for facile interpretation of existing data on photomagnetic films, and can even explain an observed photoinduced decrease in low-field magnetization concurrent with increase in high-spin fraction. As a whole, these results reiterate the need to consider demagnetizing effects in photomagnetic films. - Highlights: Black-Right-Pointing-Pointer Finite element methods are used to examine demagnetization in photomagnetic films. Black-Right-Pointing-Pointer Under the right conditions, photomagnetic films may show a photoinduced decrease. Black-Right-Pointing-Pointer Demagnetization in photomagnets will be important to consider in possible devices.

  12. Tsunakawa-Shaw method - an absolute paleointensity technique using alternating field demagnetization

    Science.gov (United States)

    Yamamoto, Y.; Mochizuki, N.; Shibuya, H.; Tsunakawa, H.

    2015-12-01

    Among geologic materials volcanic rocks have been typically used to deduce an absolute paleointensity. In the last decade, however, there seems a becoming consensus that volcanic rocks are not so ideal materials due to such as magnetic grains other than non-interacting single domain particles. One approach to obtain a good paleointensity estimate from the rocks is to reduce and correct the non-ideality, suppress alterations in laboratory and screen out suspicious results. We have been working on a development and an application of the Tsunakawa-Shaw method, which has been previously called the LTD-DHT Shaw method. This method is an AF(alternating field)-based technique and thus a paleointensity is estimated using coercivity spectra. To reduce the non-ideality, all remanences undergo low-temperature demagnetization (LTD) before any AF demagnetizations to remove multi-domain like component. To correct the non-ideality, anhysteretic remanent magnetizations (ARMs) are imparted with their directions parallel to natural remanent magnetizations and laboratory-imparted thermoremanent magnetizations (TRMs) and measured before and after laboratory heating. These ARMs are used to correct remanence anisotropies, possible interaction effects originated from the non-ideal grains and TRM changes caused by laboratory alterations. TRMs are imparted by heating specimens above their Curie temperatures and then cooling to room temperature at once to simulate nature conditions. These cycles are done in vacuum to suppress alterations in laboratory. Obtained results are judged by selection criteria, including a check for validity of the ARM corrections.It has been demonstrated that successful paleointensities are obtained from historical lavas in Japan and Hawaii, and from baked clay samples from a reconstructed ancient kiln, with the flow-mean precision of 5-10%. In case of old volcanic rocks, however, the method does not necessarily seem to be perfect. We will summarize these points in

  13. Reversal mechanisms and interactions in magnetic systems: coercivity versus switching field and thermally assisted demagnetization

    Directory of Open Access Journals (Sweden)

    Cebollada, F.

    2005-06-01

    Full Text Available In this paper we present a comparative analysis of the magnetic interactions and reversal mechanisms of two different systems: NdFeB-type alloys with grain sizes in the single domain range and Fe-SiO2 nanocomposites with Fe concentrations above and below the percolation threshold. We evidence that the use of the coercivity as the main parameter to analyse them might be misleading due to the convolution of both reversible and irreversible magnetization variations. We show that the switching field and thermally assisted demagnetization allow a better understanding of these mechanisms since they involve just irreversible magnetization changes. Specifically, the experimental analysis of the coercivity adquisition process for the NdFeB-type system suggests that the magnetization reversal is nucleated at the spin misalignments present due to intergranular exchange interactions. On the other hand, the study of the magnetic viscosity and of the isothermal remanent magnetization (IRM and direct field demagnetization (DCD remanence curves indicates that the dipolar interactions are responsible for the propagation of the switching started at individual particles.

    En este artículo presentamos un análisis comparativo de la influencia de la microestructura a través de las interacciones magnéticas en los mecanismos de inversión de la magnetización en dos sistemas diferentes: aleaciones tipo NdFeB con tamaños de grano en el rango de monodominio y nanocompuestos de Fe-SiO2 con concentraciones de Fe tanto por encima como por debajo del umbral de percolación. Ponemos de manifiesto que el uso del campo coercitivo como parámetro de análisis puede llevar a equívocos debido a la coexistencia de variaciones reversibles e irreversibles de la magnetización. También mostramos que el campo de conmutación y la desimanación térmicamente asistida permiten una mejor comprensión de dichos mecanismos ya que reflejan exclusivamente cambios irreversibles de

  14. Delayed demagnetization jumps in (NdDy)(FeCo)B magnets in a steady-state magnetic field

    Science.gov (United States)

    L'vova, G. L.; Kirman, M. V.; Koplak, O. V.; Kucheryaev, V. V.; Valeev, R. A.; Piskorskii, V. P.; Morgunov, R. B.

    2017-11-01

    Spontaneous demagnetization jumps are observed in sintered magnets (Nd0.6Dy0.4)16(Fe0.77Co0.23)78B6 in a constant magnetic field after a sharp decrease in an external magnetic field from the value corresponding to the saturation to a value close to the coercive force. It is shown that the number of the magnetization jumps is proportional to their amplitudes. A low value of the autocorrelation coefficient between the jump amplitude and the time of its appearance ( R white magnetic noise is observed. The distribution of the magnetic field gradient has been obtained near the sample surface that makes it possible to distinguish domains and the grain magnetization in the dependence on the direction of the texturing of the sintered magnet.

  15. Highly parallel demagnetization field calculation using the fast multipole method on tetrahedral meshes with continuous sources

    Science.gov (United States)

    Palmesi, P.; Exl, L.; Bruckner, F.; Abert, C.; Suess, D.

    2017-11-01

    The long-range magnetic field is the most time-consuming part in micromagnetic simulations. Computational improvements can relieve problems related to this bottleneck. This work presents an efficient implementation of the Fast Multipole Method [FMM] for the magnetic scalar potential as used in micromagnetics. The novelty lies in extending FMM to linearly magnetized tetrahedral sources making it interesting also for other areas of computational physics. We treat the near field directly and in use (exact) numerical integration on the multipole expansion in the far field. This approach tackles important issues like the vectorial and continuous nature of the magnetic field. By using FMM the calculations scale linearly in time and memory.

  16. Computation of demagnetizing fields and particle distribution in magnetic fluid with inhomogeneous density

    International Nuclear Information System (INIS)

    Pshenichnikov, A.F.

    2012-01-01

    A new algorithm for calculating magnetic fields in a concentrated magnetic fluid with inhomogeneous density is proposed. Inhomogeneity of the fluid is caused by magnetophoresis. In this case, the diffusion and magnetostatic parts of the problem are tightly linked together and are solved jointly. The dynamic diffusion equation is solved by the finite volume method and, to calculate the magnetic field inside the fluid, an iterative process is performed in parallel. The solution to the problem is sought in Cartesian coordinates, and the computational domain is decomposed into rectangular elements. This technique eliminates the need to solve the related boundary-value problem for magnetic fields, accelerates computations and eliminates the error caused by the finite sizes of the outer region. Formulas describing the contribution of the rectangular element to the field intensity in the case of a plane problem are given. Magnetic and concentration fields inside the magnetic fluid filling a rectangular cavity generated under the action of the uniform external filed are calculated. - Highlights: ▶ New algorithm for calculating magnetic field intense magnetic fluid with account of magnetophoresis and diffusion of particles. ▶ We do not need to solve boundary-value problem, but we accelerate computations and eliminate some errors. ▶ We solve nonlinear flow equation by the finite volume method and calculate magnetic and focus fields in the fluid for plane case.

  17. Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

    Directory of Open Access Journals (Sweden)

    Jaiok Roh

    2011-01-01

    Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

  18. Adiabatic Demagnetization Refrigerator Field Mapping and Shielding Models for a 70 mK Superconducting Transition Edge Sensor Array and Associated Electronics

    Science.gov (United States)

    Ladner, D. R.; Martinez-Galarce, D. S.; McCammon, D.

    2006-04-01

    An X-ray detection instrument to be flown on a sounding rocket experiment (the Advanced Technology Solar Spectroscopic Imager - ATSSI) for solar physics observations is being developed by the Lockheed Martin Solar and Astrophysics Laboratory (LMSAL). The detector is a novel class of microcalorimeter, a superconducting Transition-Edge Sensor (TES), that coupled with associated SQUID and feedback electronics requires high temperature stability at ~70 mK to resolve the energy of absorbed X-ray photons emitted from the solar corona. The cooling system incorporates an existing Adiabatic Demagnetization Refrigerator (ADR) developed at the University of Wisconsin (UW), which was previously flown to study the diffuse cosmic X-ray background. The Si thermistor detectors for that project required 130 K shielded JFET electronic components that are much less sensitive to the external field of the ADR solenoid than are the 1st (~70 mK) and 2nd (~2 K) SQUID stages used with TESs for solar observations. Modification of the Wisconsin ADR design, including TES focal plane and electronics re-positioning, therefore requires a tradeoff between the existing ADR solenoid nulling coil geometry and a low mass passive solenoid shield, while preserving the vibration isolation features of the existing design. We have developed models to accurately compute the magnetic field with and without shielding or nulling coils at critical locations to guide the re-design of the detector subsystem. The models and their application are described.

  19. Research on Strategies and Methods Suppressing Permanent Magnet Demagnetization in Permanent Magnet Synchronous Motors Based on a Multi-Physical Field and Rotor Multi-Topology Structure

    Directory of Open Access Journals (Sweden)

    Lin Li

    2017-12-01

    Full Text Available In this paper, a permanent magnet synchronous motor (PMSM with sleeves on the rotor outer surface is investigated. The purpose of sleeves is to fix the permanent magnets and protect them from being destroyed by the large centrifugal force. However, the sleeve material characteristics have a great influence on the PMSM, and therewith, most of the rotor eddy-current losses are generated in the rotor sleeve, which could increase the device temperature and even cause thermal demagnetization of the magnets. Thus, a sleeve scheme design with low eddy-current losses is necessary, and a method suppressing the local temperature peak of permanent magnets is presented. The 3-D electromagnetic finite element model of a 12.5 kW, 2000 r/min PMSM with a segmented sleeve is established, and the electromagnetic field is calculated by using the finite element method. The results show the effectiveness of the presented method in reducing the eddy current losses in the rotor. Using the thermal method, it can be found that the maximum temperature position and zone of permanent magnet will change. Thus, some strategies are comparatively analyzed in order to obtain the change rule of the position and zone. The obtained conclusions may provide a useful reference for the design and research of PMSMs.

  20. The demagnetizing factors for the rectangular samples

    International Nuclear Information System (INIS)

    Akishin, P.G.; Gaganov, I.A.

    1990-01-01

    The influence of the demagnetization effect on the distribution of internal magnetic fields for finite samples is considered. The boundary integral method is used to compute the space distribution of the magnetic field in rectangular samples. On the basis of these calculations we compute the distribution of demagnetization factors in the sample for μSR experimental set-up with the real field geometry. The corresponding mathematical expectation and dispersion of this distribution are estimated. The results of the calculation are used in the analysis of the μSR data obtained for high T c superconductors. It is shown for these compounds that the correction to the penetration depth related to the broadening of the field distribution, is not more than 5%. 8 refs.; 2 figs.; 1 tab

  1. Theory of laser-induced demagnetization at high temperatures

    KAUST Repository

    Manchon, Aurelien

    2012-02-17

    Laser-induced demagnetization is theoretically studied by explicitly taking into account interactions among electrons, spins, and lattice. Assuming that the demagnetization processes take place during the thermalization of the subsystems, the temperature dynamics is given by the energy transfer between the thermalized interacting baths. These energy transfers are accounted for explicitly through electron-magnon and electron-phonon interactions, which govern the demagnetization time scale. By properly treating the spin system in a self-consistent random phase approximation, we derive magnetization dynamic equations for a broad range of temperature. The dependence of demagnetization on the temperature and pumping laser intensity is calculated in detail. In particular, we show several salient features for understanding magnetization dynamics near the Curie temperature. While the critical slowdown in dynamics occurs, we find that an external magnetic field can restore the fast dynamics. We discuss the implication of the fast dynamics in the application of heat-assisted magnetic recording.

  2. Theory of laser-induced demagnetization at high temperatures

    KAUST Repository

    Manchon, Aurelien; Li, Q.; Xu, L.; Zhang, S.

    2012-01-01

    Laser-induced demagnetization is theoretically studied by explicitly taking into account interactions among electrons, spins, and lattice. Assuming that the demagnetization processes take place during the thermalization of the subsystems, the temperature dynamics is given by the energy transfer between the thermalized interacting baths. These energy transfers are accounted for explicitly through electron-magnon and electron-phonon interactions, which govern the demagnetization time scale. By properly treating the spin system in a self-consistent random phase approximation, we derive magnetization dynamic equations for a broad range of temperature. The dependence of demagnetization on the temperature and pumping laser intensity is calculated in detail. In particular, we show several salient features for understanding magnetization dynamics near the Curie temperature. While the critical slowdown in dynamics occurs, we find that an external magnetic field can restore the fast dynamics. We discuss the implication of the fast dynamics in the application of heat-assisted magnetic recording.

  3. The effect of demagnetization on the magnetocaloric properties of gadolinium

    DEFF Research Database (Denmark)

    Bahl, Christian Robert Haffenden; Nielsen, Kaspar Kirstein

    2009-01-01

    of gadolinium. The adiabatic temperature change DeltaTad of gadolinium sheets upon application of a magnetic field has been measured at a range of applied magnetic fields and sample orientations. A significant dependence of DeltaTad on the sample orientation is observed. This can be accounted...... for by the demagnetization factor. Also, the temperature dependence of DeltaTad has been measured experimentally and modeled by mean field theory. Corrections to mean field theory modeling due to the demagnetization field are proposed and discussed. ©2009 American Institute of Physics...

  4. Ion Demagnetization in the Magnetopause Current Layer Observed by MMS

    Science.gov (United States)

    Wang, Shan; Chen, Li-Jen; Hesse, Michael; Gershman, Daniel J.; Dorelli, John; Giles, Barbara; Torbert, Roy B.; Pollock, Craig J.; Lavraud, Benoit; Strangeway, Robert; hide

    2016-01-01

    We report ion velocity distribution functions (VDfs) observed by Magnetospheric Multiscale Mission (MMS) and present evidence for demagnetized ion Speiser motion during magnetopause reconnection. The demagnetization is observed in the vicinity of the X llne, as well as near the current sheet midlplane about tens of ion skin depths (d(sub 1)) away from the X line. Close to the X line before the outflow is built up, the VDFs are elongated, and the elongated part of VDFs rotates from the out-of-plane current direction toward the outflow directions downstream from the X line. Farther downstream, demagnetized ions exhibit a characteristic half-ring structure in the VDFs, as a result of the mixture of ions that have experienced different amounts of cyclotron turning around the magnetic field normal to the current sheet. Signatures of acceleration by electric fields are more pronounced in the VDFs near the X line than downstream.

  5. PIPER Continuous Adiabatic Demagnetization Refrigerator

    Science.gov (United States)

    Kimball, Mark O.; Shirron, Peter J.; Canavan, Edgar R.; James, Bryan L.; Sampson, Michael A.; Letmate, Richard V.

    2017-01-01

    We report upon the development and testing of a 4-stage adiabatic demagnetization refrigerator (ADR) capable of continuous cooling at 0.100 Kelvin. This cooler is being built to cool the detector array aboard NASA's Primordial Inflation Polarization Explorer (PIPER) observatory. The goal of this balloon mission is to measure the primordial gravitational waves that should exist if the theory of cosmological inflation is correct. At altitude, the ADR will hold the array of transition-edge sensors at 100 mK continuously while periodically rejecting heat to a 1.2 K pumped helium bath. During testing on ground, the array is held at the same temperature but heat is rejected to a 4.2 K helium bath indicating the flexibility in this coolers design.

  6. Thermal Demagnetization of Mare Basalts 10017 and 10020

    Science.gov (United States)

    Suavet, C. R.; Weiss, B. P.; Grove, T. L.

    2012-12-01

    Paleomagnetic studies of lunar rocks 76535 (Garrick-Bethell et al., 2009), 10020 (Shea et al., 2012) and 10017 (Suavet et al., 2012) have shown that the Moon had an active dynamo field at 4.2 Ga, 3.7 Ga, and 3.6 Ga, respectively. These studies were carried out using alternating field (AF) demagnetization, which has the advantage to avoid sample alteration by heating, but the paleointensity is only constrained within a factor of 3-5 due to uncertainties on the calibration factor between thermoremanent magnetization (TRM) and anhysteretic remanent magnetization (ARM). Thermal demagnetization is expected to give better estimates of the paleofields. Thellier-Thellier paleointensity experiments on 10017 under reducing atmosphere (Sugiura et al., 1978) and in vacuum (Hoffman et al., 1979) were attempted in the past. Almost full demagnetization was observed after heating from 200 to 300°C, which was interpreted as alteration of magnetic carriers, or interaction effects between troilite and kamacite (Pearce et al., 1976). For both experiments, the oxygen fugacity was poorly constrained due to methodological flaws: no oxygen was introduced in the system and further reduction of the rocks could not be mitigated. We designed a controlled atmosphere apparatus to conduct thermal demagnetization in a mixture of H2 and CO2. Gas mixtures were calibrated by exploring the stability of iron, magnetite, and wustite at temperatures in the range of 300-800°C. We thermally demagnetized the natural remanent magnetization (NRM) of subsamples of 10017 and 10020 in a gas mixture with an oxygen fugacity ~1 log unit below the iron-wustite buffer (Sato et al., 1973). After heating from 200 to 250°C, the magnetization was reduced to 10% of the NRM for 10017, and 20% of the NRM for 10020, and the magnetization directions became unstable. A subsample of 10020 was given a 0.1 mT ARM, and thermally demagnetized up to 250°C: the magnetization was reduced to 38% of the ARM and the direction became

  7. A review of radiation-induced demagnetization of permanent magnets

    Science.gov (United States)

    Samin, Adib J.

    2018-05-01

    Radiation-induced demagnetization of permanent magnets is important for a number of applications including space missions, particle accelerators and robots designed to carry out rescue missions at nuclear accidents where magnet failure can lead to serious consequences. This topic has been studied by several investigators over the past three decades and in this work, a review of the available literature is conducted and some general conclusions and trends are presented. In short, it can be gleaned that magnetism loss is dependent on the type of radiation, the energy of the incoming particle and the overall dose or fluence. Furthermore, magnetism loss also shows a dependence on the type of the irradiated magnet, the coercivity of the magnet, the demagnetizing field and the temperature of irradiation.

  8. Investigation of Demagnetization Effect in an Interior V-Shaped Magnet Synchronous Motor at Dynamic and Static Conditions

    Directory of Open Access Journals (Sweden)

    F. Mahmouditabar

    2018-03-01

    Full Text Available Permanent magnet motors have been considered for a variety of applications due to their features such as high power density and high efficiency. One of the issues that should be investigated in the design of these motors is the demagnetization problem. Usually, the demagnetization analysis is carried out in a steady state, while demagnetization effect in dynamic condition is more considerable due to pulse shaped of armature field. Based on this fact, in this paper, dynamic demagnetization is investigated for an IPM V‑shaped magnet. This study has been done for two types of magnet, each one in static & dynamic conditions and the results are compared. Moreover, the effect of flux weakening regime on demagnetization is investigated.

  9. Computing the demagnetizing tensor for finite difference micromagnetic simulations via numerical integration

    International Nuclear Information System (INIS)

    Chernyshenko, Dmitri; Fangohr, Hans

    2015-01-01

    In the finite difference method which is commonly used in computational micromagnetics, the demagnetizing field is usually computed as a convolution of the magnetization vector field with the demagnetizing tensor that describes the magnetostatic field of a cuboidal cell with constant magnetization. An analytical expression for the demagnetizing tensor is available, however at distances far from the cuboidal cell, the numerical evaluation of the analytical expression can be very inaccurate. Due to this large-distance inaccuracy numerical packages such as OOMMF compute the demagnetizing tensor using the explicit formula at distances close to the originating cell, but at distances far from the originating cell a formula based on an asymptotic expansion has to be used. In this work, we describe a method to calculate the demagnetizing field by numerical evaluation of the multidimensional integral in the demagnetizing tensor terms using a sparse grid integration scheme. This method improves the accuracy of computation at intermediate distances from the origin. We compute and report the accuracy of (i) the numerical evaluation of the exact tensor expression which is best for short distances, (ii) the asymptotic expansion best suited for large distances, and (iii) the new method based on numerical integration, which is superior to methods (i) and (ii) for intermediate distances. For all three methods, we show the measurements of accuracy and execution time as a function of distance, for calculations using single precision (4-byte) and double precision (8-byte) floating point arithmetic. We make recommendations for the choice of scheme order and integrating coefficients for the numerical integration method (iii). - Highlights: • We study the accuracy of demagnetization in finite difference micromagnetics. • We introduce a new sparse integration method to compute the tensor more accurately. • Newell, sparse integration and asymptotic method are compared for all ranges

  10. On the computation of the demagnetization tensor for uniformly magnetized particles of arbitrary shape. Part I: Analytical approach

    International Nuclear Information System (INIS)

    Tandon, S.; Beleggia, M.; Zhu, Y.; De Graef, M.

    2004-01-01

    A Fourier space formalism based on the shape amplitude of a particle is used to compute the demagnetization tensor field for uniformly magnetized particles of arbitrary shape. We provide a list of explicit shape amplitudes for important particle shapes, among others: the sphere, the cylindrical tube, an arbitrary polyhedral shape, a truncated paraboloid, and a cone truncated by a spherical cap. In Part I of this two-part paper, an analytical representation of the demagnetization tensor field for particles with cylindrical symmetry is provided, as well as expressions for the magnetostatic energy and the volumetric demagnetization factors

  11. Study of the weekly irrigation cycle of a cultivated field in a semi-arid area (Marrakech region, Morocco) by using CR-39 and LR-115 II track detectors and radon as a natural tracer

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Essaouif, Z.

    2007-01-01

    Uranium ( 238 U) and thorium ( 232 Th) concentrations were measured in the soil of a cultivated field situated in a semi-arid area (Marrakech, Morocco) by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The same track detectors were used for measuring alpha- and beta-activities due to radon and thoron gases emanating from the soil of the studied irrigated agricultural field. The influence of the humidity (soil water content), soil depth and climate conditions on the weekly irrigation cycle of the studied cultivated field was investigated by exploiting radon measurements

  12. Study on optimal design of 210kW traction IPMSM considering thermal demagnetization characteristics

    Science.gov (United States)

    Kim, Young Hyun; Lee, Seong Soo; Cheon, Byung Chul; Lee, Jung Ho

    2018-04-01

    This study analyses the permanent magnet (PM) used in the rotor of an interior permanent magnet synchronous motor (IPMSM) used for driving an electric railway vehicle (ERV) in the context of controllable shape, temperature, and external magnetic field. The positioning of the inserted magnets is a degree of freedom in the design of such machines. This paper describes a preliminary analysis using parametric finite-element method performed with the aim of achieving an effective design. Next, features of the experimental design, based on methods such as the central-composition method, Box-Behnken and Taguchi method, are explored to optimise the shape of the high power density. The results are used to produce an optimal design for IPMSMs, with design errors minimized using Maxwell 2D, a commercial program. Furthermore, the demagnetization process is analysed based on the magnetization and demagnetization theory for PM materials in computer simulation. The result of the analysis can be used to calculate the magnetization and demagnetization phenomenon according to the input B-H curve. This paper presents the conditions for demagnetization by the external magnetic field in the driving and stopped states, and proposes a simulation method that can analyse demagnetization phenomena according to each condition and design the IPMSM that maximizes efficiency and torque characteristics. Finally, operational characteristics are analysed in terms of the operation patterns of railway vehicles, and control conditions are deduced to achieve maximum efficiency in all sections. This was experimentally verified.

  13. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  14. Demagnetization diagnosis in permanent magnet synchronous motors under non-stationary speed conditions

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Jordi-Roger Riba [EUETII, Dept. d' Enginyeria Electrica, Universitat Politecnica de Catalunya, Placa del Rei 15, 08700 Igualada, Barcelona (Spain); Garcia Espinosa, Antonio [Dept. d' Enginyeria Electrica, Universitat Politecnica de Catalunya C/Colom 1, 08222 Terrassa (Spain); Romeral, Luis; Cusido, Jordi [Dept. d' Enginyeria Electronica, Universitat Politecnica de Catalunya C/Colom 1, 08222 Terrassa (Spain)

    2010-10-15

    Permanent magnet synchronous motors (PMSMs) are applied in high performance positioning and variable speed applications because of their enhanced features with respect to other AC motor types. Fault detection and diagnosis of electrical motors for critical applications is an active field of research. However, much research remains to be done in the field of PMSM demagnetization faults, especially when running under non-stationary conditions. This paper presents a time-frequency method specifically focused to detect and diagnose demagnetization faults in PMSMs running under non-stationary speed conditions, based on the Hilbert Huang transform. The effectiveness of the proposed method is proven by means of experimental results. (author)

  15. The influence of demagnetizing effects on the performance of active magnetic regenerators

    DEFF Research Database (Denmark)

    Nielsen, Kaspar Kirstein; Smith, Anders; Bahl, Christian

    2012-01-01

    Active magnetic regenerators (AMR) comprise an involved, multi-physics problem including heat transfer, fluid flow, magnetocaloric properties and demagnetizing fields. In this paper a method is developed that combines previously published models that simulate a parallel-plate AMR and the magnetos......Active magnetic regenerators (AMR) comprise an involved, multi-physics problem including heat transfer, fluid flow, magnetocaloric properties and demagnetizing fields. In this paper a method is developed that combines previously published models that simulate a parallel-plate AMR...... are varied and the results show that not only do demagnetizing effects have a significant impact on the AMR performance, but the magnitude of the effect is very sensitive to a range of parameters such as stack geometry (number of plates, dimensions of the plates and flow channels and overall dimensions...

  16. Investigation on demagnetization of Nd2Fe14B permanent magnets induced by irradiation

    Science.gov (United States)

    Li, Zhefu; Jia, Yanyan; Liu, Renduo; Xu, Yuhai; Wang, Guanghong; Xia, Xiaobin

    2017-12-01

    Nd2Fe14B is an important component of insertion devices, which are used in synchrotron radiation sources, and could be demagnetized by irradiation. In the present study, the Monte Carlo code FLUKA was used to analyze the irradiation field of Nd2Fe14B, and it was confirmed that the main demagnetization particle was neutron. Nd2Fe14B permanent magnet samples were irradiated by Ar ions at different doses to simulate neutron irradiation damage. The hysteresis loops were measured using a vibrating sample magnetometer, and the microstructure evolutions were characterized by transmission electron microscopy. Moreover, the relationship between them was discussed. The results indicate that the decrease in saturated magnetization is caused by the changes in microstructure. The evolution of single crystals into an amorphous structure is the reason for the demagnetization phenomenon of Nd2Fe14B permanent magnets when considering its microscopic structure.

  17. Low frequency terahertz-induced demagnetization in ferromagnetic nickel

    Energy Technology Data Exchange (ETDEWEB)

    Shalaby, Mostafa, E-mail: most.shalaby@gmail.com; Vicario, Carlo, E-mail: carlo.vicario@psi.ch [SwissFEL, Paul Scherrer Institute, 5232 Villigen PSI (Switzerland); Hauri, Christoph P., E-mail: christoph.hauri@psi.ch [SwissFEL, Paul Scherrer Institute, 5232 Villigen PSI (Switzerland); École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland)

    2016-05-02

    A laser stimulus at terahertz (THz) frequency is expected to offer superior control over magnetization dynamics compared to an optical pulse, where ultrafast demagnetization is mediated by heat deposition. As a THz field cycle occurs on a timescale similar to the natural speed of spin motions, this can open a path for triggering precessional magnetization motion and ultimately ultrafast magnetic switching by the THz magnetic field component, without quenching. Here, we explore the ultrafast magnetic response of a ferromagnetic nickel thin film excited by a strong (33 MV/cm) terahertz transient in non-resonant conditions. While the magnetic laser pulse component induces ultrafast magnetic precessions, we experimentally found that at high pump fluence, the THz pulse leads to large quenching which dominates the precessional motion by far. Furthermore, degradation of magnetic properties sets in and leads to permanent modifications of the Ni thin film and damage.

  18. Fluxmetric and magnetometric demagnetizing factors for cylinders

    International Nuclear Information System (INIS)

    Chen, D.-X.; Pardo, E.; Sanchez, A.

    2006-01-01

    Fluxmetric and magnetometric demagnetizing factors, N f and N m , for cylinders along the axial direction are numerically calculated as functions of material susceptibility χ and the ratio γ of length to diameter. The results have an accuracy better than 0.1% with respect to min(N f,m ,1-N f,m ) and are tabulated in the range of 0.01= m along the radial direction is evaluated with a lower accuracy from N m along the axis and tabulated in the range of 0.01=<γ=<1 and -1=<χ<∼. Some previous results are discussed and several applications are explained based on the new results

  19. Magnetoelastic Demagnetization of Steel under Cyclic Loading

    Science.gov (United States)

    Muratov, K. R.; Novikov, V. F.; Neradovskii, D. F.; Kazakov, R. Kh.

    2018-01-01

    Magnetoelastic demagnetization of steel samples under cyclic tensile loads has been analyzed. It has been established that values of residual magnetization that correspond to peak loads are characterized by the power-law dependence on the number of loading cycles. In some cases, in the region of high loads, the qualitative transition to exponential dependence has been observed. Coefficients of the power-law approximation of peak magnetization depend on the value of amplitude load and have specific characteristics in the vicinity of characteristic loads. The ratios of approximated slide load coefficients depending on the load are common for the three considered samples, and there is an outburst in the vicinity of the fatigue limit, which can be used as the basis for developing the rapid nondestructive method for determination of this limit.

  20. Demagnetization factor for a powder of randomly packed spherical particles

    DEFF Research Database (Denmark)

    Bjørk, Rasmus; Bahl, Christian R.H.

    2013-01-01

    The demagnetization factors for randomly packed spherical particle powders with different porosities, sample aspect ratios, and monodisperse, normal, and log-normal particle size distributions have been calculated using a numerical model. For a relative permeability of 2, comparable to room...... temperature Gd, the calculated demagnetization factor is close to the theoretical value. The normalized standard deviation of the magnetization in the powder was 6.0%-6.7%. The demagnetization factor decreased significantly, while the standard deviation of the magnetization increased, for increasing relative...

  1. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  2. Adiabatic demagnetization of the antiferromagnetic spin-1/2 Heisenberg hexagonal cluster

    International Nuclear Information System (INIS)

    Deb, Moumita; Ghosh, Asim Kumar

    2016-01-01

    Exact analytic expressions of eigenvalues of the antiferromagnetic spin-1/2 Heisenberg hexagon in the presence of uniform magnetic field have been obtained. Magnetization process, nature of isentrops and properties of magneto caloric effect in terms of adiabatic demagnetization have been investigated. Theoretical results have been used to study the magneto caloric effect of the spin-1/2 Heisenberg hexagonal compound Cu_3WO_6.

  3. Failure Diagnosis for Demagnetization in Interior Permanent Magnet Synchronous Motors

    Directory of Open Access Journals (Sweden)

    Takeo Ishikawa

    2017-01-01

    Full Text Available Since a high degree of reliability is necessary for permanent magnet synchronous motors, the detection of a precursor for the demagnetization of permanent magnets is very important. This paper investigates the diagnosis of very slight PM demagnetization. The permanent magnet volume is altered so as to mimic the effect of demagnetization. This paper investigates the influence of demagnetization by using several methods: the 3D finite element analysis (FEA of the motor, the measurement of high-frequency impedance, and the measurement and FEA of the stator voltage and current under vector control. We have obtained the following results. The back-EMF is proportional to permanent magnet volume, and there is no difference in the demagnetization in the radial direction and in the axial direction. Even harmonics and subharmonics of flux density at the teeth tip could be useful for diagnosis if a search coil is installed there. The relatively low frequency resistance at the d-axis position is useful for diagnosis. Under vector control, the stator voltage is useful except in an intermediate torque range, and the intermediate torque is expressed by a simple equation.

  4. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  5. Analytical modeling of demagnetizing effect in magnetoelectric ferrite/PZT/ferrite trilayers taking into account a mechanical coupling

    Science.gov (United States)

    Loyau, V.; Aubert, A.; LoBue, M.; Mazaleyrat, F.

    2017-03-01

    In this paper, we investigate the demagnetizing effect in ferrite/PZT/ferrite magnetoelectric (ME) trilayer composites consisting of commercial PZT discs bonded by epoxy layers to Ni-Co-Zn ferrite discs made by a reactive Spark Plasma Sintering (SPS) technique. ME voltage coefficients (transversal mode) were measured on ferrite/PZT/ferrite trilayer ME samples with different thicknesses or phase volume ratio in order to highlight the influence of the magnetic field penetration governed by these geometrical parameters. Experimental ME coefficients and voltages were compared to analytical calculations using a quasi-static model. Theoretical demagnetizing factors of two magnetic discs that interact together in parallel magnetic structures were derived from an analytical calculation based on a superposition method. These factors were introduced in ME voltage calculations which take account of the demagnetizing effect. To fit the experimental results, a mechanical coupling factor was also introduced in the theoretical formula. This reflects the differential strain that exists in the ferrite and PZT layers due to shear effects near the edge of the ME samples and within the bonding epoxy layers. From this study, an optimization in magnitude of the ME voltage is obtained. Lastly, an analytical calculation of demagnetizing effect was conducted for layered ME composites containing higher numbers of alternated layers (n ≥ 5). The advantage of such a structure is then discussed.

  6. Modeling demagnetization effects in permanent magnet synchronous machines

    NARCIS (Netherlands)

    Kral, C.; Sprangers, R.L.J.; Waarma, J.; Haumer, A.; Winter, O.; Lomonova, E.

    2010-01-01

    This paper presents a permanent magnet model which takes temperature dependencies and demagnetization effects into account. The proposed model is integrated into a magnetic fundamental wave machine model using the model- ing language Modelica. For different rotor types permanent magnet models are

  7. Measuring the effect of demagnetization in stacks of gadolinium plates using the magnetocaloric effect

    International Nuclear Information System (INIS)

    Lipso, K.W.; Nielsen, K.K.; Christensen, D.V.; Bahl, C.R.H.; Engelbrecht, K.; Theil Kuhn, L.; Smith, A.

    2011-01-01

    The effect of demagnetization in a stack of gadolinium plates is determined experimentally by using spatially resolved measurements of the adiabatic temperature change due to the magnetocaloric effect. The number of plates in the stack, the spacing between them and the position of the plate on which the temperature is measured are varied. The orientation of the magnetic field is also varied. The measurements are compared to a magnetostatic model previously described. The results show that the magnetocaloric effect, due to the change in the internal field, is sensitive to the stack configuration and the orientation of the applied field. This may have significant implications for the construction of a magnetic cooling device. - Highlights: → The magnetocaloric effect is used as an indirect measure of the internal magnetic field. → To our knowledge nobody has published experimental determination of demagnetizing field in stack configurations of plates of magnetic material. → We present good agreement between the experimental results and an established numerical model. → This serves to show that the model may be used further to predict, e.g., optimal configurations.

  8. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  9. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  10. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  11. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  12. Particle Demagnetization in Collisionless Magnetic Reconnection

    Science.gov (United States)

    Hesse, Michael

    2006-01-01

    The dissipation mechanism of magnetic reconnection remains a subject of intense scientific interest. On one hand, one set of recent studies have shown that particle inertia-based processes, which include thermal and bulk inertial effects, provide the reconnection electric field in the diffusion region. In this presentation, we present analytical theory results, as well as 2.5 and three-dimensional PIC simulations of guide field magnetic reconnection. We will show that diffusion region scale sizes in moderate and large guide field cases are determined by electron Larmor radii, and that analytical estimates of diffusion region dimensions need to include description of the heat flux tensor. The dominant electron dissipation process appears to be based on thermal electron inertia, expressed through nongyrotropic electron pressure tensors. We will argue that this process remains viable in three dimensions by means of a detailed comparison of high resolution particle-in-cell simulations.

  13. Temperature stability limits for an isothermal demagnetization refrigerator

    Science.gov (United States)

    Kittel, P.

    1984-01-01

    It is pointed out that magnetic refrigeration can provide additional cooling for infrared detectors on space missions, taking into account the Shuttle Infrared Telescope Facility (SIRTF) and the Large Deployable Reflector (LDR). From a temperature of 2 K provided by the primary cryogens, magnetic refrigerators could cool bolometers or pumped photoconductors to 0.1 K or below. Such a reduction in operating temperature would increase the sensitivity for bolometers, while the response at longer wavelengths for pumped photoconductors would be improved. Two types of magnetic refrigeration cycles have been proposed. One type uses a complete demagnetization. The present investigation is concerned with the second type, which uses a feedback-controlled isothermal demagnetization, taking into account the temperature stability limits. Attention is given to control system resolution, thermometer noise, reaction time, and thermal time constants.

  14. The role of demagnetizing factors in the occurrence of vortex avalanches in Nb thin films

    International Nuclear Information System (INIS)

    Colauto, F; Ortiz, W A; Patino, E J; Aprilli, M

    2009-01-01

    Under specific circumstances, magnetic flux penetrates into superconducting thin films as dendritic flux jumps. The phenomenon has a thermomagnetic origin, where flux motion generates heat that suppresses flux pining and facilitates further flux motion. We have studied the thickness influence on the flux stability for very thin Nb films, 20, 40, 60, and 80 nm, through dc-magnetometry. The thicker the film; the higher is the threshold field where instabilities first take place. Due to the demagnetizing factor in a perpendicular geometry, the effective magnetic field at the border of the film is largely amplified. For thin specimens, a linear dependence between the threshold field and the thickness is expected and has been actually observed. When normalized by the sample aspect ratio, the effective threshold magnetic field is nearly the same for all specimens studied.

  15. The role of demagnetizing factors in the occurrence of vortex avalanches in Nb thin films

    Energy Technology Data Exchange (ETDEWEB)

    Colauto, F; Ortiz, W A [Grupo de Supercondutividade e Magnetismo, Departamento de Fisica, Universidade Federal de Sao Carlos, C P 676, 13565-905, Sao Carlos, SP (Brazil); Patino, E J; Aprilli, M, E-mail: fcolauto@df.ufscar.b [Laboratoire de Physique des Solides, Universite Paris-Sud, C.N.R.S., 91405 Orsay cedex (France)

    2009-03-01

    Under specific circumstances, magnetic flux penetrates into superconducting thin films as dendritic flux jumps. The phenomenon has a thermomagnetic origin, where flux motion generates heat that suppresses flux pining and facilitates further flux motion. We have studied the thickness influence on the flux stability for very thin Nb films, 20, 40, 60, and 80 nm, through dc-magnetometry. The thicker the film; the higher is the threshold field where instabilities first take place. Due to the demagnetizing factor in a perpendicular geometry, the effective magnetic field at the border of the film is largely amplified. For thin specimens, a linear dependence between the threshold field and the thickness is expected and has been actually observed. When normalized by the sample aspect ratio, the effective threshold magnetic field is nearly the same for all specimens studied.

  16. The demagnetizing energies of a uniformly magnetized cylinder with an elliptic cross-section

    International Nuclear Information System (INIS)

    Goode, D.A.; Rowlands, G.

    2003-01-01

    Analytic expressions for the demagnetizing energies are obtained in the form of partial series, for long elliptic cylinders and for squat ones where the ellipticity of the cross-section is unrestrained. This leaves just a small range where the demagnetizing energies are not well defined. It is found that by replacing the elliptic cylinders with rectangular blocks, a good approximation to the demagnetizing energy may be made in this small range

  17. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  18. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  19. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  20. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  1. Properties of a two stage adiabatic demagnetization refrigerator

    International Nuclear Information System (INIS)

    Fukuda, H; Ueda, S; Arai, R; Numazawa, T; Li, J; Saito, A T; Nakagome, H

    2015-01-01

    Currently, many space missions using cryogenic temperatures are being planned. In particular, high resolution sensors such as Transition Edge Sensors need very low temperatures, below 100 mK. It is well known that the adiabatic demagnetization refrigerator (ADR) is one of most useful tools for producing ultra-low temperatures in space because it is gravity independent. We studied a continuous ADR system consisting of 4 stages and demonstrated it could provide continuous temperatures around 100 mK. However, there was some heat leakage from the power leads which resulted in reduced cooling power. Our efforts to upgrade our ADR system are presented. We show the effect of using the HTS power leads and discuss a cascaded Carnot cycle consisting of 2 ADR units. (paper)

  2. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  3. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  4. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  5. Detection of Partial Demagnetization Fault in PMSMs Operating under Nonstationary Conditions

    DEFF Research Database (Denmark)

    Wang, Chao; Delgado Prieto, Miguel; Romeral, Luis

    2016-01-01

    Demagnetization fault detection of in-service Permanent Magnet Synchronous Machines (PMSMs) is a challenging task because most PMSMs operate under nonstationary circumstances in industrial applications. A novel approach based on tracking characteristic orders of stator current using Vold-Kalman F......Demagnetization fault detection of in-service Permanent Magnet Synchronous Machines (PMSMs) is a challenging task because most PMSMs operate under nonstationary circumstances in industrial applications. A novel approach based on tracking characteristic orders of stator current using Vold......-Kalman Filter is proposed to detect the partial demagnetization fault in PMSMs running at nonstationary conditions. Amplitude of envelope of the fault characteristic orders is used as fault indictor. Experimental results verify the superiority of the proposed method on partial demagnetization online fault...... detection of PMSMs under various speed and load conditions....

  6. Salt pill design and fabrication for adiabatic demagnetization refrigerators

    Science.gov (United States)

    Shirron, Peter J.; McCammon, Dan

    2014-07-01

    The performance of an adiabatic demagnetization refrigerator (ADR) is critically dependent on the design and construction of the salt pills that produce cooling. In most cases, the primary goal is to obtain the largest cooling capacity at the low temperature end of the operating range. The realizable cooling capacity depends on a number of factors, including refrigerant mass, and how efficiently it absorbs heat from the various instrument loads. The design and optimization of “salt pills” for ADR systems depend not only on the mechanical, chemical and thermal properties of the refrigerant, but also on the range of heat fluxes that the salt pill must accommodate. Despite the fairly wide variety of refrigerants available, those used at very low temperature tend to be hydrated salts that require a dedicated thermal bus and must be hermetically sealed, while those used at higher temperature - greater than about 0.5 K - tend to be single- or poly-crystals that have much simpler requirements for thermal and mechanical packaging. This paper presents a summary of strategies and techniques for designing, optimizing and fabricating salt pills for both low- and mid-temperature applications.

  7. Salt Pill Design and Fabrication for Adiabatic Demagnetization Refrigerators

    Science.gov (United States)

    Shirron, Peter J.; Mccammon, Dan

    2014-01-01

    The performance of an adiabatic demagnetization refrigerator (ADR) is critically dependent on the design and construction of the salt pills that produce cooling. In most cases, the primary goal is to obtain the largest cooling capacity at the low temperature end of the operating range. The realizable cooling capacity depends on a number of factors, including refrigerant mass, and how efficiently it absorbs heat from the various instrument loads. The design and optimization of "salt pills" for ADR systems depend not only on the mechanical, chemical and thermal properties of the refrigerant, but also on the range of heat fluxes that the salt pill must accommodate. Despite the fairly wide variety of refrigerants available, those used at very low temperature tend to be hydrated salts that require a dedicated thermal bus and must be hermetically sealed, while those used at higher temperature - greater than about 0.5 K - tend to be single-­- or poly-­-crystals that have much simpler requirements for thermal and mechanical packaging. This paper presents a summary of strategies and techniques for designing, optimizing and fabricating salt pills for both low-­- and mid-­-temperature applications.

  8. Baking effect for NdFeB magnets against demagnetization induced by high-energy electrons

    Energy Technology Data Exchange (ETDEWEB)

    Bizen, T. E-mail: bizen@spring8.or.jp; Asano, Y.; Hara, T.; Marechal, X.; Seike, T.; Tanaka, T.; Lee, H.S.; Kim, D.E.; Chung, C.W.; Kitamura, H

    2003-12-11

    The effect of thermal stabilization (pre-baking at 142 deg. C) on the sensitivity of neodymium-iron-boron (Nd{sub 2}Fe{sub 14}B) magnets to irradiation was studied. Thermally stabilized magnets showed higher resistance to irradiation with 2.0 GeV electrons: their demagnetization curves decrease linearly with respect to the number of electrons, and with a demagnetization rate remarkably smaller than that of the unbaked magnets.

  9. Measurement of NdFeB permanent magnets demagnetization induced by high energy electron radiation

    Energy Technology Data Exchange (ETDEWEB)

    Temnykh, Alexander B. [Wilson Lab, Cornell University, LEPP, Ithaca, NY 14850 (United States)], E-mail: abt6@cornell.edu

    2008-03-11

    Demagnetization of NdFeB permanent magnets has been measured as function of radiation dose induced by high energy electrons. The magnet samples were of different intrinsic coercive forces, {approx_equal}12 and {approx_equal}20KOe, dimensions and direction of magnetization. 5 GeV electron beam from 12 GeV Cornell Synchrotron was used as a radiation source. A calorimetric technique was employed for radiation dose measurement. Results indicated that depending on the sample intrinsic coercive force, shape and direction of magnetization the radiation dose causing 1% of demagnetization of the sample varies from 0.0765{+-}0.005Mrad to 11.3{+-}3.0Mrad, i.e., by more than a factor of 100. Experimental data analysis revealed that demagnetization of the given sample induced by radiation is strongly correlated with the sample demagnetizing temperature. This correlation was approximated by an exponential function with two parameters obtained from the data fitting. The function can be used to predict the critical radiation dose for permanent magnet assemblies like undulator magnets based on its demagnetizing temperature. The latter (demagnetization temperature) can be determined at the design stage from 3-D magnetic modeling and permanent magnet material properties.

  10. WWER safety investigations on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2001-01-01

    A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

  11. Impact of ultrafast demagnetization process on magnetization reversal in L10 FePt revealed using double laser pulse excitation

    Science.gov (United States)

    Shi, J. Y.; Tang, M.; Zhang, Z.; Ma, L.; Sun, L.; Zhou, C.; Hu, X. F.; Zheng, Z.; Shen, L. Q.; Zhou, S. M.; Wu, Y. Z.; Chen, L. Y.; Zhao, H. B.

    2018-02-01

    Ultrafast laser induced magnetization reversal in L10 FePt films with high perpendicular magnetic anisotropy was investigated using single- and double-pulse excitations. Single-pulse excitation beyond 10 mJ cm-2 caused magnetization (M) reversal at the applied fields much smaller than the static coercivity of the films. For double-pulse excitation, both coercivity reduction and reversal percentage showed a rapid and large decrease with the increasing time interval (Δt) of the two pulses in the range of 0-2 ps. In this Δt range, the maximum demagnetization (ΔMp) was also strongly attenuated, whereas the integrated demagnetization signals over more than 10 ps, corresponding to the average lattice heat effect, showed little change. These results indicate that laser induced M reversal in FePt films critically relies on ΔMp. Because ΔMp is determined by spin temperature, which is higher than lattice temperature, utilizing an ultrafast laser instead of a continuous-wave laser in laser-assisted M reversal may reduce the overall deposited energy and increase the speed of recording. The effective control of M reversal by slightly tuning the time delay of two laser pulses may also be useful for ultrafast spin manipulation.

  12. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  13. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  14. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  15. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  16. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Absolute Transition Rates in {sup 188}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V

    1969-09-15

    Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

  18. Analysis of thermal demagnetization behavior of Nd–Fe–B sintered magnets using magnetic domain observation

    International Nuclear Information System (INIS)

    Takezawa, Masaaki; Ikeda, Soichiro; Morimoto, Yuji; Kabashima, Hisayuki

    2016-01-01

    We used magnetic domain observation to statistically observe the thermal demagnetization behavior of Nd–Fe–B sintered magnets at elevated temperatures up to 150 °C. Simultaneous magnetization reversal in a hundred adjacent grains occurred at 90 °C because of the magnetic interaction among the grains beyond grain boundaries in the Dysprosium (Dy)-free low-coercivity magnet. Conversely, simultaneous magnetization reversal in a hundred grains did not occur in the Dy-added high-coercivity magnets, and the demagnetizing ratio steadily increased with temperature. Furthermore, the addition of Dy induced high thermal stability by eliminating the simultaneous thermal demagnetization, which was caused by the magnetic interaction among the grains.

  19. Analysis of thermal demagnetization behavior of Nd–Fe–B sintered magnets using magnetic domain observation

    Energy Technology Data Exchange (ETDEWEB)

    Takezawa, Masaaki, E-mail: take@ele.kyutech.ac.jp; Ikeda, Soichiro; Morimoto, Yuji [Department of Applied Science for Integrated System Engineering, Faculty of Engineering, Kyushu Institute of Technology, 1-1 Sensui-cho, Tobata-ku, Kitakyushu, Fukuoka 804-8550 (Japan); Kabashima, Hisayuki [Mazda Motor Corporation,3-1, Shinchi, Fuchu-cho, Aki-gun Hiroshima 730-8670 (Japan)

    2016-05-15

    We used magnetic domain observation to statistically observe the thermal demagnetization behavior of Nd–Fe–B sintered magnets at elevated temperatures up to 150 °C. Simultaneous magnetization reversal in a hundred adjacent grains occurred at 90 °C because of the magnetic interaction among the grains beyond grain boundaries in the Dysprosium (Dy)-free low-coercivity magnet. Conversely, simultaneous magnetization reversal in a hundred grains did not occur in the Dy-added high-coercivity magnets, and the demagnetizing ratio steadily increased with temperature. Furthermore, the addition of Dy induced high thermal stability by eliminating the simultaneous thermal demagnetization, which was caused by the magnetic interaction among the grains.

  20. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  1. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  2. Improvement of the superconducting transition and demagnetization factor in YBa2Cu3O7-δ single crystals by laser cutting

    International Nuclear Information System (INIS)

    Bhattacharya, A.; Grupp, D.E.; Goldman, A.M.; Welp, U.

    1996-01-01

    Single crystals of YBa 2 Cu 3 O 7-δ have been cut into disc shapes using an excimer laser. The bulk superconducting transition was found to be sharpened in all cases measured. This is associated with the removal of material at the edges which may be depleted of oxygen or otherwise damaged. The magneto-optical images for one crystal have been correlated with the optical image. The angular dependence of the demagnetizing factor for field applied in the plane was drastically reduced in disc-shaped crystals relative to rectangular ones. The field of first flux entry was also increased. copyright 1996 American Institute of Physics

  3. Phase-dependent deterministic switching of magnetoelectric spin wave detector in the presence of thermal noise via compensation of demagnetization

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, Sourav, E-mail: sdutta38@gatech.edu; Naeemi, Azad [School of Electrical and Computer Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); Nikonov, Dmitri E.; Manipatruni, Sasikanth; Young, Ian A. [Components Research, Intel Corporation, Hillsboro, Oregon 97124 (United States)

    2015-11-09

    The possibility of achieving phase-dependent deterministic switching of the magnetoelectric spin wave detector in the presence of thermal noise has been discussed. The proposed idea relies on the modification of the energy landscape by partially canceling the out-of-plane demagnetizing field and the resultant change in the intrinsic magnetization dynamics to drive the nanomagnet towards a preferential final magnetization state. The remarkable increase in the probability of successful switching can be accounted for by the shift in the location of the saddle point in the energy landscape and a resultant change in the nature of the relaxation dynamics of the magnetization from a highly precessional to a fairly damped one and an increased dependence on the initial magnetization values, a crucial requirement for phase-dependent spin wave detection.

  4. Demagnetization fault diagnosis in permanent magnet synchronous motors: A review of the state-of-the-art

    Energy Technology Data Exchange (ETDEWEB)

    Moosavi, S.S., E-mail: anchepoli@gmail.com [University of Technology Belfort Montbeliard (UTBM), Laboratory of IRTES-SET, Belfort (France); Engineering Department, Amol University of Special Modern Technology, Amol (Iran, Islamic Republic of); Djerdir, A. [University of Technology Belfort Montbeliard (UTBM), Laboratory of IRTES-SET, Belfort (France); Amirat, Y.Ait. [Laboratory of Femto-ST, University of Franche-Comte (France); Khaburi, D.A. [Center of Excellence for Power System Automation and Operation, Iran University of Science and Technology (IUST), Tehran (Iran, Islamic Republic of)

    2015-10-01

    There are a lot of research activities on developing techniques to detect permanent magnet (PM) demagnetization faults (DF). These faults decrease the performance, the reliability and the efficiency of permanent magnet synchronous motor (PMSM) drive systems. In this work, we draw a broad perspective on the status of these studies. The advantages, disadvantages of each method, a deeper view investigated and a comprehensive list of references are reported. - Highlights: • A review of state of the art on demagnetization fault diagnosis was studied deeply. • Critical points in fault diagnosis are discussed aiming to safety and cost management. • Critical comparison on all existent demagnetization diagnosis methods was done. • It is proved that DE and UL have the same signature frequencies as partial demagnetization. • MCSA have some limitations in frequency component under uniform demagnetization.

  5. Demagnetization fault diagnosis in permanent magnet synchronous motors: A review of the state-of-the-art

    International Nuclear Information System (INIS)

    Moosavi, S.S.; Djerdir, A.; Amirat, Y.Ait.; Khaburi, D.A.

    2015-01-01

    There are a lot of research activities on developing techniques to detect permanent magnet (PM) demagnetization faults (DF). These faults decrease the performance, the reliability and the efficiency of permanent magnet synchronous motor (PMSM) drive systems. In this work, we draw a broad perspective on the status of these studies. The advantages, disadvantages of each method, a deeper view investigated and a comprehensive list of references are reported. - Highlights: • A review of state of the art on demagnetization fault diagnosis was studied deeply. • Critical points in fault diagnosis are discussed aiming to safety and cost management. • Critical comparison on all existent demagnetization diagnosis methods was done. • It is proved that DE and UL have the same signature frequencies as partial demagnetization. • MCSA have some limitations in frequency component under uniform demagnetization

  6. Laser-induced ultrafast demagnetization time and spin moment in ferromagnets: First-principles calculation

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, G. P., E-mail: gpzhang@indstate.edu [Department of Physics, Indiana State University, Terre Haute, Indiana 47809 (United States); Si, M. S. [Key Laboratory for Magnetism and Magnetic Materials of the Ministry of Education, Lanzhou University, Lanzhou 730000 (China); George, Thomas F. [Office of the Chancellor and Center for Nanoscience, Departments of Chemistry and Biochemistry and Physics and Astronomy, University of Missouri-St. Louis, St. Louis, Missouri 63121 (United States)

    2015-05-07

    When a laser pulse excites a ferromagnet, its spin undergoes a dramatic change. The initial demagnetization process is very fast. Experimentally, it is found that the demagnetization time is related to the spin moment in the sample. In this study, we employ the first-principles method to directly simulate such a process. We use the fixed spin moment method to change the spin moment in ferromagnetic nickel, and then we employ the Liouville equation to couple the laser pulse to the system. We find that in general the dependence of demagnetization time on the spin moment is nonlinear: It decreases with the spin moment up to a point, after which an increase with the spin moment is observed, followed by a second decrease. To understand this, we employ an extended Heisenberg model, which includes both the exchange interaction and spin-orbit coupling. The model directly links the demagnetization rate to the spin moment itself and demonstrates analytically that the spin relaxes more slowly with a small spin moment. A future experimental test of our predictions is needed.

  7. Direct observation of the thermal demagnetization of magnetic vortex structures in nonideal magnetite recorders

    DEFF Research Database (Denmark)

    Almeida, Trevor P.; Muxworthy, Adrian R.; Kovács, András

    2016-01-01

    The thermal demagnetization of pseudo-single-domain (PSD) magnetite (Fe3O4) particles, which govern the magnetic signal in many igneous rocks, is examined using off-axis electron holography. Visualization of a vortex structure held by an individual Fe3O4 particle (~250nm in diameter) during in situ...

  8. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  9. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  10. Autonomous health management for PMSM rail vehicles through demagnetization monitoring and prognosis control.

    Science.gov (United States)

    Niu, Gang; Jiang, Junjie; Youn, Byeng D; Pecht, Michael

    2018-01-01

    Autonomous vehicles are playing an increasingly importance in support of a wide variety of critical events. This paper presents a novel autonomous health management scheme on rail vehicles driven by permanent magnet synchronous motors (PMSMs). Firstly, the PMSMs are modeled based on first principle to deduce the initial profile of pneumatic braking (p-braking) force, then which is utilized for real-time demagnetization monitoring and degradation prognosis through similarity-based theory and generate prognosis-enhanced p-braking force strategy for final optimal control. A case study is conducted to demonstrate the feasibility and benefit of using the real-time prognostics and health management (PHM) information in vehicle 'drive-brake' control automatically. The results show that accurate demagnetization monitoring, degradation prognosis, and real-time capability for control optimization can be obtained, which can effectively relieve brake shoe wear. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  11. Online fault detection of permanent magnet demagnetization for IPMSMs by nonsingular fast terminal-sliding-mode observer.

    Science.gov (United States)

    Zhao, Kai-Hui; Chen, Te-Fang; Zhang, Chang-Fan; He, Jing; Huang, Gang

    2014-12-05

    To prevent irreversible demagnetization of a permanent magnet (PM) for interior permanent magnet synchronous motors (IPMSMs) by flux-weakening control, a robust PM flux-linkage nonsingular fast terminal-sliding-mode observer (NFTSMO) is proposed to detect demagnetization faults. First, the IPMSM mathematical model of demagnetization is presented. Second, the construction of the NFTSMO to estimate PM demagnetization faults in IPMSM is described, and a proof of observer stability is given. The fault decision criteria and fault-processing method are also presented. Finally, the proposed scheme was simulated using MATLAB/Simulink and implemented on the RT-LAB platform. A number of robustness tests have been carried out. The scheme shows good performance in spite of speed fluctuations, torque ripples and the uncertainties of stator resistance.

  12. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  13. ESR study of thermal demagnetization processes in ferromagnetic nanoparticles with Curie temperatures between 40 and 60 deg. C

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, Oleg A. [Institute of Biochemical Physics, Russian Academy of Sciences (RAS), Kosygin St. 4, Moscow 119991 (Russian Federation)]. E-mail: kuznetsov_oa@yahoo.com; Sorokina, Olga N. [Institute of Biochemical Physics, Russian Academy of Sciences (RAS), Kosygin St. 4, Moscow 119991 (Russian Federation); Leontiev, Vladimir G. [Institute of Metallurgy, Russian Academy of Sciences (RAS), Moscow 119991 (Russian Federation); Shlyakhtin, Oleg A. [Institute of Chemical Physics, Russian Academy of Sciences (RAS), Kosygin St. 4, Moscow 119991 (Russian Federation); Kovarski, Alexander L. [Institute of Biochemical Physics, Russian Academy of Sciences (RAS), Kosygin St. 4, Moscow 119991 (Russian Federation); Kuznetsov, Anatoly A. [Institute of Biochemical Physics, Russian Academy of Sciences (RAS), Kosygin St. 4, Moscow 119991 (Russian Federation)

    2007-04-15

    Thermal demagnetization in the vicinity of the Curie temperature of silver and sodium manganite nanoparticles, as well as copper-nickel and palladium-nickel alloy nanoparticles were studied by both static magnetic measurements and by electron spin resonance (ESR). ESR data indicate that some magnetic ordering remains even above the Curie temperature, determined by static magnetometry. Mechanisms of thermal demagnetization in alloy nanoparticles appear to be different from that in manganites.

  14. ESR study of thermal demagnetization processes in ferromagnetic nanoparticles with Curie temperatures between 40 and 60 deg. C

    International Nuclear Information System (INIS)

    Kuznetsov, Oleg A.; Sorokina, Olga N.; Leontiev, Vladimir G.; Shlyakhtin, Oleg A.; Kovarski, Alexander L.; Kuznetsov, Anatoly A.

    2007-01-01

    Thermal demagnetization in the vicinity of the Curie temperature of silver and sodium manganite nanoparticles, as well as copper-nickel and palladium-nickel alloy nanoparticles were studied by both static magnetic measurements and by electron spin resonance (ESR). ESR data indicate that some magnetic ordering remains even above the Curie temperature, determined by static magnetometry. Mechanisms of thermal demagnetization in alloy nanoparticles appear to be different from that in manganites

  15. Demagnetization monitoring and life extending control for permanent magnet-driven traction systems

    Science.gov (United States)

    Niu, Gang; Liu, Senyi

    2018-03-01

    This paper presents a novel scheme of demagnetization monitoring and life extending control for traction systems driven by permanent magnet synchronous motors (PMSMs). Firstly, the offline training is carried to evaluate fatigue damage of insulated gate bipolar transistors (IGBTs) under different flux loss based on first-principle modeling. Then an optimal control law can be extracted by turning down the power distribution factor of the demagnetizing PMSM until all damages of IGBTs turn to balance. Next, the similarity-based empirical modeling is employed to online estimate remaining flux of PMSMs, which is used to update the power distribution factor by referring the optimal control law for the health-oriented autonomous control. The proposed strategy can be demonstrated by a case study of traction drive system coupled with dual-PMSMs. Compared with traditional control strategy, the results show that the novel scheme can not only guarantee traction performance but also extend remaining useful life (RUL) of the system after suffering demagnetization fault.

  16. Investigation of Permanent Magnet Demagnetization in Synchronous Machines during Multiple Short-Circuit Fault Conditions

    Directory of Open Access Journals (Sweden)

    Stefan Sjökvist

    2017-10-01

    Full Text Available Faults in electrical machines can vary in severity and affect different parts of the machine. This study focuses on various kinds of short-circuits on the terminal side of a generic 20 kW surface mounted permanent magnet synchronous generator and how successive faults affect the performance of the machine. The study was conducted with the commercially available finite element method software COMSOL Multiphysics ® , and two time-dependent models for demagnetization of permanent magnets were compared, one using only internal models and the other using a proprietary external function. The study is simulation based and the two models were compared to a previously experimentally verified stationary model. Results showed that the power output decreased by more than 30% after five successive faults. In addition, the no-load voltage had become unsymmetrical, which was explained by the uneven demagnetization of the permanent magnets. The permanent magnet with the lowest reduction in average remanence was decreased by 0.8%, while the highest average reduction was 23.8% in another permanent magnet. The internal simulation model was about four times faster than the external model, but slightly overestimated the demagnetization.

  17. Ultrafast demagnetization in rare-earth alloys: the role of spin-orbit coupling

    Energy Technology Data Exchange (ETDEWEB)

    Le Guyader, Loic; Solopow, Sergej; Radu, Florin; Holldack, Karsten; Mitzner, Rolf; Kachel, Torsten; Pontius, Niko; Foehlisch, Alexander; Radu, Ilie [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Berlin (Germany); Abrudan, Radu [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Berlin (Germany); Institut fuer Experimentalphysik/Festkoerperphysik, Ruhr-Universitaet Bochum (Germany)

    2015-07-01

    Understanding the ultrafast demagnetization occurring upon femtosecond laser excitation of a magnetic material is a fundamental problem of modern magnetism and its microscopic origin remains highly elusive and intensely debated. Particularly, the spin-orbit coupling mediating the spin-lattice interaction is one of the key ingredients. An intriguing case of tunable parallel to anti-parallel LS coupling can be realized in rare-earth (RE) alloys. For instance, Gd60Sm40 and Gd60Dy40 alloys have similar absolute S and L, but exhibit opposite LS coupling while displaying the same ferromagnetic ordering temperature of 250 K. They constitute thus an ideal case to investigate the particular role of the LS coupling on the ultrafast demagnetization. Here we report on the properties of such RE thin film alloys using X-ray Magnetic Circular Dichroism (XMCD) with the spin and orbit sum rules at M5,4 edges. Femtosecond time-resolved transmission XMCD measurements performed at the slicing beamline reveal the element-specific demagnetization time constant in these alloys. Funding from European Union through FEMTOSPIN is gratefully acknowledged.

  18. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    International Nuclear Information System (INIS)

    Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

    2008-01-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  19. Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

    2008-07-01

    This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

  20. Design and expected performance of a compact and continuous nuclear demagnetization refrigerator for sub-mK applications

    Science.gov (United States)

    Toda, Ryo; Murakawa, Satoshi; Fukuyama, Hiroshi

    2018-03-01

    Sub-mK temperatures are achievable by a copper nuclear demagnetization refrigerator (NDR). Recently, research demands for such an ultra-low temperature environment are increasing not only in condensed matter physics but also in astrophysics. A standard NDR requires a specially designed room, a high-field superconducting magnet, and a high-power dilution refrigerator (DR). And it is a one-shot cooling apparatus. To reduce these requirements, we are developing a compact and continuous NDR with two PrNi5 nuclear stages which occupies only a small space next to an appropriate pre-cooling stage such as DR. PrNi5 has a large magnetic-field enhancement on Pr3+ nuclei due to the strong hyperfine coupling. This enables us to enclose each stage in a miniature superconducting magnet and to locate two such sets in close proximity by surrounding them with high-permeability magnetic shields. The two stages are thermally connected in series to the pre-cooling stage by two Zn superconducting heat switches. A numerical analysis taking account of thermal resistances of all parts and an eddy current heating shows that the lowest sample temperature of 0.8 mK can be maintained continuously under a 10 nW ambient heat leak.

  1. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  2. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  3. Bulk etch rate of LR-115 cellulose nitrate film

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

  4. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  5. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  6. Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

    International Nuclear Information System (INIS)

    Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

    2010-01-01

    The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

  7. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  9. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Modeling the effect of the stress demagnetization phenomenon on the magnetic properties in a no Fe-Si 3% sheet

    Directory of Open Access Journals (Sweden)

    Yakhlef Malika

    2015-01-01

    Full Text Available The aim of this paper is the modeling of the stress demagnetization effect on the magnetic properties in a non-oriented Fe-Si 3% sheet under different external stresses. The magneto-mechanical model used for magnetic hysteresis is based on a model originally formulated by Sablik-Jiles-Atherthon (S.J.A.. This latter has been modified by including both the stress demagnetization factor and the eddy current effects. The influence of the stress demagnetization term SDT on the magnetostrictive behavior of the material is also modeled. The proposed model has been validated by extensive simulations at different stresses, namely compressive and tensile stresses. Simulation results obtained by this model are very close to those published in the literature. Using the proposed model, very satisfactory performance has been achieved.

  11. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  12. Parameters of calibration of the measurement system of 222 Rn based in LR-115

    International Nuclear Information System (INIS)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

    2003-01-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  13. LR1: a candidate RNA virus of Leishmania.

    OpenAIRE

    Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

    1988-01-01

    Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

  14. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  15. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  16. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  17. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  18. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  19. System and method for preventing stator permanent magnet demagnetization during vacuum pressure impregnation

    Science.gov (United States)

    Raminosoa, Tsarafidy; Alexander, James Pellegrino; EL-Refaie, Ayman Mohamed Fawzi

    2017-06-06

    A permanent magnet electrical machine includes a stator having conductive windings wound thereon and one or more permanent magnets embedded in the stator. A magnetic keeper element is positioned on the stator so as to form a magnetic flux path with the permanent magnets, with the magnetic keeper element closing the magnetic flux path of the permanent magnets by providing a low reluctance flux path to magnetic flux generated by the permanent magnets. A vacuum pressure impregnation (VPI) process is performed on the stator to increase a thermal conductivity of the windings, with the VPI process including a curing step that is performed at a selected temperature. The magnetic keeper element sets an operating point of the permanent magnets to an internal flux density level above a demagnetization threshold associated with the selected temperature at which the curing step is performed.

  20. Hysteresis loops and the demagnetization process at 4.2 K for melt-spun Nd sub 1 sub 3 Fe sub 7 sub 7 B sub 1 sub 0

    CERN Document Server

    Jin Han Min; Park, W S; Park, M J; Wang Xue Feng

    1998-01-01

    Hysteresis loops of melt-spun Nd sub 1 sub 3 Fe sub 7 sub 7 B sub 1 sub 0 cooled down at the remanent state were measured at 4.2 K. The loop for fields of H sub m sub a sub x =6.4 MA m sup - sup 1 is characterized by low- and high-field steps. The loop for fields of H sub m sub a sub x =4.0 MA m sup - sup 1 is very thin with only a low-field step and is shifted profoundly along the H-axes. The loops and the spin distribution during the demagnetization process were analysed by micromagnetic finite-element calculations. Quantitatively, the calculations reproduce the experimental loops fairly well. The spin distribution is fairly nonuniform, and a domain-wall-like distribution appears not only at some grain boundaries but also within some grains at the high-field step. The demagnetization proceeds by nonuniform reversion as a whole, and neither the model of single-domain reversion nor the model of domain-wall pinning in the grain boundary model describes the process appropriately. (author)

  1. Perturbation measurements in reactor LR-0 and their evaluation

    International Nuclear Information System (INIS)

    Rypar, W.; Faehrmann, K.H.

    1988-07-01

    To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

  2. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  3. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  5. Model of ultrafast demagnetization driven by spin-orbit coupling in a photoexcited antiferromagnetic insulator Cr2O3

    Science.gov (United States)

    Guo, Feng; Zhang, Na; Jin, Wei; Chang, Jun

    2017-06-01

    We theoretically study the dynamic time evolution following laser pulse pumping in an antiferromagnetic insulator Cr2O3. From the photoexcited high-spin quartet states to the long-lived low-spin doublet states, the ultrafast demagnetization processes are investigated by solving the dissipative Schrödinger equation. We find that the demagnetization times are of the order of hundreds of femtoseconds, in good agreement with recent experiments. The switching times could be strongly reduced by properly tuning the energy gaps between the multiplet energy levels of Cr3+. Furthermore, the relaxation times also depend on the hybridization of atomic orbitals in the first photoexcited state. Our results suggest that the selective manipulation of the electronic structure by engineering stress-strain or chemical substitution allows effective control of the magnetic state switching in photoexcited insulating transition-metal oxides.

  6. Ultrafast demagnetization enhancement in CoFeB/MgO/CoFeB magnetic tunneling junction driven by spin tunneling current.

    Science.gov (United States)

    He, Wei; Zhu, Tao; Zhang, Xiang-Qun; Yang, Hai-Tao; Cheng, Zhao-Hua

    2013-10-07

    The laser-induced ultrafast demagnetization of CoFeB/MgO/CoFeB magnetic tunneling junction is exploited by time-resolved magneto-optical Kerr effect (TRMOKE) for both the parallel state (P state) and the antiparallel state (AP state) of the magnetizations between two magnetic layers. It was observed that the demagnetization time is shorter and the magnitude of demagnetization is larger in the AP state than those in the P state. These behaviors are attributed to the ultrafast spin transfer between two CoFeB layers via the tunneling of hot electrons through the MgO barrier. Our observation indicates that ultrafast demagnetization can be engineered by the hot electrons tunneling current. It opens the door to manipulate the ultrafast spin current in magnetic tunneling junctions.

  7. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  8. THE ADIABATIC DEMAGNETIZATION REFRIGERATOR FOR THE MICRO-X SOUNDING ROCKET TELESCOPE

    International Nuclear Information System (INIS)

    Wikus, P.; Bagdasarova, Y.; Figueroa-Feliciano, E.; Leman, S. W.; Rutherford, J. M.; Trowbridge, S. N.; Adams, J. S.; Bandler, S. R.; Eckart, M. E.; Kelley, R. L.; Kilbourne, C. A.; Porter, F. S.; Doriese, W. B.; McCammon, D.

    2010-01-01

    The Micro-X Imaging X-ray Spectrometer is a sounding rocket payload slated for launch in 2011. An array of Transition Edge Sensors, which is operated at a bath temperature of 50 mK, will be used to obtain a high resolution spectrum of the Puppis-A supernova remnant. An Adiabatic Demagnetization Refrigerator (ADR) with a 75 gram Ferric Ammonium Alum (FAA) salt pill in the bore of a 4 T superconducting magnet provides a stable heat sink for the detector array only a few seconds after burnout of the rocket motors. This requires a cold stage design with very short thermal time constants. A suspension made from Kevlar strings holds the 255 gram cold stage in place. It is capable of withstanding loads in excess of 200 g. Stable operation of the TES array in proximity to the ADR magnet is ensured by a three-stage magnetic shielding system which consists of a superconducting can, a high-permeability shield and a bucking coil. The development and testing of the Micro-X payload is well underway.

  9. A compact copper nuclear demagnetization cryostat and a search for superfluidity in solid 4He

    International Nuclear Information System (INIS)

    Haar, P.G. van de.

    1991-01-01

    The subject of this thesis is the theoretical and experimental study of matter at low temperatures, and the development of techniques to reach and measure these temperatures. A copper nuclear demagnetization cryostat was developed in order to reach low temperatures. This system distinguishes itself from other cryostats by its compact construction. The lowest temperature recorded by a pulsed Pt-NMR thermometer was 115 μK. This system was used to search for superfluidity in solid 4 He. Due to the large zero-point motion of the atoms, 4He remains liquid down to zero temperature; a pressure of 25.3 bar is needed to force the atoms in a lattice. Even in solid state, the 4 He atoms remain very mobile, changing lattice sites at a frequency of approximately 10 7 Hz. It is possible that solid 4 He contains vacancies at zero temperature. These zero point vacancies are expected to behave like a gas of bosons, and should Bose-condense at some temperature. From experiments the upper limit to the vacancy concentration is set of 4·10-5. (author). 217 refs.; 46 figs.; 2 tabs

  10. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  12. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  13. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  14. Removal of spurious normal polarity directions in the Kanapoi Formation with progressive thermal demagnetization: implications for dating Pliocene hominin fossils from the Turkana Basin of Kenya

    Science.gov (United States)

    Lepre, C. J.; Kent, D.

    2017-12-01

    The Kanapoi Formation is a 75-m-thick sedimentary unit in northern Kenya whose fossil record documents the evolution of the genus Australopithecus and habitual bipedalism in Pliocene hominins. Published 40Ar/39Ar dates of 4.20 to 4.10 Ma for three aqueously reworked tuffs from the lower and middle stratigraphic intervals of the formation and a whole-rock K-Ar date of 3.4 ± 0.1 Ma on the Kalokwanya Basalt, which caps the succession, coupled with paleomagnetic data from an unpublished thesis have been used to constrain the age of the unit (McDougall+2012 J Geol Soc). Normal polarities at the base of the formation were correlated to normal subchron C3n.1n (Cochiti Subchron) and would extend the Kanapoi chronostratigraphy back to between 4.29 and 4.18 Ma. The credibility of the normal polarities at the base and elsewhere in the formation as records of the geomagnetic field at the time of deposition, however, is called into question by the ubiquity of the high-coercivity mineral hematite in the Kanapoi sediments and the alternating field demagnetization methods exclusively used to generate the polarity directions. We tested this proposed chronostratigraphy of the Kanapoi Fm by collecting nearly 70 independently orientated block samples from 10 outcrop localities, which sampled roughly two-thirds of the total stratigraphic thickness of the formation and covered the entire vertical extent of the supposed basal normal polarity magnetozone. For most every specimen, stepwise thermal demagnetization (TD) resolved well-defined characteristic magnetizations of uniformly reverse polarity and were carried by a high-temperature component consistent with hematite. TD of the Kalokwanya Basalt confirmed its reverse magnetic polarity, which implies emplacement most likely prior to the base of normal Chron C2An (Gauss Chron) at 3.58 Ma. Kanapoi sediments thus accumulated sometime during reverse subchron C2Ar (4.18-3.58 Ma) but over a period of much less than 600 kyr. Basal age control

  15. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  16. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  17. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  18. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  19. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  20. Determination of Intrinsic Magnetic Response from Local Measurements of Fringing Fields

    OpenAIRE

    Wen, Bo; Millis, Andrew J.; Pardo, Enric; Subedi, Pradeep; Kent, Andrew D.; Yeshurun, Yosi; Sarachik, Myriam P.

    2014-01-01

    Micron-sized Hall bars and micro-SQUIDs are now used routinely to measure the local static and dynamic magnetic response with micron-scale spatial resolution. While this provides a powerful new tool, determining the intrinsic magnetization presents new challenges, as it requires correcting for demagnetization fields that vary widely with position on a sample. In this paper we develop a method to correct for the demagnetization effect at local points of a rectangular prism shaped sample using ...

  1. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  2. Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

    2003-07-01

    Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

  3. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  5. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  6. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  7. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  8. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  9. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  10. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  11. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  12. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  13. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  14. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  15. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  17. alpha-particle radioactivity from LR 115 by two methods of analysis

    CERN Document Server

    Azkour, K; Adloff, J C; Pape, A

    1999-01-01

    LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

  18. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  19. Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

    CERN Document Server

    Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

    1999-01-01

    Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

  20. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  1. IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

    Science.gov (United States)

    Woods, Carol M.

    2008-01-01

    Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

  2. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  3. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  4. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  5. Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

    NARCIS (Netherlands)

    Haraksim, Rudolf; Meuwly, Didier

    2013-01-01

    This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

  6. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  7. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  8. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  9. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  10. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  11. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  12. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  13. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  14. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  15. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  16. Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

    Directory of Open Access Journals (Sweden)

    Ellen Cristine Giese

    2015-06-01

    Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

  17. Direct determination of bulk etching rate for LR-115-II solid state ...

    Indian Academy of Sciences (India)

    The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

  18. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  19. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  20. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  1. Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

    International Nuclear Information System (INIS)

    Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

    2001-01-01

    An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

  2. The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

    Science.gov (United States)

    1956-01-01

    The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

  3. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  4. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  5. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  6. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  7. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

    International Nuclear Information System (INIS)

    Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

    2010-01-01

    LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

  9. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  10. Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

    International Nuclear Information System (INIS)

    Harris, M.J.; Schlenker, R.A.

    1977-01-01

    An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

  11. Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

    International Nuclear Information System (INIS)

    De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

    2014-01-01

    An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

  12. Application of the LR-56 at DOE Facilities in the United States

    International Nuclear Information System (INIS)

    Smith, A.C.

    1998-05-01

    The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

  13. Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

    International Nuclear Information System (INIS)

    Hadek, J.; Grundmann, U.

    1989-09-01

    Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

  14. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  15. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  16. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  17. Continuous demagnetization of cerium impurities in superconducting and normal lanthanum--thorium binary alloy matrices

    International Nuclear Information System (INIS)

    Fertig, W.A.

    1976-01-01

    Experimental evidence is presented for the dramatic changes occurring in the low temperature properties of this system as the magnetic character of the Ce solutes changes from Kondo-magnetic in LaCe to nonmagnetic in ThCe. Three types of measurements are reported: (1) the superconducting transition temperature T/sub c/ vs Ce impurity concentration n for matrix compositions of 0 to 100 at. percent Th; (2) T/sub c/ vs magnetic field H for La 0 . 80 Th 0 . 20 Ce; and (3) the incremental electrical resistivity per Ce impurity vs temperature T for all the ternary systems listed above. The lowest temperature was 50 mK, and the annealed bulk samples had essentially 100 percent fcc structure. Three features in the T/sub c/ vs n data occur near the midpoint of the compositional spectrum from LaCe to ThCe: (1) the presence of a conspicuous maximum in the initial depression vertical barΔT/sub c/Δnvertical bar/sub n→0/; (2) the smooth evolution in the curvature of T/sub c/ vs n from negative to positive with increasing Th concentration; and (3) the appearance of re-entrant superconductivity in the La 0 . 90 Th 0 . 10 Ce, La 0 . 80 Th 0 . 20 Ce, and La 0 . 75 Th 0 . 25 Ce systems. As the La:Th host ratio decreases, there is a continuous decrease in the logarithmically temperature-dependent Ce impurity contribution to the total electrical resistivity. The Mueller--Hartmann and Zittartz theory for superconducting Kondo systems can qualitatively account for the behavior of the T/sub c/ vs n data for host compositions with approximately less than 70 at. percent Th. The Kaiser theory for conduction electron scattering by nonmagnetic resonant states yields a reasonable fit to the T/sub c/ vs n data for Th concentrations as low as approximately 60 at. percent

  18. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  1. Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

    International Nuclear Information System (INIS)

    Clement, G.; Delvecchio, D.J.; Sazawal, V.

    1997-01-01

    The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

  2. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  3. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr; Shihada, Basem

    2015-01-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  4. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  5. Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

    International Nuclear Information System (INIS)

    Aharmim, B.; Sabir, A.; Marah, H.

    2002-01-01

    A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

  6. Development of measuring system with self-powered neutron detectors for the LR-0 reactor

    International Nuclear Information System (INIS)

    Erben, O.; Horinek, K.; Szasz, Z.

    1989-01-01

    A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

  7. Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

    International Nuclear Information System (INIS)

    Sawamura, Teruko; Yamazaki, Hatsuo

    1988-01-01

    This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

  8. Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

    International Nuclear Information System (INIS)

    Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

    2006-01-01

    The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

  9. Blind void filling in LR-EPONs: How efficient it can be?

    KAUST Repository

    Elrasad, Amr

    2015-07-01

    This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

  10. Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

    International Nuclear Information System (INIS)

    Somogyi, G.; Hunyadi, I.; Varga, Zs.

    1978-01-01

    Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

  11. On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

    International Nuclear Information System (INIS)

    Heydari-Fard, Malihe

    2010-01-01

    The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

  12. Type B liquid package technical issues -- Experience with LR-56 safety analysis

    International Nuclear Information System (INIS)

    Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

    1997-01-01

    In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

  13. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  14. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  15. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  16. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  17. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  18. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  19. Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

    DEFF Research Database (Denmark)

    Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

    2015-01-01

    We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

  20. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  1. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  2. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  3. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  4. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

    Science.gov (United States)

    Feng, Rulin; Peterson, Kirk A

    2017-08-28

    New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

  6. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  7. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  8. Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

    Directory of Open Access Journals (Sweden)

    Carolina Saori Ishii Mauro

    2016-12-01

    Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

  9. Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

    International Nuclear Information System (INIS)

    Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

    2007-01-01

    Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

  10. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  11. Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

    2016-01-01

    Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

  12. Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

    Directory of Open Access Journals (Sweden)

    Košál Michal

    2017-01-01

    Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

  13. Magnetic viscosity, susceptibility and fluctuation fields in sintered NdFeB

    International Nuclear Information System (INIS)

    Tomka, G.J.; Bissell, P.R.; O'Grady, K.; Chantrell, R.W.

    1990-01-01

    Magnetic viscosity and irreversible susceptibility of a sample of anisotropic sintered NdFeB have been measured using a vibrating sample magnetometer. The fluctuation field as a function of local field is found to decrease with increasing demagnetizing field with a dip at the coercivity. This behavior is compared with an existing computer model based on a non-interacting system of fine, uniaxial, randomly oriented particles

  14. Low-Thermal Conductivity Suspensions Used in the Isolation of the Salt Pills Aboard the Astro-H Adiabatic Demagnetization Refrigerator

    Science.gov (United States)

    Kimball, Mark O.; Shirron, Peter J.; Wegel, Donald C.; James, Bryan L.; Galassi, Nicholas M.; Faulkner, Richard L.; San Sebastian, Marcelino

    2011-01-01

    An adiabatic demagnetization refrigerator (ADR) utilizes the magnetocholoric effect in a paramagnetic salt to produce sub-Kelvin temperatures. It is a solid-state device that has no moving parts and does not rely upon a density gradient in a working fluid. This makes it ideal for cooling space-based instruments. ·Typically the salt is enclosed in a cylindrical pill that is suspended within the bore of a magnet. The suspension between the salt pill and magnet must be robust enough to survive a launch yet have a thermal conductance that minimizes heat from the magnet that is mechanically, and thermally, anchored to a stage at a higher temperature. Here we detail such a design that uses Kevlar(Trade Mark) as the supporting media in a system that limits motion of the salt pill axial as well as laterally with respect to the magnet bore.

  15. fields

    Directory of Open Access Journals (Sweden)

    Brad J. Arnold

    2014-07-01

    Full Text Available Surface irrigation, such as flood or furrow, is the predominant form of irrigation in California for agronomic crops. Compared to other irrigation methods, however, it is inefficient in terms of water use; large quantities of water, instead of being used for crop production, are lost to excess deep percolation and tail runoff. In surface-irrigated fields, irrigators commonly cut off the inflow of water when the water advance reaches a familiar or convenient location downfield, but this experience-based strategy has not been very successful in reducing the tail runoff water. Our study compared conventional cutoff practices to a retroactively applied model-based cutoff method in four commercially producing alfalfa fields in Northern California, and evaluated the model using a simple sensor system for practical application in typical alfalfa fields. These field tests illustrated that the model can be used to reduce tail runoff in typical surface-irrigated fields, and using it with a wireless sensor system saves time and labor as well as water.

  16. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  17. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  18. Pulsed laser induced heat transfer from a phthalocyanine-based thin film to a Bi, Al-substituted DyIG substrate: photothermal demagnetization observed by magnetic circular dichroism and numerical analysis.

    Science.gov (United States)

    Karasawa, Masanobu; Ishii, Kazuyuki

    2018-05-03

    We have investigated the demagnetization of a ferrimagnetic substrate, Bi, Al-substituted dysprosium iron garnet (Bi0.8Dy2.2Fe4.3Al0.7O12), based on selective pulsed laser irradiation of a molecular thin film consisting of μ-oxo-bis[hydroxyl{2,9(or 10),16(or 17),23(or 24)-tetra-tert-butylphthalocyanato}silicon] ((SiPc)2) and poly(vinylidene fluoride), and succeeded in reproducing photothermal energy transfer from a molecular thin film to an inorganic magnetic substrate in a submicrometer-order and a submicrosecond time scale using numerical analysis. After the instant temperature rise due to nanosecond pulsed laser irradiation of the (SiPc)2-based film, followed by heat transfer from the film to the neighboring magnetic substrate, demagnetization of the magnetic substrate was spectroscopically monitored by the decrease in its magnetic circular dichroism (MCD) intensity. The MCD intensity decreased with increasing pulsed laser energy, which reflects the fact that the submicrometer-order region of the substrate was demagnetized as a result of temperature rise reaching high Curie temperature. This heat transfer phenomenon resulting in the demagnetization of the magnetic substrate was numerically analyzed in a submicrometer-order and a submicrosecond time scale using the finite difference method: the demagnetized regions were calculated to be the same order of magnitude as those experimentally evaluated. These results would provide a more detailed understanding of photothermal energy transfer in organic-inorganic hybrid materials, which would be useful for developing photofunctional materials.

  19. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    Science.gov (United States)

    Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

    2016-08-01

    Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

  20. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  1. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  3. Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

    OpenAIRE

    Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

    2016-01-01

    International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

  4. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  5. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  6. Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

    Directory of Open Access Journals (Sweden)

    Fernanda da Conceição Moreira

    2017-06-01

    Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

  7. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  8. Determination of the saturation magnetization, anisotropy field, mean field interaction, and switching field distribution for nanocrystalline hard magnets

    International Nuclear Information System (INIS)

    McCallum, R. William

    2005-01-01

    For a uniaxial nanocrystalline magnetic material, the determination of the saturation magnetization, M s , requires measurements of the magnetization at fields which exceed the anisotropy field. For a typical RE-Tm compound, where RE=rare earth and Tm=transition metal, this may require fields above 7 T if the approach to saturation law is used. However for an isotropic material composed of a random distribution of non-interacting uniaxial grains, both M s and the anisotropy filed, H a , may be determined by fitting the Stoner-Wohlfarth (SW) model (Philos. Trans. Roy. Soc. 240 (1948) 599) to the reversible part of the demagnetization curve in the first quadrant. Furthermore, using the mean field interaction model of Callen, Liu and Cullen [2], a quantitative measure of the interaction strength for interacting particles may be determined. In conjunction with an analytical fit to the first quadrant demagnetization curve of the SW model, this allows M s , H a and the mean field interaction constant of a nanocrystalline magnet to be determined from measurements below 5 T. Furthermore, comparison of the model solution for the reversible magnetization with experimental data in the 2nd and 3rd quadrants allows the accurate determination of the switching field distribution. In many cases the hysteresis loop may be accurately described by a normal distribution of switching fields

  9. Analytic solution of magnetic induction distribution of ideal hollow spherical field sources

    Science.gov (United States)

    Xu, Xiaonong; Lu, Dingwei; Xu, Xibin; Yu, Yang; Gu, Min

    2017-12-01

    The Halbach type hollow spherical permanent magnet arrays (HSPMA) are volume compacted, energy efficient field sources, and capable of producing multi-Tesla field in the cavity of the array, which have attracted intense interests in many practical applications. Here, we present analytical solutions of magnetic induction to the ideal HSPMA in entire space, outside of array, within the cavity of array, and in the interior of the magnet. We obtain solutions using concept of magnetic charge to solve the Poisson's and Laplace's equations for the HSPMA. Using these analytical field expressions inside the material, a scalar demagnetization function is defined to approximately indicate the regions of magnetization reversal, partial demagnetization, and inverse magnetic saturation. The analytical field solution provides deeper insight into the nature of HSPMA and offer guidance in designing optimized one.

  10. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  11. Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

    Science.gov (United States)

    Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

    2018-06-01

    The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

  12. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

    OpenAIRE

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

  14. Enhanced microactuation with magnetic field curing of ...

    Indian Academy of Sciences (India)

    ples have been enhanced by two times when compared with that of zero field cured samples. The effect of .... Gauge of wire ... electrolitic-300 mesh (84.67 µm) LR, Product No. ... be in the body centered cubic phase with a lattice parameter.

  15. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  16. Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

    Directory of Open Access Journals (Sweden)

    R. Greco

    2013-09-01

    Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

  17. Reply to “Comment on ‘Ultrafast Demagnetization Measurements Using Extreme Ultraviolet Light: Comparison of Electronic and Magnetic Contributions’ ”

    Directory of Open Access Journals (Sweden)

    Emrah Turgut

    2013-09-01

    Full Text Available In the following, we show that the conclusions of our article titled “Ultrafast Demagnetization Measurements Using Extreme Ultraviolet Light: Comparison of Electronic and Magnetic Contributions” are correct. The Comment of Vodungbo et al. argues that a unique determination of the refractive index variation over time is not possible using the data set presented in our paper. Furthermore, it was suggested that the lack of uniqueness allows for the possibility of a very specific time-dependent trajectory of the refractive index in the complex plane that could give rise to a large nonmagnetic modulation of the measured asymmetry, in spite of a negligible change in the s-polarized reflectivity. In this Reply, we conclusively show that any nonmagnetic contribution to the measured asymmetry is indeed negligible (<2%, below the noise level of the magnetic-asymmetry measurements. First, we use a few additional measurements to unambiguously rule out the presence of any nonmagnetic contributions to the signal. Second, we show that the scenario proposed by Vodungbo et al. would require both exotic time and energy dependences of the refractive index near the M edge that are extremely unlikely (virtually impossible in real materials. Thus, the conclusions of our original article are preserved.

  18. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

    Science.gov (United States)

    Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

    2016-01-01

    This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

  20. Planar Josephson tunnel junctions in a transverse magnetic field

    DEFF Research Database (Denmark)

    Monacoa, R.; Aarøe, Morten; Mygind, Jesper

    2007-01-01

    demagnetization effects imposed by the tunnel barrier and electrodes geometry are important. Measurements of the junction critical current versus magnetic field in planar Nb-based high-quality junctions with different geometry, size, and critical current density show that it is advantageous to use a transverse......Traditionally, since the discovery of the Josephson effect in 1962, the magnetic diffraction pattern of planar Josephson tunnel junctions has been recorded with the field applied in the plane of the junction. Here we discuss the static junction properties in a transverse magnetic field where...

  1. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    International Nuclear Information System (INIS)

    Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

    2016-01-01

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  2. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  3. Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

    2016-08-31

    Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 7LiF-BeF2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

  4. The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

    Science.gov (United States)

    Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

    2012-10-01

    • The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  5. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  6. MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

    Science.gov (United States)

    Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

    2016-01-01

    The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

  7. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  8. Placed in a steady magnetic field, the flux density inside a permalloy-shielded volume decreases over hours and days

    Science.gov (United States)

    Feinberg, Benedict; Gould, Harvey

    2018-03-01

    Following the application of an external magnetic field to a thin-walled demagnetized Permalloy cylinder, the magnetic flux density at the center of the shielded volume decreases by roughly 20% over periods of hours to days. We measured this effect for applied magnetic fields from 0.48 A/m to 16 A/m, the latter being comparable to the Earths magnetic field at its weakest point. Delayed changes in magnetic flux density are also observed following alternating current demagnetization. We attribute these effects to delayed changes in magnetization, which have previously been observed in thin Permalloy films and small bulk samples of ferromagnetic materials. Phenomenological models of thermal activation are discussed. Some possible effects on experiments that rely on static shielding are noted.

  9. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

    International Nuclear Information System (INIS)

    Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

    2007-01-01

    Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

  11. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  12. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  13. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  14. A Machine Approach for Field Weakening of Permanent-Magnet Motors

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, J.S.

    2000-04-02

    The commonly known technology of field weakening for permanent-magnet (PM) motors is achieved by controlling the direct-axis current component through an inverter, without using mechanical variation of the air gap, a new machine approach for field weakening of PM machines by direct control of air-gap fluxes is introduced. The demagnetization situation due to field weakening is not an issue with this new method. In fact, the PMs are strengthened at field weakening. The field-weakening ratio can reach 1O:1 or higher. This technology is particularly useful for the PM generators and electric vehicle drives.

  15. Axial-field permanent magnet motors for electric vehicles

    Science.gov (United States)

    Campbell, P.

    1981-01-01

    The modelling of an anisotropic alnico magnet for the purpose of field computation involves assigning a value for the material's permeability in the transverse direction. This is generally based upon the preferred direction properties, being all that are easily available. By analyzing the rotation of intrinsic magnetization due to the self demagnetizing field, it is shown that the common assumptions relating the transverse to the preferred direction are not accurate. Transverse magnetization characteristics are needed, and these are given for Alnico 5, 5-7, and 8 magnets, yielding appropriate permeability values.

  16. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  17. On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

    International Nuclear Information System (INIS)

    Cerrada, Lucia; San Martin, Jesus

    2011-01-01

    In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

  18. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  19. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  20. TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

    2018-03-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

  1. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  2. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  3. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  4. Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

    Science.gov (United States)

    Sellbom, Martin; Bagby, R. Michael

    2008-01-01

    In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

  5. System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

    International Nuclear Information System (INIS)

    Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

    1998-01-01

    In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

  6. Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

    2014-04-18

    Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

  7. Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

    NARCIS (Netherlands)

    K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

    2016-01-01

    markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

  8. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  9. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  10. In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

    Science.gov (United States)

    Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

    2013-05-01

    Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

  11. Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

    Science.gov (United States)

    Siuly; Li, Yan; Paul Wen, Peng

    2014-03-01

    Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  13. ultrasound studies of superfluid 3He in high magnetic fields

    International Nuclear Information System (INIS)

    De Vegvar, P.G.N.

    1986-01-01

    Measurements of ultrasound propagation in superfluid helium-three in magnetic fields of up to 94 kG are reported. The experiments were performed on an adiabatic nuclear demagnetization cryostat using a sensitive radio frequency spectrometer. In addition to observing the expected collective mode splittings, an anomaly near the A-two transition was intensively investigated. The effect is interpreted in terms of a first order transformation in the superfluid I-texture driven by the second order bulk phase transition at the point. Numerical computations give fair agreement with the experimental data

  14. Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

    Science.gov (United States)

    Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

    2017-12-01

    The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

  15. Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

    Directory of Open Access Journals (Sweden)

    Maya Safira Dewi

    2011-05-01

    Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

  16. Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

    International Nuclear Information System (INIS)

    Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

    2016-01-01

    Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

  17. Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

    International Nuclear Information System (INIS)

    Agba, Dabo Salif Ignace

    2011-02-01

    Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

  18. Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Vanessa de Farias

    2009-06-01

    Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

  19. Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

    Science.gov (United States)

    Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

    2011-05-15

    Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

    International Nuclear Information System (INIS)

    Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

    1987-01-01

    The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

  1. Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

    International Nuclear Information System (INIS)

    Vallejo Delgado, L.R.

    1989-01-01

    This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

  2. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  3. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  4. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  5. Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

    OpenAIRE

    Jacobs, Loraine Cristina do Valle

    2011-01-01

    Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

  6. siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

    Science.gov (United States)

    Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

    2018-07-01

    The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

  7. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  8. Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

    2014-07-01

    Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

  9. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Magnetostriction of field-structured magnetoelastomers.

    Energy Technology Data Exchange (ETDEWEB)

    Gulley, Gerald L. (Dominican University, River Forest, IL); Read, Douglas H.; Martin, James Ellis; Huber, Dale L.; Anderson, Robert Alan; Frankamp, Benjamin L.

    2005-12-01

    Field-structured magnetic particle composites are an important new class of materials that have great potential as both sensors and actuators. These materials are synthesized by suspending magnetic particles in a polymeric resin and subjecting these to magnetic fields while the resin polymerizes. If a simple uniaxial magnetic field is used, the particles will form chains, yielding composites whose magnetic susceptibility is enhanced along a single direction. A biaxial magnetic field, comprised of two orthogonal ac fields, forms particle sheets, yielding composites whose magnetic susceptibility is enhanced along two principal directions. A balanced triaxial magnetic field can be used to enhance the susceptibility in all directions, and biased heterodyned triaxial magnetic fields are especially effective for producing composites with a greatly enhanced susceptibility along a single axis. Magnetostriction is quadratic in the susceptibility, so increasing the composite susceptibility is important to developing actuators that function well at modest fields. To investigate magnetostriction in these field-structured composites we have constructed a sensitive, constant-stress apparatus capable of 1 ppm strain resolution. The sample geometry is designed to minimize demagnetizing field effects. With this apparatus we have demonstrated field-structured composites with nearly 10,000 ppm strain.

  11. Function of the demagnetization factor in respect of a quasi-solid filtermatrix of a magnetic separator Функциональный вид коэффициента размагничивания квазисплошной фильтр-матрицы магнитного сепаратора

    Directory of Open Access Journals (Sweden)

    Sandulyak Anna Aleksandrovna

    2013-07-01

    Full Text Available The author presents the prospects for the use of a magnetic separator, equipped with a filter matrix, in the treatment of ceramic suspensions and minerals. Particles of ferromagnetic impurities are captured by matrix pores, when purified media is transmitted through the magnetized filter matrix. The particle capture efficiency depends on the level of the filter matrix magnetization. The intensity of demagnetization influences the filter matrix magnetization intensity. Unfortunately, many researchers frequently ignore the demagnetization factor of a filter matrix as a specific (granulated magnet.The effect of self-demagnetization is studied in terms of homogeneous (solid magnets. The effect of self-demagnetization means that poles emerge on the borders of magnetized “short” magnets. Thus, a strong inner demagnetization field emerges. The main parameter of this physical characteristic of sample-magnets is the coefficient of demagnetization, which relates the intensity of the demagnetization field and the magnetization intensity of a sample body. The author considers the relevant issue of influence of the demagnetization intensity on the average values of the magnetic permeability of porous (quasi-solid magnets, for example, a filter matrix. This dependence is relevant for the calculation of magnetic permeability values.Обсуждается актуальный вопрос о существенном влиянии размагничивающего фактора N на средние значения магнитной проницаемости пористых магнетиков (фильтр-матриц. Приведены значения N в зависимости от отношения длины L таких магнетиков к их диаметру D . Показано, что данные N имеют убывающую экспоненциальную связь с радикалом относительного

  12. Field-impressed anisotropy of susceptibility in iron-terbium thin films

    International Nuclear Information System (INIS)

    Stephenson, A.; Booth, N.A.

    1995-01-01

    Two thin films of Fe 1-x Tb x where x=0.17 and 0.23 are shown to exhibit the effect of field-impressed anisotropy. After application of a direct field of 80 mT, which gives them an isothermal remanent magnetization (IRM) in their plane, the anisotropy of initial susceptibility differs from that measured after the films have been tumble-demagnetized. By subtracting the susceptibility results of the tumble-demagnetized state from those obtained after the application of the 80 mT direct field, it is shown that the effect of this field is to decrease the susceptibility measured along the former applied field direction and to increase the susceptibility at right angles to this. The effect is almost certainly due to changes in domain alignment. Even though these films contain many domains, the above results are similar to those previously obtained for single-domain γFe 2 O 3 and magnetite particles. The sense of the effect is opposite to that for multi-domain magnetite particles where the susceptibility has been found to increase along the previously applied field direction. ((orig.))

  13. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  14. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  15. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    Science.gov (United States)

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

    2002-01-01

    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  16. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

    Science.gov (United States)

    Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

    2017-01-01

    In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

  17. The Dopants and Doping Level Dependence of the Structure and Magnetic Properties of the Eu (BA1-xLRx)2Cu3O7+δ

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Yu [Iowa State Univ., Ames, IA (United States)

    2002-12-31

    Eu(Ba1-xLRx)2Cu3O7+δ were systematically studied in order to understand how the valence of the rear earth elements, ionic sizes and magnetic moment affect the crystal structure and magnetic and electrical properties. Differential thermal analyses were carried out to check the phase purity, X-ray data were least-squares fitted to determine the lattice parameters, and DC-SQUID magnetometry was used to characterize the superconducting properties. These results showed that the crystallography is consistent with other EuLR123ss series, LR = La, Pr, Eu. The lattice parameters vary with the ionic radii of the rare earth ions. Unlike the uniform change in lattice parameter, the superconducting transition did not vary systematically with the ionic size of the dopants. Although the general trend was for Tc to decrease with decreasing ionic size of the dopant, for the same doping level, Pr was anomalous, depressing Tc faster. Although the exact mechanism is not clear, this result is consistent with the depression of Tc for Pr substitution for the rare earth in R123. The critical current Jc was determined using the Bean model from magnetization versus field measurements as a function of temperature and field. The effect of the dopants on Jc with the increasing of temperature or applied field was determined. For T < 77 K and small values of x, the value of Jc was increased over that of the x = 0 sample. In addition, the smaller the substituting atom, the higher the Jc becomes. For instance, at x = 0.025, Eu123 < EuLa.025 < EuPr.025 < EuNd.025 < EuEu.025. The enhancement of Jc disappears for x > 0.05 and T > 0.5Tc.

  18. Fourier transform zero field NMR and NQR

    International Nuclear Information System (INIS)

    Zax, D.B.

    1985-01-01

    In many systems the chemical shifts measured by traditional high resolution solid state NMR methods are insufficiently sensitive, or the information contained in the dipole-dipole couplings is more important. In these cases, Fourier transform zero field magnetic resonance may make an important contribution. Zero field NMR and NQR is the subject of this thesis. Chapter I presents the quantum mechanical background and notational formalism for what follows. Chapter II gives a brief review of high resolution magnetic resonance methods, with particular emphasis on techniques applicable to dipole-dipole and quadrupolar couplings. Level crossings between spin-1/2 and quadrupolar spins during demagnetization transfer polarization from high to low λ nuclei. This is the basis of very high sensitivity zero field NQR measurements by field cycling. Chapter III provides a formal presentation of the high resolution Fourier transform zero field NMR method. Theoretical signal functions are calculated for common spin systems, and examples of typical spectra are presented. Chapters IV and V review the experimental progress in zero field NMR of dipole-dipole coupled spin-1/2 nuclei and for quadrupolar spin systems. Variations of the simple experiment describe in earlier chapters that use pulsed dc fields are presented in Chapter VI

  19. Electric field controlled reversible magnetic anisotropy switching studied by spin rectification

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Hengan; Fan, Xiaolong, E-mail: fanxiaolong@lzu.edu.cn; Wang, Fenglong; Jiang, Changjun; Rao, Jinwei; Zhao, Xiaobing; Xue, Desheng [Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China); Gui, Y. S.; Hu, C.-M. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada)

    2014-03-10

    In this letter, spin rectification was used to study the electric field controlled dynamic magnetic properties of the multiferroic composite which is a Co stripe with induced in-plane anisotropy deposited onto a Pb(Mg{sub 1∕3}Nb{sub 2∕3})O{sub 3}-PbTiO{sub 3} substrate. Due to the coupling between piezoelectric and magnetoelastic effects, a reversible in-plane anisotropy switching has been realized by varying the history of the applied electric field. This merit results from the electric hysteresis of the polarization in the nonlinear piezoelectric regime, which has been proved by a butterfly type electric field dependence of the in-plane anisotropy field. Moreover, the electric field dependent effective demagnetization field and linewidth have been observed at the same time.

  20. Electric field controlled reversible magnetic anisotropy switching studied by spin rectification

    International Nuclear Information System (INIS)

    Zhou, Hengan; Fan, Xiaolong; Wang, Fenglong; Jiang, Changjun; Rao, Jinwei; Zhao, Xiaobing; Xue, Desheng; Gui, Y. S.; Hu, C.-M.

    2014-01-01

    In this letter, spin rectification was used to study the electric field controlled dynamic magnetic properties of the multiferroic composite which is a Co stripe with induced in-plane anisotropy deposited onto a Pb(Mg 1∕3 Nb 2∕3 )O 3 -PbTiO 3 substrate. Due to the coupling between piezoelectric and magnetoelastic effects, a reversible in-plane anisotropy switching has been realized by varying the history of the applied electric field. This merit results from the electric hysteresis of the polarization in the nonlinear piezoelectric regime, which has been proved by a butterfly type electric field dependence of the in-plane anisotropy field. Moreover, the electric field dependent effective demagnetization field and linewidth have been observed at the same time

  1. A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Ktata, A.; Bakhchi, A.

    2000-01-01

    Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

  2. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    Science.gov (United States)

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

    2011-01-01

    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  3. Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

    International Nuclear Information System (INIS)

    Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

    2015-01-01

    Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

  4. Stray-field-induced Faraday contributions in wide-field Kerr microscopy and -magnetometry

    International Nuclear Information System (INIS)

    Markó, D.; Soldatov, I.; Tekielak, M.; Schäfer, R.

    2015-01-01

    The magnetic domain contrast in wide-field Kerr microscopy on bulk specimens can be substantially distorted by non-linear, field-dependent Faraday rotations in the objective lens that are caused by stray-field components emerging from the specimen. These Faraday contributions, which were detected by Kerr-magnetometry on grain-oriented iron–silicon steel samples, are thoroughly elaborated and characterized. They express themselves as a field-dependent gray-scale offset to the domain contrast and in highly distorted surface magnetization curves if optically measured in a wide field Kerr microscope. An experimental method to avoid such distortions is suggested. In the course of these studies, a low-permeability part in the surface magnetization loop of slightly misoriented (110)-surfaces in iron–silicon sheets was discovered that is attributed to demagnetization effects in direction perpendicular to the sheet surface. - Highlights: • Magnetizing a finite sample in a Kerr microscope leads to sample-generated stray-fields. • They cause non-linear, field- and position-dependent Faraday rotations in the objective. • This leads to a modulation of the Kerr contrast and to distorted MOKE loops. • A method to compensate these Faraday rotations is presented

  5. Analytical description of the coefficient of demagnetization for chains of cores of granulesin the filter matrix of a magnetic separator Аналитическое описание коэффициента размагничивания разнопористых сердцевин цепочек гранул фильтр-матрицы магнитного сепаратора

    Directory of Open Access Journals (Sweden)

    Sandulyak Anna Aleksandrovna

    2013-09-01

    Full Text Available Particle capturing efficiency inside the filter matrix of a magnetic separator used in the treatment of ceramic suspensions, minerals, condensates, other liquids and gas depends immediately on the intensity of its magnetization capacity. Chains of granules of a filter matrix represent effective magnetization channels. Demagnetization intensity influences the magnetization intensity of the whole filter matrix and its separate chains that are also considered as magnetization channels. The pattern of calculation of demagnetization factor N (coefficient of demagnetization for such channel magnets is of utmost academic interest, and this pattern is provided in this article. The author provides values for demagnetization factor N for quasi solid cores ofchains of granules having with various lengths L and diameters d (metal concentra-tion 0.78—0.99, if magnetized by the field having the intensity of Н =18–175 kА/m. It isproven that the values of N and √ L / d have an exponential relation.Earlier, the author identified that the values of N for the porous media having a cylindrical form depend on the ratio of the length of magnet L to its diameter D . It is proven that the values of N and those of √ L / D also have an exponential relation. Therefore, this reciprocal conformity of relations in respect of the demagnetization factor for samples of the granulated medium (consisting of chains of magnets-channels and for cores of magnets-channels (having different porosity values has confirmed the similarity of the demagnetization factor for magnets having substantial and high concentration of the ferromagnetic material. The analytical description (the formula of the coefficient of demagnetization of channel cores is provided in the article.Исходя из оригинальной концепции о поканальном намагничивании гранулированных сред, в которых эффективными магне

  6. The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

    Directory of Open Access Journals (Sweden)

    Jeong Byung-Hoon

    2011-08-01

    Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

  7. Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

    Science.gov (United States)

    Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

    2017-03-01

    The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

  8. Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

    Science.gov (United States)

    Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

    2013-11-01

    While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Recent progress in photoactive organic field-effect transistors.

    Science.gov (United States)

    Wakayama, Yutaka; Hayakawa, Ryoma; Seo, Hoon-Seok

    2014-04-01

    Recent progress in photoactive organic field-effect transistors (OFETs) is reviewed. Photoactive OFETs are divided into light-emitting (LE) and light-receiving (LR) OFETs. In the first part, LE-OFETs are reviewed from the viewpoint of the evolution of device structures. Device performances have improved in the last decade with the evolution of device structures from single-layer unipolar to multi-layer ambipolar transistors. In the second part, various kinds of LR-OFETs are featured. These are categorized according to their functionalities: phototransistors, non-volatile optical memories, and photochromism-based transistors. For both, various device configurations are introduced: thin-film based transistors for practical applications, single-crystalline transistors to investigate fundamental physics, nanowires, multi-layers, and vertical transistors based on new concepts.

  10. Recent progress in photoactive organic field-effect transistors

    International Nuclear Information System (INIS)

    Wakayama, Yutaka; Hayakawa, Ryoma; Seo, Hoon-Seok

    2014-01-01

    Recent progress in photoactive organic field-effect transistors (OFETs) is reviewed. Photoactive OFETs are divided into light-emitting (LE) and light-receiving (LR) OFETs. In the first part, LE-OFETs are reviewed from the viewpoint of the evolution of device structures. Device performances have improved in the last decade with the evolution of device structures from single-layer unipolar to multi-layer ambipolar transistors. In the second part, various kinds of LR-OFETs are featured. These are categorized according to their functionalities: phototransistors, non-volatile optical memories, and photochromism-based transistors. For both, various device configurations are introduced: thin-film based transistors for practical applications, single-crystalline transistors to investigate fundamental physics, nanowires, multi-layers, and vertical transistors based on new concepts. (review)

  11. Asymptotic behavior of local dipolar fields in thin films

    Energy Technology Data Exchange (ETDEWEB)

    Bowden, G.J., E-mail: gjb@phys.soton.ac.uk [School of Physics and Astronomy, University of Southampton, SO17 1BJ (United Kingdom); Stenning, G.B.G., E-mail: Gerrit.vanderlaan@diamond.ac.uk [Magnetic Spectroscopy Group, Diamond Light Source, Didcot OX11 0DE (United Kingdom); Laan, G. van der, E-mail: gavin.stenning@stfc.ac.uk [ISIS Neutron and Muon Source, Rutherford Appleton Laboratory, Didcot OX11 0QX (United Kingdom)

    2016-10-15

    A simple method, based on layer by layer direct summation, is used to determine the local dipolar fields in uniformly magnetized thin films. The results show that the dipolar constants converge ~1/m where the number of spins in a square film is given by (2m+1){sup 2}. Dipolar field results for sc, bcc, fcc, and hexagonal lattices are presented and discussed. The results can be used to calculate local dipolar fields in films with either ferromagnetic, antiferromagnetic, spiral, exponential decay behavior, provided the magnetic order only changes normal to the film. Differences between the atomistic (local fields) and macroscopic fields (Maxwellian) are also examined. For the latter, the macro B-field inside the film is uniform and falls to zero sharply outside, in accord with Maxwell boundary conditions. In contrast, the local field for the atomistic point dipole model is highly non-linear inside and falls to zero at about three lattice spacing outside the film. Finally, it is argued that the continuum field B (used by the micromagnetic community) and the local field B{sub loc}(r) (used by the FMR community) will lead to differing values for the overall demagnetization energy. - Highlights: • Point-dipolar fields in uniformly magnetized thin films are characterized by just three numbers. • Maxwell's boundary condition is partially violated in the point-dipole approximation. • Asymptotic values of point dipolar fields in circular monolayers scale as π/r.

  12. Precise quantization of anomalous Hall effect near zero magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Bestwick, A. J. [Stanford Univ., Stanford, CA (United States); SLAC National Accelerator Lab., Menlo Park, CA (United States); Fox, E. J. [Stanford Univ., Stanford, CA (United States); SLAC National Accelerator Lab., Menlo Park, CA (United States); Kou, Xufeng [Univ. of California, Los Angeles, CA (United States); Pan, Lei [Univ. of California, Los Angeles, CA (United States); Wang, Kang L. [Univ. of California, Los Angeles, CA (United States); Goldhaber-Gordon, D. [Stanford Univ., Stanford, CA (United States); SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2015-05-04

    In this study, we report a nearly ideal quantum anomalous Hall effect in a three-dimensional topological insulator thin film with ferromagnetic doping. Near zero applied magnetic field we measure exact quantization in the Hall resistance to within a part per 10,000 and a longitudinal resistivity under 1 Ω per square, with chiral edge transport explicitly confirmed by nonlocal measurements. Deviations from this behavior are found to be caused by thermally activated carriers, as indicated by an Arrhenius law temperature dependence. Using the deviations as a thermometer, we demonstrate an unexpected magnetocaloric effect and use it to reach near-perfect quantization by cooling the sample below the dilution refrigerator base temperature in a process approximating adiabatic demagnetization refrigeration.

  13. Inversion of Gravity and Magnetic Field Data for Tyrrhena Patera

    Science.gov (United States)

    Milbury, C.; Schubert, G.; Raymond, C. A.; Smrekar, S. E.

    2011-01-01

    Tyrrhena Patera is located to the southeast/northeast of the Isidis/Hellas impact basin. It was geologically active into the Late Amazonian, although the main edifice was formed in the Noachian(approximately 3.7-4.0 Ga). Tyrrhena Patera and the surrounding area contain gravity and magnetic anomalies that appear to be correlated. The results presented here are for the anomalies 1a and 1b (closest to Tyrrhena Patera), however other anomalies in this region have been modeled and will be presented at the conference.The Mars Global Surveyor (MGS) free-air gravity signature of Tyrrhena Patera has been studied by Kiefer, who inferred the existence of an extinct magma chamber below it. The magnetic signature has been mapped by Lillis R. J. et al., who compared electron reflectometer data, analogous to the total magnetic field, for Syrtis Major and Tyrrhena Patera and argued for demagnetization of both volcanoes.

  14. Proton and deuterium NMR experiments in zero field

    International Nuclear Information System (INIS)

    Millar, J.M.

    1986-02-01

    High field solid-state NMR lineshapes suffer from inhomogeneous broadening since resonance frequencies are a function of molecular orientation. Time domain zero field NMR is a two-dimensional field-cycling technique which removes this broadening by probing the evolution of the spin system under zero applied field. The simplest version, the sudden transition experiment, induces zero field evolution by the sudden removal of the applied magnetic field. Theory and experimental results of this experiment and several variations using pulsed dc magnetic fuelds to initiate zero field evolution are presented. In particular, the pulsed indirect detection method allows detection of the zero field spectrum of one nuclear spin species via another (usually protons) by utilizing the level crossings which occur upon adiabatic demagnetization to zero field. Experimental examples of proton/deuteron systems are presented which demonstrate the method results in enhanced sensitivity relative to that obtained in sudden transition experiments performed directly on deuterium. High resolution 2 H NQR spectra of a series of benzoic acid derivatives are obtained using the sudden transition and indirect detection methods. Librational oscillations in the water molecules of barium chlorate monohydrate are studied using proton and deuterium ZF experiments. 177 refs., 88 figs., 2 tabs

  15. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  16. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  17. Hysteresis, critical fields and superferromagnetism of the film with perpendicular anisotropy

    International Nuclear Information System (INIS)

    Kalita, V.M.; Kulyk, M.M.; Ryabchenko, S.M.

    2016-01-01

    This paper is focused on the analysis of hysteresis and critical phenomena of magnetization reversal of superferromagnetic (SFM) state in nanogranular (NG) Co/Al 2 O 3 film with perpendicular anisotropy. It was demonstrated that the transition from the multidomain SFM state to the homogeneous SFM state, during the magnetization process, occurs critically. The value of the field of critical transition to the homogeneous state depends on the demagnetization field, granular anisotropy and interparticle exchange anisotropy. It turned out that the temperature dependence of the coercive force of the film, despite its SFM state, accords with the Neel–Brown formula for anisotropic single-domain ferromagnetic particles, but has an anomalous angular dependence. It was concluded that domain wall motion affects these features of the coercive field. The domain wall movement may occur due to the overturn of magnetic moments of particles in the boundaries between the superdomains. At the same time, the main factors influencing the coercivity are the anisotropy of the particles, which blocks their magnetic moment reorientation, and demagnetizing factor of the film. Together they lead to the anomalous angular dependence of the coercive field. - Highlights: • The transition from the multidomain SFM to homogeneous SFM state occurs critically. • The value of the critical field depends on the direction of the magnetizing field. • Critical transition field depends on the anisotropy of the interparticle exchange. • Dependence of H c (θ H ) differs from expected one for an ensemble of the particles. • Magnetization reversal occurs by turning the particle's moments in domain borders.

  18. Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

    Science.gov (United States)

    Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

    2014-02-01

    The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. 48Ca+249Bk fusion reaction leading to element Z = 117: long-lived α-decaying 270Db and discovery of 266Lr.

    Science.gov (United States)

    Khuyagbaatar, J; Yakushev, A; Düllmann, Ch E; Ackermann, D; Andersson, L-L; Asai, M; Block, M; Boll, R A; Brand, H; Cox, D M; Dasgupta, M; Derkx, X; Di Nitto, A; Eberhardt, K; Even, J; Evers, M; Fahlander, C; Forsberg, U; Gates, J M; Gharibyan, N; Golubev, P; Gregorich, K E; Hamilton, J H; Hartmann, W; Herzberg, R-D; Heßberger, F P; Hinde, D J; Hoffmann, J; Hollinger, R; Hübner, A; Jäger, E; Kindler, B; Kratz, J V; Krier, J; Kurz, N; Laatiaoui, M; Lahiri, S; Lang, R; Lommel, B; Maiti, M; Miernik, K; Minami, S; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Pang, G K; Papadakis, P; Renisch, D; Roberto, J; Rudolph, D; Runke, J; Rykaczewski, K P; Sarmiento, L G; Schädel, M; Schausten, B; Semchenkov, A; Shaughnessy, D A; Steinegger, P; Steiner, J; Tereshatov, E E; Thörle-Pospiech, P; Tinschert, K; Torres De Heidenreich, T; Trautmann, N; Türler, A; Uusitalo, J; Ward, D E; Wegrzecki, M; Wiehl, N; Van Cleve, S M; Yakusheva, V

    2014-05-02

    The superheavy element with atomic number Z=117 was produced as an evaporation residue in the (48)Ca+(249)Bk fusion reaction at the gas-filled recoil separator TASCA at GSI Darmstadt, Germany. The radioactive decay of evaporation residues and their α-decay products was studied using a detection setup that allowed measuring decays of single atomic nuclei with half-lives between sub-μs and a few days. Two decay chains comprising seven α decays and a spontaneous fission each were identified and are assigned to the isotope (294)117 and its decay products. A hitherto unknown α-decay branch in (270)Db (Z = 105) was observed, which populated the new isotope (266)Lr (Z = 103). The identification of the long-lived (T(1/2) = 1.0(-0.4)(+1.9) h) α-emitter (270)Db marks an important step towards the observation of even more long-lived nuclei of superheavy elements located on an "island of stability."

  20. Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

    International Nuclear Information System (INIS)

    Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

    2011-01-01

    General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

  1. Long-term determination of airborne concentrations of unattached and attached radon progeny using stacked LR 115 detector with multi-step etching

    International Nuclear Information System (INIS)

    Nikezic, D.; Yu, K.N.

    2010-01-01

    We developed the theoretical basis for long-term determination of airborne concentrations of unattached and attached radon progeny. The work was separated into two parts. First, we showed that (stacked and multiply etched) LR 115 detectors could be used to determine airborne concentrations of the short-lived radon progeny, 218 Po and 214 Bi. The equilibrium factor F between radon and its progeny could then be determined through the use of the reduced equilibrium factor F red . The airborne concentrations of 214 Pb could then be determined. Second, we developed a method based on the airborne concentrations of 218 Po, 214 Pb and 214 Bi to determine the parameters of the Jacobi room model, viz., the ventilation rate λ v , aerosol attachment rate λ a , deposition rate of unattached progeny λ d u and the deposition rate of attached progeny λ d u . With these parameters, the unattached fraction f p of the potential alpha energy concentration could also be determined. Knowledge of f p , together with F, would enable more accurate determination of the effective dose in the human lung.

  2. Predicting performance of polymer-bonded Terfenol-D composites under different magnetic fields

    International Nuclear Information System (INIS)

    Guan Xinchun; Dong Xufeng; Ou Jinping

    2009-01-01

    Considering demagnetization effect, the model used to calculate the magnetostriction of the single particle under the applied field is first created. Based on Eshelby equivalent inclusion and Mori-Tanaka method, the approach to calculate the average magnetostriction of the composites under any applied field, as well as the saturation, is studied by treating the magnetostriction particulate as an eigenstrain. The results calculated by the approach indicate that saturation magnetostriction of magnetostrictive composites increases with an increase of particle aspect and particle volume fraction, and a decrease of Young's modulus of the matrix. The influence of an applied field on magnetostriction of the composites becomes more significant with larger particle volume fraction or particle aspect. Experiments were done to verify the effectiveness of the model, the results of which indicate that the model only can provide approximate results.

  3. A study of the suitability of ferrite for use in low-field insertion devices

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, K.; Hassenzahl, W.V.

    1995-02-01

    Most insertion devices built to date use rare-earth permanent-magnet materials, which have a high remanent field and are more expensive than many other permanent-magnet materials. Low-field insertion devices could use less-expensive, lower performance magnetic materials if they had suitable magnetic characteristics. These materials must be resistant to demagnetization during construction and operation of the insertion device, have uniform magnetization, possess low minor-axis magnetic moments, and have small minor field components on the surfaces. This paper describes an investigation to determine if ferrite possesses magnetic qualities suitable for insertion device applications. The type of ferrite investigated, MMPA Ceramic 8 from Stackpole Inc., was found to be acceptable for insertion device applications.

  4. Paleomagnetism in the Determination of the Emplacement Temperature of Cerro Colorado Tuff Cone, El Pinacate Volcanic Field, Sonora, Mexico.

    Science.gov (United States)

    Rodriguez Trejo, A.; Alva-Valdivia, L. M.; Vidal Solano, J. R.; Garcia Amador, B.; Gonzalez-Rangel, J. A.

    2014-12-01

    Cerro Colorado Maar is located at the World Heritage Site, biosphere reserve El Pinacate and Gran Desierto del Altar, at the NNW region of Sonora, Mexico (in El Pinacate Volcanic Field). It is a tuff cone, about 1 km diameter, result of several phreatomagmatic episodes during the late Quaternary. We report paleomagnetic and rock magnetic properties from fusiform volcanic bombs obtained from the borders of Cerro Colorado. This study is based in the thermoremanent magnetization TRM normally acquired by volcanic rocks, which can be used to estimate the emplacement temperature range. We performed the experiments on 20 lithic fragments (10 cm to 20 cm approximately), taking 6-8 paleomagnetic cores from each. Rock magnetic experiments (magnetic susceptibility vs. temperature (k-T), hysteresis curves and FORC analysis, shows that the main magnetic mineral carriers of magnetization are titanomagnetite and titanohematite in different levels of intergrowth. The k-T curves suggest in many cases, only one magnetic phase, but also in other cases a second magnetic phase. Thermal demagnetization was used to demagnetize the specimens in detailed short steps and make a well-defined emplacement temperature determination ranges. We found that temperature emplacement determination range for these two magnetic phases is between 350-450 °C, and 550-580 °C, respectively. These results are consistent with those expected in an eruption of Surtsey type, showing a distinct volcanic activity compared to the other craters from El Pinacate volcanic field.

  5. Performance degradation of ferrofluidic feedthroughs in a mixed irradiation field

    Science.gov (United States)

    Simos, Nikolaos; Fernandes, S.; Mittig, Wolfgang; Pellemoine, Frederique; Avilov, M.; Kostin, M.; Mausner, L.; Ronningen, R.; Schein, M.; Bollen, G.

    2017-01-01

    Ferrofluidic feedthrough (FF) rotary seals containing either NdFeB or SmCo-type permanent magnets have been considered for use in the target and beam dump systems of the Facility for Rare Isotope Beams (FRIB). To evaluate their performance under irradiation three FF seals were irradiated in a mixed field consisting of fast neutrons, protons and γ-rays to an average absorbed dose of 0.2, 2.0, and 20.0 MGy at the Brookhaven Linac Isotope Producer facility (BLIP). The radiation types and energy profiles mimic those expected at the FRIB facility. Degradation of the operational performance of these devices due to irradiation is expected to be the result of the de-magnetization of the permanent magnets contained within the seal and the changes in the ferrofluid properties. Post-irradiation performance was evaluated by determining the ferrofluidic seal vacuum tightness and torque under static and dynamic conditions. The study revealed that the ferrofluidic feedthrough seal irradiated to a dose of 0.2 MGy maintained its vacuum tightness under both static and rotational condition while the one irradiated to a dose of 2.0 MGy exhibited signs of ferrofluid damage but no overall performance loss. At 20 MGy dose the effects of irradiation on the ferrofluid properties (viscosity and particle agglomeration) were shown to be severe. Furthermore, limited de-magnetization of the annular shaped Nd2Fe14B and Sm2Co17 magnets located within the irradiated FFs was observed for doses of 0.2 MGy and 20 MGy respectively.

  6. The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

    Directory of Open Access Journals (Sweden)

    Valentina Kubale

    2016-07-01

    Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

  7. Melt-processed Gd-Ba-Cu-O superconductor with trapped field of 3 T at 77 K

    International Nuclear Information System (INIS)

    Nariki, S; Sakai, N; Murakami, M

    2005-01-01

    We fabricated a single-domain Gd-Ba-Cu-O bulk superconductor 65 mm in diameter and studied the microstructure, superconducting and field-trapping properties. Melt-processing was performed under a controlled oxygen partial pressure of 1.0% using a precursor containing Gd123 and Gd211 powders in a molar ratio of 2:1, with 0.5 wt% of Pt and 20 wt% of Ag 2 O added. The distribution of Ag and Gd211 particles was almost homogeneous. The addition of Ag was very effective in reducing the amount of cracking in the sample. The maximum trapped magnetic field recorded was 3.05 T at 77 K. We also measured the trapped field between two Gd-Ba-Cu-O bulk samples in order to minimize the demagnetizing effect and found that the trapped field reached 4.3 T at 77 K

  8. Antagonism of yeasts to Xanthomonas campestris pv. campestris on cabbage phylloplane in field Antagonismo de leveduras a Xanthomonas campestris pv. campestris no filoplano de repolho em condições de campo

    Directory of Open Access Journals (Sweden)

    Sayonara M.P. Assis

    1999-07-01

    Full Text Available Twenty yeast isolates, obtained from cabbage phylloplane, were evaluated for antagonistic activity against Xanthomonas campestris pv. campestris, in field. Plants of cabbage cv. Midori were pulverized simultaneously with suspensions of antagonists and pathogen. After 10 days, plants were evaluated through percentage of foliar area with lesions. Percentage of disease severity reduction (DSR% was also calculated. Yeast isolates LR32, LR42 and LR19 showed, respectively, 72, 75 and 79% of DSR. These antagonists were tested in seven different application periods in relation to pathogen inoculation (T1=4 d before; T2=simultaneously; T3=4 d after; T4=4 d before + simultaneously; T5=4 d after + simultaneously; T6=4 d before + 4 d after; T7=4 d before + simultaneously + 4 d after. The highest DSRs were showed by LR42 (71%, LR42 (67%, LR35 (69% and LR19 (68% in the treatments T7, T4, T5 and T6, which significantly differed from the others. The same yeast antagonists were also tested for black rot control using different cabbage cultivars (Fuyutoyo, Master-325, Matsukaze, Midori, Sekai I and Red Winner. The DSRs varied from 58 to 61%, and there was no significant difference among cultivars.Vinte isolados de leveduras, obtidos a partir do filoplano de repolho foram avaliados pela atividade antagônica contra Xanthomonas campestris pv. campestris, em condições de campo. Plantas de repolho cv. Midori foram pulverizadas simultaneamente com suspensões do antagonista e do patógeno. Após 10 dias, as plantas foram avaliadas através da porcentagem de área foliar infectada. A porcentagem de redução da severidade da doença (DSR%, também foi calculada. Os isolados de leveduras LR32, LR42 e LR19 apresentaram, respectivamente, 72, 75 e 79% de DSR. Estes isolados foram testados em sete diferentes períodos de aplicação dos antagonistas em relação a inoculação do patógeno. (T1=4d antes; T2=simultaneamente; T3=4 d após; T4=4 d antes + simultaneamente; T5

  9. A Comparative Analysis of the Magnetic Field Signals over Impact Structures on the Earth, Mars and the Moon

    Science.gov (United States)

    Isac, Anca; Mandea, Mioara; Purucker, Michael; Langlais, Benoit

    2015-01-01

    An improved description of magnetic fields of terrestrial bodies has been obtained from recent space missions, leading to a better characterization of the internal fields including those of crustal origin. One of the striking differences in their crustal magnetic field is the signature of large impact craters. A comparative analysis of the magnetic characteristics of these structures can shed light on the history of their respective planetary-scale magnetic dynamos. This has motivated us to identify impact craters and basins, first by their quasi-circular features from the most recent and detailed topographic maps and then from available global magnetic field maps. We have examined the magnetic field observed above 27 complex craters on the Earth, 34 impact basins on Mars and 37 impact basins on the Moon. For the first time, systematic trends in the amplitude and frequency of the magnetic patterns, inside and outside of these structures are observed for all three bodies. The demagnetization effects due to the impact shock wave and excavation processes have been evaluated applying the Equivalent Source Dipole forward modeling approach. The main characteristics of the selected impact craters are shown. The trends in their magnetic signatures are indicated, which are related to the presence or absence of a planetary-scale dynamo at the time of their formation and to impact processes. The low magnetic field intensity at center can be accepted as the prime characteristic of a hypervelocity impact and strongly associated with the mechanics of impact crater formation. In the presence of an active internal field, the process of demagnetization due to the shock impact is associated with post-impact remagnetization processes, generating a more complex magnetic signature.

  10. Precise measurement of remanent magnetism of rocks under non-magnetic fields; Mujikaika deno ganseki zanryu jiki no seimitsu sokutei

    Energy Technology Data Exchange (ETDEWEB)

    Oda, Y; Nakatsuka, K [Tohoku University, Sendai (Japan)

    1997-10-22

    Various magnetic information data from solidification or deposition up to date are contained in rocks. For the analysis of remanent magnetism, in general, the stable thermal remanent magnetization and the secondary magnetization are separately evaluated using vector variations determined by the location changes of magnetic pole from ac demagnetization or thermal demagnetization. Especially, in geothermal fields, the remanent magnetism in rocks is complicated due to the predominant alteration. When the remanent magnetism of rocks can be precisely measured and the primary and secondary magnetization can be evaluated, important data can be obtained, which represent oriented core samples required for evaluating the geothermal reservoirs. A rock remanent magnetism measuring system using superconductive magnetic shield has been developed, to evaluate the location of magnetic pole. This system can distinguish the remanent magnetization in rocks, and can be applied to the remanent magnetism in rocks in which the location of dipole model is shifted from the center of core. Important basic data of orientation information in rocks can be provided. 6 figs.

  11. Optimizing the field distribution of a Halbach type permanent magnet cylinder using the soft iron and superhard magnet

    Science.gov (United States)

    Xu, Xiaonong; Lu, Dingwei; Xu, Xibin; Yu, Yang; Gu, Min

    2018-01-01

    When a conventional Halbach type Hollow Cylindrical Permanent Magnet Array (HCPMA) is used to generate magnetic induction over the magnitude of coercivity μ0Hc, some detrimental parasitic magnetic phenomena, such as the demagnetization, magnetization reversal, and vortexes of magnetization, can appear in the interior of the magnets. We present a self-consistent quantitative analysis of the magnetization and magnetic induction distributions inside the magnetic array by considering the anisotropic and nonlinear magnetization functions of the materials consisting of the array. These numeric simulations reveal novel magnetization structures resulted from the self-field of array. We demonstrate that both the field uniformity and magnetic flux in the pole gap can be modulated by partially substituting the magnets of high energy products with the soft irons and the superhard magnets. We also show how the optimized substitution parameters can be obtained for a HCPMA achieving the best field uniformity or the maximum magnetic flux.

  12. Self-Generated Magnetic Fields in the Stagnation Phase of Indirect-Drive Implosions on the National Ignition Facility

    Science.gov (United States)

    Walsh, C. A.; Chittenden, J. P.; McGlinchey, K.; Niasse, N. P. L.; Appelbe, B. D.

    2017-04-01

    Three-dimensional extended-magnetohydrodynamic simulations of the stagnation phase of inertial confinement fusion implosion experiments at the National Ignition Facility are presented, showing self-generated magnetic fields over 104 T . Angular high mode-number perturbations develop large magnetic fields, but are localized to the cold, dense hot-spot surface, which is hard to magnetize. When low-mode perturbations are also present, the magnetic fields are injected into the hot core, reaching significant magnetizations, with peak local thermal conductivity reductions greater than 90%. However, Righi-Leduc heat transport effectively cools the hot spot and lowers the neutron spectra-inferred ion temperatures compared to the unmagnetized case. The Nernst effect qualitatively changes the results by demagnetizing the hot-spot core, while increasing magnetizations at the edge and near regions of large heat loss.

  13. Radon studies for extending Los Azufres geothermal energy field in Mexico

    International Nuclear Information System (INIS)

    Tavera, L.; Balcazar, M.; Camacho, M.E.; Chavez, A.; Perez, H.; Gomez, J.

    1999-01-01

    Los Azufres is a 98 MW producing geothermal energy field situated in the Mexican volcanic belt at the west part of the country. Recently, hydrothermal activity and geochemical analysis of geothermal fluids from the north part of the geothermal field gave indications of a possible geothermal-production area, similar to the already producing field. In order to investigate the activity of geological structures, which are considered the means of geothermal fluids transporters, radon mapping was carried out using sets of 240 LR-115 detectors in the area of interest. Radon values higher than 10 kBq m -3 were considered anomalous and indicative of geothermal anomalies

  14. Radon studies for extending Los Azufres geothermal energy field in Mexico

    CERN Document Server

    Tavera, L; Camacho, M E; Chavez, A; Pérez, H; Gómez, J

    1999-01-01

    Los Azufres is a 98 MW producing geothermal energy field situated in the Mexican volcanic belt at the west part of the country. Recently, hydrothermal activity and geochemical analysis of geothermal fluids from the north part of the geothermal field gave indications of a possible geothermal-production area, similar to the already producing field. In order to investigate the activity of geological structures, which are considered the means of geothermal fluids transporters, radon mapping was carried out using sets of 240 LR-115 detectors in the area of interest. Radon values higher than 10 kBq m sup - sup 3 were considered anomalous and indicative of geothermal anomalies.

  15. Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

    International Nuclear Information System (INIS)

    Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

    2005-01-01

    Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

  16. Effects of the shape anisotropy and biasing field on the magnetization reversal process of the diamond-shaped NiFe nano films

    Science.gov (United States)

    Xu, Sichen; Yin, Jianfeng; Tang, Rujun; Zhang, Wenxu; Peng, Bin; Zhang, Wanli

    2017-11-01

    The effects of the planar shape anisotropy and biasing field on the magnetization reversal process (MRP) of the diamond-shaped NiFe nano films have been investigated by micromagnetic simulations. Results show that when the length to width ratio (LWR) of the diamond-shaped film is small, the MRP of the diamond-shaped films are sensitive to LWR. But when LWR is larger than 2, a stable domain switching mode is observed which nucleates from the center of the diamond and then expands to the edges. At a fixed LWR, the magnitude of the switching fields decrease with the increase of the biasing field, but the domain switching mode is not affected by the biasing field. Further analysis shows that demagnetization energy dominates over the MRP of the diamond-shaped films. The above LWR dependence of MRP can be well explained by a variation of the shape anisotropic factor with LWR.

  17. Field driven ferromagnetic phase nucleation and propagation from the domain boundaries in antiferromagnetically coupled perpendicular anisotropy films

    Energy Technology Data Exchange (ETDEWEB)

    Hauet, Thomas; Gunther, Christian M.; Hovorka, Ondrej; Berger, Andreas; Im, Mi-Young; Fischer, Peter; Hellwig, Olav

    2008-12-09

    We investigate the reversal process in antiferromagnetically coupled [Co/Pt]{sub X-1}/{l_brace}Co/Ru/[Co/Pt]{sub X-1}{r_brace}{sub 16} multilayer films by combining magnetometry and Magnetic soft X-ray Transmission Microscopy (MXTM). After out-of-plane demagnetization, a stable one dimensional ferromagnetic (FM) stripe domain phase (tiger-tail phase) for a thick stack sample (X=7 is obtained), while metastable sharp antiferromagnetic (AF) domain walls are observed in the remanent state for a thinner stack sample (X=6). When applying an external magnetic field the sharp domain walls of the thinner stack sample transform at a certain threshold field into the FM stripe domain wall phase. We present magnetic energy calculations that reveal the underlying energetics driving the overall reversal mechanisms.

  18. Remagnetization of bulk high-temperature superconductors subjected to crossed and rotating magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Vanderbemden, P [SUPRATECS and Department of Electrical Engineering and Computer Science B28, Sart-Tilman, B-4000 Liege (Belgium); Hong, Z [Centre for Advanced Photonics and Electronics, Engineering Department, University of Cambridge, 9 JJ Thomson Avenue, Cambridge CB3 0FA (United Kingdom); Coombs, T A [Centre for Advanced Photonics and Electronics, Engineering Department, University of Cambridge, 9 JJ Thomson Avenue, Cambridge CB3 0FA (United Kingdom); Ausloos, M [SUPRATECS and Department of Physics B5, Sart-Tilman, B-4000 Liege (Belgium); Babu, N Hari [IRC in Superconductivity, University of Cambridge, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cardwell, D A [IRC in Superconductivity, University of Cambridge, Madingley Road, Cambridge CB3 0HE (United Kingdom); Campbell, A M [IRC in Superconductivity, University of Cambridge, Madingley Road, Cambridge CB3 0HE (United Kingdom)

    2007-09-15

    Bulk melt-processed Y-Ba-Cu-O (YBCO) has significant potential for a variety of high-field permanent-magnet-like applications, such as the rotor of a brushless motor. When used in rotating devices of this kind, however, the YBCO can be subjected to both transient and alternating magnetic fields that are not parallel to the direction of magnetization and which have a detrimental effect on the trapped field. These effects may lead to long-term decay of the magnetization of the bulk sample. In the present work, we analyze both experimentally and numerically the remagnetization process of a melt-processed YBCO single domain that has been partially demagnetized by a magnetic field applied orthogonal to the initial direction of trapped flux. Magnetic torque measurements are used as a tool to probe changes in the remanent magnetization during various sequences of applied field. The application of a small magnetic field between the transverse cycles parallel to the direction of original magnetization results in partial remagnetization of the sample. Rotating the applied field, however, is found to be much more efficient at remagnetizing the bulk material than applying a magnetizing field pulse of the same amplitude. The principal features of the experimental data can be reproduced qualitatively using a two-dimensional finite-element numerical model based on an E-J power law. Finally, the remagnetization process is shown to result from the complex modification of current distribution within the cross-section of the bulk sample.

  19. Remagnetization of bulk high-temperature superconductors subjected to crossed and rotating magnetic fields

    International Nuclear Information System (INIS)

    Vanderbemden, P; Hong, Z; Coombs, T A; Ausloos, M; Babu, N Hari; Cardwell, D A; Campbell, A M

    2007-01-01

    Bulk melt-processed Y-Ba-Cu-O (YBCO) has significant potential for a variety of high-field permanent-magnet-like applications, such as the rotor of a brushless motor. When used in rotating devices of this kind, however, the YBCO can be subjected to both transient and alternating magnetic fields that are not parallel to the direction of magnetization and which have a detrimental effect on the trapped field. These effects may lead to long-term decay of the magnetization of the bulk sample. In the present work, we analyze both experimentally and numerically the remagnetization process of a melt-processed YBCO single domain that has been partially demagnetized by a magnetic field applied orthogonal to the initial direction of trapped flux. Magnetic torque measurements are used as a tool to probe changes in the remanent magnetization during various sequences of applied field. The application of a small magnetic field between the transverse cycles parallel to the direction of original magnetization results in partial remagnetization of the sample. Rotating the applied field, however, is found to be much more efficient at remagnetizing the bulk material than applying a magnetizing field pulse of the same amplitude. The principal features of the experimental data can be reproduced qualitatively using a two-dimensional finite-element numerical model based on an E-J power law. Finally, the remagnetization process is shown to result from the complex modification of current distribution within the cross-section of the bulk sample

  20. Observation of field-induced long-range order in disordered Sr14Cu24O41

    International Nuclear Information System (INIS)

    Ohsugi, S.; Matsumoto, S.; Kitaoka, Y.; Matsuda, M.; Uehara, M.; Nagata, T.; Akimitsu, J.

    2004-01-01

    Field-induced magnetic order in a structural disordered single-crystal Sr 14 Cu 24 O 41 (Sr 14 -B) has been observed in the Cu-nuclear magnetic resonance (NMR) measurements for the ladder sites below 20 K under the magnetic field H∼11 T. For the Zhang Rice (ZR) sites in the chains, the spectrum splits below 20 K due to an appearance of the internal field, whereas that of less disordered Sr 14 -A does not. This gives an evidence of three-dimensional (3D) long-range (LR) ordering in Sr 14 -B below T N ∼20 K under H∼11 T

  1. A general nonlinear magnetomechanical model for ferromagnetic materials under a constant weak magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Pengpeng; Zheng, Xiaojing, E-mail: xjzheng@xidian.edu.cn [School of Mechano-Electronic Engineering, Xidian University, Xi' an 710071, Shaanxi (China); Jin, Ke [School of Aerospace Science and Technology, Xidian University, Xi' an 710071, Shaanxi (China)

    2016-04-14

    Weak magnetic nondestructive testing (e.g., metal magnetic memory method) concerns the magnetization variation of ferromagnetic materials due to its applied load and a weak magnetic surrounding them. One key issue on these nondestructive technologies is the magnetomechanical effect for quantitative evaluation of magnetization state from stress–strain condition. A representative phenomenological model has been proposed to explain the magnetomechanical effect by Jiles in 1995. However, the Jiles' model has some deficiencies in quantification, for instance, there is a visible difference between theoretical prediction and experimental measurements on stress–magnetization curve, especially in the compression case. Based on the thermodynamic relations and the approach law of irreversible magnetization, a nonlinear coupled model is proposed to improve the quantitative evaluation of the magnetomechanical effect. Excellent agreement has been achieved between the predictions from the present model and previous experimental results. In comparison with Jiles' model, the prediction accuracy is improved greatly by the present model, particularly for the compression case. A detailed study has also been performed to reveal the effects of initial magnetization status, cyclic loading, and demagnetization factor on the magnetomechanical effect. Our theoretical model reveals that the stable weak magnetic signals of nondestructive testing after multiple cyclic loads are attributed to the first few cycles eliminating most of the irreversible magnetization. Remarkably, the existence of demagnetization field can weaken magnetomechanical effect, therefore, significantly reduces the testing capability. This theoretical model can be adopted to quantitatively analyze magnetic memory signals, and then can be applied in weak magnetic nondestructive testing.

  2. The relationship between the presence and extent of lobular carcinoma in situ (LCIS) and the risk of local recurrence (LR) in patients with infiltrating cancer of the breast treated with conservative surgery (CS) and radiation therapy (RT)

    International Nuclear Information System (INIS)

    Abner, A.; Schnitt, S.; Connolly, J.; Recht, A.; Bornstein, B.; Nixon, A.; Hetelekidis, S.; Silver, B.; Harris, J.R.

    1997-01-01

    Purpose: Lobular carcinoma in situ, when found in an otherwise benign breast biopsy, is associated with an increased risk of developing a subsequent invasive breast cancer. Among patients with an infiltrating cancer resected without margin assessment, the extent of ductal carcinoma in situ is an established risk factor for LR after CS and RT. However, the association between the presence and extent of LCIS and the risk of recurrence in patients treated with CS and RT for infiltrating breast cancer remains at issue. Materials and Methods: Between 1968 and 1986, 1625 patients with clinical stage T1 and T2 invasive breast cancer were treated at the Joint Center for Radiation Therapy with complete gross tumor excision and RT to a total of ≥60 Gy. Of these, 1160 had infiltrating ductal cancer (IDC), infiltrating lobular cancer (ILC), or mixed IDC/ILC (IMC) and sufficient pathologic material for review by the study pathologists (SS and JC) to establish the presence or absence of LCIS and were evaluable at 10 years. LCIS was present adjacent to the invasive cancer in (43(1027)) IDC (4%), and either within or adjacent to the infiltrating tumor in (70(82)) ILC (85%) and (26(51)) IMC (51%). Margins were evaluable in 35% of LCIS-positive patients and 33% of LCIS-negative patients. The median follow-up time was 153 months for surviving patients. Results: The 10-year crude risk of recurrence by first site of failure for all patients was as follows: Furthermore, there was no significant relationship between the extent of the LCIS adjacent to the invasive tumor and the LR risk: The 10-year crude risk of contralateral breast cancer was 7% for the patients with LCIS and 7% for those without LCIS. CONCLUSION: We conclude that neither the presence nor the extent of LCIS is related to the risk of LR in patients with invasive breast cancer treated with CS and RT. Thus, LCIS should not be considered a contraindication to breast conservation with CS and RT

  3. Effects of small magnetic fields on the critical current of thin films

    International Nuclear Information System (INIS)

    Passos, Wagner de Assis Cangussu; Lisboa-Filho, Paulo Noronha; Ortiz, Wilson Aires; Kang, W.N.; Choi, Eun-Mi; Hyeong-Jin, Kim; Lee, Sung-Ik Lee

    2002-01-01

    Full text: Magnetic fields applied perpendicularly to superconducting thin films may produce dendritic patterns, where penetrated and Meissner regions coexist, as observed in Nb, YBaCuO and MgB 2 [1]. A temperature-dependent limiting-field, Hd(T), separates the dendritic mode from a critical-state-like penetration regime. Due to large demagnetizing factors in the perpendicular geometry, small fields may be enough to drive portions of the sample into the mixed state. Lack of symmetry and local defects might then permeate the dendritic mode. Hd(T) is related[2] to the bulk lower critical field, Hc1, which depends on the in-plane current density, J. Not surprisingly, Hd is depressed by J[3]. The dendritic mode can be detected by the AC-susceptibility: penetrated fingers act as intergranular material, and the imaginary component peaks at Tc-inter(J). Films of 0.2-0.4 microns, with millimeter lateral sizes, develop dendrites when submitted to Earth's field[2], what limits the critical current, J c . This contribution studies how J c is affected by field-induced granularity in thin films. 1. C. A. Duran et al., PRB 52 (1995) 75; P. Leiderer et al., PRL. 71 (1993) 2646; T.H. Johansen et al., Supercond. Sci. Technol. 14 (2001) 1. 2. W. A. Ortiz et al., Physica C 361 (2001) 267. 3. A. V. Bobyl et al., cond-mat/0201260, submitted to APL

  4. Remoção de microcistina-LR da Microcystis aeruginosa utilizando bagaço de cana-de-açúcar in natura e carvão ativado

    OpenAIRE

    Almeida,Aline Rafaela de; Passig,Fernando Hermes; Pagioro,Thomaz Aurélio; Nascimento,Priscila Tiemi Higuti do; Carvalho,Karina Querne de

    2016-01-01

    Resumo Microcistina-LR é um tipo de toxina liberada pela cianobactéria Microcystis aeruginosa encontrada em mananciais de água usados para abastecimento humano que pode causar doenças e até mesmo a mortandade do homem se não for totalmente removida no tratamento convencional da água. A retenção desta toxina é muitas vezes realizada através do processo de adsorção em carvão ativado nas estações de tratamento de água. Neste estudo foi avaliada a utilização do bagaço de cana-de-açúcar in natura ...

  5. Complete Sensitivity/Uncertainty Analysis of LR-0 Reactor Experiments with MSRE FLiBe Salt and Perform Comparison with Molten Salt Cooled and Molten Salt Fueled Reactor Models

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mueller, Don [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-12-01

    In September 2016, reactor physics measurements were conducted at Research Centre Rez (RC Rez) using the FLiBe (2 7LiF + BeF2) salt from the Molten Salt Reactor Experiment (MSRE) in the LR-0 low power nuclear reactor. These experiments were intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems using FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL), in collaboration with RC Rez, performed sensitivity/uncertainty (S/U) analyses of these experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objectives of these analyses were (1) to identify potential sources of bias in fluoride salt-cooled and salt-fueled reactor simulations resulting from cross section uncertainties, and (2) to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a final report on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. In the future, these S/U analyses could be used to inform the design of additional FLiBe-based experiments using the salt from MSRE. The key finding of this work is that, for both solid and liquid fueled fluoride salt reactors, radiative capture in 7Li is the most significant contributor to potential bias in neutronics calculations within the FLiBe salt.

  6. Neutron and photon spectrometry in mixed radiation fields

    International Nuclear Information System (INIS)

    Jancar, A.; Kopecky, Z.; Veskrna, M.

    2014-01-01

    Spectrometric measurements of the mixed fields of neutron and photon radiation in the workplaces with the L-R-0 research reactor located in the UJV Rez and with the Van de Graaff accelerator, located in the UTEF laboratories Prague, are presented in this paper. The experimental spectrometric measurements were performed using a newly developed digital measuring system, based on the technology of analog-digital converters with a very high sampling frequency (up to 2 GHz), in connection with organic scintillation detector, type BC-501A, and stilbene detector. The results of experimental measurements show high quality of spectrometry mixed fields of neutron and photon radiation across the wide dynamic range of measured energy. (authors)

  7. Effect of sample shape on nonlinear magnetization dynamics under an external magnetic field

    International Nuclear Information System (INIS)

    Vagin, Dmitry V.; Polyakov, Oleg P.

    2008-01-01

    Effect of sample shape on the nonlinear collective dynamics of magnetic moments in the presence of oscillating and constant external magnetic fields is studied using the Landau-Lifshitz-Gilbert (LLG) approach. The uniformly magnetized sample is considered to be an ellipsoidal axially symmetric particle described by demagnetization factors and uniaxial crystallographic anisotropy formed some angle with an applied field direction. It is investigated as to how the change in particle shape affects its nonlinear magnetization dynamics. To produce a regular study, all results are presented in the form of bifurcation diagrams for all sufficient dynamics regimes of the considered system. In this paper, we show that the sample's (particle's) shape and its orientation with respect to the external field (system configuration) determine the character of magnetization dynamics: deterministic behavior and appearance of chaotic states. A simple change in the system's configuration or in the shapes of its parts can transfer it from chaotic to periodic or even static regime and back. Moreover, the effect of magnetization precession stall and magnetic moments alignment parallel or antiparallel to the external oscillating field is revealed and the way of control of such 'polarized' states is found. Our results suggest that varying the particle's shape and fields' geometry may provide a useful way of magnetization dynamics control in complex magnetic systems

  8. Structural effects on fusion reactor blankets due to liquid metals in magnetic fields

    International Nuclear Information System (INIS)

    Lehner, J.R.; Reich, M.; Powell, J.R.

    1976-01-01

    The transient stress distribution caused in the blanket structure when the plasma current suddenly switches off in a time short compared to the L/R decay time of the liquid metal blanket was studied. Poloidal field of the plasma will induce a current to flow in the liquid metal and blanket walls. Since the resistance of the liquid lithium will be much less than that of the metal walls, the current can be considered as flowing around the blanket near the cross section perimeter, but in the lithium

  9. Validation of General Electric Aviation DAPS2015 Digital Recording and 1/3 Octave Analysis System for Use in Support of Aircraft Noise Certification Efforts in Compliance with 14 CFR Part 36; Letter Report: V324-FA5JBQ-LR4 Rev. 1

    Science.gov (United States)

    2017-10-31

    NOTE: This is a revision of Letter Report V324-FA5JBQ-LR4. The purpose of the revision is to correctly identify the system designation for which the validation applies. The applicant originally identified the materials provided in support of this val...

  10. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  11. Field transformations to multivalued fields

    Energy Technology Data Exchange (ETDEWEB)

    Kleinert, H [Institut fuer Theoretische Physik, Arnimallee 14, D-14195 Berlin (Germany)

    2007-05-15

    Changes of field variables may lead to multivalued fields which do not satisfy the Schwarz integrability conditions. Their quantum field theory needs special care as is shown in an application to the superfluid and superconducting phase transitions.

  12. Toward constructing a time-series of geomagnetic field variations from thermal remanence in slowly cooled igneous rocks

    Science.gov (United States)

    Burns, Z.; Gee, J. S.

    2017-12-01

    Analysis of paleomagnetic data can not only help us to understand the behavior of the ancient magnetic field but may also further our understanding of the current field, as well as of the mechanisms and constraints of the geodynamo and geomagnetic reversals. A question of particular interest is the possible relationship between reversal frequency and geomagnetic field intensity. Some research appears to indicate a correlation between low intensity and high reversal frequency, seeming to support the theory that low field intensity is what makes reversals possible. In order to study this correlation, we obtained several hundred samples from the 182 Ma Dufek Massif, in Antarctica. This intrusion was cooled slowly, at depth, during the high reversal frequency era of the early Jurassic, and most of our samples record multiple polarity intervals. This, combined with their particularly homogeneous magnetic characteristics, makes them ideally suited for recovering a record of geomagnetic field variations. On approximately 300 samples from the lower portion of the intrusion, we performed step-wise thermal demagnetization of the natural remanent magnetization (NRM), followed by thermal demagnetization of a laboratory thermoremance (TRM), imparted as partial TRMs in three orthogonal directions to assess the reliability of the remanence. These two sets of measurements can tell us about the amount and direction of magnetization acquired at each temperature step and the sample's capacity to acquire a remanence. Corrected for anisotropy, the ratio of the NRM/TRM values at each step multiplied by the value of the lab field can give us an estimate of the paleofield intensity. When convolved with a thermal cooling model for the intrusion, this yields a model of the time-varying ancient field during the intrusion's cooling period. Initial analysis of our data shows average field values of around 20 µT and a minimum of four reversals. The average at this high-latitude site is lower

  13. Circular Wilson loops in defect conformal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Aguilera-Damia, Jeremías; Correa, Diego H. [Instituto de Física La Plata, CONICET, Universidad Nacional de La Plata,C.C. 67, 1900 La Plata (Argentina); Giraldo-Rivera, Victor I. [International Centre for Theoretical Sciences (ICTS-TIFR),Shivakote, Hesaraghatta Hobli, Bengaluru 560089 (India)

    2017-03-06

    We study a D3-D5 system dual to a conformal field theory with a codimension-one defect that separates regions where the ranks of the gauge groups differ by k. With the help of this additional parameter, as observed by Nagasaki, Tanida and Yamaguchi, one can define a double scaling limit in which the quantum corrections are organized in powers of λ/k{sup 2}, which should allow to extrapolate results between weak and strong coupling regimes. In particular we consider a radius R circular Wilson loop placed at a distance L, whose internal space orientation is given by an angle χ. We compute its vacuum expectation value and show that, in the double scaling limit and for small χ and small L/R, weak coupling results can be extrapolated to the strong coupling limit.

  14. Visual field

    Science.gov (United States)

    ... your visual field. How the Test is Performed Confrontation visual field exam. This is a quick and ... to achieve this important distinction for online health information and services. Learn more about A.D.A. ...

  15. Alteration in the Expression of Cytochrome P450s (CYP1A1, CYP2E1, and CYP3A11 in the Liver of Mouse Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Bangjun Zhang

    2015-03-01

    Full Text Available Microcystins (MCs are cyclic heptapeptide toxins and can accumulate in the liver. Cytochrome P450s (CYPs play an important role in the biotransformation of endogenous substances and xenobiotics in animals. It is unclear if the CYPs are affected by MCs exposure. The objective of this study was to evaluate the effects of microcystin-LR (MCLR on cytochrome P450 isozymes (CYP1A1, CYP2E1, and CYP3A11 at mRNA level, protein content, and enzyme activity in the liver of mice the received daily, intraperitoneally, 2, 4, and 8 µg/kg body weight of MCLR for seven days. The result showed that MCLR significantly decreased ethoxyresorufin-O-deethylase (EROD (CYP1A1 and erythromycin N-demthylase (ERND (CYP3A11 activities and increased aniline hydroxylase (ANH activity (CYP2E1 in the liver of mice during the period of exposure. Our findings suggest that MCLR exposure may disrupt the function of CYPs in liver, which may be partly attributed to the toxicity of MCLR in mice.

  16. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Science.gov (United States)

    Hrouzek, Pavel; Štys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036

  17. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Directory of Open Access Journals (Sweden)

    Jan Urban

    2013-01-01

    Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  18. Estimation of ion competition via correlated responsivity offset in linear ion trap mass spectrometry analysis: theory and practical use in the analysis of cyanobacterial hepatotoxin microcystin-LR in extracts of food additives.

    Science.gov (United States)

    Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  19. Dipolar local field in homogeneously magnetized quasi-two-dimensional crystals

    International Nuclear Information System (INIS)

    Leon, H; Estevez-Rams, E

    2009-01-01

    A formalism to calculate the dipolar local field in homogeneously magnetized quasi-two-dimensional (Q2D) crystals is comprehensively presented. Two fundamental tests for this formalism are accomplished: the transition from the Q2D quantities to the corresponding 3D ones; and the recovering of the macroscopic quantities of the 3D continuum theory. The additive separation between lattice and shape contributions to the local field allows an unambiguous interpretation of the respective effects. Calculated demagnetization tensors for square and circular lateral geometries of dipole layers show that for a single crystal layer an extremely thin film, but still with a finite thickness, is a better physical representation than a strictly 2D plane. Distinct close-packed structures are simulated and calculations of the local field at the nodes of the stacked 2D lattices allow one to establish the number of significantly coupled dipole layers, depending on the ratio between the interlayer distance and the 2D lattice constant. The conclusions drawn are of interest for the study of the dipolar interaction in magnetic ultrathin films and other nanostructured materials, where magnetic nanoparticles are embedded in non-magnetic matrices.

  20. Radiation hardness of permanent magnets of NdFeB in high energy neutron fields

    International Nuclear Information System (INIS)

    Shchegolev, V.Yu.

    2003-01-01

    Magnetic properties of NdFeB permanent magnet samples were measured before and after irradiation with conditions similar to conditions of DRIBs (phase 1) (FLNR, JINR) facility. Demagnetization of the samples after 8-day irradiation was found to be in the range of 17 to 87 %. Estimation of magnet 'life time' was made in the case of setting up these magnets on ECR ion source of DRIBs (phase 1) facility. Possible reasons of considerable demagnetization of the magnets are discussed. (author)

  1. Radiation Hardness of Permanent Magnets of NdFeB in High Energy Neutrons Field

    CERN Document Server

    Schegolev, V Yu

    2003-01-01

    Magnetic properties of NdFeB permanent magnet samples were measured before and after irradiation with conditions similar to conditions of DRIBs (phase 1) (FLNR, JINR) facility. Demagnetization of the samples after 8-day irradiation was found to be in the range of 17 to 87 \\%. Estimation of magnet "life tim" was made in the case of setting up these magnets on ECR ion source of DRIBs (phase 1) facility. Possible reasons of considerable demagnetization of the magnets are discussed.

  2. Radiation hardness of permanent magnets of NdFeB in high energy neutron fields

    CERN Document Server

    Shchegolev, V Y

    2003-01-01

    Magnetic properties of NdFeB permanent magnet samples were measured before and after irradiation with conditions similar to conditions of DRIBs (phase 1) (FLNR, JINR) facility. Demagnetization of the samples after 8-day irradiation was found to be in the range of 17 to 87 %. Estimation of magnet 'life time' was made in the case of setting up these magnets on ECR ion source of DRIBs (phase 1) facility. Possible reasons of considerable demagnetization of the magnets are discussed.

  3. The observation of resistivity change on the ultrasonic treated Fe-Cr ODS sinter alloy under magnetic field influence

    Science.gov (United States)

    Silalahi, Marzuki; Purwanto, Setyo; Mujamilah; Dimyati, Arbi

    2018-03-01

    About the observation of resistivity change on the ultrasonic treated Fe-Cr ODS sinter alloy under magnetic field influence. This paper reported about the observation of the resistivity change in the ultrasonic pre-treated Fe-Cr ODS sinter alloy under the influence of magnetic field at the Center for Science and Technology of Advanced Material, Nuclear Energy Agency of Indonesia. Fe-Cr ODS alloy were sinthesized by vacuum sintering of Fe- and Cr-powder dispersed Y2O3. However, before sintering the powder mixture was subjected to the irradiation process by ultrasonic for 50 hours at 20 kHz and then isostatic pressed up to 50.91 MPa to form a coin of 10 mm in diameter. LCR meassurement revealed the decreasing of resistivity about 3 times by increasing of applied magnetic field from 0 to 70 mT. In addition, VSM meassurement was performed on both as powder material and as sintered sample. The results showed increasing the magnetization with increasing magnetic field and the curve exhibits almost exact symmetry S-form with small hysterese indicating fast changing magnetization and demagnetization capability without energy loss. This opens strong speculations about the existence of magnetoresistant property of the material which is important for many application in field of sensors or electro magnetic valves.

  4. Magnetic Field

    DEFF Research Database (Denmark)

    Olsen, Nils

    2015-01-01

    he Earth has a large and complicated magnetic field, the major part of which is produced by a self-sustaining dynamo operating in the fluid outer core. Magnetic field observations provide one of the few tools for remote sensing the Earth’s deep interior, especially regarding the dynamics...... of the fluid flow at the top of the core. However, what is measured at or near the surface of the Earth is the superposition of the core field and fields caused by magnetized rocks in the Earth’s crust, by electric currents flowing in the ionosphere, magnetosphere, and oceans, and by currents induced...... in the Earth by time-varying external fields. These sources have their specific characteristics in terms of spatial and temporal variations, and their proper separation, based on magnetic measurements, is a major challenge. Such a separation is a prerequisite for remote sensing by means of magnetic field...

  5. Phase field

    International Nuclear Information System (INIS)

    Radhakrishnan, B.; Gorti, S.B.; Clarno, K.; Tonks, M.R.

    2015-01-01

    In this work, the phase-field method and its application to microstructure evolution in reactor fuel and clad are discussed. The examples highlight the capability of the phase-field method to capture evolution processes that are influenced by both thermal and elastic stress fields that are caused by microstructural changes in the solid-state. The challenges that need to be overcome before the technique can become predictive and material-specific are discussed. (authors)

  6. Time dependent mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2014-01-06

    We consider time dependent mean-field games (MFG) with a local power-like dependence on the measure and Hamiltonians satisfying both sub and superquadratic growth conditions. We establish existence of smooth solutions under a certain set of conditions depending both on the growth of the Hamiltonian as well as on the dimension. In the subquadratic case this is done by combining a Gagliardo-Nirenberg type of argument with a new class of polynomial estimates for solutions of the Fokker-Planck equation in terms of LrLp- norms of DpH. These techniques do not apply to the superquadratic case. In this setting we recur to a delicate argument that combines the non-linear adjoint method with polynomial estimates for solutions of the Fokker-Planck equation in terms of L1L1-norms of DpH. Concerning the subquadratic case, we substantially improve and extend the results previously obtained. Furthermore, to the best of our knowledge, the superquadratic case has not been addressed in the literature yet. In fact, it is likely that our estimates may also add to the current understanding of Hamilton-Jacobi equations with superquadratic Hamiltonians.

  7. Field Report

    DEFF Research Database (Denmark)

    Gorm Hansen, Louise Lyngfeldt

    2012-01-01

    This field report expresses perfectly the kind of confusion almost all of us experience when entering the field. How do we know whether what we’re doing is “right” or not? What in particular should we record when we don’t have time to write down everything among all the myriad impressions thrusting...

  8. Intact preservation of environmental samples by freezing under an alternating magnetic field.

    Science.gov (United States)

    Morono, Yuki; Terada, Takeshi; Yamamoto, Yuhji; Xiao, Nan; Hirose, Takehiro; Sugeno, Masaya; Ohwada, Norio; Inagaki, Fumio

    2015-04-01

    The study of environmental samples requires a preservation system that stabilizes the sample structure, including cells and biomolecules. To address this fundamental issue, we tested the cell alive system (CAS)-freezing technique for subseafloor sediment core samples. In the CAS-freezing technique, an alternating magnetic field is applied during the freezing process to produce vibration of water molecules and achieve a stable, super-cooled liquid phase. Upon further cooling, the temperature decreases further, achieving a uniform freezing of sample with minimal ice crystal formation. In this study, samples were preserved using the CAS and conventional freezing techniques at 4, -20, -80 and -196 (liquid nitrogen) °C. After 6 months of storage, microbial cell counts by conventional freezing significantly decreased (down to 10.7% of initial), whereas that by CAS-freezing resulted in minimal. When Escherichia coli cells were tested under the same freezing conditions and storage for 2.5 months, CAS-frozen E. coli cells showed higher viability than the other conditions. In addition, an alternating magnetic field does not impact on the direction of remanent magnetization in sediment core samples, although slight partial demagnetization in intensity due to freezing was observed. Consequently, our data indicate that the CAS technique is highly useful for the preservation of environmental samples. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Modification of the trapped field in bulk high-temperature superconductors as a result of the drilling of a pattern of artificial columnar holes

    International Nuclear Information System (INIS)

    Lousberg, Gregory P; Vanderbemden, Ph; Vanderheyden, B; Fagnard, J-F; Ausloos, M

    2010-01-01

    The trapped magnetic field is examined in bulk high-temperature superconductors that are artificially drilled along their c-axis. The influence of the hole pattern on the magnetization is studied and compared by means of numerical models and Hall probe mapping techniques. To this aim, we consider two bulk YBCO samples with a rectangular cross-section that are drilled each by six holes arranged either on a rectangular lattice (sample I) or on a centered rectangular lattice (sample II). For the numerical analysis, three different models are considered for calculating the trapped flux: (i), a two-dimensional (2D) Bean model neglecting demagnetizing effects and flux creep, (ii), a 2D finite-element model neglecting demagnetizing effects but incorporating magnetic relaxation in the form of an E - J power law, and, (iii), a 3D finite element analysis that takes into account both the finite height of the sample and flux creep effects. For the experimental analysis, the trapped magnetic flux density is measured above the sample surface by Hall probe mapping performed before and after the drilling process. The maximum trapped flux density in the drilled samples is found to be smaller than that in the plain samples. The smallest magnetization drop is found for sample II, with the centered rectangular lattice. This result is confirmed by the numerical models. In each sample, the relative drops that are calculated independently with the three different models are in good agreement. As observed experimentally, the magnetization drop calculated in the sample II is the smallest one and its relative value is comparable to the measured one. By contrast, the measured magnetization drop in sample (1) is much larger than that predicted by the simulations, most likely because of a change of the microstructure during the drilling process.

  10. Quasi-1D s=1/2 antiferromagnet Cs2CuCl4 in a magnetic field

    DEFF Research Database (Denmark)

    Coldea, R.; Tennant, D.A.; Cowley, R.A.

    1997-01-01

    than the field (similar or equal to 8 T) required to fully align the spins, are observed to decouple the chains, and the system enters a disordered intermediate-field phase (IFP). The IFP excitations are in agreement with the predictions of Muller et al. for the 1D S = 1/2 HAF, and Talstra and Haldane......Magnetic excitations of the quasi-1D S = 1/2 Heisenberg antiferromagnet (HAF) Cs2CuCl4 have beer measured as a function of magnetic field using neutron scattering. For T Fields greater than B-c = 1.66 T, but less...... for the related l/r(2) chain (the Haldane-Shastry model). This behavior is inconsistent with linear spin-wave theory....

  11. Field Notes

    Data.gov (United States)

    US Agency for International Development — This is a mobile application for capturing images , data, and geolocation for USAID projects in the field. The data is then stored on a server in AllNet. The...

  12. Selfdecomposable Fields

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole E.; Sauri, Orimar; Szozda, Benedykt

    In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master Lévy measure and the associated Lévy-Itô representation. We give the dilation criterion for selfdecomposa......In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master Lévy measure and the associated Lévy-Itô representation. We give the dilation criterion...... for selfdecomposability analogous to the classical one. Next, we give necessary and sufficient conditions (in terms of the kernel functions) for a Volterra field driven by a Lévy basis to be selfdecomposable. In this context we also study the so-called Urbanik classes of random fields. We follow this with the study...... of existence and selfdecomposability of integrated Volterra fields. Finally, we introduce infinitely divisible field-valued Lévy processes, give the Lévy-Itô representation associated with them and study stochastic integration with respect to such processes. We provide examples in the form of Lévy...

  13. Selfdecomposable Fields

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole E.; Sauri, Orimar; Szozda, Benedykt

    In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master L\\'evy measure and the associated L\\'evy-It\\^o representation. We give the dilation criterion for selfdec......In the present paper we study selfdecomposability of random fields, as defined directly rather than in terms of finite-dimensional distributions. The main tools in our analysis are the master L\\'evy measure and the associated L\\'evy-It\\^o representation. We give the dilation criterion...... for selfdecomposability analogous to the classical one. Next, we give necessary and sufficient conditions (in terms of the kernel functions) for a Volterra field driven by a L\\'evy basis to be selfdecomposable. In this context we also study the so-called Urbanik classes of random fields. We follow this with the study...... of existence and selfdecomposability of integrated Volterra fields. Finally, we introduce infinitely divisible field-valued L\\'evy processes, give the L\\'evy-It\\^o representation associated with them and study stochastic integration with respect to such processes. We provide examples in the form of L...

  14. Random Fields

    Science.gov (United States)

    Vanmarcke, Erik

    1983-03-01

    Random variation over space and time is one of the few attributes that might safely be predicted as characterizing almost any given complex system. Random fields or "distributed disorder systems" confront astronomers, physicists, geologists, meteorologists, biologists, and other natural scientists. They appear in the artifacts developed by electrical, mechanical, civil, and other engineers. They even underlie the processes of social and economic change. The purpose of this book is to bring together existing and new methodologies of random field theory and indicate how they can be applied to these diverse areas where a "deterministic treatment is inefficient and conventional statistics insufficient." Many new results and methods are included. After outlining the extent and characteristics of the random field approach, the book reviews the classical theory of multidimensional random processes and introduces basic probability concepts and methods in the random field context. It next gives a concise amount of the second-order analysis of homogeneous random fields, in both the space-time domain and the wave number-frequency domain. This is followed by a chapter on spectral moments and related measures of disorder and on level excursions and extremes of Gaussian and related random fields. After developing a new framework of analysis based on local averages of one-, two-, and n-dimensional processes, the book concludes with a chapter discussing ramifications in the important areas of estimation, prediction, and control. The mathematical prerequisite has been held to basic college-level calculus.

  15. Proton and deuterium NMR experiments in zero field. [Perdeuterated p-demethoxybenzene, perdeuterated malonic acid, diethyl terephthalate-d4, nonadecane-2,2'-D2, sodium propionate-D2

    Energy Technology Data Exchange (ETDEWEB)

    Millar, J.M.

    1986-02-01

    High field solid-state NMR lineshapes suffer from inhomogeneous broadening since resonance frequencies are a function of molecular orientation. Time domain zero field NMR is a two-dimensional field-cycling technique which removes this broadening by probing the evolution of the spin system under zero applied field. The simplest version, the sudden transition experiment, induces zero field evolution by the sudden removal of the applied magnetic field. Theory and experimental results of this experiment and several variations using pulsed dc magnetic fuelds to initiate zero field evolution are presented. In particular, the pulsed indirect detection method allows detection of the zero field spectrum of one nuclear spin species via another (usually protons) by utilizing the level crossings which occur upon adiabatic demagnetization to zero field. Experimental examples of proton/deuteron systems are presented which demonstrate the method results in enhanced sensitivity relative to that obtained in sudden transition experiments performed directly on deuterium. High resolution /sup 2/H NQR spectra of a series of benzoic acid derivatives are obtained using the sudden transition and indirect detection methods. Librational oscillations in the water molecules of barium chlorate monohydrate are studied using proton and deuterium ZF experiments. 177 refs., 88 figs., 2 tabs.

  16. Evaluation Of Silicon Diodes As IN-SITU Cryogenic Field Emission Detectors For SRF Cavity Development

    International Nuclear Information System (INIS)

    Palczewski, Ari; Geng, Rongli

    2012-01-01

    We performed in-situ cryogenic testing of four silicon diodes as possible candidates for field emission (FE) monitors of superconducting radio frequency (SRF) cavities during qualification testing and in accelerator cryo-modules. We evaluated diodes from 2 companies - from Hamamatsu corporation model S1223-01; and from OSI Optoelectronics models OSD35-LR-A, XUV-50C, and FIL-UV20. The measurements were done by placing the diodes in superfluid liquid helium near the top of a field emitting 9-cell cavity during its vertical test. For each diode, we will discuss their viability as a 2K cryogenic detector for FE mapping of SRF cavities and the directionality of S1223-01 in such environments. We will also present calibration curves between the diodes and JLab's standard radiation detector placed above the Dewar's top plate.

  17. Field theories with subcanonical fields

    International Nuclear Information System (INIS)

    Bigi, I.I.Y.

    1976-01-01

    The properties of quantum field theories with spinor fields of dimension less than the canonical value of 3/2 are studied. As a starting point for the application of common perturbation theory we look for the linear version of these theories. A gange-interaction is introduced and with the aid of power counting the renormalizability of the theory is shown. It follows that in the case of a spinor-field with negative dimension renormalization can only be attained if the interaction has a further symmetry. By this symmetry the theory is determined in an unequivocal way. The gange-interaction introduced in the theory leads to a spontaneous breakdown of scale invariance whereby masses are produced. At the same time the spinor-field operators can now be separated in two orthogonal sections with opposite norm. It is proposed to use the section with negative (positive) norm to describe hadrons (leptons) respectively. (orig./WL) [de

  18. Gauge fields

    International Nuclear Information System (INIS)

    Itzykson, C.

    1978-01-01

    In these notes the author provides some background on the theory of gauge fields, a subject of increasing popularity among particle physicists (and others). Detailed motivations and applications which are covered in the other lectures of this school are not presented. In particular the application to weak interactions is omitted by referring to the introduction given by J. Ilipoulos a year ago (CERN Report 76-11). The aim is rather to stress those aspects which suggest that gauge fields may play some role in a future theory of strong interactions. (Auth.)

  19. Electromagnetic response of non-trivially shaped superconductors in external magnetic fields and with applied currents

    International Nuclear Information System (INIS)

    Cabral, Leonardo Ribeiro Eulalio; Aguiar, Jose Albino Oliveira de

    2002-01-01

    Full text: The study of the electromagnetic response of high-T c superconductors is essential for future technological applications. Such materials are hard type II superconductors, where the mixed state (a state characterized by quantized normal flux tubes - also called vortices - immersed in a superconductor phase) occupies most of the phase diagram. Therefore, the electromagnetic properties are dictated by the vortex dynamics in these materials. One has also to consider the presence of structural defects and thermal effects, which turn the vortex dynamics very complex. These difficulties may be overcome throughout a macroscopic description, also known as continuum approximation, of the electromagnetic fields in superconductors, obtained from critical state models and constitutive relations E = E(j) and H = H(B) (where E is the electric field generated by moving vortices, j the current density, B the induction - related to the local density of vortices - and H the reversible magnetic field that is in equilibrium with B). In superconductors with negligible demagnetization factors, such as long cylinders and bars with applied magnetic fields and/or currents along their longer dimensions, the Meissner state and the flux penetration is quite well understood. However, the actual specimen shape plays an important role on the electromagnetic behavior of superconductors. Numerical methods are often employed, since such cases are hard to treat analytically. In this work we studied the electromagnetic response of superconductors with various shapes. The Meissner state is obtained for thin curved strips and long cylinders with arbitrary cross-section, in perpendicular field and with applied currents. The flux penetration is numerically calculated for thin curved strips for the Bean (j c =const.) and the Kim (j c (B) = j c0 /(1 + βB)) models. (author)

  20. Field theory

    CERN Multimedia

    1999-11-08

    In these lectures I will build up the concept of field theory using the language of Feynman diagrams. As a starting point, field theory in zero spacetime dimensions is used as a vehicle to develop all the necessary techniques: path integral, Feynman diagrams, Schwinger-Dyson equations, asymptotic series, effective action, renormalization etc. The theory is then extended to more dimensions, with emphasis on the combinatorial aspects of the diagrams rather than their particular mathematical structure. The concept of unitarity is used to, finally, arrive at the various Feynman rules in an actual, four-dimensional theory. The concept of gauge-invariance is developed, and the structure of a non-abelian gauge theory is discussed, again on the level of Feynman diagrams and Feynman rules.

  1. Accurate mean-field modeling of the Barkhausen noise power in ferromagnetic materials, using a positive-feedback theory of ferromagnetism

    Science.gov (United States)

    Harrison, R. G.

    2015-07-01

    A mean-field positive-feedback (PFB) theory of ferromagnetism is used to explain the origin of Barkhausen noise (BN) and to show why it is most pronounced in the irreversible regions of the hysteresis loop. By incorporating the ABBM-Sablik model of BN into the PFB theory, we obtain analytical solutions that simultaneously describe both the major hysteresis loop and, by calculating separate expressions for the differential susceptibility in the irreversible and reversible regions, the BN power response at all points of the loop. The PFB theory depends on summing components of the applied field, in particular, the non-monotonic field-magnetization relationship characterizing hysteresis, associated with physical processes occurring in the material. The resulting physical model is then validated by detailed comparisons with measured single-peak BN data in three different steels. It also agrees with the well-known influence of a demagnetizing field on the position and shape of these peaks. The results could form the basis of a physics-based method for modeling and understanding the significance of the observed single-peak (and in multi-constituent materials, multi-peak) BN envelope responses seen in contemporary applications of BN, such as quality control in manufacturing, non-destructive testing, and monitoring the microstructural state of ferromagnetic materials.

  2. Gauge fields

    International Nuclear Information System (INIS)

    Mills, R.

    1989-01-01

    This article is a survey of the history and ideas of gauge theory. Described here are the gradual emergence of symmetry as a driving force in the shaping of physical theory; the elevation of Noether's theorem, relating symmetries to conservation laws, to a fundamental principle of nature; and the force of the idea (''the gauge principle'') that the symmetries of nature, like the interactions themselves, should be local in character. The fundamental role of gauge fields in mediating the interactions of physics springs from Noether's theorem and the gauge principle in a remarkably clean and elegant way, leaving, however, some tantalizing loose ends that might prove to be the clue to a future deeper level of understanding. The example of the electromagnetic field as the prototype gauge theory is discussed in some detail and serves as the basis for examining the similarities and differences that emerge in generalizing to non-Abelian gauge theories. The article concludes with a brief examination of the dream of total unification: all the forces of nature in a single unified gauge theory, with the differences among the forces due to the specific way in which the fundamental symmetries are broken in the local environment

  3. Experimental study on stabilizing range extension of diamagnetic levitation under modulated magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Chow, T C S; Wong, P L; Liu, K P, E-mail: 50578230@student.cityu.edu.h, E-mail: meplwong@cityu.edu.h, E-mail: mekpliu@cityu.edu.h [Manufacturing Engineering and Engineering Management Department, City University of Hong Kong, Tat Chee Avenue, Kowloon (Hong Kong)

    2010-01-01

    The real energy-free levitation exists with the help of diamagnetic material. Its ultra-high sensitivity to force is particularly attractive to micro/nano force sensing. A key parameter: Levitation Stabilizing Local Range, LR (allowable moving range of the floater) is critical to the load and self-rotating performance. Besides, larger LR reduces the energy loss due to the eddy current and has greater application potential. Recently, an idea of extending the LR by a modulating coil array has been validated using numerical simulation. This paper takes the next move to carry out an experimental study on the shape effect of stacked coil arrays with different currents on LR.

  4. Field measurements of radon exhalation and Ra-226 content in soil using the can-technique

    International Nuclear Information System (INIS)

    Hafez, A.F.; El-Khatib, A.M.; Moharram, B.M.; Kotb, M.A.; Abdel-Naby, A.

    1991-01-01

    CR-39 and LR-115 plastic nuclear track detectors in the can-technique have been employed in the field measurements of radon exhalation, Ra-226 and U-238 content in dry-soil air at numerous regions in Sudan (the Blue and White Nile and Mogran regions). Measurements gave an average radon exhalation from the soil to the atmosphere and Ra-226 content of (23.4±2.60) kBq.m -2 and (123±13.65) Bq.kg -1 respectively. A polyethylene permeable memebrane cover was used to eliminate the contribution of thoron activity inside the can. Assuming a radioactive equilibrium between the U-series, the average U-238 content in the soil was found to be (9.92±1.01) ppm. This survey may be used for uranium prospection in soil. (orig.) [de

  5. Thermal coupling in low fields between the nuclear and electronic spins in Tm2+ doped CaF2

    International Nuclear Information System (INIS)

    Urbina, Cristian.

    1977-01-01

    It is shown that in a CaF 2 crystal doped with divalent thulium ions there is in low fields, a thermal coupling between the electron magnetic moments of Tm 2+ and the nuclear moments of 19 F. When these ones have been lowered down to temperature through dynamical high-field polarization and adiabatic demagnetization in succession the resulting polarisation of the formed ones can overstep their original polarization in high field. A trial is given to explain this Zeeman electronic energy cooling through nuclear Zeeman energy with invoking a thermal coupling between both systems through the spin-spin electronic interaction but no theoretical model is developed in view of a quantitative explanation of the dynamics of such a process. The magnetic resonance spectrum of Tm 2 + in low field is also investigated: an important shift and narrowing of the electron resonance line in low field are obtained when 19 F nuclei are very cold. This special spectral characters are explained as due to magnetic interactions between electronic impurities and the neighbouring 19 F nuclei and a theoretical model is developed (based on the local Weiss field approximation) which explains rather well the changes in the spectral shift as a function of the 19 F nucleus temperature. A second theoretical model has also been developed in view of a quantitative explanation of both the narrowing and shift of the spectrum, but its prediction disagree with the experimental results. It is shown that in low fieldsx it is possible to get rid of paramagnetic impurities after they have been reused as reducing agents for 19 F nucleus entropy populating at about 80%, a non magnetic metastable state with these impurities [fr

  6. 15.SFPS "Ieņēmumi no līgumiem ar klientiem"un 16.SFPS "Noma" prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu

    OpenAIRE

    Dābola, Iveta

    2016-01-01

    Maģistra darba temats 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu. Maģistra darba mērķis - balstoties uz 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” standartu prasību izpēti un analīzi, novērtēt Latvijas likumdošanas atbilstību minēto standartu prasībām un sniegt priekšlikumus konkrētu jautājumu risināšanai Latvijas kontekstā. Maģistra darbā izpētīti LR normatīvie regulējumi un sta...

  7. Field training

    International Nuclear Information System (INIS)

    Mumford, G.E.; Hadaway, E.H.

    1991-01-01

    Individualized, personal training can be used to increase an employee's awareness of the HSE program. Such training can stimulate personal commitment and provide personal skills that can be utilized for the benefit of the overall HSE effort. But, providing such training within our industry can be a difficult task due to the scheduling, travel arrangements, and cost associated with bringing employees from isolated, remote locations to centrally located training facilities. One method of overcoming these obstacles involves the use of field instructors to provide the training at the many, and varied number of individuals can be reached with minimal disruption to their work scheduling or to their time off. In fact, this type of on-site training is already used by some oil companies and drilling contractors with encouraging results. This paper describes one drilling contractor's experiences with such a training program. The results after eight years how that this program not only can provide and efficient, economical means of employee training, but also can have a direct application to employee motivation regarding a company's HSE effort

  8. Clinical effects of buprenorphine on open field behaviour and gait symmetry in healthy and lame weaned piglets.

    Science.gov (United States)

    Meijer, Ellen; van Nes, Arie; Back, Willem; van der Staay, Franz Josef

    2015-12-01

    Lameness in pigs decreases animal welfare and economic profit for the farmer. An important reason for impaired welfare in lame animals is pain due to lameness. No direct measurement of pain is possible in animals, and methods to indirectly detect and quantify the amount of pain an animal is experiencing are urgently needed. In this study, two methods to assess pain associated with lameness in pigs were evaluated to determine if they were sensitive enough to detect a lameness reduction as an effect of an experimental analgesic medication. Asymmetry associated with lameness was objectively quantified using pressure mat kinetic parameters: peak vertical force (PVF), load rate (LR), vertical impulse (VI) and peak vertical pressure (PVP). Locomotor activity was assessed in an open field test. A dose of 0.04 mg/kg buprenorphine, a strong analgesic, was used to treat 10 lame pigs, while eight other lame pigs, treated with physiological saline solution, served as controls. Buprenorphine decreased lameness-associated asymmetry for pressure mat LR (P = 0.002), VI (P = 0.003) and PVP (P = 0.001) and increased activity of the lame pigs in the open field (P = 0.023), while saline-treated animals did not show any changes in asymmetry and became less active in the open field (P open field test are both sensitive enough to detect the analgesic effects of buprenorphine when used to treat moderate to severe clinical pain in a relatively small group of affected pigs. The methods used in this study may also provide promising additional tools for future research into early pain recognition and lameness treatment in pigs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. The innovative potential of Lactobacillus rhamnosus LR06, Lactobacillus pentosus LPS01, Lactobacillus plantarum LP01, and Lactobacillus delbrueckii Subsp. delbrueckii LDD01 to restore the "gastric barrier effect" in patients chronically treated with PPI: a pilot study.

    Science.gov (United States)

    Del Piano, Mario; Anderloni, Andrea; Balzarini, Marco; Ballarè, Marco; Carmagnola, Stefania; Montino, Franco; Orsello, Marco; Pagliarulo, Michela; Tari, Roberto; Soattini, Liliana; Sforza, Filomena; Mogna, Luca; Mogna, Giovanni

    2012-10-01

    Gastroesophageal reflux disease is a very widespread condition. In Europe, it is estimated that about 175 million people suffer from this disease and have to chronically take drugs to increase gastric pH. The proton pump inhibitors (PPIs) such as omeprazole, lansoprazole, and esomeprazole are the most widely used drug typology in this regard. However, the inhibition of normal gastric acid secretion has important side effects, the most important being bacterial overgrowth in the stomach and duodenum with a concentration of >10⁵ viable cells/mL. As a major consequence of this, many harmful or even pathogenic bacteria contained in some foods could survive the gastric transit and colonize either the stomach itself, the duodenum, or the gut, where they could establish acute and even chronic infections with unavoidable consequences for the host's health. In other words, the "gastric barrier effect" is strongly reduced or even disrupted. To date, there are no real strategies to deal with this widespread, although still relatively little known, problem. The aim of this study was to confirm the gastric bacterial overgrowth in long-term PPI consumers and to assess the efficacy of some probiotic bacteria, belonging to both genera Lactobacillus and Bifidobacterium, in the reduction of gastric and duodenal bacterial overgrowth, therefore partially restoring the gastric barrier effect against foodborne pathogenic bacteria. For this purpose, probiotics with a strong demonstrated inhibitory activity on gram-negative bacteria, such as Escherichia coli, were tested in a human intervention trial involving a total of 30 subjects treated with PPIs for either 3 to 12 consecutive months (short-term) or >12 consecutive months (long-term). An additional 10 subjects not taking PPIs were enrolled and used as a control group representing the general population. Four selected probiotics Probiotical SpA (Novara, Italy), namely Lactobacillus rhamnosus LR06 (DSM 21981), Lactobacillus pentosus

  10. An electric field in a gravitational field

    International Nuclear Information System (INIS)

    Harpaz, Amos

    2005-01-01

    The behaviour of an electric field in a gravitational field is analysed. It is found that due to the mass (energy) of the electric field, it is subjected to gravity and it falls in the gravitational field. This fall curves the electric field, a stress force (a reaction force) is created, and the interaction of this reaction force with the static charge gives rise to the creation of radiation

  11. A comparison of the exposure response of French and Irish radon detectors during field measurements in houses in Brittany

    International Nuclear Information System (INIS)

    Tymen, G.; Mouden, A.; McLaughlin, J.P.; Wasiolek, P.; Rannou, A.

    1988-01-01

    Intercomparisons between French (CEA) and Irish (UCD) radon detectors were made during 1986/87 under field conditions in over 100 dwellings within the framework of a regional study in Britanny which commenced in 1984. Two different types of passive radon detectors, both using Kodak-Pathe LR-115 film, were used. The French type is of the open variety while the Irish type is closed. Preliminary analysis of the results obtained from about one hundred exposures shows that while good agreement was found in some cases a mean relative variation of 40% appears to exist between the French and Irish data. In general the Irish data gave the lower radon determinations. Likely reasons for any lack of agreement between the radon data sets obtained from the passive detectors are discussed and also comparisons are made in relation to potential alpha energy data, gamma exposure data and the exposure conditions in the dwellings. (author)

  12. Quantized fields in external field. Pt. 2

    International Nuclear Information System (INIS)

    Bellissard, J.

    1976-01-01

    The case of a charged scalar field is considered first. The existence of the corresponding Green's functions is proved. For weak fields, as well as pure electric or scalar external fields, the Bogoliubov S-operator is shown to be unitary, covariant, causal up-to-a-phase. These results are generalised to a class of higher spin quantized fields, 'nicely' coupled to external fields, which includes the Dirac theory, and in the case of minimal and magnetic dipole coupling, the spin one Petiau-Duffin-Kemmer theory. (orig.) [de

  13. Gravitation and vacuum field

    International Nuclear Information System (INIS)

    Tevikyan, R.V.

    1986-01-01

    This paper presents equations that describe particles with spins s = 0, 1/2, 1 completely and which also describe 2s + 2 limiting fields as E → ∞. It is shown that the ordinary Hilbert-Einstein action for the gravitation field must be augmented by the action for the Bose vacuum field. This means that one must introduce in the gravitational equations a cosmological term proportional to the square of the strength of the Bose vacuum field. It is shown that the theory of gravitation describes three realities: matter, field, and vacuum field. A new form of matter--the vacuum field--is introduced into field theory

  14. Fractal vector optical fields.

    Science.gov (United States)

    Pan, Yue; Gao, Xu-Zhen; Cai, Meng-Qiang; Zhang, Guan-Lin; Li, Yongnan; Tu, Chenghou; Wang, Hui-Tian

    2016-07-15

    We introduce the concept of a fractal, which provides an alternative approach for flexibly engineering the optical fields and their focal fields. We propose, design, and create a new family of optical fields-fractal vector optical fields, which build a bridge between the fractal and vector optical fields. The fractal vector optical fields have polarization states exhibiting fractal geometry, and may also involve the phase and/or amplitude simultaneously. The results reveal that the focal fields exhibit self-similarity, and the hierarchy of the fractal has the "weeding" role. The fractal can be used to engineer the focal field.

  15. Electric Field Imaging

    Data.gov (United States)

    National Aeronautics and Space Administration — NDE historically has focused technology development in propagating wave phenomena with little attention to the field of electrostatics and emanating electric fields....

  16. How fields vary.

    Science.gov (United States)

    Krause, Monika

    2018-03-01

    Field theorists have long insisted that research needs to pay attention to the particular properties of each field studied. But while much field-theoretical research is comparative, either explicitly or implicitly, scholars have only begun to develop the language for describing the dimensions along which fields can be similar to and different from each other. In this context, this paper articulates an agenda for the analysis of variable properties of fields. It discusses variation in the degree but also in the kind of field autonomy. It discusses different dimensions of variation in field structure: fields can be more or less contested, and more or less hierarchical. The structure of symbolic oppositions in a field may take different forms. Lastly, it analyses the dimensions of variation highlighted by research on fields on the sub- and transnational scale. Post-national analysis allows us to ask how fields relate to fields of the same kind on different scales, and how fields relate to fields on the same scale in other national contexts. It allows us to ask about the role resources from other scales play in structuring symbolic oppositions within fields. A more fine-tuned vocabulary for field variation can help us better describe particular fields and it is a precondition for generating hypotheses about the conditions under which we can expect to observe fields with specified characteristics. © London School of Economics and Political Science 2017.

  17. Magnetic Field Calculator

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Magnetic Field Calculator will calculate the total magnetic field, including components (declination, inclination, horizontal intensity, northerly intensity,...

  18. Magnetic field reconnexion in a sheared field

    International Nuclear Information System (INIS)

    Ugai, M.

    1981-01-01

    A nonlinear development of the Petschek mode in a sheared magnetic field where there is a field component Bsub(z) along an X line is numerically studied. It is found that finite-amplitude intermediate waves, adjacent to the slow shock, may eventually stand in the quasi-steady configuration; on the other hand, the fundamental characteristics of the Petschek-mode development are scarcely influenced, either qualitatively or quantitatively, by the Bsub(z) field. (author)

  19. Wake fields and wake field acceleration

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Wilson, P.B.; Weiland, T.

    1984-12-01

    In this lecture we introduce the concepts of wake fields and wake potentials, examine some basic properties of these functions, show how they can be calculated, and look briefly at a few important applications. One such application is wake field acceleration. The wake field accelerator is capable of producing the high gradients required for future very high energy e + e - linear colliders. The principles of wake field acceleration, and a brief description of experiments in progress in this area, are presented in the concluding section. 40 references, 27 figures

  20. On Jacobi-fields

    International Nuclear Information System (INIS)

    Bruening, E.

    1981-01-01

    The concept of a Jacobi-field is introduced as such a field for which the field-operators have the form of a generalized Jacobi-matrix with respect to the n-field-sector decomposition of the state-space. It is argued that the class of Jacobi-fields is of interest for relativistic quantum field theory for two reasons: (a) Jacobi-fields allow a direct association of particles (charges etc.) with fields. The concept of (generalized) creation- and annihilation-operators is thus available. (b) Jacobi-fields belong to that class of fields which can be characterized in terms of finitely many vacuum expectation values. A characterization of Jacobi-fields in terms of continuity and hermiticity properties of their system of vacuum expectation values is derived. Furthermore it is argued that all examples of relativistic quantum fields in a four-dimensional space-time are Jacobi-fields. This is evident for generalized free fields and Wick-powers of free fields, but is also true for a class of generalized Wick-powers of generalized free fields. (Auth.)

  1. Field Trips. Beginnings Workshop.

    Science.gov (United States)

    Cartwright, Sally; Aronson, Susan S.; Stacey, Susan; Winbush, Olga

    2001-01-01

    Five articles highlight benefits and organization of field trips: (1) "Field Trips Promote Child Learning at Its Best"; (2) "Planning for Maximum Benefit, Minimum Risk"; (3) "Coaching Community Hosts"; (4) "The Story of a Field Trip: Trash and Its Place within Children's Learning and Community"; and (5) "Field Trip Stories and Perspectives" (from…

  2. Field Campaign Guidelines

    Energy Technology Data Exchange (ETDEWEB)

    Voyles, J. W. [DOE ARM Climate Research Facility, Washington, DC (United States); Chapman, L. A. [DOE ARM Climate Research Facility, Washington, DC (United States)

    2015-12-01

    This document establishes a common set of guidelines for the Atmospheric Radiation Measurement (ARM) Climate Research Facility for planning, executing, and closing out field campaigns. The steps that guide individual field campaigns are described in the Field Campaign Tracking System and are specifically tailored to meet the scope of each field campaign.

  3. The Galactic magnetic fields

    International Nuclear Information System (INIS)

    Han Jinlin

    2006-01-01

    A good progress has been made on studies of Galactic magnetic fields in last 10 years. I describe what we want to know about the Galactic magnetic fields, and then review we current knowledge about magnetic fields in the Galactic disk, the Galactic halo and the field strengths. I also listed many unsolved problems on this area

  4. Mūsdienīgas metodes cīņā ar nelikumīgā ceļā iegūto līdzekļu legalizāciju LR banku sistēmā

    OpenAIRE

    Mišina, Jeļena

    2007-01-01

    Līdz ar to, kā pēdējos gados visa pasaulē un Latvijā tiek pievērsta pastiprinātā uzmanība naudas atmazgāšanas un terorisma finansēšanas problēmai par maģistra darba tematu tika izvēlēta „Mūsdienīgas metodes cīņā ar nelikumīgā ceļa iegūto līdzekļu legalizāciju LR banku sistēmā”. Darbs sastāv no piecām nodaļām. Pirmā nodaļā tiek definēta līdzekļu legalizācijas būtība. Otrā nodaļa tiek izskatītas ārvalsts pieņemtie normatīvie akti un darbojošās institūcijas. Trešā daļā uzmanība ir vērst...

  5. Gauge fields in a torsion field

    International Nuclear Information System (INIS)

    Rosu, Ion

    2004-01-01

    In this paper we analyse the motion and the field equations in a non-null curvature and torsion space. In this 4-n dimensional space, the connection coefficients are γ bc a = 1/2S bc a + 1/2T bc a, where S bc a is the symmetrical part and T bc a are the components of the torsion tensor. We will consider that all the fields depend on x = x α , α = 1,2,3,4 and do not depend on y = y k , k=1,2,...,n. The factor S bc a depends on the components of the metric tensor g αβ (x) and on the gauge fields A ν s 0 (x) and the components of the torsion depend only on the gauge fields A ν s 0 (x). We take into consideration the particular case for which the geodesic equations coincide with the motion equations in the presence of the gravitational and the gauge fields. In this case the field equations are Einstein equations in a 4-n dimensional space. We show that both the geodesic equations and the field equations can be obtained from a variational principle. (author)

  6. Residual magnetic field in rotary machines; Campo magnetico residual en maquinas rotatorias

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez V, Esteban A; Apanco R, Marcelino [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2007-07-01

    The residual magnetism is a phenomenon in which the magnetic dipoles of a substance are oriented in a certain degree. On the other hand, when internal forces exist capable of aligning elementary magnetic dipoles of a material, a permanent magnet is obtained. Just as in a conductor or in a material, in the elements of a rotary electrical machine magnetic fields can be induced that produce a residual magnetism or magnetization. In the rotary electrical machines, the magnetization phenomenon causes serious problems, such as the generation of induced currents that propitiate the mechanical wear in bearings, collars, trunnions and inclusive in the shaft, by effects known as pitting, frosting and spark tracks, as well as erroneous readings in vibration and temperature sensors, that in some cases can cause the shut down of the machine. In this article are presented the general concepts on the residual magnetism in rotary electrical machines, the causes that originate it and the problems that arises, as well as the demagnetization of the components that have residual magnetic field. The results obtained by the area of Electrical Equipment of the Instituto de Investigaciones Electricas are revised, during the execution of activities related to the measurement and elimination of the residual magnetic field in rotary electrical machines. [Spanish] El magnetismo residual es un fenomeno en el que los dipolos magneticos de una sustancia se encuentran orientados en un grado determinado. Por otro lado, cuando existen fuerzas internas capaces de alinear los dipolos magneticos elementales de un material, se tiene un iman permanente. Al igual que en un conductor o un material, en los elementos de una maquina electrica rotatoria se pueden inducir campos magneticos que producen un magnetismo residual o magnetizacion. En las maquinas electricas rotatorias, el fenomeno de magnetizacion causa graves problemas, como la generacion de corrientes inducidas que propician el desgaste mecanico

  7. Engineering field theory

    CERN Document Server

    Baden Fuller, A J

    2014-01-01

    Engineering Field Theory focuses on the applications of field theory in gravitation, electrostatics, magnetism, electric current flow, conductive heat transfer, fluid flow, and seepage.The manuscript first ponders on electric flux, electrical materials, and flux function. Discussions focus on field intensity at the surface of a conductor, force on a charged surface, atomic properties, doublet and uniform field, flux tube and flux line, line charge and line sink, field of a surface charge, field intensity, flux density, permittivity, and Coulomb's law. The text then takes a look at gravitation

  8. Ambient Field Analysis at Groningen Gas Field

    Science.gov (United States)

    Spica, Z.; Nakata, N.; Beroza, G. C.

    2016-12-01

    We analyze continuous ambient-field data at Groningen gas field (Netherlands) through cross-correlation processing. The Groningen array is composed of 75 shallow boreholes with 6 km spacing, which contain a 3C surface accelerometer and four 5-Hz 3C borehole geophones spaced at 50 m depth intervals. We successfully retrieve coherent waves from ambient seismic field on the 9 components between stations. Results show high SNR signal in the frequency range of 0.125-1 Hz, and the ZZ, ZR, RZ, RR and TT components show much stronger wave energy than other components as expected. This poster discuss the different type of waves retrieved, the utility of the combination of borehole and surface observations, future development as well as the importance to compute the 9 components of the Green's tensor to better understand the wave field propriety with ambient noise.

  9. Covariant Noncommutative Field Theory

    Energy Technology Data Exchange (ETDEWEB)

    Estrada-Jimenez, S [Licenciaturas en Fisica y en Matematicas, Facultad de Ingenieria, Universidad Autonoma de Chiapas Calle 4a Ote. Nte. 1428, Tuxtla Gutierrez, Chiapas (Mexico); Garcia-Compean, H [Departamento de Fisica, Centro de Investigacion y de Estudios Avanzados del IPN P.O. Box 14-740, 07000 Mexico D.F., Mexico and Centro de Investigacion y de Estudios Avanzados del IPN, Unidad Monterrey Via del Conocimiento 201, Parque de Investigacion e Innovacion Tecnologica (PIIT) Autopista nueva al Aeropuerto km 9.5, Lote 1, Manzana 29, cp. 66600 Apodaca Nuevo Leon (Mexico); Obregon, O [Instituto de Fisica de la Universidad de Guanajuato P.O. Box E-143, 37150 Leon Gto. (Mexico); Ramirez, C [Facultad de Ciencias Fisico Matematicas, Universidad Autonoma de Puebla, P.O. Box 1364, 72000 Puebla (Mexico)

    2008-07-02

    The covariant approach to noncommutative field and gauge theories is revisited. In the process the formalism is applied to field theories invariant under diffeomorphisms. Local differentiable forms are defined in this context. The lagrangian and hamiltonian formalism is consistently introduced.

  10. Covariant Noncommutative Field Theory

    International Nuclear Information System (INIS)

    Estrada-Jimenez, S.; Garcia-Compean, H.; Obregon, O.; Ramirez, C.

    2008-01-01

    The covariant approach to noncommutative field and gauge theories is revisited. In the process the formalism is applied to field theories invariant under diffeomorphisms. Local differentiable forms are defined in this context. The lagrangian and hamiltonian formalism is consistently introduced

  11. Understanding Vector Fields.

    Science.gov (United States)

    Curjel, C. R.

    1990-01-01

    Presented are activities that help students understand the idea of a vector field. Included are definitions, flow lines, tangential and normal components along curves, flux and work, field conservation, and differential equations. (KR)

  12. Magnetic Field Grid Calculator

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Magnetic Field Properties Calculator will computes the estimated values of Earth's magnetic field(declination, inclination, vertical component, northerly...

  13. Gauge field copies

    International Nuclear Information System (INIS)

    Bollini, C.G.; Giambiagi, J.J.; Tiomno, J.

    1979-01-01

    The construction of field strength copies without any gauge constraint is discussed. Several examples are given, one of which is not only a field strength copy but also (at the same time) a 'current copy'. (author) [pt

  14. Cosmological magnetic fields - V

    Indian Academy of Sciences (India)

    Magnetic fields seem to be everywhere that we can look in the universe, from our own ... The field tensor is observer-independent, while the electric and magnetic .... based on string theory [11], in which vacuum fluctuations of the field are ...

  15. Unified field theory

    International Nuclear Information System (INIS)

    Prasad, R.

    1975-01-01

    Results of researches into Unified Field Theory over the past seven years are presented. The subject is dealt with in chapters entitled: the choice of affine connection, algebraic properties of the vector fields, field laws obtained from the affine connection based on the path integral method, application to quantum theory and cosmology, interpretation of physical theory in terms of geometry. (U.K.)

  16. Politics of aviation fields

    Science.gov (United States)

    Vivent, Jacques

    1922-01-01

    In short, the "politics of aviation" lies in a few propositions: the need of having as large a number of fields as possible and of sufficient area; the utilization of the larger part of the existing military fields; the selection of uncultivated or unproductive fields, whenever technical conditions permit; ability to disregard (save in exceptional cases) objections of an agricultural nature.

  17. Finite discrete field theory

    International Nuclear Information System (INIS)

    Souza, Manoelito M. de

    1997-01-01

    We discuss the physical meaning and the geometric interpretation of implementation in classical field theories. The origin of infinities and other inconsistencies in field theories is traced to fields defined with support on the light cone; a finite and consistent field theory requires a light-cone generator as the field support. Then, we introduce a classical field theory with support on the light cone generators. It results on a description of discrete (point-like) interactions in terms of localized particle-like fields. We find the propagators of these particle-like fields and discuss their physical meaning, properties and consequences. They are conformally invariant, singularity-free, and describing a manifestly covariant (1 + 1)-dimensional dynamics in a (3 = 1) spacetime. Remarkably this conformal symmetry remains even for the propagation of a massive field in four spacetime dimensions. We apply this formalism to Classical electrodynamics and to the General Relativity Theory. The standard formalism with its distributed fields is retrieved in terms of spacetime average of the discrete field. Singularities are the by-products of the averaging process. This new formalism enlighten the meaning and the problem of field theory, and may allow a softer transition to a quantum theory. (author)

  18. ZEPHYR - poloidal field system

    International Nuclear Information System (INIS)

    Seidel, U.

    1982-04-01

    The basics of the poloidal field system of the ZEPHYR experiment are considered. From the physical data the requirements for the poloidal field are derived. Hence an appropriate coil configuration consisting of coil locations and corresponding currents is obtained. A suitable electrical circuit feeding the coils is described. A preliminary assessment of the dynamic control of the poloidal field system is given. (orig.)

  19. Magnetic field line Hamiltonian

    International Nuclear Information System (INIS)

    Boozer, A.H.

    1985-02-01

    The basic properties of the Hamiltonian representation of magnetic fields in canonical form are reviewed. The theory of canonical magnetic perturbation theory is then developed and applied to the time evolution of a magnetic field embedded in a toroidal plasma. Finally, the extension of the energy principle to tearing modes, utilizing the magnetic field line Hamiltonian, is outlined

  20. Omnigenous magnetic fields

    International Nuclear Information System (INIS)

    Stupakov, G.V.

    1982-01-01

    In omnigenous magnetic fields particles' drift surfaces coincide with plasma magnetic surfaces. In this paper we formulate equations of omnigenous magnetic fields in natural curvilinear coordinates. An analysis of fields which are omnigenous only in the paraxial approximation is presented. (author)

  1. Far field acceleration

    International Nuclear Information System (INIS)

    Fernow, R.C.

    1995-07-01

    Far fields are propagating electromagnetic waves far from their source, boundary surfaces, and free charges. The general principles governing the acceleration of charged particles by far fields are reviewed. A survey of proposed field configurations is given. The two most important schemes, Inverse Cerenkov acceleration and Inverse free electron laser acceleration, are discussed in detail

  2. Cosmic Magnetic Fields

    Science.gov (United States)

    Sánchez Almeida, J.; Martínez González, M. J.

    2018-05-01

    Magnetic fields play an important role in many astrophysical processes. They are difficult to detect and characterize since often their properties have to be inferred through interpreting the polarization of the light. Magnetic fields are also challenging to model and understand. Magnetized plasmas behave following highly non-linear differential equations having no general solution, so that every astrophysical problem represents a special case to be studied independently. Hence, magnetic fields are often an inconvenient subject which is overlooked or simply neglected (the elephant in the room, as they are dubbed in poster of the school). Such difficulty burdens the research on magnetic fields, which has evolved to become a very technical subject, with many small disconnected communities studying specific aspects and details. The school tried to amend the situation by providing a unifying view of the subject. The students had a chance to understand the behavior of magnetic fields in all astrophysical contexts, from cosmology to the Sun, and from starbursts to AGNs. The school was planed to present a balanced yet complete review of our knowledge, with excursions into the unknown to point out present and future lines of research. The subject of Cosmic Magnetic Fields was split into seven different topics: cosmic magnetic field essentials, solar magnetic fields, stellar magnetic fields, the role of magnetic fields on AGN feedback, magnetic fields in galaxies, magnetic fields in galaxy clusters and at larger scales, and primordial magnetic fields and magnetic fields in the early Universe. The corresponding lectures were delivered by seven well known and experienced scientists that have played key roles in the major advances of the field during the last years: F. Cattaneo, P. Judge, O. Kochukhov, R. Keppens, R. Beck, K. Dolag, and F. Finelli. Their lectures were recorded and are freely available at the IAC website: http://iactalks.iac.es/talks/serie/19.

  3. Quantum field theory

    International Nuclear Information System (INIS)

    Ryder, L.H.

    1985-01-01

    This introduction to the ideas and techniques of quantum field theory presents the material as simply as possible and is designed for graduate research students. After a brief survey of particle physics, the quantum theory of scalar and spinor fields and then of gauge fields, is developed. The emphasis throughout is on functional methods, which have played a large part in modern field theory. The book concludes with a bridge survey of ''topological'' objects in field theory and assumes a knowledge of quantum mechanics and special relativity

  4. Unitary field theories

    International Nuclear Information System (INIS)

    Bergmann, P.G.

    1980-01-01

    A problem of construction of the unitary field theory is discussed. The preconditions of the theory are briefly described. The main attention is paid to the geometrical interpretation of physical fields. The meaning of the conceptions of diversity and exfoliation is elucidated. Two unitary field theories are described: the Weyl conformic geometry and Calitzy five-dimensioned theory. It is proposed to consider supersymmetrical theories as a new approach to the problem of a unitary field theory. It is noted that the supergravitational theories are really unitary theories, since the fields figuring there do not assume invariant expansion

  5. Field emission electronics

    CERN Document Server

    Egorov, Nikolay

    2017-01-01

    This book is dedicated to field emission electronics, a promising field at the interface between “classic” vacuum electronics and nanotechnology. In addition to theoretical models, it includes detailed descriptions of experimental and research techniques and production technologies for different types of field emitters based on various construction principles. It particularly focuses on research into and production of field cathodes and electron guns using recently developed nanomaterials and carbon nanotubes. Further, it discusses the applications of field emission cathodes in new technologies such as light sources, flat screens, microwave and X-ray devices.

  6. Strong Magnetic Field Characterisation

    Science.gov (United States)

    2012-04-01

    an advertised surface field of approximately 0.5 T were used to supply the static magnetic field source. The disc magnet had a diameter of 50 mm and... colour bar indicates the magnetic field strength set to an arbitrary 0.25 T. The white area has a field >0.25 T. The size of the arrow is proportional...9 shows the magnetic field strength along a slice in the XZ plane. The colours represent the total UNCLASSIFIED 10 UNCLASSIFIED DSTO-TR-2699

  7. Classical field theory

    CERN Document Server

    Franklin, Joel

    2017-01-01

    Classical field theory, which concerns the generation and interaction of fields, is a logical precursor to quantum field theory, and can be used to describe phenomena such as gravity and electromagnetism. Written for advanced undergraduates, and appropriate for graduate level classes, this book provides a comprehensive introduction to field theories, with a focus on their relativistic structural elements. Such structural notions enable a deeper understanding of Maxwell's equations, which lie at the heart of electromagnetism, and can also be applied to modern variants such as Chern–Simons and Born–Infeld. The structure of field theories and their physical predictions are illustrated with compelling examples, making this book perfect as a text in a dedicated field theory course, for self-study, or as a reference for those interested in classical field theory, advanced electromagnetism, or general relativity. Demonstrating a modern approach to model building, this text is also ideal for students of theoretic...

  8. Earth's electric field

    International Nuclear Information System (INIS)

    Kelley, M.C.

    1978-01-01

    The earth becomes charged during thunderstorm activity and discharges through the weak conducting atmosphere. Balloon and rocket studies infer that a high altitude electric field penetrates virtually unattenuated through the atmosphere, at least as far as balloon heights. The field has two primary sources. At low and mid latitudes, interaction between the earth's magnetic field and the neutral wind creates electric fields. At latitudes above 60 0 , the high altitude electrical structure is dominated by the interaction between the solar wind and the earth's magnetic field. The auroral light is emitted by atmospheric atoms and molecules excited by electrons with potentials of many thousands volts. The potentials are induced by the solar wind. Recent satellite data shows that the electrons get this energy by passing through a localized electric field about 6000 km above the auroral zone. Several rocket and satellite experiments used to study the earth's electric field are discussed

  9. Forces in electromagnetic field and gravitational field

    OpenAIRE

    Weng, Zihua

    2008-01-01

    The force can be defined from the linear momentum in the gravitational field and electromagnetic field. But this definition can not cover the gradient of energy. In the paper, the force will be defined from the energy and torque in a new way, which involves the gravitational force, electromagnetic force, inertial force, gradient of energy, and some other new force terms etc. One of these new force terms can be used to explain why the solar wind varies velocity along the magnetic force line in...

  10. Continuum gauge fields from lattice gauge fields

    International Nuclear Information System (INIS)

    Goeckeler, M.; Kronfeld, A.S.; Schierholz, G.; Wiese, U.J.

    1993-01-01

    On the lattice some of the salient features of pure gauge theories and of gauge theories with fermions in complex representations of the gauge group seem to be lost. These features can be recovered by considering part of the theory in the continuum. The prerequisite for that is the construction of continuum gauge fields from lattice gauge fields. Such a construction, which is gauge covariant and complies with geometrical constructions of the topological charge on the lattice, is given in this paper. The procedure is explicitly carried out in the U(1) theory in two dimensions, where it leads to simple results. (orig.)

  11. Polarimetry of random fields

    Science.gov (United States)

    Ellis, Jeremy

    On temporal, spatial and spectral scales which are small enough, all fields are fully polarized. In the optical regime, however, instantaneous fields can rarely be examined, and, instead, only average quantities are accessible. The study of polarimetry is concerned with both the description of electromagnetic fields and the characterization of media a field has interacted with. The polarimetric information is conventionally presented in terms of second order field correlations which are averaged over the ensemble of field realizations. Motivated by the deficiencies of classical polarimetry in dealing with specific practical situations, this dissertation expands the traditional polarimetric approaches to include higher order field correlations and the description of fields fluctuating in three dimensions. In relation to characterization of depolarizing media, a number of fourth-order correlations are introduced in this dissertation. Measurements of full polarization distributions, and the subsequent evaluation of Stokes vector element correlations and Complex Degree of Mutual Polarization demonstrate the use of these quantities for material discrimination and characterization. Recent advancements in detection capabilities allow access to fields near their sources and close to material boundaries, where a unique direction of propagation is not evident. Similarly, there exist classical situations such as overlapping beams, focusing, or diffusive scattering in which there is no unique transverse direction. In this dissertation, the correlation matrix formalism is expanded to describe three dimensional electromagnetic fields, providing a definition for the degree of polarization of such a field. It is also shown that, because of the dimensionality of the problem, a second parameter is necessary to fully describe the polarimetric properties of three dimensional fields. Measurements of second-order correlations of a three dimensional field are demonstrated, allowing the

  12. New detailed holocene paleomagnetic records with anomalous geomagnetic field behavior in Argentina Nuevos registros paleomagnéticos holocenos detallados con comportamiento anómalo del campo magnético terrestre en Argentina

    Directory of Open Access Journals (Sweden)

    Hugo G Nami

    2012-12-01

    Full Text Available Detailed palaeomagnetic studies were performed in several archaeological and geological sections dated with diverse relative and absolute methods. Data from 360 cores obtained in eight sites across eastern Argentina are reported. Characteristic remanence magnetization directions were determined by progressive alternating field demagnetization. Remanence directions showed anomalous geomagnetic field behavior far from the present magnetic field bearing oblique normal, oblique reverse and reverse polarities for the latest Pleistocene and Holocene, as well as evidence of possible field excursions recorded in several stratigraphic sections spanning ~11-0.5 kya. Computed virtual geomagnetic poles from those directions tend to be concentrated over North America, Europe, Eastern Asia, Africa and Australia. The hypothesis of the anomalous geomagnetic field directions is probably related with 14C fluctuations and solar activity.Se realizaron estudios paleomagnéticos detallados en varias secciones sedimentarias arqueológicas y geológicas fechadas con diversos métodos de datación absoluta y relativa. Se reportan resultados obtenidos de 360 muestras recogidas en ocho sitios localizados en el este de Argentina. La magnetización remanente característica fue determinada por desmagnetización progresiva utilizando campos alternos. Las direcciones remanentes mostraron conductas anómalas del campo geomagnético lejanas al campo actual mostrando polaridades oblicuas normales, oblicuas reversas y reversas con evidencia de posibles excursiones geomagnéticas registradas en varias secciones con un lapso temporal de ~11-0.5 kya. Los polos geomagnéticos virtuales computados a partir de las direcciones tienden a concentrarse sobre Norteamérica, Europa, Este de Asia, África y Australia. Se discute la hipótesis que la conducta anómala del campo magnético terrestre probablemente se relacione con las fluctuaciones de la producción de 14C y la actividad solar.

  13. Covariant electromagnetic field lines

    Science.gov (United States)

    Hadad, Y.; Cohen, E.; Kaminer, I.; Elitzur, A. C.

    2017-08-01

    Faraday introduced electric field lines as a powerful tool for understanding the electric force, and these field lines are still used today in classrooms and textbooks teaching the basics of electromagnetism within the electrostatic limit. However, despite attempts at generalizing this concept beyond the electrostatic limit, such a fully relativistic field line theory still appears to be missing. In this work, we propose such a theory and define covariant electromagnetic field lines that naturally extend electric field lines to relativistic systems and general electromagnetic fields. We derive a closed-form formula for the field lines curvature in the vicinity of a charge, and show that it is related to the world line of the charge. This demonstrates how the kinematics of a charge can be derived from the geometry of the electromagnetic field lines. Such a theory may also provide new tools in modeling and analyzing electromagnetic phenomena, and may entail new insights regarding long-standing problems such as radiation-reaction and self-force. In particular, the electromagnetic field lines curvature has the attractive property of being non-singular everywhere, thus eliminating all self-field singularities without using renormalization techniques.

  14. Partial Komori fields and imperative Komori fields

    NARCIS (Netherlands)

    Bergstra, J.A.; Middelburg, C.A.

    2009-01-01

    This paper is concerned with the status of 1/0 and ways to deal with it. These matters are treated in the setting of Komori fields, also known as non-trivial cancellation meadows. Different viewpoints on the status of 1/0 exist in mathematics and theoretical computer science. We give a simple

  15. Nonlocal continuum field theories

    CERN Document Server

    2002-01-01

    Nonlocal continuum field theories are concerned with material bodies whose behavior at any interior point depends on the state of all other points in the body -- rather than only on an effective field resulting from these points -- in addition to its own state and the state of some calculable external field. Nonlocal field theory extends classical field theory by describing the responses of points within the medium by functionals rather than functions (the "constitutive relations" of classical field theory). Such considerations are already well known in solid-state physics, where the nonlocal interactions between the atoms are prevalent in determining the properties of the material. The tools developed for crystalline materials, however, do not lend themselves to analyzing amorphous materials, or materials in which imperfections are a major part of the structure. Nonlocal continuum theories, by contrast, can describe these materials faithfully at scales down to the lattice parameter. This book presents a unif...

  16. Simulated workplace neutron fields

    International Nuclear Information System (INIS)

    Lacoste, V.; Taylor, G.; Rottger, S.

    2011-01-01

    The use of simulated workplace neutron fields, which aim at replicating radiation fields at practical workplaces, is an alternative solution for the calibration of neutron dosemeters. They offer more appropriate calibration coefficients when the mean fluence-to-dose equivalent conversion coefficients of the simulated and practical fields are comparable. Intensive Monte Carlo modelling work has become quite indispensable for the design and/or the characterization of the produced mixed neutron/photon fields, and the use of Bonner sphere systems and proton recoil spectrometers is also mandatory for a reliable experimental determination of the neutron fluence energy distribution over the whole energy range. The establishment of a calibration capability with a simulated workplace neutron field is not an easy task; to date only few facilities are available as standard calibration fields. (authors)

  17. Magnetism in meteorites. [terminology, principles and techniques

    Science.gov (United States)

    Herndon, J. M.; Rowe, M. W.

    1974-01-01

    An overview of this subject is presented. The paper includes a glossary of magnetism terminology and a discussion of magnetic techniques used in meteorite research. These techniques comprise thermomagnetic analysis, alternating field demagnetization, thermal demagnetization, magnetic anisotropy, low-temperature cycling, and coercive forces, with emphasis on the first method. Limitations on the validity of paleointensity determinations are also discussed.

  18. Nonequilibrium quantum field theories

    International Nuclear Information System (INIS)

    Niemi, A.J.

    1988-01-01

    Combining the Feynman-Vernon influence functional formalism with the real-time formulation of finite-temperature quantum field theories we present a general approach to relativistic quantum field theories out of thermal equilibrium. We clarify the physical meaning of the additional fields encountered in the real-time formulation of quantum statistics and outline diagrammatic rules for perturbative nonequilibrium computations. We derive a generalization of Boltzmann's equation which gives a complete characterization of relativistic nonequilibrium phenomena. (orig.)

  19. Organic magnetic field sensor

    Energy Technology Data Exchange (ETDEWEB)

    McCamey, Dane; Boehme, Christoph

    2017-01-24

    An organic, spin-dependent magnetic field sensor (10) includes an active stack (12) having an organic material with a spin-dependence. The sensor (10) also includes a back electrical contact (14) electrically coupled to a back of the active stack (12) and a front electrical contact (16) electrically coupled to a front of the active stack (12). A magnetic field generator (18) is oriented so as to provide an oscillating magnetic field which penetrates the active stack (12).

  20. Elementary quantum field theory

    International Nuclear Information System (INIS)

    Thirring, W.; Henley, E.M.

    1975-01-01

    The first section of the book deals with the mathematical and physical description of a quantum field with the Bose-Einstein statistics and discusses observables, invariants of the field, and inner symmetries. The second section develops further methods for solvable interactions of a quantum field with static source. Section 3 explains with the aid of the Chew-Low model especially pion-nucleon scattering, static properties of nucleons, electromagnetic phenomena, and nuclear forces. (BJ/LN) [de

  1. Wake field accelerators

    International Nuclear Information System (INIS)

    Wilson, P.B.

    1986-02-01

    In a wake field accelerator a high current driving bunch injected into a structure or plasma produces intense induced fields, which are in turn used to accelerate a trailing charge or bunch. The basic concepts of wake field acceleration are described. Wake potentials for closed cavities and periodic structures are derived, as are wake potentials on a collinear path with a charge distribution. Cylindrically symmetric structures excited by a beam in the form of a ring are considered

  2. Geomagnetic field, global pattern

    OpenAIRE

    Macmillan, Susan

    2011-01-01

    The geomagnetic field is generated in the fluid outer core region of the Earth by electrical currents flowing in the slowly moving molten iron. In addition to sources in the Earth’s core, the geomagnetic field observable on the Earth’s surface has sources in the crust and in the ionosphere and magnetosphere. The signal from the core dominates, accounting for over 95% of the field at the Earth’s surface. The geomagnetic field varies on a range of scales, both temporal and spatial; the...

  3. Effective quantum field theories

    International Nuclear Information System (INIS)

    Georgi, H.M.

    1993-01-01

    The most appropriate description of particle interactions in the language of quantum field theory depends on the energy at which the interactions are studied; the description is in terms of an ''effective field theory'' that contains explicit reference only to those particles that are actually important at the energy being studied. The various themes of the article are: local quantum field theory, quantum electrodynamics, new physics, dimensional parameters and renormalizability, socio-dynamics of particle theory, spontaneously broken gauge theories, scale dependence, grand unified and effective field theories. 2 figs

  4. Closed string field theory

    International Nuclear Information System (INIS)

    Strominger, A.

    1987-01-01

    A gauge invariant cubic action describing bosonic closed string field theory is constructed. The gauge symmetries include local spacetime diffeomorphisms. The conventional closed string spectrum and trilinear couplings are reproduced after spontaneous symmetry breaking. The action S is constructed from the usual ''open string'' field of ghost number minus one half. It is given by the associator of the string field product which is non-vanishing because of associativity anomalies. S does not describe open string propagation because open string states associate and can thereby be shifted away. A field theory of closed and open strings can be obtained by adding to S the cubic open string action. (orig.)

  5. Dielectrics in electric fields

    CERN Document Server

    Raju, Gorur G

    2003-01-01

    Discover nontraditional applications of dielectric studies in this exceptionally crafted field reference or text for seniors and graduate students in power engineering tracks. This text contains more than 800 display equations and discusses polarization phenomena in dielectrics, the complex dielectric constant in an alternating electric field, dielectric relaxation and interfacial polarization, the measurement of absorption and desorption currents in time domains, and high field conduction phenomena. Dielectrics in Electric Fields is an interdisciplinary reference and text for professionals and students in electrical and electronics, chemical, biochemical, and environmental engineering; physical, surface, and colloid chemistry; materials science; and chemical physics.

  6. Geomagnetic field of earth

    International Nuclear Information System (INIS)

    Delipetrev, Marjan; Delipetrev, Blagoj; Panovska, Sanja

    2008-01-01

    In this paper is introduced the theory of geomagnetic field of the Earth. A homogenous and isotropic sphere is taken for a model of Earth with a bar magnet at its center as a magnetic potential. The understanding of the real origin of geomagnetic field produced from differential rotation of inner core with respect to the outer core of Earth is here presented. Special attention is given to the latest observed data of the established net of geomagnetic repeat stations in the Republic of Macedonia. Finally, the maps of elements of geomagnetic field and the equation for calculation of normal magnetic field of Earth are provided. (Author)

  7. Fields, symmetries, and quarks

    International Nuclear Information System (INIS)

    Mosel, U.

    1989-01-01

    'Fields, symmetries, and quarks' covers elements of quantum field theory, symmetries, gauge field theories and phenomenological descriptions of hadrons, with special emphasis on topics relevant to nuclear physics. It is aimed at nuclear physicists in general and at scientists who need a working knowledge of field theory, symmetry principles of elementary particles and their interactions and the quark structure of hadrons. The book starts out with an elementary introduction into classical field theory and its quantization. As gauge field theories require a working knowledge of global symmetries in field theories this topic is then discussed in detail. The following part is concerned with the general structure of gauge field theories and contains a thorough discussion of the still less widely known features of Non-Abelian gauge field theories. Quantum Chromodynamics (QCD), which is important for the understanding of hadronic matter, is discussed in the next section together with the quark compositions of hadrons. The last two chapters give a detailed discussion of phenomenological bag-models. The MIT bag is discussed, so that all theoretical calculations can be followed step by step. Since in all other bag-models the calculational methods and steps are essentially identical, this chapter should enable the reader to actually perform such calculations unaided. A last chapter finally discusses the topological bag-models which have become quite popular over the last few years. (orig.)

  8. LR-parsing of Extended Context-free Grammars

    DEFF Research Database (Denmark)

    Madsen, Ole Lehrmann; Kristensen, Bent Bruun

    1976-01-01

    To improve the readability of a grammar it is common to use extended context free grammars (ECFGs) which are context free grammars (CFGs) extended with the repetition operator (*), the alternation operator (¦) and parentheses to express the right hand sides of the productions. The topic treated h...

  9. LR-Spring Mass Model for Cardiac Surgical Simulation

    DEFF Research Database (Denmark)

    Mosegaard, Jesper

    2004-01-01

    The purpose of the research conducted was to develop a real-time surgical simulator for preoperative planning of surgery in congenital heart disease. The main problem simulating procedures on cardiac morphology is the need for a large degree of detail and simulation speed. In combination with a d......The purpose of the research conducted was to develop a real-time surgical simulator for preoperative planning of surgery in congenital heart disease. The main problem simulating procedures on cardiac morphology is the need for a large degree of detail and simulation speed. In combination...

  10. The Low Energy Level Structure of {sup 191}lr

    Energy Technology Data Exchange (ETDEWEB)

    Malmskog, S G; Berg, V [AB Atomenergi, Nykoeping (Sweden); [Inst. of Physics, U niv. of Stockholm (Sweden); Baecklin, A; Hedin, G [Inst. of Physics, Univ. of Upp sala (Sweden)

    1970-02-15

    The decay of {sup 191}Pt to {sup 191}Ir has been investigated using Ge(Li)-detectors and a double focusing beta spectrometer. 35 transitions were observed and most of them were placed in a level scheme. Special attention was given to the low energy level band structure. Several multipolarity mixing ratios were determined from L-subshell ratio measurements. Using the delayed coincidence technique the half-life of the 179.05 keV level was measured to 40 {+-} 12 psec. The low level decay properties are discussed in terms of the Nilsson model with the inclusion of Coriolis coupling.

  11. The equivalence problem for LL- and LR-regular grammars

    NARCIS (Netherlands)

    Nijholt, Antinus

    1982-01-01

    The equivalence problem for context-free grammars is "given two arbitrary grammars, do they generate the same language?" Since this is undecidable in general, attention has been restricted to decidable subclasses of the context-free grammars. For example, the classes of LL(k) grammars and real-time

  12. The equivalence problem for LL- and LR-regular grammars

    NARCIS (Netherlands)

    Nijholt, Antinus; Gecsec, F.

    It will be shown that the equivalence problem for LL-regular grammars is decidable. Apart from extending the known result for LL(k) grammar equivalence to LLregular grammar equivalence, we obtain an alternative proof of the decidability of LL(k) equivalence. The equivalence prob]em for LL-regular

  13. Reducing Attendance Time in LR-EPONs With Differentiated Services

    KAUST Repository

    Elrasad, Amr

    2015-04-09

    This work presents a novel on-the-fly void filling scheme for Long-Reach EPON called Size Controlled Batch Void Filling (SCBVF). SCBVF aims at reducing the time between consecutive bandwidth grants (attendance time) and hence reducing the average delay for delay-sensitive traffic.

  14. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    user

    2011-01-17

    Jan 17, 2011 ... The water quality of the shallow hand dug wells and reservoir water were almost similar. .... formation of Sibasa basalt in the area (SRR, 2001). The cyanobacteria usually ... 3D). The nitrate level in sampling site 2 exceeded 6 mg/l. DWAF guideline .... The 1 µg/l is the safe limit suggested by the Word. Health ...

  15. Paul trap experiment to simulate intense nonneutral beam propagation through a periodic focusing field configuration

    CERN Document Server

    Davidson, R C; Majeski, R; Qin, H; Shvets, G

    2001-01-01

    This paper describes the design concept for a compact Paul trap experimental configuration that fully simulates the collective processes and nonlinear transverse dynamics of an intense charged particle beam that propagates over large distances through a periodic quadrupole magnetic field. To summarize, a long nonneutral plasma column (L>=r sub p) is confined axially by applied DC voltages V[circ]=const. on end cylinders at z=+-L, and transverse confinement is provided by segmented cylindrical electrodes (at radius r sub w) with applied oscillatory voltages +-V sub 0 (t) over 90 deg. segments. Because the transverse focusing force is similar in waveform to that produced by a discrete set of periodic quadrupole magnets in a frame moving with the beam, the Paul trap configuration offers the possibility of simulating intense beam propagation in a compact experimental facility. The nominal operating parameters in the experimental design are: barium ions (A=137); plasma column length 2L=2 m; wall radius r sub w =10...

  16. Effective field theories

    International Nuclear Information System (INIS)

    Mack, G.; Kalkreuter, T.; Palma, G.; Speh, M.

    1992-05-01

    Effective field theories encode the predictions of a quantum field theory at low energy. The effective theory has a fairly low utraviolet cutoff. As a result, loop corrections are small, at least if the effective action contains a term which is quadratic in the fields, and physical predictions can be read straight from the effective Lagrangean. Methods will be discussed how to compute an effective low energy action from a given fundamental action, either analytically or numerically, or by a combination of both methods. Basically, the idea is to integrate out the high frequency components of fields. This requires the choice of a 'blockspin', i.e. the specification af a low frequency field as a function of the fundamental fields. These blockspins will be fields of the effective field theory. The blockspin need not be a field of the same type as one of the fundamental fields, and it may be composite. Special features of blockspin in nonabelian gauge theories will be discussed in some detail. In analytical work and in multigrid updating schemes one needs interpolation kernels A from coarse to fine grid in addition to the averaging kernels C which determines the blockspin. A neural net strategy for finding optimal kernels is presented. Numerical methods are applicable to obtain actions of effective theories on lattices of finite volume. The special case of a 'lattice' with a single site (the constraint effective potential) is of particular interest. In a higgs model, the effective action reduces in this case to the free energy, considered as a function of a gauge covariant magnetization. Its shape determines the phase structure of the theory. Its loop expansion with and without gauge fields can be used to determine finite size corrections to numerical data. (orig.)

  17. twistors and gauge fields

    Directory of Open Access Journals (Sweden)

    A. G. Sergeev

    1986-01-01

    Full Text Available We describe briefly the basic ideas and results of the twistor theory. The main points: twistor representation of Minkowsky space, Penrose correspondence and its geometrical properties, twistor interpretation of linear massless fields, Yang-Mills fields (including instantons and monopoles and Einstein-Hilbert equations.

  18. Hyperfunction quantum field theory

    International Nuclear Information System (INIS)

    Nagamachi, S.; Mugibayashi, N.

    1976-01-01

    The quantum field theory in terms of Fourier hyperfunctions is constructed. The test function space for hyperfunctions does not contain C infinitely functios with compact support. In spite of this defect the support concept of H-valued Fourier hyperfunctions allows to formulate the locality axiom for hyperfunction quantum field theory. (orig.) [de

  19. Mean field games

    KAUST Repository

    Gomes, Diogo A.

    2014-01-06

    In this talk we will report on new results concerning the existence of smooth solutions for time dependent mean-field games. This new result is established through a combination of various tools including several a-priori estimates for time-dependent mean-field games combined with new techniques for the regularity of Hamilton-Jacobi equations.

  20. Quantum field theory

    CERN Document Server

    Sadovskii, Michael V

    2013-01-01

    This book discusses the main concepts of the Standard Model of elementary particles in a compact and straightforward way. The work illustrates the unity of modern theoretical physics by combining approaches and concepts of the quantum field theory and modern condensed matter theory. The inductive approach allows a deep understanding of ideas and methods used for solving problems in this field.

  1. Killing fields; The politics

    Energy Technology Data Exchange (ETDEWEB)

    Philips, Alasdair

    1990-02-01

    An overview considers the NRPB guidelines on possible health effects of low-level alternating electrical and magnetic fields and examines work by individuals on the hazards of microwave radiation, overhead power lines and childhood cancer, and the problems caused by electromagnetic fields at 50 Hz frequency. (U.K.).

  2. Moving Field Guides

    Science.gov (United States)

    Cassie Meador; Mark Twery; Meagan. Leatherbury

    2011-01-01

    The Moving Field Guides (MFG) project is a creative take on site interpretation. Moving Field Guides provide an example of how scientific and artistic endeavors work in parallel. Both begin with keen observations that produce information that must be analyzed, understood, and interpreted. That interpretation then needs to be communicated to others to complete the...

  3. Respirator field performance factors

    International Nuclear Information System (INIS)

    Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

    1985-01-01

    The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

  4. Magnetic field on board

    International Nuclear Information System (INIS)

    Estevez Radio, H.; Fernandez Arenal, C.A.

    1995-01-01

    Here, the calculation of the magnetic field on board ships is performed, using matrix calculus, in a similar way as when the magnetic field in matter is studied. Thus the final formulas are written in a more compact form and they are obtained through a simpler way, more suitable for the university education. (Author)

  5. Pregnancy and electromagnetic fields

    International Nuclear Information System (INIS)

    Bisseriex, Ch.; Laurent, P.; Cabaret, Ph.; Bonnet, C.; Marteau, E.; Le Berre, G.; Tirlemont, S.; Castro, H.; Becker, A.; Demaret, Ph.; Donati, M.; Ganem, Y.; Moureaux, P.

    2011-07-01

    This document briefly indicates the status of knowledge regarding the effect of magnetic fields on biological tissues and pregnancy, outlines the lack of data on some frequencies and the weakness of studies on long term effects on child development. It evokes the issue of exposure assessment and that of identification of workstations exposed to electromagnetic fields

  6. Magnetic field line Hamiltonian

    International Nuclear Information System (INIS)

    Boozer, A.H.

    1984-03-01

    The magnetic field line Hamiltonian and the associated canonical form for the magnetic field are important concepts both for understanding toroidal plasma physics and for practical calculations. A number of important properties of the canonical or Hamiltonian representation are derived and their importance is explained

  7. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  8. Pulsed electric fields

    Science.gov (United States)

    The concept of pulsed electric fields (PEF) was first proposed in 1967 to change the behavior or microorganisms. The electric field phenomenon was identified as membrane rupture theory in the 1980s. Increasing the membrane permeability led to the application of PEF assisted extraction of cellular co...

  9. MAGNETIC FIELDS OF STARS

    OpenAIRE

    Bychkov, V. D.; Bychkova, L. V.; Madej, J.

    2008-01-01

    Now it is known about 1212 stars of the main sequence and giants (from them 610 stars - it is chemically peculiarity (CP) stars) for which direct measurements of magnetic fields were spent (Bychkov et al.,2008). Let's consider, what representations were generated about magnetic fields (MT) of stars on the basis of available observations data.

  10. Quantization and nonlocal fields

    International Nuclear Information System (INIS)

    Kolerov, G.I.

    1977-01-01

    A relation between the postulate of causality and quatization conditions is considered for the scalar field. A formalism of outer forms given on the functional space is used. A current commutator is obtained for nonlogical fields in the space-like region

  11. Mean field games

    KAUST Repository

    Gomes, Diogo A.

    2014-01-01

    In this talk we will report on new results concerning the existence of smooth solutions for time dependent mean-field games. This new result is established through a combination of various tools including several a-priori estimates for time-dependent mean-field games combined with new techniques for the regularity of Hamilton-Jacobi equations.

  12. Unified field theory

    International Nuclear Information System (INIS)

    Vollendorf, F.

    1976-01-01

    A theory is developed in which the gravitational as well as the electromagnetic field is described in a purely geometrical manner. In the case of a static central symmetric field Newton's law of gravitation and Schwarzschild's line element are derived by means of an action principle. The same principle leads to Fermat's law which defines the world lines of photons. (orig.) [de

  13. Pregnant Field Students' Guilt

    Science.gov (United States)

    Baum, Nehami

    2006-01-01

    This study examined guilt feelings among social work students who were pregnant for the first time during field work training. Semi-structured interviews were conducted either in the 9th month (n=5) or 2-12 months after delivery (n=5). Content analysis revealed 6 main triggers, illustrated by excerpts, which stimulated field students' guilt…

  14. Electromagnetic fields in biological systems

    National Research Council Canada - National Science Library

    Lin, James C

    2012-01-01

    "Focusing on exposure, induced fields, and absorbed energy, this volume covers the interaction of electromagnetic fields and waves with biological systems, spanning static fields to terahertz waves...

  15. The Coriolis field

    Science.gov (United States)

    Costa, L. Filipe; Natário, José

    2016-05-01

    We present a pedagogical discussion of the Coriolis field, emphasizing its not-so-well-understood aspects. We show that this field satisfies the field equations of the so-called Newton-Cartan theory, a generalization of Newtonian gravity that is covariant under changes of arbitrarily rotating and accelerated frames. Examples of solutions of this theory are given, including the Newtonian analogue of the Gödel universe. We discuss how to detect the Coriolis field by its effect on gyroscopes, of which the gyrocompass is an example. Finally, using a similar framework, we discuss the Coriolis field generated by mass currents in general relativity, and its measurement by the gravity probe B and LAGEOS/LARES experiments.

  16. Complex Polynomial Vector Fields

    DEFF Research Database (Denmark)

    The two branches of dynamical systems, continuous and discrete, correspond to the study of differential equations (vector fields) and iteration of mappings respectively. In holomorphic dynamics, the systems studied are restricted to those described by holomorphic (complex analytic) functions...... or meromorphic (allowing poles as singularities) functions. There already exists a well-developed theory for iterative holomorphic dynamical systems, and successful relations found between iteration theory and flows of vector fields have been one of the main motivations for the recent interest in holomorphic...... vector fields. Since the class of complex polynomial vector fields in the plane is natural to consider, it is remarkable that its study has only begun very recently. There are numerous fundamental questions that are still open, both in the general classification of these vector fields, the decomposition...

  17. Finite fields and applications

    CERN Document Server

    Mullen, Gary L

    2007-01-01

    This book provides a brief and accessible introduction to the theory of finite fields and to some of their many fascinating and practical applications. The first chapter is devoted to the theory of finite fields. After covering their construction and elementary properties, the authors discuss the trace and norm functions, bases for finite fields, and properties of polynomials over finite fields. Each of the remaining chapters details applications. Chapter 2 deals with combinatorial topics such as the construction of sets of orthogonal latin squares, affine and projective planes, block designs, and Hadamard matrices. Chapters 3 and 4 provide a number of constructions and basic properties of error-correcting codes and cryptographic systems using finite fields. Each chapter includes a set of exercises of varying levels of difficulty which help to further explain and motivate the material. Appendix A provides a brief review of the basic number theory and abstract algebra used in the text, as well as exercises rel...

  18. Dual double field theory

    Energy Technology Data Exchange (ETDEWEB)

    Bergshoeff, Eric A. [Centre for Theoretical Physics, University of Groningen,Nijenborgh 4, 9747 AG Groningen (Netherlands); Hohm, Olaf [Simons Center for Geometry and Physics, Stony Brook University,Stony Brook, NY 11794-3636 (United States); Penas, Victor A. [Centre for Theoretical Physics, University of Groningen,Nijenborgh 4, 9747 AG Groningen (Netherlands); Riccioni, Fabio [INFN - Sezione di Roma, Dipartimento di Fisica, Università di Roma “La Sapienza”,Piazzale Aldo Moro 2, 00185 Roma (Italy)

    2016-06-06

    We present the dual formulation of double field theory at the linearized level. This is a classically equivalent theory describing the duals of the dilaton, the Kalb-Ramond field and the graviton in a T-duality or O(D,D) covariant way. In agreement with previous proposals, the resulting theory encodes fields in mixed Young-tableau representations, combining them into an antisymmetric 4-tensor under O(D,D). In contrast to previous proposals, the theory also requires an antisymmetric 2-tensor and a singlet, which are not all pure gauge. The need for these additional fields is analogous to a similar phenomenon for “exotic' dualizations, and we clarify this by comparing with the dualizations of the component fields. We close with some speculative remarks on the significance of these observations for the full non-linear theory yet to be constructed.

  19. Field theory and strings

    International Nuclear Information System (INIS)

    Bonara, L.; Cotta-Ramusino, P.; Rinaldi, M.

    1987-01-01

    It is well-known that type I and heterotic superstring theories have a zero mass spectrum which correspond to the field content of N=1 supergravity theory coupled to supersymmetric Yang-Mills theory in 10-D. The authors study the field theory ''per se'', in the hope that simple consistency requirements will determine the theory completely once one knows the field content inherited from string theory. The simplest consistency requirements are: N=1 supersymmetry; and absence of chiral anomalies. This is what the authors discuss in this paper here leaving undetermined the question of the range of validity of the resulting field theory. As is known, a model of N=1 supergravity (SUGRA) coupled to supersymmetric Yang-Mills (SYM) theory was known in the form given by Chapline and Manton. The coupling of SUGRA to SYM was determined by the definition of the ''field strength'' 3-form H in this paper

  20. Narrowing the field

    DEFF Research Database (Denmark)

    Knudsen, Bo Nissen

    characteristics and the sequence of information in the series. Adding to the challenge is the macrostructural variation: The areas covered in printed form are covered with shifting principles of selecting the names to be published. Finding the right balance between letting the algorithms structure this complex....... As of now, no less than 45 different database fields have been found necessary to structure the information found in a single place-name entry – some fields mandatory, some nonmandatory. And using a relational database structure, some fields have multiple occurrences within one entry (i.e. multiple source...... forms for one entry a.s.f.). Having made the conscious decision to split up the information into so many categories (i.e. fields) – instead of employing a broad 'other information' field – sophisticated algorithms have been developed in order to identify information category from typographical...