Assessment of co-seismic landslide susceptibility using LR and ...

Indian Academy of Sciences (India)

Suchita Shrestha

2018-03-28

Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Microcystin-LR equivalent concentrations in fish tissue during a ...

African Journals Online (AJOL)

The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

International Nuclear Information System (INIS)

Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

2016-01-01

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

2016-09-05

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

Science.gov (United States)

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

Science.gov (United States)

Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

2015-10-01

The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

Directory of Open Access Journals (Sweden)

Kai Shen

2011-07-01

Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

Directory of Open Access Journals (Sweden)

Sérgio João de Luca

2010-03-01

Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Microcystin-LR in surface water of Ponjavica river

Directory of Open Access Journals (Sweden)

Natić Dejan

2012-01-01

Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

Science.gov (United States)

2012-01-01

visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

Directory of Open Access Journals (Sweden)

Xin Sui

Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

International Nuclear Information System (INIS)

Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

2006-01-01

Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

Science.gov (United States)

Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

2014-01-01

Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

Science.gov (United States)

Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

2017-06-01

A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

Science.gov (United States)

Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

2017-06-01

Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

International Nuclear Information System (INIS)

Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

2010-01-01

LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

Science.gov (United States)

Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

2016-06-01

Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Detoxification of microcystin-LR in water by Portulaca oleracea cv.

Science.gov (United States)

Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

2014-03-01

Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Main: 1LR5 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

Some investigations and use of LR-115 track detectors for radon measurements

CERN Document Server

Amrani, D

2001-01-01

Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

Science.gov (United States)

Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

2016-03-05

A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

Directory of Open Access Journals (Sweden)

Liqiang Liu

2014-08-01

Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

International Nuclear Information System (INIS)

Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

2014-01-01

Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

Science.gov (United States)

Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

2018-06-01

A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

Spatial interpolation of precipitation in a dense gauge network for monsoon storm events in the southwestern United States

Science.gov (United States)

Garcia, Matthew; Peters-Lidard, Christa D.; Goodrich, David C.

2008-05-01

Inaccuracy in spatially distributed precipitation fields can contribute significantly to the uncertainty of hydrological states and fluxes estimated from land surface models. This paper examines the results of selected interpolation methods for both convective and mixed/stratiform events that occurred during the North American monsoon season over a dense gauge network at the U.S. Department of Agriculture Agricultural Research Service Walnut Gulch Experimental Watershed in the southwestern United States. The spatial coefficient of variation for the precipitation field is employed as an indicator of event morphology, and a gauge clustering factor CF is formulated as a new, scale-independent measure of network organization. We consider that CF 0 (clustering in the gauge network) will produce errors because of reduced areal representation of the precipitation field. Spatial interpolation is performed using both inverse-distance-weighted (IDW) and multiquadric-biharmonic (MQB) methods. We employ ensembles of randomly selected network subsets for the statistical evaluation of interpolation errors in comparison with the observed precipitation. The magnitude of interpolation errors and differences in accuracy between interpolation methods depend on both the density and the geometrical organization of the gauge network. Generally, MQB methods outperform IDW methods in terms of interpolation accuracy under all conditions, but it is found that the order of the IDW method is important to the results and may, under some conditions, be just as accurate as the MQB method. In almost all results it is demonstrated that the inverse-distance-squared method for spatial interpolation, commonly employed in operational analyses and for engineering assessments, is inferior to the ID-cubed method, which is also more computationally efficient than the MQB method in studies of large networks.

Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

International Nuclear Information System (INIS)

Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

2016-01-01

Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

International Nuclear Information System (INIS)

Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

1998-01-01

Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

Energy Technology Data Exchange (ETDEWEB)

Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

International Nuclear Information System (INIS)

Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

2007-01-01

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

Energy Technology Data Exchange (ETDEWEB)

Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

2013-02-15

In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

Science.gov (United States)

Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

2018-05-10

Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

International Nuclear Information System (INIS)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

Science.gov (United States)

Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

2018-06-01

To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

African Journals Online (AJOL)

Yomi

2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

Science.gov (United States)

2011-09-30

...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

Science.gov (United States)

Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

2016-05-01

Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

International Nuclear Information System (INIS)

Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

2004-01-01

Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

Science.gov (United States)

Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

2016-12-01

A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Main: 1LR4 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

WWER-440 control assembly local power peaking investigation on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

International Nuclear Information System (INIS)

Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

2006-01-01

The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

International Nuclear Information System (INIS)

Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

2016-01-01

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

Science.gov (United States)

Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

2017-07-01

In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

Directory of Open Access Journals (Sweden)

Jinlin Jiang

Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

Science.gov (United States)

Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

2013-01-01

Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

Science.gov (United States)

González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

2017-10-01

This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

International Nuclear Information System (INIS)

Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

2017-01-01

Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

Low-priced, time-saving, reliable and stable LR-115 counting system

International Nuclear Information System (INIS)

Tchorz-Trzeciakiewicz, D.E.

2015-01-01

Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

International Nuclear Information System (INIS)

Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

1996-01-01

The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

Energy Technology Data Exchange (ETDEWEB)

Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

2016-12-15

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

LALR(1) : LL(1) = LR(0) : LL(0)

NARCIS (Netherlands)

Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

1992-01-01

It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

Science.gov (United States)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

Science.gov (United States)

Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

2018-04-30

Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

Radon concentrations in some Egyptian dwellings using LR 115 detectors

International Nuclear Information System (INIS)

Hussein, A.S.

2007-01-01

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

International Nuclear Information System (INIS)

Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

2013-01-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

Science.gov (United States)

A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

Radon concentrations in some Egyptian dwellings using LR 115 detectors

Energy Technology Data Exchange (ETDEWEB)

Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

Science.gov (United States)

Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

2013-11-15

Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

Science.gov (United States)

Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

2011-10-01

A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

Science.gov (United States)

Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

2017-06-05

A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

NARCIS (Netherlands)

Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

2017-01-01

The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

The calibration of the solid state nuclear track detector LR 115 for radon measurements

CERN Document Server

Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

1999-01-01

An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

Energy Technology Data Exchange (ETDEWEB)

Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

2013-10-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann

1981-01-01

A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

Science.gov (United States)

Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

First successful ionization of Lr (Z = 103) by a surface-ionization technique

Energy Technology Data Exchange (ETDEWEB)

Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

2013-02-15

We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

International Nuclear Information System (INIS)

Zeller, P.; Clement, M.; Fessard, V.

2011-01-01

Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

Directory of Open Access Journals (Sweden)

Mawethu P. Bilibana

2016-11-01

Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

Directory of Open Access Journals (Sweden)

Carol P. S. Lam

2015-01-01

Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

International Nuclear Information System (INIS)

Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

2004-01-01

A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

Institute of Scientific and Technical Information of China (English)

王文琴; 张永臣; 贾红玲

2013-01-01

目的：通过对太冲古代文献的整理，总结太冲的应用规律。方法：以《中华医典》（第四版）收录的中医古籍1000部为检索范围，对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理，并建立数据库。结果：太冲应用符合纳入标准的有752条，治疗病症共有689条，涉及87部古籍。太冲配伍的使用频次共有1433次，与太冲穴配伍的经穴为167个。结论：太冲单穴适应于临床各科，尤善于治疗中医内科病症，前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证；配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风；太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多，常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交；常用的刺灸法为灸法，针刺深度为针三分，针刺时间为十呼，灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

Science.gov (United States)

Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

2007-12-26

Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

International Nuclear Information System (INIS)

Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

2012-01-01

Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

Science.gov (United States)

Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

Directory of Open Access Journals (Sweden)

Jing Li

2018-01-01

Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

Directory of Open Access Journals (Sweden)

Gaodao Liang

2011-01-01

Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

Bulk etch rate of LR-115 cellulose nitrate film

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

Science.gov (United States)

Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

2017-11-01

Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

International Nuclear Information System (INIS)

Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

2001-01-01

An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

Science.gov (United States)

He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

2015-01-01

A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

Science.gov (United States)

Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

2017-10-01

The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

2012-04-15

Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

Science.gov (United States)

Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

2018-06-01

The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

NARCIS (Netherlands)

Haraksim, Rudolf; Meuwly, Didier

2013-01-01

This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

alpha-particle radioactivity from LR 115 by two methods of analysis

CERN Document Server

Azkour, K; Adloff, J C; Pape, A

1999-01-01

LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

WWER safety investigations on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2001-01-01

A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

Science.gov (United States)

Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

2015-02-01

The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

2018-03-01

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

Energy Technology Data Exchange (ETDEWEB)

Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

2017-02-15

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

International Nuclear Information System (INIS)

Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

2017-01-01

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

Science.gov (United States)

Siuly; Li, Yan; Paul Wen, Peng

2014-03-01

Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

Directory of Open Access Journals (Sweden)

Lorena Rosso

2014-04-01

Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

International Nuclear Information System (INIS)

Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

2010-01-01

The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

CERN Document Server

Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

1999-01-01

Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

Directory of Open Access Journals (Sweden)

Ellen Cristine Giese

2015-06-01

Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

International Nuclear Information System (INIS)

Clement, G.; Delvecchio, D.J.; Sazawal, V.

1997-01-01

The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

International Nuclear Information System (INIS)

Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-01-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

Energy Technology Data Exchange (ETDEWEB)

Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

2010-03-15

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

Science.gov (United States)

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

Absolute Transition Rates in {sup 188}lr

Energy Technology Data Exchange (ETDEWEB)

Malmskog, S G; Berg, V

1969-09-15

Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

DEFF Research Database (Denmark)

Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

2015-01-01

We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

Direct determination of bulk etching rate for LR-115-II solid state ...

Indian Academy of Sciences (India)

The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

Directory of Open Access Journals (Sweden)

Jaiok Roh

2011-01-01

Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

The Role of Polymerase Chain Reaction (PCR in Diagnosis of Spine Tuberculosis after Pre-operative Anti-tuberculosis Treatment

Directory of Open Access Journals (Sweden)

AH Rasit

2011-03-01

Full Text Available OBJECTIVE: The aim of this study was to evaluate the role of polymerase chain reaction (PCR in the diagnosis of spinal tuberculosis after 2 weeks of preoperative anti-tuberculosis treatment and to compare PCR to the Löwenstein - Jensen Culture (LJC and histopathological examination (HPE methods. METHODS: Twenty-five patients were included in this study. Sixteen patients were diagnosed and treated for spinal tuberculosis based on clinical and radiological evidence. Nine patients were controls. The LJC method and HPE of the specimen were performed according to hospital protocol. PCR was performed using primer encoding insertion of sequences IS6110 for mycobacterium tuberculosis complex. Clinical findings and radiological features were the gold standard for comparison. RESULTS: PCR results were 15 positive and one negative. The sensitivity and specificity of PCR was 94% and 100% respectively (with 95% confidence interval [CI] 67% to 99% and 63% to 100%, respectively. HPE results showed 13 were positive and 3 negative in the spinal tuberculosis group; for the control group, all were negative. Sensitivity and specificity value of HPE was 82 % and 100% respectively (with 95% confidence interval [CI] 54% to 95% and 63% to 100%, respectively. Use of LJC showed only one was positive and 15 were negative in the spinal tuberculosis group whole all nine in the control group were negative. Sensitivity and specificity value of LJC was 6% and 100% respectively (with 95% confidence interval [CI] 0.3% to 32% and 63% to 100%, respectively. CONCLUSION: Our findings showed that the PCR for Mycobacterium tuberculosis is reliable as a method for diagnosis of spinal tuberculosis, even after of 2 weeks of anti-TB treatment, with an overall sensitivity of 94% and specificity of 100%.

Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

Science.gov (United States)

McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

2002-01-01

A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

Science.gov (United States)

Woods, Carol M.

2008-01-01

Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

Science.gov (United States)

Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

2016-03-01

While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

International Nuclear Information System (INIS)

El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

2014-01-01

Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

Science.gov (United States)

Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

2016-01-01

The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

Science.gov (United States)

Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

2011-01-01

A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

6. State energy balance - 1978/1987 - Minas Gerais, Brazil

International Nuclear Information System (INIS)

1989-05-01

The energetic plan of Minas Gerais state and the steps such as energy balance, state potential energy identification, social and economic analysis, energetic flux, energy consumption is presented. (L.J.C.)

In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

Science.gov (United States)

Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

2013-05-01

Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

Science.gov (United States)

Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-03-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

Science.gov (United States)

Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

2018-07-01

The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

Science.gov (United States)

1956-01-01

The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

Energy Technology Data Exchange (ETDEWEB)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

2003-07-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

CSIR Research Space (South Africa)

Nchabeleng, T

2014-12-01

Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

Application of the LR-56 at DOE Facilities in the United States

International Nuclear Information System (INIS)

Smith, A.C.

1998-05-01

The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

Study of the variation of the nuclear transcriptional map during de initial development of Drosophyla melanogaster embryos

International Nuclear Information System (INIS)

Alonso, C.E.V.

1987-01-01

The variation of nuclear transcriptional map during the initial development of Drosophyla melanogaster embryos were studied. Thermic treatment, chromatographic techniques and liquid scintilation in embryos inoculated with radioactive uridine were used. (L.J.C.)

Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

2014-04-18

Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

Directory of Open Access Journals (Sweden)

Julin Yuan

2015-10-01

Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

7. State energy balance - 1978/1988 - Minas Gerais, Brazil

International Nuclear Information System (INIS)

1990-05-01

The Minas Gerais energetic system is presented, including the energy sources by economic social aspects as well as statistical data. This balance is a data base for prospective studies of consumption and energy availability. (L.J.C.)

Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

Science.gov (United States)

Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

2013-04-01

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

Science.gov (United States)

Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

2005-12-01

Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

OpenAIRE

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

Parameters of calibration of the measurement system of 222 Rn based in LR-115

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

2003-01-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Type B liquid package technical issues -- Experience with LR-56 safety analysis

International Nuclear Information System (INIS)

Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

1997-01-01

In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

Environmental impacts of Proalcool: production and consumption

International Nuclear Information System (INIS)

Magrini, A.; Nassi, C.D.; Barcellos, P.P.

1992-01-01

The environmental impacts caused by the Programa Nacional do Alcool -PROALCOOL - Brazil, are analysed. Rio de Janeiro and Sao Paulo States are studied, comparing the regional differences. The production and the consumption phases are analysed separately. (L.J.C.)

Perturbation measurements in reactor LR-0 and their evaluation

International Nuclear Information System (INIS)

Rypar, W.; Faehrmann, K.H.

1988-07-01

To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

Directory of Open Access Journals (Sweden)

R. Greco

2013-09-01

Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

International Nuclear Information System (INIS)

Hadek, J.; Grundmann, U.

1989-09-01

Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

International Nuclear Information System (INIS)

Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

1987-01-01

The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

Science.gov (United States)

Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

International Nuclear Information System (INIS)

Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

2008-01-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

Energy Technology Data Exchange (ETDEWEB)

Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

2008-07-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

International Nuclear Information System (INIS)

Aharmim, B.; Sabir, A.; Marah, H.

2002-01-01

A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

2016-08-31

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 ⁷LiF-BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

International Nuclear Information System (INIS)

Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

2016-01-01

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

Directory of Open Access Journals (Sweden)

Tingting Xu

2014-01-01

Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

Science.gov (United States)

Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

2018-04-25

A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

International Nuclear Information System (INIS)

De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

2014-01-01

An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr; Shihada, Basem

2015-01-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr

2015-07-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Scaling of the dynamics of flexible Lennard-Jones chains

DEFF Research Database (Denmark)

Veldhorst, Arno; Dyre, J. C.; Schrøder, Thomas

2014-01-01

functions of excess entropy) which has been observed in simulations of both molecular and polymeric systems. Doing molecular dynamics simulations of flexible Lennard-Jones chains (LJC) with rigid bonds, we here provide the first detailed test of the isomorph theory applied to flexible chain molecules. We...

Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

Science.gov (United States)

The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

Phytomedicine versus Gonorrhoea: The Bapedi Experience ...

African Journals Online (AJOL)

Phytomedicine versus Gonorrhoea: The Bapedi Experience. LJC Erasmus, MJ Potgieter, SS Semenya, SJ Lennox. Abstract. Records regarding the phytomedicine employed by the Bapedi are almost non-existent. This is the first study of herbal remedies used by Bapedi traditional healers to treat gonorrhoea, of concern as it ...

Author Details

African Journals Online (AJOL)

Erasmus, LJC. Vol 9, No 4 (2012) - Articles Phytomedicine versus Gonorrhoea: The Bapedi Experience Abstract PDF · Vol 10, No 2 (2013) - Articles Herbal medicines used by Bapedi traditional healers to treat reproductive ailments in the Limpopo Province, South Africa Abstract PDF. ISSN: 0189-6016. AJOL African ...

Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

International Nuclear Information System (INIS)

Vallejo Delgado, L.R.

1989-01-01

This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

International Nuclear Information System (INIS)

Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

2007-01-01

Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

Science.gov (United States)

Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

2017-06-01

The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

International Nuclear Information System (INIS)

Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

2006-01-01

The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

International Nuclear Information System (INIS)

Somogyi, G.; Hunyadi, I.; Varga, Zs.

1978-01-01

Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

NARCIS (Netherlands)

K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

2016-01-01

markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

Author Details

African Journals Online (AJOL)

Erasmus, LJC. Vol 13, No 2 (2013) - Articles Exotic and indigenous problem plants species used, by the Bapedi, to treat sexually transmitted infections in Limpopo Province, South Africa Abstract PDF. ISSN: 1680-6905. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

Investigations into the biodegradation of microcystin-LR in wastewaters

International Nuclear Information System (INIS)

Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

2010-01-01

Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

Development of measuring system with self-powered neutron detectors for the LR-0 reactor

International Nuclear Information System (INIS)

Erben, O.; Horinek, K.; Szasz, Z.

1989-01-01

A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

Directory of Open Access Journals (Sweden)

Košťál Michal

2016-01-01

Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

OpenAIRE

Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

2016-01-01

International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

International Nuclear Information System (INIS)

Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

1998-01-01

In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

Chemicals and lemon essential oil effect on Alicyclobacillus acidoterrestris viability

Directory of Open Access Journals (Sweden)

Maria Cristina Maldonado

2013-12-01

Full Text Available Alicyclobacillus acidoterrestris is considered to be one of the important target microorganisms in the quality control of acidic canned foods. There is an urgent need to develop a suitable method for inhibiting or controlling the germination and outgrowth of A.acidoterrestris in acidic drinks. The aim of this work was to evaluate the chemicals used in the lemon industry (sodium benzoate, potassium sorbate, and lemon essential oil as a natural compound, against a strain of A.acidoterrestris in MEB medium and in lemon juice concentrate. The results pointed out that sodium benzoate (500-1000-2000 ppm and lemon essential oil (0.08- 0.12- 0.16% completely inhibited the germination of A. acidoterrestris spores in MEB medium and LJC for 11 days. Potassium sorbate (600-1200 ppm was more effective to inhibit the growth of the microbial target in lemon juice than in MEB medium. The effect of sodium benzoate, potassium sorbate and essential oil was sporostatic in MEB and LJC as they did not affect spore viability.

Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

Directory of Open Access Journals (Sweden)

Vitor Vasconcelos

2011-12-01

Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

Science.gov (United States)

Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

2012-10-01

• The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

International Nuclear Information System (INIS)

Heydari-Fard, Malihe

2010-01-01

The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

Energy final consumption projection - 1985/2005 - basic scenery - Minas Gerais State

International Nuclear Information System (INIS)

1989-03-01

A projection of the final energy consumption study for the Minas Gerais State until 2005 year is presented. The conclusion of this projection shows a increasing of 108,8% for the total energy. The industries will be response for 62,0% and the transport sector will use 20,7% of the total energy in 2005. (L.J.C.)

Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

International Nuclear Information System (INIS)

Sawamura, Teruko; Yamazaki, Hatsuo

1988-01-01

This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

Directory of Open Access Journals (Sweden)

Valentina Kubale

2016-07-01

Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

Science.gov (United States)

Sellbom, Martin; Bagby, R. Michael

2008-01-01

In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

Organização estrutural da folha de Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae Leaf structural organization of Pimenta pseudocaryophyllus (Gomes L.R. Landrum, Myrtaceae

Directory of Open Access Journals (Sweden)

Vanessa de Farias

2009-06-01

Full Text Available Com grande distribuição no Brasil e ocorrência principalmente no cerrado, caatinga e floresta atlântica, Pimenta pseudocaryophyllus (Gomes L.R. Landrum, que está inclusa em um dos menores gêneros de Myrtaceae, é popularmente conhecida como craveiro-do-mato, louro-cravo ou chá-de-bugre. Trata-se de uma espécie nativa e suas folhas são usadas na culinária substituindo o cravo-da-índia (Syzygium aromaticum devido ao aroma semelhante. O estudo tem o objetivo de caracterizar anatomicamente a folha dessa espécie. Para a confecção do laminário, amostras da região mediana da folha e do pecíolo foram seccionadas em micrótomo de rotação e coradas com azul de toluidina a 1%. Em vista frontal, a epiderme é glabra na face adaxial e pilosa na face abaxial, com tricomas unicelulares. A folha é hipoestomática e os complexos estomáticos são anomocíticos. Em secção transversal, a epiderme é uniestratificada revestida por cutícula espessa e camada subepidérmica formada por 1-2 estratos celulares. O mesofilo é dorsiventral e bainha esclerenquimática envolve o feixe vascular bicolateral. Na folha e no pecíolo observam-se colênquima lacunar, flanges cuticulares, canais secretores e idioblastos contendo drusas e monocristais. Concluise que a espécie possui características freqüentes para Myrtaceae, com exceção da camada subepidérmica e flanges cuticulares, e que os resultados obtidos contribuem com novas informações que podem subsidiar estudos futuros no que se refere à identificação e delimitação do táxon.Pimenta pseudocaryophyllus (Gomes L.R. Landrum is a native species from Brazil and occurs mainly in cerrado, caatinga and Atlantic rainforest vegetation. It is commonly known as "craveiro-do-mato", "louro-cravo" or "chá-de-bugre". It is a tree species whose leaves are used for cooking; they smell and taste like cloves (Syzygium aromaticum. This study describes the leaf anatomy of the species. The leaves were sliced

Estudo da potencialidade dos processos oxidativos avançados na remediação de águas contaminadas por microcistina - LR.

OpenAIRE

Jacobs, Loraine Cristina do Valle

2011-01-01

Resumo:Dentre os muitos efeitos deleterios provocados pelo processo de eutrofizacao de aguas naturais, importante destaque deve ser dado ao surgimento de floracoes de cianobacterias e a consequente geracao de cianotoxinas de potente efeito hapatotoxico (ex. Microcistina-LR). Em geral, rotinas convencionais para potabilizacao da agua se mostram ineficientes para a remocao destes micropoluentes, o que tem estimulado o estudo de novas alternativas de tratamento. O presente trabalho teve como pri...

Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

Science.gov (United States)

Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

2017-01-01

In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

Science.gov (United States)

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

International Nuclear Information System (INIS)

Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

2010-01-01

LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

Science.gov (United States)

Feng, Rulin; Peterson, Kirk A

2017-08-28

New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

International Nuclear Information System (INIS)

Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

2014-01-01

This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

Science.gov (United States)

Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

2014-06-01

This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

International Nuclear Information System (INIS)

Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

2016-01-01

Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

Science.gov (United States)

Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

2013-01-01

Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

Directory of Open Access Journals (Sweden)

Gábor Vasas

2013-09-01

Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

Determination of power density in VVER-1000 Mock-Up in LR-0 reactor

Directory of Open Access Journals (Sweden)

Košál Michal

2017-01-01

Full Text Available The pin power density is an important quantity which has to be monitored during the reactor operation, for two main reasons. Firstly, it is part of the limits and conditions of safe operation and, secondly, it is source term in neutron transport calculations used for the adequate assessing of the state of core structures and pressure vessel material. It is often calculated using deterministic codes which may have problems with an adequate definition of boundary conditions in subcritical regions. This may lead to overestimation of real situation, and therefore the validation of the utility codes contributes not only to better fuel utilization, but also to more precise description of radiation situation in structural components of core. Current paper presents methods developed at LR-0 reactor, as well as selected results for pin power density measurement in peripheral regions of VVER-1000 mock-up. The presented data show that the results of a utility diffusion code at core boundary overestimate the measurement. This situation, however satisfactory safe, may lead to unduly conservative approach in the determination of radiation damage of core structures.

On the trajectories of CRL...LR...R orbits, their period-doubling cascades and saddle-node bifurcation cascades

International Nuclear Information System (INIS)

Cerrada, Lucia; San Martin, Jesus

2011-01-01

In this Letter, it is shown that from a two region partition of the phase space of a one-dimensional dynamical system, a p-region partition can be obtained for the CRL...LR...R orbits. That is, permutations associated with symbolic sequences are obtained. As a consequence, the trajectory in phase space is directly deduced from permutation. From this permutation other permutations associated with period-doubling and saddle-node bifurcation cascades are derived, as well as other composite permutations. - Research highlights: → Symbolic sequences are the usual topological approach to dynamical systems. → Permutations bear more physical information than symbolic sequences. → Period-doubling cascade permutations associated with original sequences are obtained. → Saddle-node cascade permutations associated with original sequences are obtained. → Composite permutations are derived.

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

International Nuclear Information System (INIS)

Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

2005-01-01

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

The first report of RPSA polymorphisms, also called 37/67 kDa LRP/LR gene, in sporadic Creutzfeldt-Jakob disease (CJD

Directory of Open Access Journals (Sweden)

Jeong Byung-Hoon

2011-08-01

Full Text Available Abstract Background Although polymorphisms of PRNP, the gene encoding prion protein, are known as a determinant affecting prion disease susceptibility, other genes also influence prion incubation time. This finding offers the opportunity to identify other genetic or environmental factor (s modulating susceptibility to prion disease. Ribosomal protein SA (RPSA, also called 37 kDa laminin receptor precursor (LRP/67 kDa laminin receptor (LR, acts as a receptor for laminin, viruses and prion proteins. The binding/internalization of prion protein is dependent for LRP/LR. Methods To identify other susceptibility genes involved in prion disease, we performed genetic analysis of RPSA. For this case-control study, we included 180 sporadic Creutzfeldt-Jakob disease (CJD patients and 189 healthy Koreans. We investigated genotype and allele frequencies of polymorphism on RPSA by direct sequencing or restriction fragment length polymorphism (RFLP analysis. Results We observed four single nucleotide polymorphisms (SNPs, including -8T>C (rs1803893 in the 5'-untranslated region (UTR of exon 2, 134-32C>T (rs3772138 in the intron, 519G>A (rs2269350 in the intron and 793+58C>T (rs2723 in the intron on the RPSA. The 519G>A (at codon 173 is located in the direct PrP binding site. The genotypes and allele frequencies of the RPSA polymorphisms showed no significant differences between the controls and sporadic CJD patients. Conclusion These results suggest that these RPSA polymorphisms have no direct influence on the susceptibility to sporadic CJD. This was the first genetic association study of the polymorphisms of RPSA gene with sporadic CJD.

Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

Directory of Open Access Journals (Sweden)

Augusto Etchegaray

2010-01-01

Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

Directory of Open Access Journals (Sweden)

Carolina Saori Ishii Mauro

2016-12-01

Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

Comparison of fast neutron spectra in graphite and FLINA salt inserted in well-defined core assembled in LR-0 reactor

International Nuclear Information System (INIS)

Košťál, Michal; Veškrna, Martin; Cvachovec, František; Jánský, Bohumil; Novák, Evžen; Rypar, Vojtěch; Milčák, Ján; Losa, Evžen; Mravec, Filip; Matěj, Zdeněk; Rejchrt, Jiří; Forget, Benoit; Harper, Sterling

2015-01-01

Highlights: • Neutron spectra measured in graphite and LiF + NaF. • Comparison of calculated and measured neutron spectra. • Effect of 19F on variation between various library calculated spectra. - Abstract: The present paper aims to compare the calculated and measured spectra after insertion of candidate materials for the Molten salt reactor/Fluoride cooled high temperature reactor system concept into the LR-0 reactor. The calculation is realized with MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JENDL-3.3, JENDL-4, ROSFOND-2010 and CENDL-3.1 nuclear data libraries. Additionally, comparisons between the slowing down power of each media were performed. The slowing down properties are important parameters affecting the thickness of moderator media in a reactor

Study of graphite reactivity worth on well-defined cores assembled on LR-0 reactor

International Nuclear Information System (INIS)

Košťál, Michal; Rypar, Vojtěch; Milčák, Ján; Juříček, Vlastimil; Losa, Evžen; Forget, Benoit; Harper, Sterling

2016-01-01

Highlights: • A light water critical facility for graphite reactivity worth measurements. • Comparison of calculated and measured k eff . • Effect of graphite description on k eff . - Abstract: Graphite is an often-used moderating material on the basis of its good moderating power and very low absorption cross section. This small absorption cross section permits the use of natural or low-enriched uranium in graphite moderated reactors. Graphite is now being considered as the moderator for Fluoride-salt-cooled High Temperature Reactors (FHR). The critical moderator level was measured for various graphite block configurations in an experimental dry assembly of the LR-0 reactor. Comparisons with experiments were performed between Monte Carlo simulation tools for which satisfactory agreement was obtained with the exception of some systematic discrepancies. The larger discrepancies were observed when using the ENDF/B-VII.0 library. To decrease the uncertainties, based on conservative assumptions, relative comparisons were done. The results provided by the different nuclear data libraries are within 3 sigma interval of experimental uncertainties. It has been determined that differences between the results of calculations are caused by variations in the (n,n), (n,n′), (n,g) reactions and also by various angular distributions, while the (n,g) cross section variations play only a minor role for these configurations.

Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

International Nuclear Information System (INIS)

Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

1991-01-01

The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

CSIR Research Space (South Africa)

Oberholster, Paul J

2009-09-01

Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

International Nuclear Information System (INIS)

Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

2016-01-01

Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

Directory of Open Access Journals (Sweden)

Hanna Mazur

2001-09-01

Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

15.SFPS "Ieņēmumi no līgumiem ar klientiem"un 16.SFPS "Noma" prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu

OpenAIRE

Dābola, Iveta

2016-01-01

Maģistra darba temats 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” prasības un to salīdzinājums ar iepriekšējiem SFPS/SGS un LR likumdošanu. Maģistra darba mērķis - balstoties uz 15. SFPS “Ieņēmumi no līgumiem ar klientiem” un 16. SFPS “Noma” standartu prasību izpēti un analīzi, novērtēt Latvijas likumdošanas atbilstību minēto standartu prasībām un sniegt priekšlikumus konkrētu jautājumu risināšanai Latvijas kontekstā. Maģistra darbā izpētīti LR normatīvie regulējumi un sta...

Radon survey related to construction materials and soils in Zacatecas, Mexico using LR-115

International Nuclear Information System (INIS)

Mireles, F.; Garcia, M.L.; Quirino, L.L.; Davila, J.I.; Pinedo, J.L.; Rios, C.; Montero, M.E.; Colmenero, L.; Villalba, L.

2007-01-01

Indoor radon gas ( 222 Rn), present in the air inside buildings, is one of the most important sources of radiation exposure to the population. This gas originates in the 238 U radioactive decay chain, which is contained in rock and solid soil particles. Radon accumulation in confined spaces, inside buildings, depends on several factors such as the type of soils, type of constructions, building materials, and ventilation. The aim of this work is to present indoor and outdoor radon concentrations for 202 dwellings and indoor concentrations for 148 public clinics; and the radon concentrations relate to the type of predominant soils, the construction years; and building materials used in the ceilings, walls and floors, for cities and towns of the 57 municipalities in the State of Zacatecas, Mexico. The 222 Rn concentrations were measured with a passive-type radon monitor, with LR-115 as detector material; and the radon survey was made during four stages of three months each throughout Zacatecas from 2001 to 2002. The indoor and outdoor radon concentration averages in dwellings were 55.6±4.9Bqm -3 and 46.5±5.3Bqm -3 , respectively. The indoor radon concentration average in public clinics was 57.8±5.4Bqm -3 . These values were lower than the US EPA action limit of 148Bqm -3

PCS a code system for generating production cross section libraries

International Nuclear Information System (INIS)

Cox, L.J.

1997-01-01

This document outlines the use of the PCS Code System. It summarizes the execution process for generating FORMAT2000 production cross section files from FORMAT2000 reaction cross section files. It also describes the process of assembling the ASCII versions of the high energy production files made from ENDL and Mark Chadwick's calculations. Descriptions of the function of each code along with its input and output and use are given. This document is under construction. Please submit entries, suggestions, questions, and corrections to (ljc at sign llnl.gov) 3 tabs

Radon measurement by Solid States Nuclear Tracks Detectors (SSNTD/LR-115) in the city of Cocody (Abidjan)

International Nuclear Information System (INIS)

Agba, Dabo Salif Ignace

2011-02-01

Radon as natural gas is permanently present in our environment. It is the main natural radiological exposure source for human beings. So, the study of the concentration of this rare gas is essential in order to evaluate the risks incured by the population and the environment. The results of different studies will guide as to take the appropriate protection decisions as recommended by the World Health Organization (WHO). The present work consists in measuring the concentration of radon (Rn 222 isotope) in seven (7) pre-selected sites in the city of Cocody (Abidjan) using SSNTD/LR-115 (photographic film detectors). Our measurements showed some variations in the concentration of radon according to seasons and the influence of main factors such as the porosity, humidity and the diameter of the specks of soil. We noticed that our measured values remain very low compared to international standards. This work is the first step for more important measurements throughout the whole ivorian territory. The aim is to draw a national cartography of radon in Cote d'Ivoire. [fr

Sensitivity of species to chemicals: dose-response characteristics for various test types (LC(50), LR(50) and LD(50)) and modes of action.

Science.gov (United States)

Hendriks, A Jan; Awkerman, Jill A; de Zwart, Dick; Huijbregts, Mark A J

2013-11-01

While variable sensitivity of model species to common toxicants has been addressed in previous studies, a systematic analysis of inter-species variability for different test types, modes of action and species is as of yet lacking. Hence, the aim of the present study was to identify similarities and differences in contaminant levels affecting cold-blooded and warm-blooded species administered via different routes. To that end, data on lethal water concentrations LC50, tissue residues LR50 and oral doses LD50 were collected from databases, each representing the largest of its kind. LC50 data were multiplied by a bioconcentration factor (BCF) to convert them to internal concentrations that allow for comparison among species. For each endpoint data set, we calculated the mean and standard deviation of species' lethal level per compound. Next, the means and standard deviations were averaged by mode of action. Both the means and standard deviations calculated depended on the number of species tested, which is at odds with quality standard setting procedures. Means calculated from (BCF) LC50, LR50 and LD50 were largely similar, suggesting that different administration routes roughly yield similar internal levels. Levels for compounds interfering biochemically with elementary life processes were about one order of magnitude below that of narcotics disturbing membranes, and neurotoxic pesticides and dioxins induced death in even lower amounts. Standard deviations for LD50 data were similar across modes of action, while variability of LC50 values was lower for narcotics than for substances with a specific mode of action. The study indicates several directions to go for efficient use of available data in risk assessment and reduction of species testing. Copyright © 2013 Elsevier Inc. All rights reserved.

Measurement of 89Y(n,2n) spectral averaged cross section in LR-0 special core reactor spectrum

Science.gov (United States)

Košťál, Michal; Losa, Evžen; Baroň, Petr; Šolc, Jaroslav; Švadlenková, Marie; Koleška, Michal; Mareček, Martin; Uhlíř, Jan

2017-12-01

The present paper describes reaction rate measurement of 89Y(n,2n)88Y in a well-defined reactor spectrum of a special core assembled in the LR-0 reactor and compares this value with results of simulation. The reaction rate is derived from the measurement of activity of 88Y using gamma-ray spectrometry of irradiated Y2O3 sample. The resulting cross section value averaged in spectrum is 43.9 ± 1.5 μb, averaged in the 235U spectrum is 0.172 ± 0.006 mb. This cross-section is important as it is used as high energy neutron monitor and is therefore included in the International Reactor Dosimetry and Fusion File. Calculations of reaction rates were performed with the MCNP6 code using ENDF/B-VII.0, JEFF-3.1, JEFF-3.2, JENDL-3.3, JENDL-4, ROSFOND-2010, CENDL-3.1 and IRDFF nuclear data libraries. The agreement with uranium description by CIELO library is very good, while in ENDF/B-VII.0 description of uranium, underprediction about 10% in average can be observed.

Kebijakan PPN atas Jasa Pengelolaan Gedung Diselenggarakan Perhimpunan Penghuni Rumah Susun Strata Title: Studi Kasus pada Apartemen LR

Directory of Open Access Journals (Sweden)

Maya Safira Dewi

2011-05-01

Full Text Available Building management service that delivered by appartment tenant association is categorized as service that not imposed PPN. Subject determination PPN becoming not clear, because definition difference between this hand bill and the rules of hits honor bound party collects PPN. Though apartment tenant association LR have circulation bruto exceeds definition small entrepreneur, tenant association remain not to be obliged as taxable employers. Evaluated from PPN object also not gives rule of law because intrinsically its service included in facility understanding or amenity or rights is available to weared as understanding taxable service as the same manner as determined by section 4 UU PPN, until provisions in this handbill opposes against rule on it. Evaluated from elementary imposition PPN generates indistinctness the level of income that obtained from management fee can become elementary imposition PPN or not, because existed difference of object definition PPN between hand bill and the rules of other PPN.

WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

International Nuclear Information System (INIS)

Josek, R.; Hudec, F.; Rypar, V.

2006-01-01

One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

Science.gov (United States)

Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

2017-03-01

The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

Complete Sensitivity/Uncertainty Analysis of LR-0 Reactor Experiments with MSRE FLiBe Salt and Perform Comparison with Molten Salt Cooled and Molten Salt Fueled Reactor Models

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mueller, Don [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2016-12-01

In September 2016, reactor physics measurements were conducted at Research Centre Rez (RC Rez) using the FLiBe (2 ⁷LiF + BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) in the LR-0 low power nuclear reactor. These experiments were intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems using FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL), in collaboration with RC Rez, performed sensitivity/uncertainty (S/U) analyses of these experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objectives of these analyses were (1) to identify potential sources of bias in fluoride salt-cooled and salt-fueled reactor simulations resulting from cross section uncertainties, and (2) to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a final report on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. In the future, these S/U analyses could be used to inform the design of additional FLiBe-based experiments using the salt from MSRE. The key finding of this work is that, for both solid and liquid fueled fluoride salt reactors, radiative capture in ⁷Li is the most significant contributor to potential bias in neutronics calculations within the FLiBe salt.

Validation of General Electric Aviation DAPS2015 Digital Recording and 1/3 Octave Analysis System for Use in Support of Aircraft Noise Certification Efforts in Compliance with 14 CFR Part 36; Letter Report: V324-FA5JBQ-LR4 Rev. 1

Science.gov (United States)

2017-10-31

NOTE: This is a revision of Letter Report V324-FA5JBQ-LR4. The purpose of the revision is to correctly identify the system designation for which the validation applies. The applicant originally identified the materials provided in support of this val...

Remoção de microcistina-LR da Microcystis aeruginosa utilizando bagaço de cana-de-açúcar in natura e carvão ativado

OpenAIRE

Almeida,Aline Rafaela de; Passig,Fernando Hermes; Pagioro,Thomaz Aurélio; Nascimento,Priscila Tiemi Higuti do; Carvalho,Karina Querne de

2016-01-01

Resumo Microcistina-LR é um tipo de toxina liberada pela cianobactéria Microcystis aeruginosa encontrada em mananciais de água usados para abastecimento humano que pode causar doenças e até mesmo a mortandade do homem se não for totalmente removida no tratamento convencional da água. A retenção desta toxina é muitas vezes realizada através do processo de adsorção em carvão ativado nas estações de tratamento de água. Neste estudo foi avaliada a utilização do bagaço de cana-de-açúcar in natura ...

The Dopants and Doping Level Dependence of the Structure and Magnetic Properties of the Eu (BA_1-xLR_x)₂Cu₃O_7+δ

Energy Technology Data Exchange (ETDEWEB)

Lin, Yu [Iowa State Univ., Ames, IA (United States)

2002-12-31

Eu(Ba_1-xLR_x)₂Cu₃O_7+δ were systematically studied in order to understand how the valence of the rear earth elements, ionic sizes and magnetic moment affect the crystal structure and magnetic and electrical properties. Differential thermal analyses were carried out to check the phase purity, X-ray data were least-squares fitted to determine the lattice parameters, and DC-SQUID magnetometry was used to characterize the superconducting properties. These results showed that the crystallography is consistent with other EuLR123ss series, LR = La, Pr, Eu. The lattice parameters vary with the ionic radii of the rare earth ions. Unlike the uniform change in lattice parameter, the superconducting transition did not vary systematically with the ionic size of the dopants. Although the general trend was for T_c to decrease with decreasing ionic size of the dopant, for the same doping level, Pr was anomalous, depressing T_c faster. Although the exact mechanism is not clear, this result is consistent with the depression of T_c for Pr substitution for the rare earth in R123. The critical current J_c was determined using the Bean model from magnetization versus field measurements as a function of temperature and field. The effect of the dopants on J_c with the increasing of temperature or applied field was determined. For T < 77 K and small values of x, the value of J_c was increased over that of the x = 0 sample. In addition, the smaller the substituting atom, the higher the J_c becomes. For instance, at x = 0.025, Eu123 < EuLa.025 < EuPr.025 < EuNd.025 < EuEu.025. The enhancement of J_c disappears for x > 0.05 and T > 0.5T_c.

Optimization strategies for improving irrigation water management of lower jhelum canal

International Nuclear Information System (INIS)

Rashid, M.U.

2015-01-01

The paper includes computing crop water requirement, identification of problems and optimization strategies for improved irrigation water management of a canal command. Lower Jhelum Canal (LJC) System was selected as a case study. Possible strategies for optimization are enhancing irrigation water productivity by high value and high yield crops, adoption of resource conservation interventions (RCIs) at the farm level, improving irrigation system efficiency and its management. Estimation of daily reference evapotranspiration of LJC command was carried out by Penman Montieth -2000 method and metrological data of Sargodha for the period 1999 to 2010 was used. Crop water requirements were computed from reference evapotranspiration, crop coefficients and periods of crops for existing cropping pattern. The comparison of the crop water requirements and available water supplies indicated shortage of more than 51% in Kharif and 54% in Rabi seasons. The gap between requirements and supplies is fulfilled by groundwater in the command. The structural measures identified in the present study for improving canal management include rationalization of canal capacities in keeping with the current water requirements and availability, rehabilitation and remodeling of canal network and lining of distributaries and minors in saline groundwater areas. An array of measures and practices identified for improved water management at the farm level include: improvement and lining of watercourses, proper farm design and layout, adoption of resource conservation technologies involving laser land leveling, zero tillage, and bed-furrow irrigation method. Adopting proper cropping systems considering land suitability and capacity building of farming community in improved soil, crop and water management technologies would enhance the water productivity in an effective and sustainable manner. (author)

The relationship between the presence and extent of lobular carcinoma in situ (LCIS) and the risk of local recurrence (LR) in patients with infiltrating cancer of the breast treated with conservative surgery (CS) and radiation therapy (RT)

International Nuclear Information System (INIS)

Abner, A.; Schnitt, S.; Connolly, J.; Recht, A.; Bornstein, B.; Nixon, A.; Hetelekidis, S.; Silver, B.; Harris, J.R.

1997-01-01

Purpose: Lobular carcinoma in situ, when found in an otherwise benign breast biopsy, is associated with an increased risk of developing a subsequent invasive breast cancer. Among patients with an infiltrating cancer resected without margin assessment, the extent of ductal carcinoma in situ is an established risk factor for LR after CS and RT. However, the association between the presence and extent of LCIS and the risk of recurrence in patients treated with CS and RT for infiltrating breast cancer remains at issue. Materials and Methods: Between 1968 and 1986, 1625 patients with clinical stage T1 and T2 invasive breast cancer were treated at the Joint Center for Radiation Therapy with complete gross tumor excision and RT to a total of ≥60 Gy. Of these, 1160 had infiltrating ductal cancer (IDC), infiltrating lobular cancer (ILC), or mixed IDC/ILC (IMC) and sufficient pathologic material for review by the study pathologists (SS and JC) to establish the presence or absence of LCIS and were evaluable at 10 years. LCIS was present adjacent to the invasive cancer in (43(1027)) IDC (4%), and either within or adjacent to the infiltrating tumor in (70(82)) ILC (85%) and (26(51)) IMC (51%). Margins were evaluable in 35% of LCIS-positive patients and 33% of LCIS-negative patients. The median follow-up time was 153 months for surviving patients. Results: The 10-year crude risk of recurrence by first site of failure for all patients was as follows: Furthermore, there was no significant relationship between the extent of the LCIS adjacent to the invasive tumor and the LR risk: The 10-year crude risk of contralateral breast cancer was 7% for the patients with LCIS and 7% for those without LCIS. CONCLUSION: We conclude that neither the presence nor the extent of LCIS is related to the risk of LR in patients with invasive breast cancer treated with CS and RT. Thus, LCIS should not be considered a contraindication to breast conservation with CS and RT

Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

Science.gov (United States)

Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

2018-02-01

Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

48Ca+249Bk fusion reaction leading to element Z = 117: long-lived α-decaying 270Db and discovery of 266Lr.

Science.gov (United States)

Khuyagbaatar, J; Yakushev, A; Düllmann, Ch E; Ackermann, D; Andersson, L-L; Asai, M; Block, M; Boll, R A; Brand, H; Cox, D M; Dasgupta, M; Derkx, X; Di Nitto, A; Eberhardt, K; Even, J; Evers, M; Fahlander, C; Forsberg, U; Gates, J M; Gharibyan, N; Golubev, P; Gregorich, K E; Hamilton, J H; Hartmann, W; Herzberg, R-D; Heßberger, F P; Hinde, D J; Hoffmann, J; Hollinger, R; Hübner, A; Jäger, E; Kindler, B; Kratz, J V; Krier, J; Kurz, N; Laatiaoui, M; Lahiri, S; Lang, R; Lommel, B; Maiti, M; Miernik, K; Minami, S; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Pang, G K; Papadakis, P; Renisch, D; Roberto, J; Rudolph, D; Runke, J; Rykaczewski, K P; Sarmiento, L G; Schädel, M; Schausten, B; Semchenkov, A; Shaughnessy, D A; Steinegger, P; Steiner, J; Tereshatov, E E; Thörle-Pospiech, P; Tinschert, K; Torres De Heidenreich, T; Trautmann, N; Türler, A; Uusitalo, J; Ward, D E; Wegrzecki, M; Wiehl, N; Van Cleve, S M; Yakusheva, V

2014-05-02

The superheavy element with atomic number Z=117 was produced as an evaporation residue in the (48)Ca+(249)Bk fusion reaction at the gas-filled recoil separator TASCA at GSI Darmstadt, Germany. The radioactive decay of evaporation residues and their α-decay products was studied using a detection setup that allowed measuring decays of single atomic nuclei with half-lives between sub-μs and a few days. Two decay chains comprising seven α decays and a spontaneous fission each were identified and are assigned to the isotope (294)117 and its decay products. A hitherto unknown α-decay branch in (270)Db (Z = 105) was observed, which populated the new isotope (266)Lr (Z = 103). The identification of the long-lived (T(1/2) = 1.0(-0.4)(+1.9) h) α-emitter (270)Db marks an important step towards the observation of even more long-lived nuclei of superheavy elements located on an "island of stability."

Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

Science.gov (United States)

O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

2011-01-01

Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

A new method for studying the transport of radon and thoron in various building materials using CR-39 and LR-115 solid state nuclear track detectors

International Nuclear Information System (INIS)

Misdaq, M.A.; Ktata, A.; Bakhchi, A.

2000-01-01

Radon ( 222 Rn) and thoron ( 220 Rn) α-activities per unit volume were measured inside and outside different building materials by using two types of solid state nuclear track detectors (SSNTD) (CR-39 and LR-115 type II). In addition, the radon and thoron emanation coefficients of the studied materials were evaluated. Based on these data, the transport of radon and thoron across parallelepipedic blocks of the building materials could be investigated and radon and thoron global α-activities per unit volume outside different building material blocks were determined. Moreover, the diffusion length and the effective diffusion coefficient of radon in the building materials were evaluated and the total alpha activity due to radon in the atmospheres of different rooms consisting of different building materials was studied

Development of everlasting flowers (Comanthera elegans (Bong. L.R. Parra & Giul. in three cultivation systems

Directory of Open Access Journals (Sweden)

Fernanda da Conceição Moreira

2017-06-01

Full Text Available Marketing the inflorescences of Comanthera elegans (Bong. L.R. Parra & Giul. represents a source of income to many families from extractives communities in the portion of the Espinhaço Range located in the state of Minas Gerais, Brazil. Cultivating this species stands out by allying income generation with conservation since the species is currently endangered. This study aimed to assess aspects of the development of C. elegans in three cultivation systems: beds, rows, and whole area. Sowing took place in January 2009 and the inflorescences were harvested in May 2010, which characterized the experimental period. Emergence; plant density; rates of flowering, mortality, resprouting, and recruiting of new individuals; and production of inflorescences per plant and per area were assessed. Emergence began approximately 50 days after sowing. Plant density ranged from 130 to 350 plants.m-2 among the three cultivation systems. The highest mortality rate (18% was observed at the peak of the dry season (August and the overall mortality rate over one reproductive cycle was 49%. Of the plants that lost the aerial part, 36% resprouted. Sprouting and seed germination accounted for 30 and 3% of the recruiting of new individuals, respectively. C. elegans had two bloom (AprilMay 2009 and April-May 2010: 5.4% of the plants bloomed in the first season and 78%, in the second. Each plant produced between three and 178 inflorescences and the highest inflorescence production in terms of weight (232 g.m-2 and number (2,910 inflorescences.m-2 was observed in the cultivation in beds at 1,624 kg.ha-1.

Long-term determination of airborne concentrations of unattached and attached radon progeny using stacked LR 115 detector with multi-step etching

International Nuclear Information System (INIS)

Nikezic, D.; Yu, K.N.

2010-01-01

We developed the theoretical basis for long-term determination of airborne concentrations of unattached and attached radon progeny. The work was separated into two parts. First, we showed that (stacked and multiply etched) LR 115 detectors could be used to determine airborne concentrations of the short-lived radon progeny, 218 Po and 214 Bi. The equilibrium factor F between radon and its progeny could then be determined through the use of the reduced equilibrium factor F red . The airborne concentrations of 214 Pb could then be determined. Second, we developed a method based on the airborne concentrations of 218 Po, 214 Pb and 214 Bi to determine the parameters of the Jacobi room model, viz., the ventilation rate λ v , aerosol attachment rate λ a , deposition rate of unattached progeny λ d u and the deposition rate of attached progeny λ d u . With these parameters, the unattached fraction f p of the potential alpha energy concentration could also be determined. Knowledge of f p , together with F, would enable more accurate determination of the effective dose in the human lung.

A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

International Nuclear Information System (INIS)

Sohail, Y.

2015-01-01

Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

Study of the weekly irrigation cycle of a cultivated field in a semi-arid area (Marrakech region, Morocco) by using CR-39 and LR-115 II track detectors and radon as a natural tracer

International Nuclear Information System (INIS)

Misdaq, M.A.; Essaouif, Z.

2007-01-01

Uranium ( 238 U) and thorium ( 232 Th) concentrations were measured in the soil of a cultivated field situated in a semi-arid area (Marrakech, Morocco) by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The same track detectors were used for measuring alpha- and beta-activities due to radon and thoron gases emanating from the soil of the studied irrigated agricultural field. The influence of the humidity (soil water content), soil depth and climate conditions on the weekly irrigation cycle of the studied cultivated field was investigated by exploiting radon measurements

The Compleat TRAIDsman.

Science.gov (United States)

1969-09-01

uses a COMMON block of 663 cells . PLOTT works from a table of data, and assigns to each trace (up to 6 traces) a preset character. Once yoor data is...ALFA 000777 1 ~L P M A LP A U VU I 00) 󈧑 EL4 ’ I’LAC 4-43 FLIER slU.-r t;IINk fLIE" (5,LP.KONUA IlEI 335 50C k k LJ~C I~ N’.12 5 ExTEN, REVISION of...FLAG, PLACLD IN CumM"O. 753 C N3.0,0 AS RUN OAIE (IF BLANK* TAKEN FROM SYSTEM C DATE CELL ) ?SS C e1-63 13 EXECUTION TIME LIMIT IN MINUTES (IF ?b6 C

Heat management in a new modular transverse toolkit used by Volkswagen; Thermomanagement im neuen modularen Querbaukasten bei Volkswagen

Energy Technology Data Exchange (ETDEWEB)

Jaeckel, Tobias; Neusser, Heinz-Jakob; Metzner, Frank-Thomas; Herzog, Ralf [Volkswagen AG, Wolfsburg (Germany)

2012-11-01

Most trips in a passenger car are shorter than 15km. Especially at low temperatures the engine, gearbox and cabin occupants compete for their heat requirements. To solve this problem an intelligent cold start and warm up program is necessary. The Innovative Thermal Management (ITM) function reduces the engine warm up time after a cold start by a systematic management of the coolant flows in the engine. Hereby the engine and gearbox reach their consumption-optimal temperature quicker. The consequence is that heating up time for the cabin is also reduced. This uniform group managment software was implemented into the ECU's of different engines in the modular transverse engine range (MQB). In the early phase of development different control strategies and technologies where simulated via a Co-Simulation environment. The potential of the third thermal management generation (ITM3) can hereby be identified at an early stage and operating scenarios can be developed. The interaction of thermal management measures upon partly and fully electrified vehicles was respected during the development of the model range with the simulation environment. (orig.)

Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

Indian Academy of Sciences (India)

Mona Singh

2017-12-08

Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

International Nuclear Information System (INIS)

Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

2007-01-01

Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

Science.gov (United States)

Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

2018-03-29

Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

International Nuclear Information System (INIS)

Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

2014-01-01

The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

International Nuclear Information System (INIS)

Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

2011-01-01

General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

Indoor radon measurements in the dwellings of Kangra District of Himachal Pradesh, India, using LR-115 nuclear track detectors

Energy Technology Data Exchange (ETDEWEB)

Dhiman, M. [Punjab Technical University (India); Mehra, R. [Department of Physics, Dr. B.R. Ambedkar National Institute of Technology (India); Tyagi, A.K. [Department of Applied Sciences, Shaheed Bhagat Singh College of Engineering and Technology (India)

2014-07-01

Study of indoor radon was carried out in the domestic environment of 15 villages of Kangra district of Himachal Pradesh, India. Time integrated track etch technique has been used for the measurement of indoor radon levels. Bare cellulose nitrate LR-115 type II films have been used as detectors in the survey of indoor radon for four seasons of three months each covering a period of one year from March 2012 to March 2013. The houses were chosen randomly in such a way that the dwellings constructed with different types of building materials such as soil, bricks, cement, marble, concrete, wood in different localities of the village are covered. It has been found that indoor radon concentration depends upon the type of house, ventilation condition etc. The calibration constant of 1 track cm{sup -2} day{sup -1} which is equal to 50 Bqm{sup -3} has been used to express radon concentration in Bqm{sup -3}. The conversion factors have been used to calculate the exposure (an exposure of an individual to radon progeny of 1 WLM is equivalent to 3.54 mJ h m{sup -3}), the annual effective dose (1 WLM=3.88 mSv) and the lifetime fatality risk (3 x 10{sup -4} WLM). Indoor radon concentrations were found to vary from 132.25 Bqm{sup -3} to 449.75 Bqm{sup -3} with an average value of 261.40 Bqm{sup -3}. Annual effective dose in these dwellings were found to vary form 2.78 mSv to 7.68 mSv with an average value of 4.5 mSv. The average radon concentration in dwellings in most of the villages falls in the action level (200-600 Bqm{sup -3}) recommended by International Commission on Radiological Protection. Document available in abstract form only. (authors)

Fine mapping of the latency-related gene of herpes simplex virus type 1: alternative splicing produces distinct latency-related RNAs containing open reading frames

International Nuclear Information System (INIS)

Wechsler, S.L.; Nesburn, A.B.; Watson, R.; Slanina, S.M.; Ghiasi, H.

1988-01-01

The latency-related (LR) gene of herpes simplex virus type 1 (HSV-1) is transcriptionally active during HSV-1 latency, producing at least two LR-RNAs. The LR gene partially overlaps the immediate-early gene ICP0 and is transcribed in the opposite direction from ICP0, producing LR-RNAs that are complementary (antisense) to ICP0 mRNA. The LR gene is thought to be involved in HSV-1 latency. The authors report here the time mapping and partial sequence analysis of this HSV-1 LR gene. 32 P-labeled genomic DNA restriction fragments and synthetic oligonucleotides were used as probes for in situ hybridizations and Northern (RNA) blot hybridizations of RNA from trigeminal ganglia of rabbits latently infected with HSV-1. The two most abundant LR-RNAs appeared to share their 5' and 3' ends and to be produced by alternative splicing. These LR-RNAs were approximately 2 and 1.3 to 1.5 kilobases in length and were designated LR-RNA 1 and LF-RNA 2, respectively. LR-RNA 1 appeared to have at least one intron removed, while LR-RNA 2 appeared to have at least two introns removed. The LR-RNAs contained two potential long open reading frames, suggesting the possibility that one or more of the LR-RNAs may be a functional mRNA

Oncologic outcome after local recurrence of chondrosarcoma: Analysis of prognostic factors.

Science.gov (United States)

Kim, Han-Soo; Bindiganavile, Srimanth S; Han, Ilkyu

2015-06-01

Literature on outcome after local recurrence (LR) in chondrosarcoma is scarce and better appreciation of prognostic factors is needed. (1) To evaluate post-LR oncologic outcomes of disease-specific survival and subsequent LR and (2) to identify prognostic factors for post-LR oncologic outcomes. Review of 28 patients with locally recurrent chondrosarcoma from the original cohort of 150 patients, who were treated surgically with or without adjuvants between 1982 and 2011, was performed. Mean age was 46 years (range, 21-73) which included 20 males and 8 females with mean follow up of 8.4 ± 7.5 years (range, 1.2-31.0). Post-LR survival at 5 years was 58.6 ± 10.3%. Age greater than 50 years (P = 0.011) and LR occurring within 1 year of primary surgery (P = 0.011) independently predicted poor survival. Seven patients suffered subsequent LR, which was significantly affected by surgical margin for LR (P = 0.038). Long-term survival of locally recurrent chondrosarcoma is achievable in a substantial number of patients. Older age at onset of LR and shorter interval from primary surgery to LR identifies high risk patients for poor post-LR survival while, wide surgical margins at LR surgery reduces the risk of subsequent LR. © 2015 Wiley Periodicals, Inc.

Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

Science.gov (United States)

Mignot, Juliette; García-Serrano, Javier; Swingedouw, Didier; Germe, Agathe; Nguyen, Sébastien; Ortega, Pablo; Guilyardi, Eric; Ray, Sulagna

2016-08-01

Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square errors computed against several reanalysis and gridded observational fields, as well as against the nudged simulation used to produce the hindcasts initial conditions. The last skill measure gives an upper limit of the predictability horizon one can expect in the forecast system, while the comparison with different datasets highlights uncertainty when assessing the actual skill. Results provide a potential prediction skill (verification against the nudged simulation) beyond the linear trend of the order of 10 years ahead at the global scale, but essentially associated with non-linear radiative forcings, in particular from volcanoes. At regional scale, we obtain 1 year in the tropical band, 10 years at midlatitudes in the North Atlantic and North Pacific, and 5 years at tropical latitudes in the North Atlantic, for both sea surface temperature (SST) and upper-ocean heat content. Actual prediction skill (verified against observational or reanalysis data) is overall more limited and less robust. Even so, large actual skill is found in the extratropical North Atlantic for SST and in the tropical to subtropical North Pacific for upper-ocean heat content. Results are analyzed with respect to the specific dynamics of the model and the way it is influenced by the nudging. The interplay between initialization and internal modes of variability is also analyzed for sea surface salinity. The study illustrates the importance of two key ingredients both necessary for the success of future coordinated decadal

Development and validation of a real time PCR for the detection of myxoma virus based on the diploid gene M000.5L/R.

Science.gov (United States)

Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

2014-02-01

The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.

1,3-Propanediol dehydrogenases in Lactobacillus reuteri: impact on central metabolism and 3-hydroxypropionaldehyde production.

Science.gov (United States)

Stevens, Marc J A; Vollenweider, Sabine; Meile, Leo; Lacroix, Christophe

2011-08-03

Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA) and further to 1,3-propanediol (1,3-PDO), the latter step catalysed by a propanediol dehydrogenase (PDH). The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts.During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.

[The influence of combinations of alien translocations on in vitro androgenesis in near-isogenic lines of spring bread wheat].

Science.gov (United States)

Sibikeeva, Yu E; Sibikeev, S N

2014-07-01

The features of in vitro androgenesis were studied in Cultured anthers of spring bread wheats L503 and Dobrynya, having 7DS-7DL-7Ae#1 L translocation with genes Lrl9/Sr25 (Lrl9 translocation) from Agropyron elongatum (Host.) P.B. and their near-isogenic lines carrying combinations of Lrl9 translocation with translocations: 1BL-IR#1S with genes Pm8/Sr31/Lr26/Yr9 (Lr26translocation) from Secale cereal L., 4BS-4BL-2R#1L with genes Lr25/Pm7 (Lr25 translocation) from Secale cereal, 3DS-3DL-3Ae#1L with genes Lr24/Sr24 (Lr24 translocation) from Agropyron elongatum and 6BS-6BL-6U#1L with gene Lr9 (Lr9 translocation) from Aegilops umbellulata Zhuk. In comparison with those varieties having received the Lrl9 translocation, the following was established: (1) the combination of translocations Lr19+26 increased embryo frequency and green plant regeneration; (2) the combination of translocations Lr19+9 decreased embryo frequency but increased green plant regeneration; (3) the combination of translocations Lr19+24 decreased embryo frequency but increased green and albino plant regeneration; (4) the combination of translocations Lr19+25 increased embryo frequency and green plant regeneration but decreased albino plant regeneration. Thus, on near-isogenic lines of spring bread wheat, the influences of genotypes of four alien translocation combinations on in vitro androgenesis were determined.

Prognosis after local recurrence after conservative surgery and radiation for early-stage breast cancer

International Nuclear Information System (INIS)

Galper, Sharon; Blood, Emily; Gelman, Rebecca; Abner, Anthony; Recht, Abram; Kohli, Anita; Wong, Julia S.; Smith, Darrell; Bellon, Jennifer; Connolly, James; Schnitt, Stuart; Winer, Eric; Silver, Barbara B.A.; Harris, Jay R.

2005-01-01

Purpose: To determine the long-term prognosis of patients who develop a local recurrence (LR) after conservative surgery (CS) and radiation therapy (RT) for early-stage invasive breast cancer. Methods and materials: Between 1970 and 1987, 2102 patients with clinical Stage I-II breast cancer were treated with CS+RT. LR was defined as any recurrence within the ipsilateral breast with or without simultaneous regional nodal or distant metastasis. Patients were at risk for a LR until the first of distant metastases, second nonbreast malignancy, or death (DF/S/D). The final study population comprised 341 patients with LR. The median time to LR was 72 months. The median follow-up time after LR was 85 months. A proportional hazards model of time from LR to DF/S/D was done to investigate the influence of factors at initial diagnosis and at LR on subsequent outcome. Results: The actuarial freedom from DF/S/D 5 years after LR was 65% and the survival was 81%. Variables significantly associated with time to DF/S/D were: LR histology (invasive vs. ductal carcinoma in situ, hazard ratio [HR] = 4.1, p 5 years, HR = 2.6, p 5 years, HR = 1.8, p = 0.006); and age at initial diagnosis (≥60 vs. < 60, HR = 1.6, p = 0.01). Conclusions: Many patients with LR after CS+RT have prolonged distant disease-free survival, particularly those able to be treated with mastectomy. Patients with a noninvasive LR, longer interval to LR, or age <60 had a longer time to distant failure, second malignancy, or death than other patients

Genetics of leprosy reactions: an overview

Directory of Open Access Journals (Sweden)

Vinicius Fava

2012-12-01

Full Text Available Type-1 (T1R and Type-2 (T2R leprosy reactions (LR, which affect up to 50% of leprosy patients, are aggressive inflammatory episodes of sudden onset and highly variable incidence across populations. LR are often diagnosed concurrently with leprosy, but more frequently occur several months after treatment onset. It is not uncommon for leprosy patients to develop recurring reactional episodes; however, they rarely undergo both types of LR. Today, LR are the main cause of permanent disabilities associated with leprosy and represent a major challenge in the clinical management of leprosy patients. Although progress has been made in understanding the immunopathology of LR, the factors that cause a leprosy patient to suffer from LR are largely unknown. Given the impact that ethnic background has on the risk of developing LR, host genetic factors have long been suspected of contributing to LR. Indeed, polymorphisms in seven genes [Toll-like receptors (TLR1, TLR2, nucleotide-binding oligomerisation domain containing 2, vitamin D receptor, natural resistance-associated macrophage protein 1, C4B and interleukin-6] have been found to be associated with one or more LR outcomes. The identification of host genetic markers with predictive value for LR would have a major impact on nerve damage control in leprosy. In this review, we present the recent advances achieved through genetic studies of LR.

Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

Science.gov (United States)

Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

2017-12-01

Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

1,3-Propanediol dehydrogenases in Lactobacillus reuteri: impact on central metabolism and 3-hydroxypropionaldehyde production

Directory of Open Access Journals (Sweden)

Meile Leo

2011-08-01

Full Text Available Abstract Background Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA and further to 1,3-propanediol (1,3-PDO, the latter step catalysed by a propanediol dehydrogenase (PDH. The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. Results A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts. During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. Conclusion The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.

Motion in the unstable thoracolumbar spine when spine boarding a prone patient

Science.gov (United States)

Conrad, Bryan P.; Marchese, Diana L.; Rechtine, Glenn R.; Horodyski, MaryBeth

2012-01-01

Introduction Previous research has found that the log roll (LR) technique produces significant motion in the spinal column while transferring a supine patient onto a spine board. The purpose of this project was to determine whether log rolling a patient with an unstable spine from prone to supine with a pulling motion provides better thoracolumbar immobilization compared to log rolling with a push technique. Methods A global instability was surgically created at the L1 level in five cadavers. Two spine-boarding protocols were tested (LR Push and LR Pull). Both techniques entailed performing a 180° LR rotation of the prone patient from the ground to the supine position on the spine board. An electromagnetic tracking device registered motion between the T12 and L2 vertebral segments. Six motion parameters were tracked. Repeated-measures statistical analysis was performed to evaluate angular and translational motion. Results Less motion was produced during the LR Push compared to the LR Pull for all six motion parameters. The difference was statistically significant for three of the six parameters (flexion–extension, axial translation, and anterior–posterior (A–P) translation). Conclusions Both the LR Push and LR Pull generated significant motion in the thoracolumbar spine during the prone to supine LR. The LR Push technique produced statistically less motion than the LR Pull, and should be considered when a prone patient with a suspected thoracolumbar injury needs to be transferred to a long spine board. More research is needed to identify techniques to further reduce the motion in the unstable spine during prone to supine LR. PMID:22330191

A comprehensive immunoassay for the detection of microcystins in waters based on polyclonal antibodies

International Nuclear Information System (INIS)

Sheng Jianwu; He Miao; Shi Hanchang; Qian Yi

2006-01-01

Microcystins (MCs) are a group of closely related toxic cyclic heptapeptides produced by common cyanobacteria (blue-green algae), and microcystin-leucine-arginine (MC-LR) is among the most frequent and most toxic microcystin congeners. In this study, a free amino group was introduced to MC-LR at its seventh amino acid residue with 2-mercaptoethylamine, and the product aminoethyl-MC-LR was coupled to bovine serum albumin (BSA) and horseradish peroxidise (HRP) by glutaraldehyde to be complete antigen (MC-LR-BSA) and labelled hapten (MC-LR-HRP), respectively. Polyclonal antibodies against MC-LR were generated by immunization with MC-LR-BSA. A direct competitive enzyme-linked immunosorbent assay (dc-ELISA) was established to detect the MCs in waters, which showed a good cross-reactivity with MC-LR, MC-RR, MC-YR, MC-LF, MC-LW and nodularin, and have a detection limit for MC-LR 0.12 μg L -1 , the 50% inhibition concentration (IC 50 ) for MC-LR was 0.63 ± 0.06 μg L -1 and the quantitative detection range was from 0.17 to 2.32 μg L -1 , the analysis result of water samples showed good recovery and reliability. So the comprehensive and reliable dc-ELISA will well potentially suit for sensitive analysis for total MCs in drinking as well as resource water samples

Alteration in the Expression of Cytochrome P450s (CYP1A1, CYP2E1, and CYP3A11 in the Liver of Mouse Induced by Microcystin-LR

Directory of Open Access Journals (Sweden)

Bangjun Zhang

2015-03-01

Full Text Available Microcystins (MCs are cyclic heptapeptide toxins and can accumulate in the liver. Cytochrome P450s (CYPs play an important role in the biotransformation of endogenous substances and xenobiotics in animals. It is unclear if the CYPs are affected by MCs exposure. The objective of this study was to evaluate the effects of microcystin-LR (MCLR on cytochrome P450 isozymes (CYP1A1, CYP2E1, and CYP3A11 at mRNA level, protein content, and enzyme activity in the liver of mice the received daily, intraperitoneally, 2, 4, and 8 µg/kg body weight of MCLR for seven days. The result showed that MCLR significantly decreased ethoxyresorufin-O-deethylase (EROD (CYP1A1 and erythromycin N-demthylase (ERND (CYP3A11 activities and increased aniline hydroxylase (ANH activity (CYP2E1 in the liver of mice during the period of exposure. Our findings suggest that MCLR exposure may disrupt the function of CYPs in liver, which may be partly attributed to the toxicity of MCLR in mice.

The Laser Ranging Experiment of the Lunar Reconnaissance Orbiter: Five Years of Operations and Data Analysis

Science.gov (United States)

Mao, Dandan; McGarry, Jan F.; Mazarico, Erwan; Neumann, Gregory A.; Sun, Xiaoli; Torrence, Mark H.; Zagwodzki, Thomas W.; Rowlands, David D.; Hoffman, Evan D.; Horvath, Julie E.;

Correlation between the Limbus-Insertion Distance of the Lateral Rectus Muscle and Lateral Rectus Recession Surgery in Intermittent Exotropia.

Directory of Open Access Journals (Sweden)

Ju-Yeun Lee

Full Text Available The aim of this study was to investigate whether the limbus-insertion distance (LID of the lateral rectus (LR muscle can be a useful indicator for predicting the surgical effect of recession surgery in intermittent exotropia (IXT. Patients who underwent unilateral or bilateral LR recession for the basic type of IXT were included. The distance between the corneal limbus and the posterior edge of the insertion of LR muscle (limbus-insertion distance was measured intraoperatively using surgical calipers (graded with 0.25 mm precision. We calculated the actual dose-response effect as the difference between the angle of preoperative deviation and the angle of postoperative deviation, and then divided the figure by the total amount of recession at postoperative months 1, 3, and 6. The correlation between the limbus-insertion distance (LID of LR muscle and each dose-response effect was statistically analyzed. A total of 60 subjects were enrolled in this study. The mean LID of LR muscle was 5.8±0.7 mm. The dose-response effect was 3.2±1.0 prism diopters (PD/mm at postoperative month 1, 3.4±1.0 PD/mm at postoperative month 3, and 3.4±1.1 PD/mm at postoperative month 6. The LID of the LR muscle was significantly correlated with dose-response effects in cases of unilateral and bilateral LR recession at postoperative months 3 and 6 (P = 0.01, <0.01, 0.04 and <0.01 respectively. As the LID of the LR muscle increased by 1 mm, the dose-response effect increased by 0.2PD/mm in unilateral LR recession, and by 0.4 PD/mm in bilateral LR recession at postoperative month 6. In conclusion, the LID of the LR muscle can be used as one predictor of the recession effect to assist in surgical planning for IXT. Moreover, undercorrection at the time of LR recession might be considered in patients with long LID of the LR muscle.

Nasally administered Lactobacillus rhamnosus strains differentially modulate respiratory antiviral immune responses and induce protection against respiratory syncytial virus infection.

Science.gov (United States)

Tomosada, Yohsuke; Chiba, Eriko; Zelaya, Hortensia; Takahashi, Takuya; Tsukida, Kohichiro; Kitazawa, Haruki; Alvarez, Susana; Villena, Julio

2013-08-15

Some studies have shown that nasally administered immunobiotics had the potential to improve the outcome of influenza virus infection. However, the capacity of immunobiotics to improve protection against respiratory syncytial virus (RSV) infection was not investigated before. The aims of this study were: a) to evaluate whether the nasal administration of Lactobacillus rhamnosus CRL1505 (Lr05) and L. rhamnosus CRL1506 (Lr06) are able to improve respiratory antiviral defenses and beneficially modulate the immune response triggered by TLR3/RIG-I activation; b) to investigate whether viability of Lr05 or Lr06 is indispensable to modulate respiratory immunity and; c) to evaluate the capacity of Lr05 and Lr06 to improve the resistance of infant mice against RSV infection. Nasally administered Lr05 and Lr06 differentially modulated the TLR3/RIG-I-triggered antiviral respiratory immune response. Lr06 administration significantly modulated the production of IFN-α, IFN-β and IL-6 in the response to poly(I:C) challenge, while nasal priming with Lr05 was more effective to improve levels of IFN-γ and IL-10. Both viable Lr05 and Lr06 strains increased the resistance of infant mice to RSV infection while only heat-killed Lr05 showed a protective effect similar to those observed with viable strains. The present work demonstrated that nasal administration of immunobiotics is able to beneficially modulate the immune response triggered by TLR3/RIG-I activation in the respiratory tract and to increase the resistance of mice to the challenge with RSV. Comparative studies using two Lactobacillus rhamnosus strains of the same origin and with similar technological properties showed that each strain has an specific immunoregulatory effect in the respiratory tract and that they differentially modulate the immune response after poly(I:C) or RSV challenges, conferring different degree of protection and using distinct immune mechanisms. We also demonstrated in this work that it is possible

Identification of Patients at Very Low Risk of Local Recurrence After Breast-Conserving Surgery

Energy Technology Data Exchange (ETDEWEB)

Smith, Sally L., E-mail: ssmith11@bccancer.bc.ca [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Truong, Pauline T. [Radiation Therapy Program and Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver Island Centre, University of British Columbia, Victoria, British Columbia (Canada); Lu, Linghong; Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, Victoria, British Columbia (Canada); Olivotto, Ivo A. [Division of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary, Calgary, Alberta (Canada)

2014-07-01

Purpose: To identify clinical and pathological factors that identify groups of women with stage I breast cancer with a 5-year risk of local recurrence (LR) ≤1.5% after breast-conserving therapy (BCS) plus whole-breast radiation therapy (RT). Methods and Materials: Study subjects were 5974 patients ≥50 years of age whose cancer was diagnosed between 1989 and 2006, and were referred with pT1 pN0 invasive breast cancer treated with BCS and RT. Cases of 5- and 10-year LR were examined using Kaplan-Meier methods. Recursive partitioning analysis was performed in patients treated with and without endocrine therapy to identify combinations of factors associated with a 5-year LR risk ≤1.5%. Results: The median follow-up was 8.61 years. Median age was 63 years of age (range, 50 to 91). Overall 5-year LR was 1.5% (95% confidence interval [CI], 1.2%-1.9%) and 10-year LR was 3.4% (95% CI, 2.8%-4.0%). Of 2830 patients treated with endocrine therapy, patient subsets identified with 5-year LR ≤1.5% included patients with grade 1 histology (n=1038; LR, 0.2%; 95% CI, 0%-0.5%) or grade 2 histology plus ≥60 years of age (n=843; LR, 0.5%; 95% CI, 0%-1.0%). Ten-year LR for these groups were 0.8% (95% CI, 0.1%-1.6%) and 0.9% (95% CI, 0.2%-1.6%), respectively. Of 3144 patients treated without endocrine therapy, patients with grade 1 histology plus clear margins had 5-year LR ≤1.5% (n=821; LR, 0.6%; 95% CI, 0.1%-1.2%). Ten-year LR for this group was 2.2% (95% CI, 1.0%-3.4%). Conclusions: Histologic grade, age, margin status, and use of endocrine therapy identified 45% of a population-based cohort of female patients over age 50 with stage I breast cancer with a 5-year LR risk ≤1.5% after BCS plus RT. Prospective study is needed to evaluate the safety of omitting RT in patients with such a low risk of LR.

Immunomagnetic separation combined with colony immunoblotting for selective enrichment and detection of piliated Lactobacillus rhamnosus strains.

Science.gov (United States)

Yang, Z Q; Wei, Y F; Rao, S Q; Gao, L; Yin, Y Q; Xue, F; Fang, W M; Gu, R X; Jiao, X A

2016-11-01

Piliated Lactobacillus rhamnosus (pLR) strains have attracted much attention owing to their excellent mucus adhering capacity and immunomodulatory effects. Here, we aimed to develop a rapid, sensitive method for isolating pLR strains in complex ecosystems using immunomagnetic separation (IMS) with colony immunoblotting (CIB). Magnetic nanobeads (diameter: 180 nm) conjugated with anti-pLR SpaA pilin antibodies (anti-SpaA) were prepared and used to preconcentrate pLR strains in samples, followed by confirmation with anti-SpaA-based CIB analysis. Under optimized experimental conditions, IMS-CIB selectively recovered pLR strains from 10 7  CFU ml -1 of faecal microbiota samples spiked with 2·9 × 10 1 to 2·4 × 10 6  CFU ml -1 of pLR strains. No positive colonies were detected in samples without addition of pLR strains. The detection limit of IMS-CIB was 29 CFU pLR ml -1 of faecal microbiota, which is much lower than that of CIB without IMS preconcentration (2·0 × 10 4  CFU ml -1 ). IMS-CIB allowed selective preconcentration of pLR strains in highly heterogeneous bacterial suspensions and direct detection of pLR colonies, which remained readily available for subsequent isolation. Our findings established an effective method for selective enrichment and detection of pLR strains. © 2016 The Society for Applied Microbiology.

Mūsdienīgas metodes cīņā ar nelikumīgā ceļā iegūto līdzekļu legalizāciju LR banku sistēmā

OpenAIRE

Mišina, Jeļena

2007-01-01

Līdz ar to, kā pēdējos gados visa pasaulē un Latvijā tiek pievērsta pastiprinātā uzmanība naudas atmazgāšanas un terorisma finansēšanas problēmai par maģistra darba tematu tika izvēlēta „Mūsdienīgas metodes cīņā ar nelikumīgā ceļa iegūto līdzekļu legalizāciju LR banku sistēmā”. Darbs sastāv no piecām nodaļām. Pirmā nodaļā tiek definēta līdzekļu legalizācijas būtība. Otrā nodaļa tiek izskatītas ārvalsts pieņemtie normatīvie akti un darbojošās institūcijas. Trešā daļā uzmanība ir vērst...

Low frequency vibrations disrupt left-right patterning in the Xenopus embryo.

Directory of Open Access Journals (Sweden)

Laura N Vandenberg

Full Text Available The development of consistent left-right (LR asymmetry across phyla is a fascinating question in biology. While many pharmacological and molecular approaches have been used to explore molecular mechanisms, it has proven difficult to exert precise temporal control over functional perturbations. Here, we took advantage of acoustical vibration to disrupt LR patterning in Xenopus embryos during tightly-circumscribed periods of development. Exposure to several low frequencies induced specific randomization of three internal organs (heterotaxia. Investigating one frequency (7 Hz, we found two discrete periods of sensitivity to vibration; during the first period, vibration affected the same LR pathway as nocodazole, while during the second period, vibration affected the integrity of the epithelial barrier; both are required for normal LR patterning. Our results indicate that low frequency vibrations disrupt two steps in the early LR pathway: the orientation of the LR axis with the other two axes, and the amplification/restriction of downstream LR signals to asymmetric organs.

Effect of Lithospermi Radix on Contact Dermatitis Induced by Dinitrofluorobenzene in Mice

Directory of Open Access Journals (Sweden)

Kim Han-Na

2012-06-01

Full Text Available Objectives: The root of Lithospermum erythrorhizon Sieb. et Zucc. (Lithospermi Radix, LR is a kind of heat clearing and blood cooling medicinal herbs. It can clear away heat and cool the blood, reduce toxins and disperse maculae. LR has long been used as efficacious therapy for inflammation, burns, frostbite and skin diseases such as eczema and psoriasis. Methods: In the present study, we investigate anti-allergic and anti-inflammatory effects of LR by using the 1-fluoro-2, 4- dinitrofluorobenzene (DNFB-induced contact dermatitis mouse model. Results: Topical application of 10 mg/mL of LR effectively inhibited skin lesions induced by repeated paintings with DNFB. Topical application of LR also inhibited hyperplasia, edema, spongiosis and infiltrations of mononuclear cells. In addition, production levels of total immunoglobulin and IgG1 in serum were decreased by using LR in vivo. Conclusions: These data suggest that LR acts as an antiinflammatory agent, improving skin lesions in CD mice.

Mild salinity stimulates a stress-induced morphogenic response in Arabidopsis thaliana roots.

Science.gov (United States)

Zolla, Gaston; Heimer, Yair M; Barak, Simon

2010-01-01

Plant roots exhibit remarkable developmental plasticity in response to local soil conditions. It is shown here that mild salt stress stimulates a stress-induced morphogenic response (SIMR) in Arabidopsis thaliana roots characteristic of several other abiotic stresses: the proliferation of lateral roots (LRs) with a concomitant reduction in LR and primary root length. The LR proliferation component of the salt SIMR is dramatically enhanced by the transfer of seedlings from a low to a high NO3- medium, thereby compensating for the decreased LR length and maintaining overall LR surface area. Increased LR proliferation is specific to salt stress (osmotic stress alone has no stimulatory effect) and is due to the progression of more LR primordia from the pre-emergence to the emergence stage, in salt-stressed plants. In salt-stressed seedlings, greater numbers of LR primordia exhibit expression of a reporter gene driven by the auxin-sensitive DR5 promoter than in unstressed seedlings. Moreover, in the auxin transporter mutant aux1-7, the LR proliferation component of the salt SIMR is completely abrogated. The results suggest that salt stress promotes auxin accumulation in developing primordia thereby preventing their developmental arrest at the pre-emergence stage. Examination of ABA and ethylene mutants revealed that ABA synthesis and a factor involved in the ethylene signalling network also regulate the LR proliferation component of the salt SIMR.

Characterization of Intestinal Lactobacillus reuteri Strains as Potential Probiotics.

Science.gov (United States)

Singh, Tejinder Pal; Kaur, Gurpreet; Malik, Ravinder Kumar; Schillinger, Ulrich; Guigas, Claudia; Kapila, Suman

2012-03-01

This study was conducted to evaluate the probiotic properties of Lactobacillus reuteri isolated from human infant feces (less than 3 months). Out of thirty-two representative L. reuteri strains isolated from the infant human feces, nine isolates (i.e. LR5, LR6, LR9, LR11, LR19, LR20, LR25, LR26 and LR34) showed survival in acid, bile and simulated stomach-duodenum passage conditions, indicating their high tolerance to gastric juice, duodenal juice and bile environments. The nine isolates did not show strong hydrophobic properties because the percentages of adhesion to the apolar solvent, n-hexadecane, did not exceed 40%, showing that their surfaces were rather hydrophilic. Functionality of these nine probiotic isolates was supported by their antagonistic activity and their ability to deconjugate bile salts. The safety of the nine indigenous L. reuteri isolates was supported by the absence of transferable antibiotic resistance determinants, DNase activity, gelatinase activity and hemolysis. The results obtained so far suggest that the nine strains are resistant to low pH, bile salts and duodenum juice, so they could survive when passing through the upper part of the gastrointestinal tract and fulfill their potential probiotic action in the host organism. According to these results, the L. reuteri strains isolated from human infant feces possess interesting probiotic properties that make them potentially good candidates for probiotics.

Intramuscular Distribution of the Abducens Nerve in the Lateral Rectus Muscle for the Management of Strabismus.

Science.gov (United States)

Shin, Hyun Jin; Lee, Shin-Hyo; Shin, Kang-Jae; Koh, Ki-Seok; Song, Wu-Chul

2018-06-01

To elucidate the intramuscular distribution and branching patterns of the abducens nerve in the lateral rectus (LR) muscle so as to provide anatomical confirmation of the presence of compartmentalization, including for use in clinical applications such as botulinum toxin injections. Thirty whole-mount human cadaver specimens were dissected and then Sihler's stain was applied. The basic dimensions of the LR and its intramuscular nerve distribution were investigated. The distances from the muscle insertion to the point at which the abducens nerve enters the LR and to the terminal nerve plexus were also measured. The LR was 46.0 mm long. The abducens nerve enters the muscle on the posterior one-third of the LR and then typically divides into a few branches (average of 1.8). This supports a segregated abducens nerve selectively innervating compartments of the LR. The intramuscular nerve distribution showed a Y-shaped ramification with root-like arborization. The intramuscular nerve course finished around the middle of the LR (24.8 mm posterior to the insertion point) to form the terminal nerve plexus. This region should be considered the optimal target site for botulinum toxin injections. We have also identified the presence of an overlapping zone and communicating nerve branches between the neighboring LR compartments. Sihler's staining is a useful technique for visualizing the entire nerve network of the LR. Improving the knowledge of the nerve distribution patterns is important not only for researchers but also clinicians to understand the functions of the LR and the diverse pathophysiology of strabismus.

Maternal Style Selectively Shapes Amygdalar Development and Social Behavior in Rats Genetically Prone to High Anxiety.

Science.gov (United States)

Cohen, Joshua L; Glover, Matthew E; Pugh, Phyllis C; Fant, Andrew D; Simmons, Rebecca K; Akil, Huda; Kerman, Ilan A; Clinton, Sarah M

2015-01-01

The early-life environment critically influences neurodevelopment and later psychological health. To elucidate neural and environmental elements that shape emotional behavior, we developed a rat model of individual differences in temperament and environmental reactivity. We selectively bred rats for high versus low behavioral response to novelty and found that high-reactive (bred high-responder, bHR) rats displayed greater risk-taking, impulsivity and aggression relative to low-reactive (bred low-responder, bLR) rats, which showed high levels of anxiety/depression-like behavior and certain stress vulnerability. The bHR/bLR traits are heritable, but prior work revealed bHR/bLR maternal style differences, with bLR dams showing more maternal attention than bHRs. The present study implemented a cross-fostering paradigm to examine the contribution of maternal behavior to the brain development and emotional behavior of bLR offspring. bLR offspring were reared by biological bLR mothers or fostered to a bLR or bHR mother and then evaluated to determine the effects on the following: (1) developmental gene expression in the hippocampus and amygdala and (2) adult anxiety/depression-like behavior. Genome-wide expression profiling showed that cross-fostering bLR rats to bHR mothers shifted developmental gene expression in the amygdala (but not hippocampus), reduced adult anxiety and enhanced social interaction. Our findings illustrate how an early-life manipulation such as cross-fostering changes the brain's developmental trajectory and ultimately impacts adult behavior. Moreover, while earlier studies highlighted hippocampal differences contributing to the bHR/bLR phenotypes, our results point to a role of the amygdala as well. Future work will pursue genetic and cellular mechanisms within the amygdala that contribute to bHR/bLR behavior either at baseline or following environmental manipulations. © 2015 S. Karger AG, Basel.

Laparoscopic versus open resection for transverse colon cancer.

Science.gov (United States)

Mistrangelo, Massimiliano; Allaix, Marco Ettore; Cassoni, Paola; Giraudo, Giuseppe; Arolfo, Simone; Morino, Mario

2015-08-01

Previous large randomized controlled trials comparing laparoscopic (LR) and open resection (OR) for colon cancer have not specifically analyzed the outcomes in patients with transverse colon cancer. The aims of this study were to evaluate the feasibility and safety of LR transverse colon cancer resection and to compare our findings with the results available in the literature. We performed a retrospective analysis of consecutive patients undergoing LR or OR for histologically proven adenocarcinoma of the transverse colon. A total of 123 patients were included in this study: 66 LR and 57 OR. Median operating time was similar in the two groups. Median blood loss was higher in the OR group, even though the difference was not statistically significant. The rate of conversion from LR to OR was 16.7 %. Return of bowel function occurred significantly earlier in the LR group. The incidence and severity of 30-day postoperative complications and mortality rates were similar in the two groups. The median hospital stay was significantly shorter in the LR group. There was a trend toward a greater number of lymph nodes harvested in the OR group than in the LR group, although the difference was not statistically significant. The time to first flatus and bowel movement was significantly earlier in the LR group. Five-year overall survival and disease-free survival rates were similar in the LR and OR groups (86.4 vs. 88.6 %, p = 0.770 and 80.4 vs. 77.3 %, p = 0.516, respectively). LR of transverse colon cancer is feasible and safe, with similar early short-term outcomes when compared to OR. Larger prospective comparative studies with long-term follow-up are needed to assess the oncological equivalence of the two approaches.

Progression of Treated versus Untreated Liver Imaging Reporting and Data System Category 4 Masses after Transcatheter Arterial Embolization Therapy.

Science.gov (United States)

Ronald, James; Gupta, Rajan T; Marin, Daniele; Wang, Qi; Durocher, Nicholas S; Suhocki, Paul V; Kim, Charles Y

2018-05-01

To compare outcomes of treated vs untreated Liver Imaging Reporting and Data System category 4 (LR-4) masses after transcatheter arterial embolization. In 167 patients undergoing embolization for HCC from January 2005 to December 2012, LR-4 masses were retrospectively identified on CT and MR imaging examinations performed before embolization. In 149 patients undergoing embolization from January 2013 to December 2016, masses prospectively classified as LR-4 were identified. In total, there were 81 LR-4 masses in 62 patients (16 women; mean age 62 y; range 29-83 y). Procedures were reviewed to determine whether LR-4 masses were within or outside the liver volume that received embolization during treatment of dominant masses. Time to progression to LR-5 and by modified Response Evaluation Criteria in Solid Tumors (mRECIST) was estimated for treated vs untreated LR-4 masses using the Kaplan-Meier method and compared using the log rank test. LR-4 masses averaged 1.8 cm; 88%, 60%, 14%, and 14% demonstrated arterial phase hyperenhancement, washout, a capsule, and growth. Of LR-4 masses, 62 were within the liver volume that received embolization and considered treated, and 19 were outside and considered untreated. Response rates according to mRECIST were 37% vs 21% for treated vs untreated masses (P = .27). The 6- and 12-month rates of progression to LR-5 were 7% and 26% for treated masses vs 27% and 75% for untreated masses (P = .001). According to mRECIST, 7% and 27% of treated masses progressed vs 30% and 65% of untreated masses (P = .001). LR-4 masses that receive embolization in the setting of dominant masses elsewhere show lower rates of progression compared with untreated masses. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

Task Context Influences Brain Activation during Music Listening

Directory of Open Access Journals (Sweden)

Andjela Markovic

2017-06-01

Full Text Available In this paper, we examined brain activation in subjects during two music listening conditions: listening while simultaneously rating the musical piece being played [Listening and Rating (LR] and listening to the musical pieces unconstrained [Listening (L]. Using these two conditions, we tested whether the sequence in which the two conditions were fulfilled influenced the brain activation observable during the L condition (LR → L or L → LR. We recorded high-density EEG during the playing of four well-known positively experienced soundtracks in two subject groups. One group started with the L condition and continued with the LR condition (L → LR; the second group performed this experiment in reversed order (LR → L. We computed from the recorded EEG the power for different frequency bands (theta, lower alpha, upper alpha, lower beta, and upper beta. Statistical analysis revealed that the power in all examined frequency bands increased during the L condition but only when the subjects had not had previous experience with the LR condition (i.e., L → LR. For the subjects who began with the LR condition, there were no power increases during the L condition. Thus, the previous experience with the LR condition prevented subjects from developing the particular mental state associated with the typical power increase in all frequency bands. The subjects without previous experience of the LR condition listened to the musical pieces in an unconstrained and undisturbed manner and showed a general power increase in all frequency bands. We interpret the fact that unconstrained music listening was associated with increased power in all examined frequency bands as a neural indicator of a mental state that can best be described as a mind-wandering state during which the subjects are “drawn into” the music.

Autologous leukocyte-reduced platelet-rich plasma therapy for Achilles tendinopathy induced by collagenase in a rabbit model.

Science.gov (United States)

González, Juan C; López, Catalina; Álvarez, María E; Pérez, Jorge E; Carmona, Jorge U

2016-01-19

Leukocyte-reduced platelet-rich plasma (LR-PRP) is a therapy for tendinopathy of the Achilles tendon (TAT); however, there is scarce information regarding LR-PRP effects in rabbit models of TAT. We compared, at 4 and 12 weeks (w), the LR-PRP and placebo (PBS) effects on ultrasonography, histology and relative gene expression of collagen types I (COL1A1) and III (COL3A1) and vascular endothelial growth factor (VEGF) in 24 rabbits with TAT induced by collagenase. The rabbits (treated with both treatments) were euthanatised after either 4 or 12 w. A healthy group (HG (n = 6)) was included. At 4 and 12 w, the LR-PRP group had a no statistically different histology score to the HG. At w 4, the COL1A1 expression was significantly higher in the LR-PRP group when compared to HG, and the expression of COL3A1 from both LR-PRP and PBS-treated tendons was significantly higher when compared to the HG. At w 12, the expression of COL3A1 remained significantly higher in the PBS group in comparison to the LR-PRP group and the HG. At w 4, the LR-PRP group presented a significantly higher expression of VEGF when compared to the PBS group and the HG. In conclusion, LR-PRP treatment showed regenerative properties in rabbits with TAT.

Role of eicosanoids and white blood cells in the beneficial effects of limited reperfusion after ischemia-reperfusion injury in skeletal muscle

International Nuclear Information System (INIS)

Anderson, R.J.; Cambria, R.A.; Dikdan, G.; Lysz, T.W.; Hobson, R.W. II

1990-01-01

Limiting the rate of reperfusion blood flow has been shown to be beneficial locally in models of ischemia-reperfusion injury. We investigated the effects of this on eicosanoids (thromboxane B2, 6-keto-PGF1 alpha, and leukotriene B4), white blood cell activation, and skeletal muscle injury as quantitated by triphenyltetrazolium chloride and technetium-99m pyrophosphate after ischemia-reperfusion injury in an isolated gracilis muscle model in 16 anesthetized dogs. One gracilis muscle in each dog was subjected to 6 hours of ischemia followed by 1 hour of limited reperfusion and then by a second hour of normal reperfusion. The other muscle was subjected to 6 hours of ischemia followed by 2 hours of normal reperfusion. Six dogs each were used as normal reperfusion controls (NR) and limited reperfusion controls (LR), with 5 dogs being treated with a thromboxane synthetase inhibitor (LR/TSI) and another five with a leukotriene inhibitor (LR/LI). LR in all three groups (LR, LR/TSI, and LR/LI) showed a benefit in skeletal muscle injury as measured by triphenyltetrazolim chloride and technetium-99m pyrophosphate when compared with NR. However, there was no significant difference between the groups with LR regarding eicosanoid levels and white blood cell activation when compared with NR. These results demonstrate that LR produces benefits by mechanisms other than those dependent upon thromboxane A2, prostacyclin, or white blood cell activation

The Influence of Aerosol Hygroscopicity on Retrieving the Aerosol Extincting Coefficient from MPL Data

Science.gov (United States)

Zhao, G.; Zhao, C.

2016-12-01

Micro-pulse Lidar (MPL) measurements have been widely used to profile the ambient aerosol extincting coefficient(). Lidar Ratio (LR) ,which highly depends on the particle number size distribution (PNSD) and aerosol hygroscopicity, is the most important factor to retrieve the profile. A constant AOD constrained LR is usually used in current algorithms, which would lead to large bias when the relative humidity (RH) in the mixed layer is high. In this research, the influences of PNSD, aerosol hygroscopicity and RH profiles on the vertical variation of LR were investigated based on the datasets from field measurements in the North China Plain (NCP). Results show that LR can have an enhancement factor of more than 120% when the RH reaches to 92%. A new algorithm of retrieving the profile is proposed based on the variation of LR due to aerosol hygroscopicity. The magnitude and vertical structures of retrieved using this method can be significantly different to that of the fiexed LR method. The relative difference can reach up to 40% when the RH in the mixed layer is higher than 90% . Sensitivity studies show that RH profile and PNSD affect most on the retrieved by fiexed LR method. In view of this, a scheme of LR enhancement factor by RH is proposed in the NCP. The relative differnce of the calculated between using this scheme and the new algorithm with the variable LR can be less than 10%.

Locoregional failures following thoracic irradiation in patients with limited-stage small cell lung carcinoma

International Nuclear Information System (INIS)

Giuliani, Meredith E.; Lindsay, Patricia E.; Sun, Alexander; Bezjak, Andrea; Le, Lisa W.; Brade, Anthony; Cho, John; Leighl, Natasha B.; Shepherd, Frances A.; Hope, Andrew J.

2012-01-01

Purpose: To determine the patterns of loco-regional (LR) and distant failure in patients with limited-stage small cell lung carcinoma (LS-SCLC) treated with curative intent. Methods: From 1997 to 2008, 253 LS-SCLC patients were treated with curative intent chemo-radiation at our institution. A retrospective review identified sites of failure. The cumulative LR failure (LRF) rate was calculated. Distant failure-free survival (FFS) and overall survival (OS) were calculated using the Kaplan–Meier method. Volumetric images of LR failures were delineated and registered with the original radiation treatment plans if available. Dosimetric parameters for the delineated failure volumes were calculated from the original treatment information. Results: The median follow-up was 19 months. The site of first failure was LR in 34, distant in 80 and simultaneous LR and distant in 31 patients. The cumulative LRF rate was 29% and 38% at 2 and 5 years. OS was 44% at 2 years. Seventy patients had electronically archived treatment plans of which there were 16 LR failures (7 local and 39 regional failure volumes). Of the local and regional failure volumes 29% and 31% were in-field, respectively. Conclusions: The predominant pattern of LR failure was marginal or out-of-field. LR failures may be preventable with improved radiotherapy target definition.

Governance and management dynamics of landscape restoration at multiple scales: Learning from successful environmental managers in Sweden.

Science.gov (United States)

Dawson, Lucas; Elbakidze, Marine; Angelstam, Per; Gordon, Johanna

2017-07-15

Due to a long history of intensive land and water use, habitat networks for biodiversity conservation are generally degraded in Sweden. Landscape restoration (LR) is an important strategy for achieving representative and functional green infrastructures. However, outcomes of LR efforts are poorly studied, particularly the dynamics of LR governance and management. We apply systems thinking methods to a series of LR case studies to analyse the causal structures underlying LR governance and management in Sweden. We show that these structures appear to comprise of an interlinked system of at least three sets of drivers and four core processes. This system exhibits many characteristics of a transformative change towards an integrated, adaptive approach to governance and management. Key challenges for Swedish LR projects relate to institutional and regulatory flexibility, the timely availability of sufficient funds, and the management of learning and knowledge production processes. In response, successful project leaders develop several key strategies to manage complexity and risk, and enhance perceptions of the attractiveness of LR projects. Copyright © 2017 Elsevier Ltd. All rights reserved.

The inclusion of Duroc breed in maternal line affects pork quality and fatty acid profile.

Science.gov (United States)

Alonso, Verónica; Muela, Erica; Gutiérrez, Beatriz; Calanche, Juan Benito; Roncalés, Pedro; Beltrán, José A

2015-09-01

The aim of this study was to evaluate the effect of including different percentages of Duroc (D) breed in maternal line [Landrace (LR) × Large White (LW); LR × (LW × D); LR × D] and gender on meat quality and intramuscular (IMF) and subcutaneous (SCF) fatty acid composition. No significant differences were found among dam lines in ultimate pH, L* values and drip and cooking losses. There were higher percentages of saturated fatty acids in LR × D and LR × (LW × D) lines and higher percentages of polyunsaturated fatty acids in LR × LW line in IMF and SCF. Also, LR × D line produced pork with a lower Warner-Bratzler shear force values and higher IMF content and potential of lipid oxidation. Furthermore, the L*, a* and b* values and drip loss were greater in pork from entire males than females. The IMF and SCF of females were more monounsaturated and less polyunsaturated than those from entire males. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gold nanomaterials for the selective capturing and SERS diagnosis of toxins in aqueous and biological fluids

DEFF Research Database (Denmark)

Hassanain, Waleed A.; Izake, Emad L.; Schmidt, Michael Stenbæk

2017-01-01

the extractor nanoparticles within 5min by manipulating the pH environment of the nanoparticles. The regenerated extractor nanoparticles maintained their capture efficiency and, therefore, were re-used to capture of MC-LR from successive samples. The released purified toxin was screened within 10min on gold......A highly sensitive nanosensing method for the combined selective capture and SERS detection of Microcystin-LR (MC-LR) in blood plasma has been developed. The new method utilizes gold coated magnetic nanoparticles that are functionalized with anti MC-LR antibody Fab' fragments for the selective...... capture of MC-LR from aqueous media and blood plasma. Using an oriented immobilization approach, the Fab' fragments are covalently attached to gold surface to form a monolayer with high capture efficiency towards the toxin. After the selective capture, the purified MC-LR molecules were released from...

Linear and support vector regressions based on geometrical correlation of data

Directory of Open Access Journals (Sweden)

Kaijun Wang

2007-10-01

Full Text Available Linear regression (LR and support vector regression (SVR are widely used in data analysis. Geometrical correlation learning (GcLearn was proposed recently to improve the predictive ability of LR and SVR through mining and using correlations between data of a variable (inner correlation. This paper theoretically analyzes prediction performance of the GcLearn method and proves that GcLearn LR and SVR will have better prediction performance than traditional LR and SVR for prediction tasks when good inner correlations are obtained and predictions by traditional LR and SVR are far away from their neighbor training data under inner correlation. This gives the applicable condition of GcLearn method.

Effects of sintering process, pH and temperature on chemical durability of Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics

Energy Technology Data Exchange (ETDEWEB)

Ma, Jiyan; Teng, Yuancheng, E-mail: tyc239@163.com; Huang, Yi; Wu, Lang; Zhang, Kuibao; Zhao, Xiaofeng

2015-10-15

The Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics with high relative density of 99% and small average grain size of 0.15 μm were prepared by hot-pressing at 1150 °C for 2 h. The effects of sintering process, pH values and temperature on the chemical durability of the ceramics were investigated. The results show that normalized elemental leaching rates of Pr (LR{sub Pr}) and Ce (LR{sub Ce}) of the hot-pressed ceramics are slightly lower than that of the ceramics sintered at 1500 °C for 4 h by normal pressure. The LR{sub Pr} and LR{sub Ce} reach the highest values (∼10{sup −3} g m{sup −2} d{sup −1}) when pH = 3, while the LR{sub Pr} and LR{sub Ce} have the lowest values (∼10{sup −7} g m{sup −2} d{sup −1}) when pH = 7. The surface of the ceramic in pH = 3 leachate appears serious corrosion with plenty of pores. The precipitation of low-soluble was formed on sample surface during leaching tests at pH = 9 and 11. - Highlights: • The Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics with high relative density of 99% and small average grain size of 0.15 µm were prepared by hot-pressing at 1150 ºC for 2 h. • The normalized elemental leaching rates of Pr (LR{sub Pr}) and Ce (LR{sub Ce}) of the hot-pressed ceramics are slightly lower than that of the ceramics sintered at 1500 ºC for 4 h by normal pressure. • The LR{sub Pr} and LR{sub Ce} reach the highest values (∼10{sup −3} g m{sup −2} d{sup −1}) when pH = 3, while the LR{sub Pr} and LR{sub Ce} have the lowest values (∼10{sup −7} g m{sup −2} d{sup −1}) when pH = 7.

76 FR 74834 - Interim Staff Guidance on Aging Management Program for Steam Generators

Science.gov (United States)

2011-12-01

... for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION: Interim staff guidance; issuance... (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam Generators.'' This LR-ISG provides the...) document, NEI 97-06, ``Steam Generator Program Guidelines,'' (NRC's Agencywide Documents Access and...

Rearfoot and midfoot or forefoot impacts in habitually shod runners.

Science.gov (United States)

Boyer, Elizabeth R; Rooney, Brandon D; Derrick, Timothy R

2014-07-01

Shear loading rates (LR) have not been investigated in runners with a mid- or forefoot strike (FFS) versus rearfoot strike (RFS). The purpose of this study was to compare three-dimensional ground reaction forces (GRF) and LR during impact in habitual rearfoot strikers (hRF) and habitual forefoot strikers (hFF) strikers. Thirty competitive runners performed 10 overground running trials with both foot strike styles. Peak three-dimensional and resultant GRF and instantaneous LR during impact were compared. Vertical LR significantly decreased for hRF using an FFS (RFS = 148 ± 36 body weight [BW]·s(-1), FFS = 98 ± 31 BW·s(-1)) but was similar for hFF running with either foot strike (FFS = 136 ± 35 BW·s(-1), RFS = 135 ± 28 BW·s(-1)). Posterior impact forces were present during FFS but not during RFS, and posterior LR was significantly greater for both groups during FFS (-58 ± 17 vs -19 ± 6 BW·s(-1)). Medial impact forces were also present during FFS but not during RFS, and medial LR was significantly larger for both groups during FFS (-21 ± 7 vs -6 ± 6 BW·s(-1)). Interestingly, hFF had greater impact peaks and LR in all directions compared with hRF during FFS. This may be explained by hFF using a smaller strike index (hFF = 62% ± 9%, hRF = 67% ± 9%; P = 0.02), which was significantly inversely related to vertical LR and impact peak. Peak resultant and vertical LR are not ubiquitously lower when using a shod FFS versus RFS despite an absence of resultant and vertical impact peaks. Furthermore, there were impact peaks in the posterior and medial directions, leading also to greater LR in these directions during FFS. Therefore, transitioning from RFS to FFS in traditional running shoes may not offer long-term protection against impact-related running injuries because hFF running with an FFS demonstrated many GRF and LR similar to or greater than RFS.

Treatment and Prognosis of Isolated Local Relapse after Stereotactic Body Radiotherapy for Clinical Stage I Non-Small-Cell Lung Cancer: Importance of Salvage Surgery.

Science.gov (United States)

Hamaji, Masatsugu; Chen, Fengshi; Matsuo, Yukinori; Ueki, Nami; Hiraoka, Masahiro; Date, Hiroshi

2015-11-01

Many efforts have been made to detect local relapse (LR) in the follow-up after stereotactic body radiotherapy (SBRT) for non-small-cell lung cancer (NSCLC) although limited data are available on its treatment and prognosis. We aimed to characterize treatment options and clarify long-term outcomes of isolated LR after SBRT for patients with clinical stage I NSCLC. We reviewed our institutional database in search of patients with isolated LR after SBRT for clinical stage I NSCLC at our institution between 1999 and 2013. Patient characteristics were compared with Mann-Whitney U test, χ2 test, or Fisher's exact test as appropriate. Survival outcomes were estimated with Kaplan-Meier method. Potential prognostic factors were investigated using Cox proportional hazard model. Of 308 patients undergoing SBRT for clinical stage I NSCLC, 49 patients were identified to have isolated LR. Twelve patients underwent salvage surgery, none underwent radiotherapy, and eight patients received chemotherapy, whereas 29 patients received best supportive care. No patient characteristic except operability was significantly related with patient selection for LR treatments. Five-year overall survival (OS) rate of the whole cohort was 47.9% from SBRT and 25.7% from LR. Salvage surgery was associated with improved OS after LR (p = 0.014), and 5-year OS for patients undergoing salvage surgery was 79.5% from LR. It was confirmed that our patient selection for salvage surgery for isolated LR was associated with favorable survival outcomes. Operability based on multidisciplinary conferences, rather than measurable patient characteristics, is essential for appropriate patient selection for salvage surgery.

Automatic Lung-RADS™ classification with a natural language processing system.

Science.gov (United States)

Beyer, Sebastian E; McKee, Brady J; Regis, Shawn M; McKee, Andrea B; Flacke, Sebastian; El Saadawi, Gilan; Wald, Christoph

2017-09-01

Our aim was to train a natural language processing (NLP) algorithm to capture imaging characteristics of lung nodules reported in a structured CT report and suggest the applicable Lung-RADS™ (LR) category. Our study included structured, clinical reports of consecutive CT lung screening (CTLS) exams performed from 08/2014 to 08/2015 at an ACR accredited Lung Cancer Screening Center. All patients screened were at high-risk for lung cancer according to the NCCN Guidelines ® . All exams were interpreted by one of three radiologists credentialed to read CTLS exams using LR using a standard reporting template. Training and test sets consisted of consecutive exams. Lung screening exams were divided into two groups: three training sets (500, 120, and 383 reports each) and one final evaluation set (498 reports). NLP algorithm results were compared with the gold standard of LR category assigned by the radiologist. The sensitivity/specificity of the NLP algorithm to correctly assign LR categories for suspicious nodules (LR 4) and positive nodules (LR 3/4) were 74.1%/98.6% and 75.0%/98.8% respectively. The majority of mismatches occurred in cases where pulmonary findings were present not currently addressed by LR. Misclassifications also resulted from the failure to identify exams as follow-up and the failure to completely characterize part-solid nodules. In a sub-group analysis among structured reports with standardized language, the sensitivity and specificity to detect LR 4 nodules were 87.0% and 99.5%, respectively. An NLP system can accurately suggest the appropriate LR category from CTLS exam findings when standardized reporting is used.

Effect of cyanotoxins on the hypothalamic-pituitary-gonadal axis in male adult mouse.

Science.gov (United States)

Xiong, Xiaolu; Zhong, Anyuan; Xu, Huajun

2014-01-01

Microcystins LR (MC-LR) are hepatotoxic cyanotoxins that have been shown to induce reproductive toxicity, and Hypothalamic-Pituitary-Gonadal Axis (HPG) is responsible for the control of reproductive functions. However, few studies have been performed to evaluate the effects of MC-LR on HPG axis. This study aimed to investigate the MC-LR-induced toxicity in the reproductive system of mouse and focus on the HPG axis. Adult male C57BL/6 mice were exposed to various concentrations of MC-LR (0, 3.75, 7.50, 15.00 and 30.00 µg/kg body weight per day) for 1 to 14 days, and it was found that exposure to different concentrations of MC-LR significantly disturbed sperm production in the mice testes in a dose- and time-dependent manner. To elucidate the associated possible mechanisms, the serum levels of testosterone, follicle-stimulating hormone (FSH) and luteinizing hormone (LH) were assessed. Meanwhile, PCR assays were employed to detect alterations in a series of genes involved in HPG axis, such as FSH, LH, gonadotropin-releasing hormone (GnRH) and their complement receptors. Furthermore, the effect of MC-LR on the viability and testosterone production of Leydig cells were tested in vitro. MC-LR significantly impaired the spermatogenesis of mice possibly through the direct or indirect inhibition of GnRH synthesis at the hypothalamic level, which resulted in reduction of serum levels of LH that lead to suppression of testosterone production in the testis of mice. MC-LR may be a GnRH toxin that would disrupt the reproductive system of mice.

Effect of cyanotoxins on the hypothalamic-pituitary-gonadal axis in male adult mouse.

Directory of Open Access Journals (Sweden)

Xiaolu Xiong

Full Text Available Microcystins LR (MC-LR are hepatotoxic cyanotoxins that have been shown to induce reproductive toxicity, and Hypothalamic-Pituitary-Gonadal Axis (HPG is responsible for the control of reproductive functions. However, few studies have been performed to evaluate the effects of MC-LR on HPG axis. This study aimed to investigate the MC-LR-induced toxicity in the reproductive system of mouse and focus on the HPG axis.Adult male C57BL/6 mice were exposed to various concentrations of MC-LR (0, 3.75, 7.50, 15.00 and 30.00 µg/kg body weight per day for 1 to 14 days, and it was found that exposure to different concentrations of MC-LR significantly disturbed sperm production in the mice testes in a dose- and time-dependent manner. To elucidate the associated possible mechanisms, the serum levels of testosterone, follicle-stimulating hormone (FSH and luteinizing hormone (LH were assessed. Meanwhile, PCR assays were employed to detect alterations in a series of genes involved in HPG axis, such as FSH, LH, gonadotropin-releasing hormone (GnRH and their complement receptors. Furthermore, the effect of MC-LR on the viability and testosterone production of Leydig cells were tested in vitro.MC-LR significantly impaired the spermatogenesis of mice possibly through the direct or indirect inhibition of GnRH synthesis at the hypothalamic level, which resulted in reduction of serum levels of LH that lead to suppression of testosterone production in the testis of mice.MC-LR may be a GnRH toxin that would disrupt the reproductive system of mice.

Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

Science.gov (United States)

Hrouzek, Pavel; Štys, Dalibor; Martens, Harald

2013-01-01

Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036

Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

Directory of Open Access Journals (Sweden)

Jan Urban

2013-01-01

Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

Estimation of ion competition via correlated responsivity offset in linear ion trap mass spectrometry analysis: theory and practical use in the analysis of cyanobacterial hepatotoxin microcystin-LR in extracts of food additives.

Science.gov (United States)

Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald

2013-01-01

Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

Джерела стійкості проти збудника бурої іржі та їх використання у процесі створення сортів пшениці м’якої

Directory of Open Access Journals (Sweden)

Г. М. Ковалишина

2017-12-01

Full Text Available Мета. Серед описаних у фаховій літературі ідентифікованих генів стійкості проти збудника бурої іржі виділити чужо­рідні, інтрогресовані у вид Triticum aestivum L. джерела, встановити їх походження та перспективи використання в селекційній практиці. Результати. Пшениця озима м’яка як основна зернова культура належить до групи рослин, яких найдавніше вирощують у контрольованих умовах. Протягом періоду вегетації вона зазнає згубного впливу збудників хвороб, тому пошук джерел стійкості проти них є першочерговим завданням селекції. Бура іржа – одна з найпоширеніших і шкодочинних хвороб пшениці. Вона призводить до значних втрат урожаю та погіршення якості зерна. Популяція збудника Puccinia reconditа вирізняється неабиякою адаптивною здатністю. Висока варіабельність вірулентності гриба призводить до накопичення патотипів, здатних долати гени стійкості пшениці. Найбільш екологічно безпечним методом контролювання захворювання є створення стійких сортів. Ефективність селекції на стійкість проти бурої іржі можна покращити, використовуючи різні Lr-гени стійкості. На цей час у �

Determination of a Differential Item Functioning Procedure Using the Hierarchical Generalized Linear Model

Directory of Open Access Journals (Sweden)

Tülin Acar

2012-01-01

Full Text Available The aim of this research is to compare the result of the differential item functioning (DIF determining with hierarchical generalized linear model (HGLM technique and the results of the DIF determining with logistic regression (LR and item response theory–likelihood ratio (IRT-LR techniques on the test items. For this reason, first in this research, it is determined whether the students encounter DIF with HGLM, LR, and IRT-LR techniques according to socioeconomic status (SES, in the Turkish, Social Sciences, and Science subtest items of the Secondary School Institutions Examination. When inspecting the correlations among the techniques in terms of determining the items having DIF, it was discovered that there was significant correlation between the results of IRT-LR and LR techniques in all subtests; merely in Science subtest, the results of the correlation between HGLM and IRT-LR techniques were found significant. DIF applications can be made on test items with other DIF analysis techniques that were not taken to the scope of this research. The analysis results, which were determined by using the DIF techniques in different sample sizes, can be compared.

Shaping the zebrafish heart: from left-right axis specification to epithelial tissue morphogenesis.

NARCIS (Netherlands)

Bakkers, J.; Verhoeven, M.C.; Abdelilah-Seyfried, S.

2009-01-01

Although vertebrates appear bilaterally symmetric on the outside, various internal organs, including the heart, are asymmetric with respect to their position and/or their orientation based on the left/right (L/R) axis. The L/R axis is determined during embryo development. Determination of the L/R

Dicty_cDB: Contig-U12974-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 7.1 1 ( DR697196 ) Lr_AT1CF_38E04_SKplus Earthworm Atrazine Exposure... 44 7.1 1 ( DR009256 ) Lr_Cu2CF_32B07 Earth...worm Copper Exposure Library ... 44 7.1 1 ( DR008956 ) Lr_Cu2CF_11A10 Earth

77 FR 3191 - Rules of Practice

Science.gov (United States)

2012-01-23

... would encompass all types of documentary material sought by the Commission, the revisions would better... staff's authority to inspect, copy, or sample documentary material--including electronic media--to... Case Management and Discovery); N.D. Ohio LR 30.1(b); D. Or. LR 30-5; D. Wyo. LR 30 (Depositions Upon...

High novelty-seeking rats are resilient to negative physiological effects of the early life stress.

Science.gov (United States)

Clinton, Sarah M; Watson, Stanley J; Akil, Huda

2014-01-01

Exposure to early life stress dramatically impacts adult behavior, physiology, and neuroendocrine function. Using rats bred for novelty-seeking differences and known to display divergent anxiety, depression, and stress vulnerability, we examined the interaction between early life adversity and genetic predisposition for high- versus low-emotional reactivity. Thus, bred Low Novelty Responder (bLR) rats, which naturally exhibit high anxiety- and depression-like behavior, and bred High Novelty Responder (bHR) rats, which show low anxiety/depression together with elevated aggression, impulsivity, and addictive behavior, were subjected to daily 3 h maternal separation (MS) stress postnatal days 1-14. We hypothesized that MS stress would differentially impact adult bHR/bLR behavior, physiology (stress-induced defecation), and neuroendocrine reactivity. While MS stress did not impact bHR and bLR anxiety-like behavior in the open field test and elevated plus maze, it exacerbated bLRs' already high physiological response to stress - stress-induced defecation. In both tests, MS bLR adult offspring showed exaggerated stress-induced defecation compared to bLR controls while bHR offspring were unaffected. MS also selectively impacted bLRs' (but not bHRs') neuroendocrine stress reactivity, producing an exaggerated corticosterone acute stress response in MS bLR versus control bLR rats. These findings highlight how genetic predisposition shapes individuals' response to early life stress. Future work will explore neural mechanisms underlying the distinct behavioral and neuroendocrine consequences of MS in bHR/bLR animals.

A Switch in the Dynamics of Intra-Platelet VEGF-A from Cancer to the Later Phase of Liver Regeneration after Partial Hepatectomy in Humans.

Directory of Open Access Journals (Sweden)

Bibek Aryal

Full Text Available Liver regeneration (LR involves an early inductive phase characterized by the proliferation of hepatocytes, and a delayed angiogenic phase distinguished by the expansion of non-parenchymal compartment. The interest in understanding the mechanism of LR has lately shifted from the proliferation and growth of parenchymal cells to vascular remodeling during LR. Angiogenesis accompanied by LR exerts a pivotal role to accomplish the process. Vascular endothelial growth factor (VEGF has been elucidated as the most dynamic regulator of angiogenesis. From this perspective, platelet derived/Intra-platelet (IP VEGF-A should be associated with LR.Thirty-seven patients diagnosed with hepatocellular carcinoma and undergoing partial hepatectomy (PH were enrolled in the study. Serum and IP VEGF-A was monitored preoperatively and at four weeks of PH. Liver volumetry was determined on computer models derived from computed tomography (CT scan.Serum and IP VEGF-A was significantly elevated at four weeks of PH. Preoperative IP VEGF-A was higher in patients with advanced cancer and vascular invasion. Postoperative IP VEGF-A was higher after major liver resection. There was a statistically significant correlation between postoperative IP VEGF-A and the future remnant liver volume. Moreover, the soluble vascular endothelial growth factor receptor-1 (sVEGFR1 was distinctly down-regulated suggesting a fine-tuned angiogenesis at the later phase of LR.IP VEGF-A is overexpressed during later phase of LR suggesting its implications in inducing angiogenesis during LR.

Risk factors for locoregional recurrence in patients with resected N1 non-small cell lung cancer: a retrospective study to identify patterns of failure and implications for adjuvant radiotherapy

International Nuclear Information System (INIS)

Fan, Chengcheng; Gao, Shugeng; Hui, Zhouguang; Liang, Jun; Lv, Jima; Wang, Xiaozhen; He, Jie; Wang, Luhua

2013-01-01

Meta-analysis of randomized trials has shown that postoperative radiotherapy (PORT) had a detrimental effect on overall survival (OS) in patients with resected N1 non–small cell lung cancer (NSCLC). Conversely, the locoregional recurrence (LR) rate is reported to be high without adjuvant PORT in these patients. We have evaluated the pattern of failure, actuarial risk and risk factors for LR in order to identify the subset of N1 NSCLC patients with the highest risk of LR. These patients could potentially benefit from PORT. We conducted a retrospective study on 199 patients with pathologically confirmed T1–3N1M0 NSCLC who underwent surgery. None of the patients had positive surgical margins or received preoperative therapy or PORT. The median follow-up was 53.8 months. Complete mediastinal lymph node (MLN) dissection and examination was defined as ≥3 dissected and examined MLN stations; incomplete MLN dissection or examination (IMD) was defined as <3 dissected or examined MLN stations. The primary end point of this study was freedom from LR (FFLR). Differences between patient groups were compared and risk factors for LR were identified by univariate and multivariate analyses. LR was identified in 41 (20.6%) patients, distant metastasis (DM) was identified in 79 (39.7%) patients and concurrent LR and DM was identified in 25 (12.6%) patients. The 3- and 5-year OS rates in patients with resected N1 NSCLC were 78.4% and 65.6%, respectively. The corresponding FFLR rates were 80.8% and 77.3%, respectively. Univariate analyses identified that nonsmokers, ≤23 dissected lymph nodes, visceral pleural invasion and lymph node ratio >10% were significantly associated with lower FFLR rates (P < 0.05). Multivariate analyses further confirmed positive lymph nodes at station 10 and IMD as risk factors for LR (P < 0.05). The 5-year LR rate was highest in patients with both these risk factors (48%). The incidence of LR in patients with surgically resected T1–3N1M0 NSCLC is

Supplementary Material for: Linking local retention, self-recruitment, and persistence in marine metapopulations

KAUST Repository

Lett, Christophe

2016-01-01

Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.

The utility of serum tryptase in the diagnosis of food-induced anaphylaxis.

Science.gov (United States)

Wongkaewpothong, Patcharaporn; Pacharn, Punchama; Sripramong, Chaweewan; Boonchoo, Siribangon; Piboonpocanun, Surapon; Visitsunthorn, Nualanong; Vichyanond, Pakit; Jirapongsananuruk, Orathai

2014-07-01

This study investigates the utility of serum tryptase for the confirmation of shrimp-induced anaphylaxis. Patients with a history of shrimp allergy and positive skin prick tests (SPT) to commercial shrimp extract were recruited for shrimp challenges. Serum total tryptase was obtained at baseline and 60 min (peak) after the onset of symptoms. Thirty-nine patients were challenged. There were 12 patients with anaphylaxis, 20 with mild reactions and 7 without symptoms (control group). Characteristic features and baseline tryptase were not different among the 3 groups. The peak tryptase levels were higher than the baseline in anaphylaxis and mild reaction groups (P11.4 µg/L with 17% sensitivity, 100% specificity, infinity positive LR and 0.83 negative LR. The best cut-off for delta-tryptase was ≥0.8 µg/L with 83% sensitivity, 93% specificity, 11.86 positive LR and 0.18 negative LR. The best cut-off for tryptase ratio was ≥1.5 with 92% sensitivity, 96% specificity, 23 positive LR and 0.08 negative LR. The peak tryptase level should be compared with the baseline value to confirm anaphylaxis. The tryptase ratio provide the best sensitivity, specificity, positive and negative LR than a single peak serum tryptase for the confirmation of shrimp-induced anaphylaxis.

Linking local retention, self-recruitment, and persistence in marine metapopulations

KAUST Repository

Lett, Christophe

2015-08-01

Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR, defined as the ratio of locally produced settlement to local egg production, has a clear relationship to self-persistence of individual sites. However, SR, the ratio of locally produced settlement to settlement of all origins at a site, is generally easier to measure experimentally. We use theoretical, simulation, and empirical approaches to bridge the gap between these different indices, and demonstrate that there is a proportional relationship between SR and LR for metapopulations close to a stable state and with lifetime egg production (LEP) approximately uniform over space. Similarly, for systems where larval mortality rates are a relatively uniform function of release site, RLR (defined as the ratio of locally produced settlement to all settlement of local origin) and LR will also be proportional. Therefore, SR and RLR provide information on relative rates of LR for systems satisfying these conditions. Furthermore, the ratio between LR and SR can be used to evaluate global persistence of metapopulations, and therefore provides valuable information not necessarily available if only LR is considered.

Therapy monitoring using dynamic MRI: Analysis of lung motion and intrathoracic tumor mobility before and after radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Plathow, Christian [Eberhard-Karls University Tuebingen, Department of Diagnostic Radiology, Tuebingen (Germany); German Cancer Research Center, Department of Radiology, Heidelberg (Germany); Hof, Holger; Kuhn, Sabine [University of Heidelberg, Department of Radiation Therapy, Clinic for Thoracic Diseases, Heidelberg (Germany); Puderbach, Michael; Ley, Sebastian; Biederer, Juergen; Kauczor, Hans-Ulrich [German Cancer Research Center, Department of Radiology, Heidelberg (Germany); Claussen, Claus D.; Schaefer, Juergen [Eberhard-Karls University Tuebingen, Department of Diagnostic Radiology, Tuebingen (Germany); Huber, Peter E. [University of Heidelberg, Department of Radiation Therapy, Clinic for Thoracic Diseases, Heidelberg (Germany); German Cancer Research Center, Department of Radiation Oncology, Heidelberg (Germany); Tuengerthal, Siegfried [University of Heidelberg, Department of Radiology, Heidelberg (Germany)

2006-09-15

A frequent side effect after radiotherapy of lung tumors is a decrease of pulmonary function accompanied by dyspnea due to developing lung fibrosis. The aim of this study was to monitor lung motion as a correlate of pulmonary function and intrathoracic tumor mobility before and after radiotherapy (RT) using dynamic MRI (dMRI). Thirty-five patients with stage I non-small-cell lung carcinoma were examined using dMRI (trueFISP; three images/s). Tumors were divided into T1 and T2 tumors of the upper, middle and lower lung region (LR). Maximum craniocaudal (CC) lung dimensions and tumor mobility in three dimensions were monitored. Vital capacity (VC) was measured and correlated using spirometry. Before RT, the maximum CC motion of the tumor-bearing hemithorax was 5.2{+-}0.9 cm if the tumor was located in the lower LR (middle LR: 5.5{+-}0.8 cm; upper LR: 6.0{+-}0.6 cm). After RT, lung motion was significantly reduced in the lower LR (P<0.05). Before RT, the maximum CC tumor mobility was significantly higher in tumors of the lower LR 2.5{+-}0.6 vs. 2.0{+-}0.3 cm (middle LR; P<0.05) vs. 0.7{+-}0.2 cm (upper LR; P<0.01). After RT, tumor mobility was significantly reduced in the lower LR (P<0.01) and in T2 tumor patients (P<0.05). VC showed no significant changes. dMRI is capable of monitoring changes in lung motion that were not suspected from spirometry. This might make the treatment of side effects possible at a very early stage. Changes of lung motion and tumor mobility are highly dependent on the tumor localization and tumor diameter. (orig.)

Therapy monitoring using dynamic MRI: Analysis of lung motion and intrathoracic tumor mobility before and after radiotherapy

International Nuclear Information System (INIS)

Plathow, Christian; Hof, Holger; Kuhn, Sabine; Puderbach, Michael; Ley, Sebastian; Biederer, Juergen; Kauczor, Hans-Ulrich; Claussen, Claus D.; Schaefer, Juergen; Huber, Peter E.; Tuengerthal, Siegfried

2006-01-01

A frequent side effect after radiotherapy of lung tumors is a decrease of pulmonary function accompanied by dyspnea due to developing lung fibrosis. The aim of this study was to monitor lung motion as a correlate of pulmonary function and intrathoracic tumor mobility before and after radiotherapy (RT) using dynamic MRI (dMRI). Thirty-five patients with stage I non-small-cell lung carcinoma were examined using dMRI (trueFISP; three images/s). Tumors were divided into T1 and T2 tumors of the upper, middle and lower lung region (LR). Maximum craniocaudal (CC) lung dimensions and tumor mobility in three dimensions were monitored. Vital capacity (VC) was measured and correlated using spirometry. Before RT, the maximum CC motion of the tumor-bearing hemithorax was 5.2±0.9 cm if the tumor was located in the lower LR (middle LR: 5.5±0.8 cm; upper LR: 6.0±0.6 cm). After RT, lung motion was significantly reduced in the lower LR (P<0.05). Before RT, the maximum CC tumor mobility was significantly higher in tumors of the lower LR 2.5±0.6 vs. 2.0±0.3 cm (middle LR; P<0.05) vs. 0.7±0.2 cm (upper LR; P<0.01). After RT, tumor mobility was significantly reduced in the lower LR (P<0.01) and in T2 tumor patients (P<0.05). VC showed no significant changes. dMRI is capable of monitoring changes in lung motion that were not suspected from spirometry. This might make the treatment of side effects possible at a very early stage. Changes of lung motion and tumor mobility are highly dependent on the tumor localization and tumor diameter. (orig.)

Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

Science.gov (United States)

Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

2016-11-01

Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

Greater power and computational efficiency for kernel-based association testing of sets of genetic variants.

Science.gov (United States)

Lippert, Christoph; Xiang, Jing; Horta, Danilo; Widmer, Christian; Kadie, Carl; Heckerman, David; Listgarten, Jennifer

2014-11-15

Set-based variance component tests have been identified as a way to increase power in association studies by aggregating weak individual effects. However, the choice of test statistic has been largely ignored even though it may play an important role in obtaining optimal power. We compared a standard statistical test-a score test-with a recently developed likelihood ratio (LR) test. Further, when correction for hidden structure is needed, or gene-gene interactions are sought, state-of-the art algorithms for both the score and LR tests can be computationally impractical. Thus we develop new computationally efficient methods. After reviewing theoretical differences in performance between the score and LR tests, we find empirically on real data that the LR test generally has more power. In particular, on 15 of 17 real datasets, the LR test yielded at least as many associations as the score test-up to 23 more associations-whereas the score test yielded at most one more association than the LR test in the two remaining datasets. On synthetic data, we find that the LR test yielded up to 12% more associations, consistent with our results on real data, but also observe a regime of extremely small signal where the score test yielded up to 25% more associations than the LR test, consistent with theory. Finally, our computational speedups now enable (i) efficient LR testing when the background kernel is full rank, and (ii) efficient score testing when the background kernel changes with each test, as for gene-gene interaction tests. The latter yielded a factor of 2000 speedup on a cohort of size 13 500. Software available at http://research.microsoft.com/en-us/um/redmond/projects/MSCompBio/Fastlmm/. heckerma@microsoft.com Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

Usefulness of the second heart sound for predicting pulmonary hypertension in patients with interstitial lung disease

Directory of Open Access Journals (Sweden)

Sandra de Barros Cobra

Full Text Available CONTEXT AND OBJECTIVE: P2 hyperphonesis is considered to be a valuable finding in semiological diagnoses of pulmonary hypertension (PH. The aim here was to evaluate the accuracy of the pulmonary component of second heart sounds for predicting PH in patients with interstitial lung disease. DESIGN AND SETTING: Cross-sectional study at the University of Brasilia and Hospital de Base do Distrito Federal. METHODS: Heart sounds were acquired using an electronic stethoscope and were analyzed using phonocardiography. Clinical signs suggestive of PH, such as second heart sound (S2 in pulmonary area louder than in aortic area; P2 > A2 in pulmonary area and P2 present in mitral area, were compared with Doppler echocardiographic parameters suggestive of PH. Sensitivity (S, specificity (Sp and positive (LR+ and negative (LR- likelihood ratios were evaluated. RESULTS: There was no significant correlation between S2 or P2 amplitude and PASP (pulmonary artery systolic pressure (P = 0.185 and 0.115; P= 0.13 and 0.34, respectively. Higher S2 in pulmonary area than in aortic area, compared with all the criteria suggestive of PH, showed S = 60%, Sp= 22%; LR+ = 0.7; LR- = 1.7; while P2> A2 showed S= 57%, Sp = 39%; LR+ = 0.9; LR- = 1.1; and P2 in mitral area showed: S= 68%, Sp = 41%; LR+ = 1.1; LR- = 0.7. All these signals together showed: S= 50%, Sp = 56%. CONCLUSIONS: The semiological signs indicative of PH presented low sensitivity and specificity levels for clinically diagnosing this comorbidity.

Nitric oxide mediates strigolactone signaling in auxin and ethylene-sensitive lateral root formation in sunflower seedlings.

Science.gov (United States)

Bharti, Niharika; Bhatla, Satish C

2015-01-01

Strigolactones (SLs) play significant role in shaping root architecture whereby auxin-SL crosstalk has been observed in SL-mediated responses of primary root elongation, lateral root formation and adventitious root (AR) initiation. Whereas GR24 (a synthetic strigolactone) inhibits LR and AR formation, the effect of SL biosynthesis inhibitor (fluridone) is just the opposite (root proliferation). Naphthylphthalamic acid (NPA) leads to LR proliferation but completely inhibits AR development. The diffusive distribution of PIN1 in the provascular cells in the differentiating zone of the roots in response to GR24, fluridone or NPA treatments further indicates the involvement of localized auxin accumulation in LR development responses. Inhibition of LR formation by GR24 treatment coincides with inhibition of ACC synthase activity. Profuse LR development by fluridone and NPA treatments correlates with enhanced [Ca(2+)]cyt in the apical region and differentiating zones of LR, indicating a critical role of [Ca(2+)] in LR development in response to the coordinated action of auxins, ethylene and SLs. Significant enhancement of carotenoid cleavage dioxygenase (CCD) activity (enzyme responsible for SL biosynthesis) in tissue homogenates in presence of cPTIO (NO scavenger) indicates the role of endogenous NO as a negative modulator of CCD activity. Differences in the spatial distribution of NO in the primary and lateral roots further highlight the involvement of NO in SL-modulated root morphogenesis in sunflower seedlings. Present work provides new report on the negative modulation of SL biosynthesis through modulation of CCD activity by endogenous nitric oxide during SL-modulated LR development.

Genome analysis of two type 6 echovirus (E6) strains recovered from sewage specimens in Greece in 2006.

Science.gov (United States)

Kyriakopoulou, Zaharoula; Pliaka, Vaia; Tsakogiannis, Dimitris; Ruether, Irina G A; Komiotis, Dimitris; Gartzonika, Constantina; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

2012-04-01

Echovirus 6 (E6) is one of the main enteroviral serotypes that was isolated from cases of aseptic meningitis and encephalitis during the last years in Greece. Two E6 (LR51A5 and LR61G3) were isolated from the sewage treatment plant unit in Larissa, Greece, in May 2006, 1 year before their characterization from aseptic meningitis cases. The two isolates were initially found to be intra-serotypic recombinants in the genomic region VP1, a finding that initiated a full genome sequence analysis. In the present study, nucleotide, amino acid, and phylogenetic analyses for all genomic regions were conducted. For the detection of recombination events, Simplot and bootscan analyses were carried out. The continuous phylogenetic relationship in 2C-3D genomic region of strains LR51A5 and LR61G3 with E30 isolated in France in 2002-2005 indicated that the two strains were recombinants. SimPlot and Bootscan analyses confirmed that LR51A5 and LR61G3 carry an inter-serotypic recombination in the 2C genomic region. The present study provide evidence that recombination events occurred in the regions VP1 (intraserotypic) and non-capsid (interserotypic) during the evolution of LR51A5 and LR61G3, supporting the statement that the genomes of circulating enteroviruses are a mosaic of genomic regions of viral strains of the same or different serotypes. In conclusion, full genome sequence analysis of circulating enteroviral strains is a prerequisite to understand the complexity of enterovirus evolution.

Refined estimates of local recurrence risks by DCIS score adjusting for clinicopathological features: a combined analysis of ECOG-ACRIN E5194 and Ontario DCIS cohort studies.

Science.gov (United States)

Rakovitch, E; Gray, R; Baehner, F L; Sutradhar, R; Crager, M; Gu, S; Nofech-Mozes, S; Badve, S S; Hanna, W; Hughes, L L; Wood, W C; Davidson, N E; Paszat, L; Shak, S; Sparano, J A; Solin, L J

2018-06-01

Better tools are needed to estimate local recurrence (LR) risk after breast-conserving surgery (BCS) for DCIS. The DCIS score (DS) was validated as a predictor of LR in E5194 and Ontario DCIS cohort (ODC) after BCS. We combined data from E5194 and ODC adjusting for clinicopathological factors to provide refined estimates of the 10-year risk of LR after treatment by BCS alone. Data from E5194 and ODC were combined. Patients with positive margins or multifocality were excluded. Identical Cox regression models were fit for each study. Patient-specific meta-analysis was used to calculate precision-weighted estimates of 10-year LR risk by DS, age, tumor size and year of diagnosis. The combined cohort includes 773 patients. The DS and age at diagnosis, tumor size and year of diagnosis provided independent prognostic information on the 10-year LR risk (p ≤ 0.009). Hazard ratios from E5194 and ODC cohorts were similar for the DS (2.48, 1.95 per 50 units), tumor size ≤ 1 versus  > 1-2.5 cm (1.45, 1.47), age ≥ 50 versus  15%) 10-year LR risk after BCS alone compared to utilization of DS alone or clinicopathological factors alone. The combined analysis provides refined estimates of 10-year LR risk after BCS for DCIS. Adding information on tumor size and age at diagnosis to the DS adjusting for year of diagnosis provides improved LR risk estimates to guide treatment decision making.

Diagnostic utility of magnetic resonance imaging and radiography in juvenile spondyloarthritis: evaluation of the sacroiliac joints in controls and affected subjects.

Science.gov (United States)

Jaremko, Jacob L; Liu, Lei; Winn, Naomi J; Ellsworth, Janet E; Lambert, Robert G W

2014-05-01

To compare the utility of radiography and magnetic resonance imaging (MRI) for the diagnosis of juvenile-onset spondyloarthritis in pediatric patients presenting with low back and/or sacroiliac (SI) pain of potentially inflammatory etiology. Radiographs and MRI studies of the SI joints in 26 patients with juvenile spondyloarthritis (JSpA) and 35 controls were assessed independently by 2 radiologists, with discrepancies arbitrated by a third. Radiographs and MRI were blinded and read in separate batches in random order. Erosion was common and was the most useful diagnostic feature on radiography [positive likelihood ratio (LR) = 3.5] and was especially diagnostic of SpA on MRI (LR = 6.7). Subchondral sclerosis was common but was the least specific feature for both modalities. Joint space narrowing had some utility on radiography (LR = 2.0) and MRI (LR = 2.7) but was uncommon and had poor reader reliability. Bone marrow edema (LR = 3.1) and subarticular fat infiltration (LR = 4.5), detectable only on MRI, were both useful features. Global diagnostic impression of MRI (LR = 9.4) had very high utility for the diagnosis of JSpA, exceeding radiography (LR = 4.4) because of superior specificity. In addition, global diagnosis of SpA is much more reliably made on MRI (κ = 0.80) compared to radiography (κ = 0.30). Specificity and reliability of MRI of the SI joints are superior to radiography for the diagnosis of juvenile-onset SpA and, where available, MRI should replace radiography as the first line of investigation.

Removal of MCs by Bi2O2CO3: adsorption and the potential of photocatalytic degradation.

Science.gov (United States)

Wang, Yujiao; Cao, Yanqiu; Li, Hongmei; Gong, Aijun; Han, Jintao; Qian, Zhen; Chao, Wenran

2018-04-01

Microcystins (MCs) is a kind of hepatotoxin, which is the secondary metabolite of cyanobacteria. Bi 2 O 2 CO 3 (BOC) is a kind of cheap and nontoxic semiconductor material. BOC was synthetized by solvothermal method and then microcystin-LR (MC-LR) and microcystin-RR (MC-RR) were removed by BOC, through adsorption and photocatalytic degradation. When the dosage of BOC is 6 g/L, the MC-LR and MC-RR in the natural water sample can be completely adsorbed in 30 min and then after 12 h irradiation, MC-LR and MC-RR were photocatalytically degraded by BOC.

Hormonal modulation of the heat shock response: insights from fish with divergent cortisol stress responses

DEFF Research Database (Denmark)

LeBlanc, Sacha; Höglund, Erik; Gilmour, Kathleen M.

2012-01-01

shock response, we capitalized on two lines of rainbow trout specifically bred for their high (HR) and low (LR) cortisol response to stress. We predicted that LR fish, with a low cortisol but high catecholamine response to stress, would induce higher levels of HSPs after acute heat stress than HR trout....... We found that HR fish have significantly higher increases in both catecholamines and cortisol compared with LR fish, and LR fish had no appreciable stress hormone response to heat shock. This unexpected finding prevented further interpretation of the hormonal modulation of the heat shock response...

Persistent Low-Risk and High-Risk Human Papillomavirus Infections of the Uterine Cervix in HIV-Negative and HIV-Positive Women

Directory of Open Access Journals (Sweden)

Sally N. Adebamowo

2017-07-01

Full Text Available BackgroundThe prevalence, persistence, and multiplicity of human papillomavirus (HPV infection appears different comparing HIV-positive to HIV-negative women. In this study, we examined prevalent, persistent, and multiple low- and high-risk cervical HPV infections in HIV-negative and HIV-positive women.MethodsWe studied 1,020 women involved in a study of HPV infection using SPF25/LiPA10. Two study visits were scheduled, at enrollment and 6 months afterward. At each study visit, research nurses used a cervical brush to collect samples of exfoliated cervical cells from the cervical os, from all the study participants. Exact logistic regression models were used to estimate associations between HIV and HPV infections.ResultsThe mean (SD age of the study participants was 38 (8 years, 56% were HIV-negative and 44% were HIV-positive. Among HIV-negative women at baseline, single low-risk HPV (lrHPV infections occurred in 12%; multiple lrHPV in 2%; single high-risk human papillomavirus (hrHPV infections in 9%, and multiple hrHPV infections in 2%. Single lrHPV infections were persistent in 6%, but there was no persistent multiple lrHPV infections. Single hrHPV infections were persistent in 4% while multiple hrHPV infections were persistent in 0.3%. Among HIV-positive women at baseline, single lrHPV infections occurred in 19%, multiple lrHPV in 6%, single hrHPV infections in 17%, and multiple hrHPV infections occurred in 12%. Single lrHPV infections were persistent in 9%, multiple lrHPV infections in 0.6%, single hrHPV infections in 13%, while multiple hrHPV were persistent in 3%. Prevalent, persistent, and multiple infections were more common in HIV-positive women, compared to HIV-negative women. In multivariate models adjusted for age, marital status, socioeconomic status, age at sexual initiation, and douching, the odds ratios comparing HIV-positive to HIV-negative women, were 2.09 (95% CI 1.47–2.97, p < 0.001 for prevalent lrHPV, 1.26 (95% CI

Analysis of Parameters Assessment on Laminated Rubber-Metal Spring for Structural Vibration

International Nuclear Information System (INIS)

Salim, M.A.; Putra, A.; Mansor, M.R.; Musthafah, M.T.; Akop, M.Z.; Abdullah, M.A.

2016-01-01

This paper presents the analysis of parameter assessment on laminated rubber-metal spring (LR-MS) for vibrating structure. Three parameters were selected for the assessment which are mass, Young's modulus and radius. Natural rubber materials has been used to develop the LR-MS model. Three analyses were later conducted based on the selected parameters to the LR-MS performance which are natural frequency, location of the internal resonance frequency and transmissibility of internal resonance. Results of the analysis performed were plotted in frequency domain function graph. Transmissibility of laminated rubber-metal spring (LR-MS) is changed by changing the value of the parameter. This occurrence was referred to the theory from open literature then final conclusion has been make which are these parameters have a potential to give an effects and trends for LR-MS transmissibility. (paper)

Local recurrence after laparoscopic radiofrequency ablation of malignant liver tumors: Results of a contemporary series.

Science.gov (United States)

Takahashi, Hideo; Akyuz, Muhammet; Aksoy, Erol; Karabulut, Koray; Berber, Eren

2017-06-01

The aims of this study were to determine the incidence of Local recurrence (LR) in patients at long-term follow-up after laparoscopic RFA (LRFA) and also to determine the risk factors for LR from a contemporary series. Patients undergoing LRFA between 2005 and 2014 by a single surgeon were reviewed. Demographic and perioperative data were analyzed from a prospective database. LRFA was performed on 316 patients with 901 lesions. Median follow-up was 25 months, with 76% of whom completed at least one year of follow-up. The LR rate was 18.4%. The LR in patients followed for less than 12 months was 13.8%, 20.3% for 12 months, and 19.7% for 18 months (P = 0.02). One-fourth of the LRs developed after the 1st year. Morbidity was 8.9% and mortality 0.3%. Tumor type, size, ablation margin, and surgeon experience affected LR, with tumor type, size, and ablation margin being independent. This study shows that 14% of malignant liver tumors will develop LR within a year after LRFA. Additional 4% of the lesions will demonstrate recurrence within 1 cm of the ablation zone, mostly as part of a multifocal recurrence. Ablation margin is the only parameter that the surgeon can manipulate to decrease LR. © 2017 Wiley Periodicals, Inc.

Lateral root formation and the multiple roles of auxin.

Science.gov (United States)

Du, Yujuan; Scheres, Ben

2018-01-04

Root systems can display variable architectures that contribute to survival strategies of plants. The model plant Arabidopsis thaliana possesses a tap root system, in which the primary root and lateral roots (LRs) are major architectural determinants. The phytohormone auxin fulfils multiple roles throughout LR development. In this review, we summarize recent advances in our understanding of four aspects of LR formation: (i) LR positioning, which determines the spatial distribution of lateral root primordia (LRP) and LRs along primary roots; (ii) LR initiation, encompassing the activation of nuclear migration in specified lateral root founder cells (LRFCs) up to the first asymmetric cell division; (iii) LR outgrowth, the 'primordium-intrinsic' patterning of de novo organ tissues and a meristem; and (iv) LR emergence, an interaction between LRP and overlaying tissues to allow passage through cell layers. We discuss how auxin signaling, embedded in a changing developmental context, plays important roles in all four phases. In addition, we discuss how rapid progress in gene network identification and analysis, modeling, and four-dimensional imaging techniques have led to an increasingly detailed understanding of the dynamic regulatory networks that control LR development. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Low rank alternating direction method of multipliers reconstruction for MR fingerprinting.

Science.gov (United States)

Assländer, Jakob; Cloos, Martijn A; Knoll, Florian; Sodickson, Daniel K; Hennig, Jürgen; Lattanzi, Riccardo

2018-01-01

The proposed reconstruction framework addresses the reconstruction accuracy, noise propagation and computation time for magnetic resonance fingerprinting. Based on a singular value decomposition of the signal evolution, magnetic resonance fingerprinting is formulated as a low rank (LR) inverse problem in which one image is reconstructed for each singular value under consideration. This LR approximation of the signal evolution reduces the computational burden by reducing the number of Fourier transformations. Also, the LR approximation improves the conditioning of the problem, which is further improved by extending the LR inverse problem to an augmented Lagrangian that is solved by the alternating direction method of multipliers. The root mean square error and the noise propagation are analyzed in simulations. For verification, in vivo examples are provided. The proposed LR alternating direction method of multipliers approach shows a reduced root mean square error compared to the original fingerprinting reconstruction, to a LR approximation alone and to an alternating direction method of multipliers approach without a LR approximation. Incorporating sensitivity encoding allows for further artifact reduction. The proposed reconstruction provides robust convergence, reduced computational burden and improved image quality compared to other magnetic resonance fingerprinting reconstruction approaches evaluated in this study. Magn Reson Med 79:83-96, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Development and validation of a logistic regression model to distinguish transition zone cancers from benign prostatic hyperplasia on multi-parametric prostate MRI

Energy Technology Data Exchange (ETDEWEB)

Iyama, Yuji [Kumamoto Chuo Hospital, Department of Diagnostic Radiology, Kumamoto, Kumamoto (Japan); Kumamoto University, Department of Diagnostic Radiology, Graduate School of Medical Sciences, Kumamoto, Kumamoto (Japan); Nakaura, Takeshi; Nagayama, Yasunori; Utsunomiya, Daisuke; Yamashita, Yasuyuki [Kumamoto University, Department of Diagnostic Radiology, Graduate School of Medical Sciences, Kumamoto, Kumamoto (Japan); Katahira, Kazuhiro; Oda, Seitaro [Kumamoto Chuo Hospital, Department of Diagnostic Radiology, Kumamoto, Kumamoto (Japan); Iyama, Ayumi [National Hospital Organization Kumamoto Medical Center, Department of Diagnostic Radiology, Kumamoto, Kumamoto (Japan)

2017-09-15

To develop a prediction model to distinguish between transition zone (TZ) cancers and benign prostatic hyperplasia (BPH) on multi-parametric prostate magnetic resonance imaging (mp-MRI). This retrospective study enrolled 60 patients with either BPH or TZ cancer, who had undergone 3 T-MRI. We generated ten parameters for T2-weighted images (T2WI), diffusion-weighted images (DWI) and dynamic MRI. Using a t-test and multivariate logistic regression (LR) analysis to evaluate the parameters' accuracy, we developed LR models. We calculated the area under the receiver operating characteristic curve (ROC) of LR models by a leave-one-out cross-validation procedure, and the LR model's performance was compared with radiologists' performance with their opinion and with the Prostate Imaging Reporting and Data System (Pi-RADS v2) score. Multivariate LR analysis showed that only standardized T2WI signal and mean apparent diffusion coefficient (ADC) maintained their independent values (P < 0.001). The validation analysis showed that the AUC of the final LR model was comparable to that of board-certified radiologists, and superior to that of Pi-RADS scores. A standardized T2WI and mean ADC were independent factors for distinguishing between BPH and TZ cancer. The performance of the LR model was comparable to that of experienced radiologists. (orig.)

Standard high-resolution pelvic MRI vs. low-resolution pelvic MRI in the evaluation of deep infiltrating endometriosis

International Nuclear Information System (INIS)

Scardapane, Arnaldo; Lorusso, Filomenamila; Ferrante, Annunziata; Stabile Ianora, Amato Antonio; Angelelli, Giuseppe; Scioscia, Marco

2014-01-01

To compare the capabilities of standard pelvic MRI with low-resolution pelvic MRI using fast breath-hold sequences to evaluate deep infiltrating endometriosis (DIE). Sixty-eight consecutive women with suspected DIE were studied with pelvic MRI. A double-acquisition protocol was carried out in each case. High-resolution (HR)-MRI consisted of axial, sagittal, and coronal TSE T2W images, axial TSE T1W, and axial THRIVE. Low-resolution (LR)-MRI was acquired using fast single shot (SSH) T2 and T1 images. Two radiologists with 10 and 2 years of experience reviewed HR and LR images in two separate sessions. The presence of endometriotic lesions of the uterosacral ligament (USL), rectovaginal septum (RVS), pouch of Douglas (POD), and rectal wall was noted. The accuracies of LR-MRI and HR-MRI were compared with the laparoscopic and histopathological findings. Average acquisition times were 24 minutes for HR-MRI and 7 minutes for LR-MRI. The more experienced radiologist achieved higher accuracy with both HR-MRI and LR-MRI. The values of sensitivity, specificity, PPV, NPV, and accuracy did not significantly change between HR and LR images or interobserver agreement for all of the considered anatomic sites. LR-MRI performs as well as HR-MRI and is a valuable tool for the detection of deep endometriosis extension. (orig.)

Proposed link rates in the human brain.

Science.gov (United States)

van Putten, Michael J A M

2003-07-15

There is increasing experimental evidence that neuronal synchronization is necessary for the large-scale integration of distributed neuronal activity to realize various time-dependent coherent neuronal assemblies in the brain. Phase synchronization seems a promising candidate to quantify the time-dependent, frequency specific, synchrony between simultaneously recorded electroencephalogram (EEG) signals that may partially reflect this former process. We introduce a link rate (LR) as a measure of the spatial-temporal incidence of phase synchronization and phase de-synchronization. The concept is exemplified in its application to the analysis of spontaneous phase synchronization. To this end, three scalp EEG recordings are used: a normal control, a patient suffering from epileptic seizures and a patient with diffuse brain damage due to anoxia, showing a burst-suppression EEG. In addition, the method is applied to surrogate data (white noise). We find in the normal control that LR(control)=13.90+/-0.04 (mean+/-S.E.M.), which is different from the surrogate data, where we find that LR(surr)=15.36+/-0.05. In the two pathological conditions, the LR is significantly and strongly reduced to LR(burst)=4.52+/-0.05 and LR(seizure)=5.40+/-0.08. The derived LR seems a sensitive measure to relevant changes in synchronization, as these occur in the dynamic process of generating different spatial-temporal networks, both in physiological and pathological conditions.

Cell chirality: its origin and roles in left-right asymmetric development.

Science.gov (United States)

Inaki, Mikiko; Liu, Jingyang; Matsuno, Kenji

2016-12-19

An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by 'cortical inheritance'. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left-right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Authors.

Cell chirality: its origin and roles in left–right asymmetric development

Science.gov (United States)

Inaki, Mikiko; Liu, Jingyang

2016-01-01

An item is chiral if it cannot be superimposed on its mirror image. Most biological molecules are chiral. The homochirality of amino acids ensures that proteins are chiral, which is essential for their functions. Chirality also occurs at the whole-cell level, which was first studied mostly in ciliates, single-celled protozoans. Ciliates show chirality in their cortical structures, which is not determined by genetics, but by ‘cortical inheritance’. These studies suggested that molecular chirality directs whole-cell chirality. Intriguingly, chirality in cellular structures and functions is also found in metazoans. In Drosophila, intrinsic cell chirality is observed in various left–right (LR) asymmetric tissues, and appears to be responsible for their LR asymmetric morphogenesis. In other invertebrates, such as snails and Caenorhabditis elegans, blastomere chirality is responsible for subsequent LR asymmetric development. Various cultured cells of vertebrates also show intrinsic chirality in their cellular behaviours and intracellular structural dynamics. Thus, cell chirality may be a general property of eukaryotic cells. In Drosophila, cell chirality drives the LR asymmetric development of individual organs, without establishing the LR axis of the whole embryo. Considering that organ-intrinsic LR asymmetry is also reported in vertebrates, this mechanism may contribute to LR asymmetric development across phyla. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821533

Effects of laser remelting on microstructures and immersion corrosion performance of arc sprayed Al coating in 3.5% NaCl solution

Science.gov (United States)

Sun, Ze; Zhang, Donghui; Yan, Baoxu; Kong, Dejun

2018-02-01

An arc sprayed aluminum (Al) coating on S355 steel was processed using a laser remelting (LR). The microstructures, chemical element composition, and phases of the obtained Al coating were analyzed using a field mission scanning electronic microscope (FESEM), energy dispersive spectrometer (EDS), and X-ray diffractometer (XRD), respectively, and the residual stresses were measured using an X-ray diffraction stress tester. The immersion corrosion tests and potentiodynamic polarization of Al coating in 3.5% NaCl solution were performed to investigate the effects of LR on its immersion corrosion behaviors, and the corrosion mechanism of Al coating was also discussed. The results show that the arc sprayed Al coating is composed of Al phase, while that by LR is composed of Al-Fe and AlO4FeO6 phases, and the porosities and cracks in the arc sprayed Al coating are eliminated by LR, The residual stress of arc sprayed Al coating is -5.6 ± 18 MPa, while that after LR is 137.9 ± 12 MPa, which deduces the immersion corrosion resistance of Al coating. The corrosion mechanism of arc sprayed Al coating is pitting corrosion and crevice corrosion, while that by LR is uniform corrosion and pitting corrosion. The corrosion potential of arc sprayed Al coating by LR shifts positively, which improves its immersion corrosion resistance.

Standard high-resolution pelvic MRI vs. low-resolution pelvic MRI in the evaluation of deep infiltrating endometriosis

Energy Technology Data Exchange (ETDEWEB)

Scardapane, Arnaldo; Lorusso, Filomenamila; Ferrante, Annunziata; Stabile Ianora, Amato Antonio; Angelelli, Giuseppe [University Hospital ' ' Policlinico' ' of Bari, Interdisciplinary Department of Medicine, Bari (Italy); Scioscia, Marco [Sacro Cuore Don Calabria General Hospital, Department of Obstetrics and Gynecology, Negrar, Verona (Italy)

2014-10-15

To compare the capabilities of standard pelvic MRI with low-resolution pelvic MRI using fast breath-hold sequences to evaluate deep infiltrating endometriosis (DIE). Sixty-eight consecutive women with suspected DIE were studied with pelvic MRI. A double-acquisition protocol was carried out in each case. High-resolution (HR)-MRI consisted of axial, sagittal, and coronal TSE T2W images, axial TSE T1W, and axial THRIVE. Low-resolution (LR)-MRI was acquired using fast single shot (SSH) T2 and T1 images. Two radiologists with 10 and 2 years of experience reviewed HR and LR images in two separate sessions. The presence of endometriotic lesions of the uterosacral ligament (USL), rectovaginal septum (RVS), pouch of Douglas (POD), and rectal wall was noted. The accuracies of LR-MRI and HR-MRI were compared with the laparoscopic and histopathological findings. Average acquisition times were 24 minutes for HR-MRI and 7 minutes for LR-MRI. The more experienced radiologist achieved higher accuracy with both HR-MRI and LR-MRI. The values of sensitivity, specificity, PPV, NPV, and accuracy did not significantly change between HR and LR images or interobserver agreement for all of the considered anatomic sites. LR-MRI performs as well as HR-MRI and is a valuable tool for the detection of deep endometriosis extension. (orig.)

Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

Science.gov (United States)

Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

2011-05-15

Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

Observed to expected or logistic regression to identify hospitals with high or low 30-day mortality?

Science.gov (United States)

Helgeland, Jon; Clench-Aas, Jocelyne; Laake, Petter; Veierød, Marit B.

2018-01-01

Introduction A common quality indicator for monitoring and comparing hospitals is based on death within 30 days of admission. An important use is to determine whether a hospital has higher or lower mortality than other hospitals. Thus, the ability to identify such outliers correctly is essential. Two approaches for detection are: 1) calculating the ratio of observed to expected number of deaths (OE) per hospital and 2) including all hospitals in a logistic regression (LR) comparing each hospital to a form of average over all hospitals. The aim of this study was to compare OE and LR with respect to correctly identifying 30-day mortality outliers. Modifications of the methods, i.e., variance corrected approach of OE (OE-Faris), bias corrected LR (LR-Firth), and trimmed mean variants of LR and LR-Firth were also studied. Materials and methods To study the properties of OE and LR and their variants, we performed a simulation study by generating patient data from hospitals with known outlier status (low mortality, high mortality, non-outlier). Data from simulated scenarios with varying number of hospitals, hospital volume, and mortality outlier status, were analysed by the different methods and compared by level of significance (ability to falsely claim an outlier) and power (ability to reveal an outlier). Moreover, administrative data for patients with acute myocardial infarction (AMI), stroke, and hip fracture from Norwegian hospitals for 2012–2014 were analysed. Results None of the methods achieved the nominal (test) level of significance for both low and high mortality outliers. For low mortality outliers, the levels of significance were increased four- to fivefold for OE and OE-Faris. For high mortality outliers, OE and OE-Faris, LR 25% trimmed and LR-Firth 10% and 25% trimmed maintained approximately the nominal level. The methods agreed with respect to outlier status for 94.1% of the AMI hospitals, 98.0% of the stroke, and 97.8% of the hip fracture hospitals

Comparation of the Uptake and Accumulation of Heavy Metals by Rape Species Grown in Contaminated Soil Surrounding Mining Tails in Chenzhou, China

Directory of Open Access Journals (Sweden)

YANG Yang

2015-08-01

Full Text Available The rape is usually used for phytoremediation of metal-contaminated soils, because it has the characteristics of rapid growth, large biomass, and high potential to tolerate and accumulate large quantities of heavy metals. In this work, accumulation and transformation of Cu, Zn, Pb, Cd in four rape species(B. juncea L.(BJ, Brassica napus L.(BL, Canadian Brassica napus L.(CBL, local rape(LRwere investigated in soils surrounding mine area contaminated by lead-zinc ore tailings in Chenzhou, Hunan Province. The results showed a significantly high accumulation of Cu, Zn and Cd in leaves and roots of four rape species. However, the concentration of Pb in roots of all rape species was usually one or two orders of magnitude than other parts, and the concentration of heavy metals in stems and fruits was lower. The accumulation of heavy metals in leaves parts was in the order: Zn >Cu >Pb >Cd, and in roots was as: Pb >Zn >Cu >Cd; the order of bioconcentration factor(BCFof heavy metals in above-ground parts(leavesof rape species was: Cu: BJ ≥LR >BL >CBL, Zn: BL >CBL >BJ >LR, Pb: BJ≈LR > BL≈CBL, Cd: BL >CBL >BJ >LR; and the order of translocation factor(TFfrom stems to leaves was: Cu: LR >BJ≈CBL >BL,Zn: BL >LR > BJ >CBL, Pb: BJ >CBL≈LR >BL,Cd: BJ >BL >CBL >LR. It indicated there were significant differences among the species. The results of the field experiment suggested that B. juncea L. was suitable for phytoextraction of Cu, Pb contaminated soil, Brassica napus L. could be used to remediate Zn, Cd or heavy metal combined polluted soils.

The location of locoregional recurrence in pathologic T3N0, non-irradiated lower rectal cancer

International Nuclear Information System (INIS)

Kim, Mi Sun; Keum, Ki Chang; Rhee, Woo Joong; Kim, Hyun Ju; Kim, Min Ji; Choi, Seo Hee; Nam, Ki Chang; Koom, Woong Sub

2013-01-01

To investigate the patterns of locoregional recurrence of pathologic T3N0 (pT3N0) lower rectal cancer omitting postoperative radiotherapy (RT) and explore the potential of modification of a RT field. From Jan 2003 to Nov 2011, 35 patients omitting preoperative or postoperative RT for pT3N0 lower rectal cancer were included. We defined the lower rectal cancer as the tumor with the inferior margin located below the virtual line-a convergent level between rectal wall and levator ani muscle. All patients had radiologic examinations for recurrence evaluation during the follow-up duration. The median follow-up duration was 66.4 months (range, 1.4 to 126.1 months). Eight (22.9%) of the 35 patients had recurrence. Three (8.6%) was local recurrence (LR) only, 3 (8.6%) was distant metastasis (DM) only, and 2 (5.7%) was LR with DM. All LR were located at primary tumor sites. The overall survival rate, LR-free survival rate, and DM-free survival rate at 5 years was 79.8%, 83%, and 87%, respectively. All LR developed from tumors over 5 cm. However, there was no statistical significance (p = 0.065). There was no other risk factor for LR. Even though the patients included in this study had pathologically favorable pT3N0 rectal cancer, LR developed in 14.3% of patients. Most of the LR was located at primary tumor sites prior to surgery. Based on these findings, it might seem reasonable to consider postoperative RT with a smaller radiation field to the primary tumor site rather than the conventional whole pelvic irradiation.

A comparison of logistic regression analysis and an artificial neural network using the BI-RADS lexicon for ultrasonography in conjunction with introbserver variability.

Science.gov (United States)

Kim, Sun Mi; Han, Heon; Park, Jeong Mi; Choi, Yoon Jung; Yoon, Hoi Soo; Sohn, Jung Hee; Baek, Moon Hee; Kim, Yoon Nam; Chae, Young Moon; June, Jeon Jong; Lee, Jiwon; Jeon, Yong Hwan

2012-10-01

To determine which Breast Imaging Reporting and Data System (BI-RADS) descriptors for ultrasound are predictors for breast cancer using logistic regression (LR) analysis in conjunction with interobserver variability between breast radiologists, and to compare the performance of artificial neural network (ANN) and LR models in differentiation of benign and malignant breast masses. Five breast radiologists retrospectively reviewed 140 breast masses and described each lesion using BI-RADS lexicon and categorized final assessments. Interobserver agreements between the observers were measured by kappa statistics. The radiologists' responses for BI-RADS were pooled. The data were divided randomly into train (n = 70) and test sets (n = 70). Using train set, optimal independent variables were determined by using LR analysis with forward stepwise selection. The LR and ANN models were constructed with the optimal independent variables and the biopsy results as dependent variable. Performances of the models and radiologists were evaluated on the test set using receiver-operating characteristic (ROC) analysis. Among BI-RADS descriptors, margin and boundary were determined as the predictors according to stepwise LR showing moderate interobserver agreement. Area under the ROC curves (AUC) for both of LR and ANN were 0.87 (95% CI, 0.77-0.94). AUCs for the five radiologists ranged 0.79-0.91. There was no significant difference in AUC values among the LR, ANN, and radiologists (p > 0.05). Margin and boundary were found as statistically significant predictors with good interobserver agreement. Use of the LR and ANN showed similar performance to that of the radiologists for differentiation of benign and malignant breast masses.

An iterated Laplacian based semi-supervised dimensionality reduction for classification of breast cancer on ultrasound images.

Science.gov (United States)

Liu, Xiao; Shi, Jun; Zhou, Shichong; Lu, Minhua

2014-01-01

The dimensionality reduction is an important step in ultrasound image based computer-aided diagnosis (CAD) for breast cancer. A newly proposed l2,1 regularized correntropy algorithm for robust feature selection (CRFS) has achieved good performance for noise corrupted data. Therefore, it has the potential to reduce the dimensions of ultrasound image features. However, in clinical practice, the collection of labeled instances is usually expensive and time costing, while it is relatively easy to acquire the unlabeled or undetermined instances. Therefore, the semi-supervised learning is very suitable for clinical CAD. The iterated Laplacian regularization (Iter-LR) is a new regularization method, which has been proved to outperform the traditional graph Laplacian regularization in semi-supervised classification and ranking. In this study, to augment the classification accuracy of the breast ultrasound CAD based on texture feature, we propose an Iter-LR-based semi-supervised CRFS (Iter-LR-CRFS) algorithm, and then apply it to reduce the feature dimensions of ultrasound images for breast CAD. We compared the Iter-LR-CRFS with LR-CRFS, original supervised CRFS, and principal component analysis. The experimental results indicate that the proposed Iter-LR-CRFS significantly outperforms all other algorithms.

Mesenchymal Stem Cells Enhance Liver Regeneration via Improving Lipid Accumulation and Hippo Signaling

Directory of Open Access Journals (Sweden)

Yang Liu

2018-01-01

Full Text Available The liver has the potential to regenerate after injury. It is a challenge to improve liver regeneration (LR after liver resection in clinical practice. Bone morrow-derived mesenchymal stem cells (MSCs have shown to have a role in various liver diseases. To explore the effects of MSCs on LR, we established a model of 70% partial hepatectomy (PHx. Results revealed that infusion of MSCs could improve LR through enhancing cell proliferation and cell growth during the first 2 days after PHx, and MSCs could also restore liver synthesis function. Infusion of MSCs also improved liver lipid accumulation partly via mechanistic target of rapamycin (mTOR signaling and enhanced lipid β-oxidation support energy for LR. Rapamycin-induced inhibition of mTOR decreased liver lipid accumulation at 24 h after PHx, leading to impaired LR. And after infusion of MSCs, a proinflammatory environment formed in the liver, evidenced by increased expression of IL-6 and IL-1β, and thus the STAT3 and Hippo-YAP pathways were activated to improve cell proliferation. Our results demonstrated the function of MSCs on LR after PHx and provided new evidence for stem cell therapy of liver diseases.

Integrated-Optics Components Utilizing Long-Range Surface Plasmon Polaritons

DEFF Research Database (Denmark)

Boltasseva, Alexandra

2004-01-01

This thesis describes a new class of components for integrated optics, based on the propagation of long-range surface plasmon polaritons (LR-SPPs) along metal stripes embedded in a dielectric. These novel components can provide guiding of light as well as coupling and splitting from/into a number...... with experimental results is obtained. The interaction of LR-SPPs with photonic crystals (PCs) is also studied. The PC structures are formed by periodic arrays of gold bumps that are arranged in a triangular lattice and placed symmetrically on both sides of a thin gold film. The LR-SPP transmission through...... of channels with good performance. Guiding of LR-SPPs along nm-thin and µm-wide gold stripes embedded in polymer is investigated in the wavelength range of 1250 – 1650 nm. LR-SPP guiding properties, such as the propagation loss and mode field diameter, are studied for different stripe widths and thicknesses...

Steganalysis using logistic regression

Science.gov (United States)

Lubenko, Ivans; Ker, Andrew D.

2011-02-01

We advocate Logistic Regression (LR) as an alternative to the Support Vector Machine (SVM) classifiers commonly used in steganalysis. LR offers more information than traditional SVM methods - it estimates class probabilities as well as providing a simple classification - and can be adapted more easily and efficiently for multiclass problems. Like SVM, LR can be kernelised for nonlinear classification, and it shows comparable classification accuracy to SVM methods. This work is a case study, comparing accuracy and speed of SVM and LR classifiers in detection of LSB Matching and other related spatial-domain image steganography, through the state-of-art 686-dimensional SPAM feature set, in three image sets.

Experimental study on stabilizing range extension of diamagnetic levitation under modulated magnetic field

Energy Technology Data Exchange (ETDEWEB)

Chow, T C S; Wong, P L; Liu, K P, E-mail: 50578230@student.cityu.edu.h, E-mail: meplwong@cityu.edu.h, E-mail: mekpliu@cityu.edu.h [Manufacturing Engineering and Engineering Management Department, City University of Hong Kong, Tat Chee Avenue, Kowloon (Hong Kong)

2010-01-01

The real energy-free levitation exists with the help of diamagnetic material. Its ultra-high sensitivity to force is particularly attractive to micro/nano force sensing. A key parameter: Levitation Stabilizing Local Range, LR (allowable moving range of the floater) is critical to the load and self-rotating performance. Besides, larger LR reduces the energy loss due to the eddy current and has greater application potential. Recently, an idea of extending the LR by a modulating coil array has been validated using numerical simulation. This paper takes the next move to carry out an experimental study on the shape effect of stacked coil arrays with different currents on LR.

Antagonism of yeasts to Xanthomonas campestris pv. campestris on cabbage phylloplane in field Antagonismo de leveduras a Xanthomonas campestris pv. campestris no filoplano de repolho em condições de campo

Directory of Open Access Journals (Sweden)

Sayonara M.P. Assis

1999-07-01

Full Text Available Twenty yeast isolates, obtained from cabbage phylloplane, were evaluated for antagonistic activity against Xanthomonas campestris pv. campestris, in field. Plants of cabbage cv. Midori were pulverized simultaneously with suspensions of antagonists and pathogen. After 10 days, plants were evaluated through percentage of foliar area with lesions. Percentage of disease severity reduction (DSR% was also calculated. Yeast isolates LR32, LR42 and LR19 showed, respectively, 72, 75 and 79% of DSR. These antagonists were tested in seven different application periods in relation to pathogen inoculation (T1=4 d before; T2=simultaneously; T3=4 d after; T4=4 d before + simultaneously; T5=4 d after + simultaneously; T6=4 d before + 4 d after; T7=4 d before + simultaneously + 4 d after. The highest DSRs were showed by LR42 (71%, LR42 (67%, LR35 (69% and LR19 (68% in the treatments T7, T4, T5 and T6, which significantly differed from the others. The same yeast antagonists were also tested for black rot control using different cabbage cultivars (Fuyutoyo, Master-325, Matsukaze, Midori, Sekai I and Red Winner. The DSRs varied from 58 to 61%, and there was no significant difference among cultivars.Vinte isolados de leveduras, obtidos a partir do filoplano de repolho foram avaliados pela atividade antagônica contra Xanthomonas campestris pv. campestris, em condições de campo. Plantas de repolho cv. Midori foram pulverizadas simultaneamente com suspensões do antagonista e do patógeno. Após 10 dias, as plantas foram avaliadas através da porcentagem de área foliar infectada. A porcentagem de redução da severidade da doença (DSR%, também foi calculada. Os isolados de leveduras LR32, LR42 e LR19 apresentaram, respectivamente, 72, 75 e 79% de DSR. Estes isolados foram testados em sete diferentes períodos de aplicação dos antagonistas em relação a inoculação do patógeno. (T1=4d antes; T2=simultaneamente; T3=4 d após; T4=4 d antes + simultaneamente; T5

Risk factors for locoregional disease recurrence after breast-conserving therapy in patients with breast cancer treated with neoadjuvant chemotherapy: An international collaboration and individual patient meta-analysis.

Science.gov (United States)

Valachis, Antonios; Mamounas, Eleftherios P; Mittendorf, Elizabeth A; Hayashi, Naoki; Ishitobi, Makoto; Natoli, Clara; Fitzal, Florian; Rubio, Isabel T; Tiezzi, Daniel G; Shin, Hee-Chul; Anderson, Stewart J; Hunt, Kelly K; Matsuda, Naoko; Ohsumi, Shozo; Totomi, Athina; Nilsson, Cecilia

2018-05-03

Several studies have reported a high risk of local disease recurrence (LR) and locoregional disease recurrence (LRR) in patients with breast cancer after neoadjuvant chemotherapy (NCT) and breast-conserving therapy (BCT). The objective of the current study was to identify potential risk factors for LR and LRR after NCT and BCT. Individual patient data sets from 9 studies were pooled. The outcomes of interest were the occurrence of LR and/or LRR. A 1-stage meta-analytic approach was used. Cox proportional hazards regression models were applied to identify factors that were predictive of LR and LRR, respectively. A total of 9 studies (4125 patients) provided their data sets. The 10-year LR rate was 6.5%, whereas the 10-year LRR rate was 10.3%. Four factors were found to be associated with a higher risk of LR: 1) estrogen receptor-negative disease; 2) cN + disease; 3) a lack of pathologic complete response in axilla (pN0); and 4) pN2 to pN3 disease. The predictive score for LR determined 3 risk groups: a low-risk, intermediate-risk, and high-risk group with 10-year LR rates of 4.0%, 7.9%, and 20.4%, respectively. Two additional factors were found to be associated with an increased risk of LRR: cT3 to cT4 disease and a lack of pathologic complete response in the breast. The predictive score for LRR determined 3 risk groups; a low-risk, intermediate-risk, and high-risk group with 10-year LRR rates of 3.2%, 10.1%, and 24.1%, respectively. BCT after NCT appears to be an oncologically safe procedure for a large percentage of patients with breast cancer. Two easy-to-use clinical scores were developed that can help clinicians to identify patients at higher risk of LR and LRR after NCT and BCT and individualize the postoperative treatment plan and follow-up. Cancer 2018. © 2018 American Cancer Society. © 2018 American Cancer Society.

Strategies to diagnose ovarian cancer: new evidence from phase 3 of the multicentre international IOTA study.

Science.gov (United States)

Testa, A; Kaijser, J; Wynants, L; Fischerova, D; Van Holsbeke, C; Franchi, D; Savelli, L; Epstein, E; Czekierdowski, A; Guerriero, S; Fruscio, R; Leone, F P G; Vergote, I; Bourne, T; Valentin, L; Van Calster, B; Timmerman, D

2014-08-12

To compare different ultrasound-based international ovarian tumour analysis (IOTA) strategies and risk of malignancy index (RMI) for ovarian cancer diagnosis using a meta-analysis approach of centre-specific data from IOTA3. This prospective multicentre diagnostic accuracy study included 2403 patients with 1423 benign and 980 malignant adnexal masses from 2009 until 2012. All patients underwent standardised transvaginal ultrasonography. Test performance of RMI, subjective assessment (SA) of ultrasound findings, two IOTA risk models (LR1 and LR2), and strategies involving combinations of IOTA simple rules (SRs), simple descriptors (SDs) and LR2 with and without SA was estimated using a meta-analysis approach. Reference standard was histology after surgery. The areas under the receiver operator characteristic curves of LR1, LR2, SA and RMI were 0.930 (0.917-0.942), 0.918 (0.905-0.930), 0.914 (0.886-0.936) and 0.875 (0.853-0.894). Diagnostic one-step and two-step strategies using LR1, LR2, SR and SD achieved summary estimates for sensitivity 90-96%, specificity 74-79% and diagnostic odds ratio (DOR) 32.8-50.5. Adding SA when IOTA methods yielded equivocal results improved performance (DOR 57.6-75.7). Risk of Malignancy Index had sensitivity 67%, specificity 91% and DOR 17.5. This study shows all IOTA strategies had excellent diagnostic performance in comparison with RMI. The IOTA strategy chosen may be determined by clinical preference.

Lobular carcinoma in situ (LCIS) of the breast: is long-term outcome similar to ductal carcinoma in situ (DCIS)? Analysis of 200 cases

International Nuclear Information System (INIS)

Cutuli, Bruno; De Lafontan, Brigitte; Kirova, Youlia; Auvray, Hugues; Tallet, Agnes; Avigdor, Sandrine; Brunaud, Claire; Delva, Catherine

2015-01-01

Lobular carcinomas in situ (LCIS) represent 1-2% of all breast cancers. Both significance and treatment remain widely debated, as well as the possible similarities with DCIS. Two hundred patients with pure LCIS were retrospectively analyzed in seven centres from 1990 to 2008. Median age was 52 years; 176 patients underwent breast-conserving surgery (BCS) and 24 mastectomy. Seventeen patients received whole breast irradiation (WBRT) after BCS and 20 hormonal treatment (15 by tamoxifen). With a 144-month median follow-up (FU), there were no local recurrences (LR) among 24 patients treated by mastectomy. With the same FU, 3 late LR out of 17 (17%) occurred in patients treated by BCS and WBRT (with no LR at 10 years). Among 159 patients treated by BCS alone, 20 developed LR (13%), but with only a 72-month FU (17.5% at 10 years). No specific LR risk factors were identified. Three patients developed metastases, two after invasive LR; 22 patients (11%) developed contralateral BC (59% invasive) and another five had second cancer. LCIS is not always an indolent disease. The long-term outcome is quite similar to most ductal carcinomas in situ (DCIS). The main problems are the accuracy of pathological definition and a clear identification of more aggressive subtypes, in order to avoid further invasive LR. BCS + WBRT should be discussed in some selected cases, and the long-term results seem comparable to DCIS

The interaction between nitrobenzene and Microcystis aeruginosa and its potential to impact water quality.

Science.gov (United States)

Liu, Zhiquan; Cui, Fuyi; Ma, Hua; Fan, Zhenqiang; Zhao, Zhiwei; Hou, Zhenling; Liu, Dongmei; Jia, Xuebin

2013-08-01

The potential water quality problems caused by the interaction between nitrobezene (NB) and Microcystis aeruginosa was investigated by studying the growth inhibition, the haloacetic acids formation potential (HAAFP) and the secretion of microcystin-LR (MC-LR). The results showed that NB can inhibit the growth of M. aeruginosa, and the value of EC50 increased with the increase of initial algal density. Although NB can hardly react with chlorine to form HAAs, the presence of NB can enhance the HAAFP productivity. The secretion of the intracellular MC-LR is constant under the steady experimental conditions. However, the presence of NB can reduce the MC-LR productivity of M. aeruginosa. Overall, the increased disinfection risk caused by the interaction has more important effect on the safety of drinking water quality than the benefit of the decreased MC-LR productivity, and should be serious considered when the water contained NB and M. aeruginosa is used as drinking water source. Copyright © 2013 Elsevier Ltd. All rights reserved.

Studies of e+e-→γγ and γγγ reactions

International Nuclear Information System (INIS)

Shimozawa, K.; Kajikawa, R.; Miyabayashi, K.; Nakano, E.; Ohnishi, Y.; Sugiyama, A.; Suzuki, S.; Takamure, H.; Fujimoto, J.; Adachi, I.; Doser, M.; Enomoto, R.; Fujii, H.; Fujii, K.; Ikeda, H.; Itoh, R.; Iwasaki, H.; Kawabata, S.; Kichimi, H.; Kobayashi, M.; Miyamoto, A.; Shirahashi, A.; Tauchi, T.; Tsukamoto, T.; Uno, S.; Yamamoto, A.; Yamauchi, M.; Abe, T.; Fujio, N.; Harigae, K.; Hori, S.; Nitoh, O.; Takahashi, K.; Fujii, T.; Kamae, T.; Kishida, T.; Yamamoto, S.; Fujiwara, N.; Hayashii, H.; Iida, N.; Muramatsu, K.; Nagira, T.; Nakajima, M.; Nishioka, H.; Noguchi, S.; Ohkura, M.; Sakai, E.; Howell, B.; Koltick, D.; Levine, I.; Kato, S.; Okuno, H.; Kato, Y.; Nakayama, M.; Okusawa, T.; Shimonaka, A.; Takahashi, T.; Teramoto, Y.; Nagai, K.; Nakagawa, N.; Tachibana, N.; Tanimori, T.; Watanabe, Y.; Ochiai, F.

1992-01-01

We have measured the cross section for γγ production with the TOPAZ detector in the energy region √s=50.0-61.4 GeV. The observed cross section for γγ production integrated over vertical strokecosθvertical stroke≤0.77 is 50.2±0.8±2.2 pb at =57.6 GeV and the ratio of this value to the QED prediction is 1.01±0.02±0.04. The angular distribution is in good agreement with the QED predictions, thereby setting limits on the compositeness scales, Λ L+R + =168 GeV, Λ L+R - =97 GeV, Λ L,R + =141 GeV, Λ L,R - =81 GeV, and Λ L-R ± =68 GeV, at the 95% confidence level. The reaction e + e - →γγγ was also studied and was found consistent with the QED prediction. (orig.)

Impaired Expression of Focal Adhesion Kinase in Mesenchymal Stromal Cells from Low-Risk Myelodysplastic Syndrome Patients

Directory of Open Access Journals (Sweden)

Yuenv Wu

2017-08-01

Full Text Available The pathogenic role of mesenchymal stromal cells (MSCs in myelodysplastic syndromes (MDS development and progression has been investigated by numerous studies, yet, it remains controversial in some aspects (1, 2. In the present study, we found distinct features of MSCs from low-risk (LR-MDS stromal microenvironment as compared to those from healthy subjects. At the molecular level, focal adhesion kinase, a key tyrosine kinase in control of cell proliferation, survival, and adhesion process, was found profoundly suppressed in expression and activation in LR-MDS MSC. At a functional level, LR-MDS MSCs showed impaired growth and clonogenic capacity, which were independent of cellular senescence and apoptosis. The pro-adipogenic differentiation and attenuated osteogenic capacity along with reduced SDF-1 expression could be involved in creating an unfavorable microenvironment for hematopoiesis. In conclusion, our experiments support the theory that the stromal microenvironment is fundamentally altered in LR-MDS, and these preliminary data offer a new perspective on LR-MDS pathophysiology.

On tests of local realism by CP-violation parameters of K0 mesons

International Nuclear Information System (INIS)

Genovese, M.

2005-01-01

Recently various papers have proposed to test local realism (LR) by considering electroweak CP-violation parameters values in neutral pseudoscalar meson systems. Considering the large interest for a conclusive test of LR and the experimental accessibility to these tests, in this paper we critically consider these results showing how they, albeit that they are very interesting, require anyway additional assumptions and therefore cannot be considered conclusive tests of LR. (orig.)

Lactobacillus reuteri DSM 17938 changes the frequency of Foxp3+ regulatory T cells in the intestine and mesenteric lymph node in experimental necrotizing enterocolitis.

Directory of Open Access Journals (Sweden)

Yuying Liu

Full Text Available Necrotizing enterocolitis (NEC is an inflammatory disease of the intestine in premature infants. Lactobacillus reuteri DSM 17938 improves survival and reduces the incidence and severity of NEC in a rodent model. Foxp3(+ regulatory T cells (Tregs maintain intestinal homeostasis by controlling inflammation and inducing tolerance. To determine whether there are insufficient numbers of Tregs to control inflammation in NEC and to determine if LR17938 increases the frequency of Tregs, we studied selected groups of newborn Sprague-Dawley rats according to feeding plan: dam±LR17938, formula±LR17938, and NEC±LR17938. NEC was induced by gavage feeding with special formula and exposure to hypoxic conditions. Lymphocytes isolated from ileum, mesenteric lymph nodes (MLN, spleen and thymus were labeled for T cell surface markers (CD3, CD4, CD8 and intracellular Foxp3; and labeled cells were analyzed by flow cytometry. The percentage of CD3(+ T cells and Foxp3(+ Tregs in the ileum significantly decreased in pups with NEC, compared to normal controls. Feeding LR17938 to neonatal rats with NEC increased the % of Foxp3(+ T cells in the ileum while decreasing the percentage of cells in the MLN. Administration of LR17938 to dam-fed rats significantly increased Foxp3(+Tregs in the ileum as early as day of life (DOL1 but did not produce an increase in Tregs in formula-fed rats on DOL1. These results suggest that factors in breast milk may enhance the early immunomodulatory effects of LR17938. An anti-inflammatory effect of LR17938 in NEC was associated with the modulation of immune responses and induction and what appears to be migration of Foxp3(+ Tregs to the diseased gut. Probiotic-facilitated development of Tregs might play an important role in the prevention of NEC.

Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

International Nuclear Information System (INIS)

Byun, Eui-Baek; Choi, Han-Gyu; Sung, Nak-Yun; Byun, Eui-Hong

2012-01-01

Highlights: ► Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. ► EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. ► EGCG-treated DCs inhibited MAPKs activation and NF-κB p65 translocation via 67LR. ► EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-α, interleukin [IL]-1β, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor κB (NF-κB) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

LumenRECON Guidewire: Pilot Study of a Novel, Nonimaging Technology for Accurate Vessel Sizing and Delivery of Therapy in Femoropopliteal Disease.

Science.gov (United States)

Nair, Pradeep K; Carr, Jeffrey G; Bigelow, Brian; Bhatt, Deepak L; Berwick, Zachary C; Adams, George

2018-01-01

Proper vessel sizing during endovascular interventions is crucial to avoid adverse procedural and clinical outcomes. LumenRECON (LR) is a novel, nonimaging, 0.035-inch wire-based technology that uses the physics-based principle of Ohm's law to provide a simple, real-time luminal size while also providing a platform for therapy delivery. This study evaluated the accuracy, reliability, and safety of the LR system in patients presenting for a femoropopliteal artery intervention. This multicenter, prospective pilot study of 24 patients presenting for peripheral intervention compared LR measurements of femoropopliteal artery size to angiographic visual estimation, duplex ultrasound, quantitative angiography, and intravascular ultrasound. The primary effectiveness and safety end point was comparison against core laboratory adjudicated intravascular ultrasound values and major adverse events, respectively. Additional preclinical studies were also performed in vitro and in vivo in swine to determine the accuracy of the LR guidewire system. No intra- or postprocedure device-related adverse events occurred. A balloon or stent was successfully delivered in 12 patients (50%) over the LR wire. Differences in repeatability between successive LR measurements was 2.5±0.40% ( R 2 =0.96) with no significant bias. Differences in measurements of LR to other modalities were 0.5±1.7%, 5.0±1.8%, -1.5±2.0%, and 6.8±3.4% for intravascular ultrasound core laboratory, quantitative angiography, angiographic, and duplex ultrasound, respectively. This study demonstrates that through a physics-based principle, LR provides a real-time, safe, reproducible, and accurate vessel size of the femoropopliteal artery during intervention and can additionally serve as a conduit for therapy delivery over its wire-based platform. © 2018 American Heart Association, Inc.

Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

Energy Technology Data Exchange (ETDEWEB)

Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Liu, Yuan [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Biostatistics and Bioinformatics Shared Resource, Emory University, Atlanta, Georgia (United States); Okwan-Duodu, Derrick [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Flowers, Christopher R. [Winship Cancer Institute, Emory University, Atlanta, Georgia (United States); Department of Medical Oncology, Emory University, Atlanta, Georgia (United States); Khan, Mohammad K., E-mail: drkhurram2000@gmail.com [Department of Radiation Oncology, Emory University, Atlanta, Georgia (United States); Winship Cancer Institute, Emory University, Atlanta, Georgia (United States)

2015-05-01

Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy.

Predictors of Local Recurrence After Rituximab-Based Chemotherapy Alone in Stage III and IV Diffuse Large B-Cell Lymphoma: Guiding Decisions for Consolidative Radiation

International Nuclear Information System (INIS)

Jegadeesh, Naresh; Rajpara, Raj; Esiashvili, Natia; Shi, Zheng; Liu, Yuan; Okwan-Duodu, Derrick; Flowers, Christopher R.; Khan, Mohammad K.

2015-01-01

Purpose: The role of consolidative radiation therapy (RT) for stage III and IV diffuse large B-cell lymphoma (DLBCL) in the era of rituximab is not well defined. There is evidence that some patients with bulky disease may benefit, but patient selection criteria are not well established. We sought to identify a subset of patients who experienced a high local failure rate after receiving rituximab-based chemotherapy alone and hence may benefit from the addition of consolidative RT. Methods and Materials: Two hundred eleven patients with stage III and IV DLBCL treated between August 1999 and January 2012 were reviewed. Of these, 89 had a complete response to systemic therapy including rituximab and received no initial RT. Kaplan-Meier analysis and Cox proportional hazards regression were performed, with local recurrence (LR) as the primary outcome. Results: The median follow-up time was 43.9 months. Fifty percent of patients experienced LR at 5 years. In multivariate analysis, tumor ≥5 cm and stage III disease were associated with increased risk of LR. The 5-year LR-free survival was 47.4% for patients with ≥5-cm lesions versus 74.7% for patients with <5-cm lesions (P=.01). In patients with <5-cm tumors, the maximum standardized uptake value (SUVmax) was ≥15 in all patients with LR. The 5-year LR-free survival was 100% in SUV<15 versus 68.8% in SUV≥15 (P=.10). Conclusions: Advanced-stage DLBCL patients with stage III disease or with disease ≥5 cm appear to be at an increased risk for LR. Patients with <5-cm disease and SUVmax ≥15 may be at higher risk for LR. These patients may benefit from consolidative RT after chemoimmunotherapy

Prevalence of Low Cardiovascular Risk Profile Among Diverse Hispanic/Latino Adults in the United States by Age, Sex, and Level of Acculturation: The Hispanic Community Health Study/Study of Latinos.

Science.gov (United States)

Daviglus, Martha L; Pirzada, Amber; Durazo-Arvizu, Ramon; Chen, Jinsong; Allison, Matthew; Avilés-Santa, Larissa; Cai, Jianwen; González, Hector M; Kaplan, Robert C; Schneiderman, Neil; Sorlie, Paul D; Talavera, Gregory A; Wassertheil-Smoller, Sylvia; Stamler, Jeremiah

2016-08-20

Favorable levels of all readily measurable major cardiovascular disease risk factors (ie, low risk [LR]) are associated with lower risks of cardiovascular disease morbidity and mortality. Data are not available on LR prevalence among Hispanic/Latino adults of diverse ethnic backgrounds. This study aimed to describe the prevalence of a low cardiovascular disease risk profile among Hispanic/Latino adults in the United States and to examine cross-sectional associations of LR with measures of acculturation. The multicenter, prospective, population-based Hispanic Community Health Study/Study of Latinos examined 16 415 men and women aged 18 to 74 years at baseline (2008-2011) with diverse Hispanic/Latino backgrounds. Analyses involved 14 757 adults (mean age 41.3 years; 60.6% women). LR was defined using national guidelines for favorable levels of serum cholesterol, blood pressure, and body mass index and by not having diabetes mellitus and not currently smoking. Age-adjusted LR prevalence was low (8.4% overall; 5.1% for men, 11.2% for women) and varied by background (4.2% in men of Mexican heritage versus 15.0% in women of Cuban heritage). Lower acculturation (assessed using proxy measures) was significantly associated with higher odds of a LR profile among women only: Age-adjusted odds ratios of having LR were 1.64 (95% CI 1.24-2.17) for foreign-born versus US-born women and 1.96 (95% CI 1.49-2.58) for women residing in the United States profile is low. Lower acculturation is associated with higher odds of a LR profile among women but not men. Comprehensive public health strategies are needed to improve the cardiovascular health of US Hispanic/Latino adults. © 2016 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

Energy Technology Data Exchange (ETDEWEB)

Byun, Eui-Baek [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Choi, Han-Gyu [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of); Sung, Nak-Yun [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Byun, Eui-Hong, E-mail: ehbyun80@gmail.com [Department of Microbiology and Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon 301-747 (Korea, Republic of)

2012-10-05

Highlights: Black-Right-Pointing-Pointer Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited MAPKs activation and NF-{kappa}B p65 translocation via 67LR. Black-Right-Pointing-Pointer EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-1{beta}, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor {kappa}B (NF-{kappa}B) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

Serotonin has early, cilia-independent roles in Xenopus left-right patterning

Directory of Open Access Journals (Sweden)

Laura N. Vandenberg

2013-01-01

Consistent left-right (LR patterning of the heart and viscera is a crucial part of normal embryogenesis. Because errors of laterality form a common class of birth defects, it is important to understand the molecular mechanisms and stage at which LR asymmetry is initiated. Frog embryos are a system uniquely suited to analysis of the mechanisms involved in orientation of the LR axis because of the many genetic and pharmacological tools available for use and the fate-map and accessibility of early blastomeres. Two major models exist for the origin of LR asymmetry and both implicate pre-nervous serotonergic signaling. In the first, the charged serotonin molecule is instructive for LR patterning; it is redistributed asymmetrically along the LR axis and signals intracellularly on the right side at cleavage stages. A second model suggests that serotonin is a permissive factor required to specify the dorsal region of the embryo containing chiral cilia that generate asymmetric fluid flow during neurulation, a much later process. We performed theory-neutral experiments designed to distinguish between these models. The results uniformly support a role for serotonin in the cleavage-stage embryo, long before the appearance of cilia, in ventral right blastomeres that do not contribute to the ciliated organ.

Tumor-related markers in histologically normal margins correlate with locally recurrent oral squamous cell carcinoma: a retrospective study.

Science.gov (United States)

Wang, Xinhong; Chen, Si; Chen, Xinming; Zhang, Cuicui; Liang, Xueyi

2016-02-01

Oral squamous cell carcinoma (OSCC) is characterized by a high rate of local recurrence (LR) even when the surgical margins are considered histopathologically 'normal'. The aim of our study was to determine the relationship between early tumor-related markers detected in histologically normal margins (HNM) and LR as well as disease-free survival in OSCC. The loss of heterozygosity (LOH) of markers on 9p21 (D9s1747, RPS6, D9s162) and 17p13 (TP53) and the immunostaining results of the corresponding mutant P53, P14, P15, and P16 proteins were assessed and correlated with LR and disease-free survival in 71 OSCC patients who had HNM. Fifteen of 71 patients with HNM developed LR. The presence of the following molecular markers in surgical margins was significantly correlated with the development of LR: LOH on chromosome 9p21 (D9s1747 + RPS6 + D9s162), any LOH, P16, and P53 (chi-square test, P tumor-related markers in histologically 'normal' resection margins may be a useful method for assessing LR in OSCC patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparison of Prediction Model for Cardiovascular Autonomic Dysfunction Using Artificial Neural Network and Logistic Regression Analysis

Science.gov (United States)

Zeng, Fangfang; Li, Zhongtao; Yu, Xiaoling; Zhou, Linuo

2013-01-01

Background This study aimed to develop the artificial neural network (ANN) and multivariable logistic regression (LR) analyses for prediction modeling of cardiovascular autonomic (CA) dysfunction in the general population, and compare the prediction models using the two approaches. Methods and Materials We analyzed a previous dataset based on a Chinese population sample consisting of 2,092 individuals aged 30–80 years. The prediction models were derived from an exploratory set using ANN and LR analysis, and were tested in the validation set. Performances of these prediction models were then compared. Results Univariate analysis indicated that 14 risk factors showed statistically significant association with the prevalence of CA dysfunction (P<0.05). The mean area under the receiver-operating curve was 0.758 (95% CI 0.724–0.793) for LR and 0.762 (95% CI 0.732–0.793) for ANN analysis, but noninferiority result was found (P<0.001). The similar results were found in comparisons of sensitivity, specificity, and predictive values in the prediction models between the LR and ANN analyses. Conclusion The prediction models for CA dysfunction were developed using ANN and LR. ANN and LR are two effective tools for developing prediction models based on our dataset. PMID:23940593

Subsets of Women With Close or Positive Margins After Breast-Conserving Surgery With High Local Recurrence Risk Despite Breast Plus Boost Radiotherapy

International Nuclear Information System (INIS)

Lupe, Krystine; Truong, Pauline T.; Alexander, Cheryl; Lesperance, Mary; Speers, Caroline; Tyldesley, Scott

2011-01-01

Purpose: (1) To examine the effect of surgical margin status on local recurrence (LR) and survival following breast-conserving therapy; (2) To identify subsets with close or positive margins with high LR risk despite whole breast radiotherapy (RT) plus boost. Methods and Materials: Subjects were 2,264 women with pT1–3, any N, M0 invasive breast cancer, treated with breast-conserving surgery and whole breast ± boost RT. Five-year Kaplan-Meier (KM) LR, breast cancer–specific and overall survival (BCSS and OS) were compared between cohorts with negative (n = 1,980), close (n = 222), and positive (n = 62) margins. LR rates were analyzed according to clinicopathologic characteristics. Multivariable Cox regression modeling and matched analysis of close/positive margin cases and negative margin controls were performed. Results: Median follow-up was 5.2 years. Boost RT was used in 92% of patients with close or positive margins. Five-year KM LR rates in the negative, close and positive margin cohorts were 1.3%, 4.0%, and 5.2%, respectively (p = 0.001). BCSS and OS were similar in the three margin subgroups. In the close/positive margin cohort, LR rates were 10.2% with age 10% despite whole breast plus boost RT. These patients should be considered for more definitive surgery.

Nitric oxide plays a central role in determining lateral root development in tomato.

Science.gov (United States)

Correa-Aragunde, Natalia; Graziano, Magdalena; Lamattina, Lorenzo

2004-04-01

Nitric oxide (NO) is a bioactive molecule that functions in numerous physiological processes in plants, most of them involving cross-talk with traditional phytohormones. Auxin is the main hormone that regulates root system architecture. In this communication we report that NO promotes lateral root (LR) development, an auxin-dependent process. Application of the NO donor sodium nitroprusside (SNP) to tomato ( Lycopersicon esculentum Mill.) seedlings induced LR emergence and elongation in a dose-dependent manner, while primary root (PR) growth was diminished. The effect is specific for NO since the NO scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (CPTIO) blocked the action of SNP. Depletion of endogenous NO with CPTIO resulted in the complete abolition of LR emergence and a 40% increase in PR length, confirming a physiological role for NO in the regulation of root system growth and development. Detection of endogenous NO by the specific probe 4,5-diaminofluorescein diacetate (DAF-2 DA) revealed that the NO signal was specifically located in LR primordia during all stages of their development. In another set of experiments, SNP was able to promote LR development in auxin-depleted seedlings treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). Moreover, it was found that LR formation induced by the synthetic auxin 1-naphthylacetic acid (NAA) was prevented by CPTIO in a dose-dependent manner. All together, these results suggest a novel role for NO in the regulation of LR development, probably operating in the auxin signaling transduction pathway.

Hypolipidemic Effects and Safety of Lactobacillus Reuteri 263 in a Hamster Model of Hyperlipidemia

Directory of Open Access Journals (Sweden)

Wen-Ching Huang

2015-05-01

Full Text Available We aimed to verify the beneficial effects of probiotic strain Lactobacillus reuteri 263 (Lr263 on hypolipidemic action in hamsters with hyperlipidemia induced by a 0.2% cholesterol and 10% lard diet (i.e., high-cholesterol diet (HCD. Male Golden Syrian hamsters were randomly divided into two groups: normal (n = 8, standard diet (control, and experimental (n = 32, a HCD. After a two-week induction followed by a six-week supplementation with Lr263, the 32 hyperlipidemic hamsters were divided into four groups (n = 8 per group to receive vehicle or Lr263 by oral gavage at 2.1, 4.2, or 10.5 × 109 cells/kg/day for 6 weeks, designated the HCD, 1X, 2X and 5X groups, respectively. The efficacy and safety of Lr263 supplementation were evaluated by lipid profiles of serum, liver and feces and by clinical biochemistry and histopathology. HCD significantly increased serum levels of total cholesterol (TC, triacylglycerol (TG cholesterol, high-density lipoprotein cholesterol (HDL-C, and low-density lipoprotein cholesterol (LDL-C, LDL-C/HDL-C ratio, hepatic and fetal TC and TG levels, and degree of fatty liver as compared with controls. Lr263 supplementation dose dependently increased serum HDL-C level and decreased serum TC, TG, LDL-C levels, LDL-C/HDL-C ratio, hepatic TC and TG levels, and fecal TG level. In addition, Lr263 supplementation had few subchronic toxic effects. Lr263 could be a potential agent with a hypolipidemic pharmacological effect.

Patterns of Local Recurrence and Dose Fractionation of Adjuvant Radiation Therapy in 462 Patients With Soft Tissue Sarcoma of Extremity and Trunk Wall

International Nuclear Information System (INIS)

Jebsen, Nina L.; Engellau, Jacob; Engström, Katarina; Bauer, Henrik C.; Monge, Odd R.; Muren, Ludvig P.; Eide, Geir E.; Trovik, Clement S.; Bruland, Øyvind S.

2013-01-01

Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma

Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut.

Science.gov (United States)

Essner, Jeffrey J; Amack, Jeffrey D; Nyholm, Molly K; Harris, Erin B; Yost, H Joseph

2005-03-01

Monocilia have been proposed to establish the left-right (LR) body axis in vertebrate embryos by creating a directional fluid flow that triggers asymmetric gene expression. In zebrafish, dorsal forerunner cells (DFCs) express a conserved ciliary dynein gene (left-right dynein-related1, lrdr1) and form a ciliated epithelium inside a fluid-filled organ called Kupffer's vesicle (KV). Here, videomicroscopy demonstrates that cilia inside KV are motile and create a directional fluid flow just prior to the onset of asymmetric gene expression in lateral cells. Laser ablation of DFCs and surgical disruption of KV provide direct evidence that ciliated KV cells are required during early somitogenesis for subsequent LR patterning in the brain, heart and gut. Antisense morpholinos against lrdr1 disrupt KV fluid flow and perturb LR development. Furthermore, lrdr1 morpholinos targeted to DFC/KV cells demonstrate that Lrdr1 functions in these ciliated cells to control LR patterning. This provides the first direct evidence, in any vertebrate, that impairing cilia function in derivatives of the dorsal organizer, and not in other cells that express ciliogenic genes, alters LR development. Finally, genetic analysis reveals novel roles for the T-box transcription factor no tail and the Nodal signaling pathway as upstream regulators of lrdr1 expression and KV morphogenesis. We propose that KV is a transient embryonic 'organ of asymmetry' that directs LR development by establishing a directional fluid flow. These results suggest that cilia are an essential component of a conserved mechanism that controls the transition from bilateral symmetry to LR asymmetry in vertebrates.

Patterns of Local Recurrence and Dose Fractionation of Adjuvant Radiation Therapy in 462 Patients With Soft Tissue Sarcoma of Extremity and Trunk Wall

Energy Technology Data Exchange (ETDEWEB)

Jebsen, Nina L., E-mail: nina.louise.jebsen@helse-bergen.no [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Engellau, Jacob [Department of Oncology, Skåne University Hospital, Lund (Sweden); Engström, Katarina [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Bauer, Henrik C. [Department of Molecular Medicine and Surgery, Section for Orthopaedics and Sports Medicine, Karolinska University Hospital, Karolinska Institute, Stockholm (Sweden); Monge, Odd R. [Department of Oncology, Haukeland University Hospital, Bergen (Norway); Muren, Ludvig P. [Department of Physics and Technology, University of Bergen, Bergen (Norway); Department of Medical Physics, Aarhus University and Aarhus University Hospital, Aarhus (Denmark); Eide, Geir E. [Centre for Clinical Research, Haukeland University Hospital, Bergen (Norway); Department of Public Health and Primary Health Care, University of Bergen, Bergen (Norway); Trovik, Clement S. [Department of Clinical Medicine, Faculty of Medicine and Dentistry, University of Bergen, Bergen (Norway); Department of Oncology, Haukeland University Hospital, Bergen (Norway); Bruland, Øyvind S. [Department of Oncology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway)

2013-08-01

Purpose: To study the impact of dose fractionation of adjuvant radiation therapy (RT) on local recurrence (LR) and the relation of LR to radiation fields. Methods and Materials: LR rates were analyzed in 462 adult patients with soft tissue sarcoma who underwent surgical excision and adjuvant RT at five Scandinavian sarcoma centers from 1998 to 2009. Medical records were reviewed for dose fractionation parameters and to determine the location of the LR relative to the radiation portals. Results: Fifty-five of 462 patients developed a LR (11.9%). Negative prognostic factors included intralesional surgical margin (hazard ratio [HR]: 7.83, 95% confidence interval [CI]: 3.08-20.0), high malignancy grade (HR: 5.82, 95% CI: 1.31-25.8), age at diagnosis (HR per 10 years: 1.27, 95% CI: 1.03-1.56), and malignant peripheral nerve sheath tumor histological subtype (HR: 6.66, 95% CI: 2.56-17.3). RT dose was tailored to margin status. No correlation between RT dose and LR rate was found in multiple Cox regression analysis. The majority (65%) of LRs occurred within the primary RT volume. Conclusions: No significant dose–response effect of adjuvant RT was demonstrated. Interestingly, patients given 45-Gy accelerated RT (1.8 Gy twice daily/2.5 weeks) had the best local outcome. A total dose of 50 Gy in 25 fractions seemed adequate following wide margin surgery. The risk of LR was associated with histopathologic subtype, which should be included in the treatment algorithm of adjuvant RT in soft tissue sarcoma.

Application of Long-Range Surface Plasmon Resonance for ABO Blood Typing

Directory of Open Access Journals (Sweden)

Wanida Tangkawsakul

2016-01-01

Full Text Available In this study, we demonstrate a long-range surface plasmon resonance (LR-SPR biosensor for the detection of whole cell by captured antigens A and B on the surface of red blood cells (RBCs as a model. The LR-SPR sensor chip consists of high-refractive index glass, a Cytop film layer, and a thin gold (Au film, which makes the evanescent field intensity and the penetration depth longer than conventional SPR. Therefore, the LR-SPR biosensor has improved capability for detecting large analytes, such as RBCs. The antibodies specific to blood group A and group B (Anti-A and Anti-B are covalently immobilized on a grafting self-assembled monolayer (SAM/Au surface on the biosensor. For blood typing, RBC samples can be detected by the LR-SPR biosensor through a change in the refractive index. We determined that the results of blood typing using the LR-SPR biosensor are consistent with the results obtained from the agglutination test. We obtained the lowest detection limits of 1.58 × 105 cells/ml for RBC-A and 3.83 × 105 cells/ml for RBC-B, indicating that the LR-SPR chip has a higher sensitivity than conventional SPR biosensors (3.3 × 108 cells/ml. The surface of the biosensor can be efficiently regenerated using 20 mM NaOH. In summary, as the LR-SPR technique is sensitive and has a simple experimental setup, it can easily be applied for ABO blood group typing.

Clinical and laboratory assessment of dehydration severity in children with acute gastroenteritis.

Science.gov (United States)

Parkin, Patricia C; Macarthur, Colin; Khambalia, Amina; Goldman, Ran D; Friedman, Jeremy N

2010-03-01

To evaluate clinical and laboratory assessment of dehydration severity in children, 1 to 36 months, with acute gastroenteritis. Clinical and laboratory measures and weight change following rehydration were collected for enrolled children. Pediatric emergency department. Likelihood ratio (LR+) and 95% confidence interval (CI): for a clinical score of 0, the LR+ was 2.2 (95% CI = 0.9-5.3); for a clinical score of 1 to 4, the LR+ was 1.3 (95% CI = 0.90-1.74); for a clinical score of 5 to 8, the LR+ was 5.2 (95% CI = 2.2-12.8); for a venous pH Dehydration Scale and laboratory measures into clinical decision-making algorithms to assess dehydration severity in children with acute gastroenteritis.

A Novel Ensemble Learning Approach for Corporate Financial Distress Forecasting in Fashion and Textiles Supply Chains

Directory of Open Access Journals (Sweden)

Gang Xie

2013-01-01

Full Text Available This paper proposes a novel ensemble learning approach based on logistic regression (LR and artificial intelligence tool, that is, support vector machine (SVM and back-propagation neural networks (BPNN, for corporate financial distress forecasting in fashion and textiles supply chains. Firstly, related concepts of LR, SVM, and BPNN are introduced. Then, the forecasting results by LR are introduced into the SVM and BPNN techniques which can recognize the forecasting errors in fitness by LR. Moreover, empirical analysis of Chinese listed companies in fashion and textile sector is implemented for the comparison of the methods, and some related issues are discussed. The results suggest that the proposed novel ensemble learning approach can achieve higher forecasting performance than those of individual models.

Evaluasi Sifat Morpologi dan Teknologi Pengolahan pada Gabah dan Beras

OpenAIRE

Santosa, Susilo

2017-01-01

Penelitian evaluasi dan beras terhadap mutu dan jumlah hasil ditekankan pada lr36 , lr38 dan Cisadane. Penelitian dilakukan di laboratorium Balai Penelitian Tanaman Pangan Karawang. Hasil studi menunjukkan diantara ketiga varitas, Cisadane mempunyai ukuran dimensi butiran yang lebih besar daripada Ir36 dan Ir38. Di antara ketiga varitas, persen kulit sekam yang tertinggi didapat 23,57 % pada lr38 diikuti 22,32% pada Ir36 dan 19,5% pada Cisadane. Persen beras pecah kulit tertinggi diperoleh pa...

Evaluasi Sifat Morpologi Dan Teknologi Pengolahan Pada Gabah Dan Beras

OpenAIRE

Santosa, Susilo

1982-01-01

Penelitian evaluasi dan beras terhadap mutu dan jumlah hasil ditekankan pada lr36 , lr38 dan Cisadane. Penelitian dilakukan di laboratorium Balai Penelitian Tanaman Pangan Karawang. Hasil studi menunjukkan diantara ketiga varitas, Cisadane mempunyai ukuran dimensi butiran yang lebih besar daripada Ir36 dan Ir38. Di antara ketiga varitas, persen kulit sekam yang tertinggi didapat 23,57 % pada lr38 diikuti 22,32% pada Ir36 dan 19,5% pada Cisadane. Persen beras pecah kulit tertinggi diperoleh pa...

Anatomical and Physiological Characteristics of the Ferret Lateral Rectus Muscle and Abducena Nucleus

Science.gov (United States)

2007-01-25

from the ferret LR Slow Resistant group is larger than the typically powerful Fast Fatigable motor units in the cat. Whole Muscle Contractile...623-632, 1990. 21. HESS A and PILAR G. SLOW FIBRES IN THE EXTRAOCULAR MUSCLES OF THE CAT. J Physiol 169: 780-798, 1963. 22. Jacoby J, Chiarandini DJ...were split between the LR and retractor bulbi (RB) muscle slips. In addition to individual motor units, the whole LR muscle was evaluated for twitch

Genetic and Phenotypic Analysis of Lateral Root Development in Arabidopsis thaliana.

Science.gov (United States)

Napsucialy-Mendivil, Selene; Dubrovsky, Joseph G

2018-01-01

Root system formation to a great extent depends on lateral root (LR) formation. In Arabidopsis thaliana, LRs are initiated within a parent root in pericycle that is an external tissue of the stele. LR initiation takes place in a strictly acropetal pattern, whereas posterior lateral root primordium (LRP) formation is asynchronous. In this chapter, we focus on methods of genetic and phenotypic analysis of LR initiation, LRP morphogenesis, and LR emergence in Arabidopsis. We provide details on how to make cleared root preparations and how to identify the LRP stages. We also pay attention to the categorization of the LRP developmental stages and their variations and to the normalization of the number of LRs and LRPs formed, per length of the primary root, and per number of cells produced within a root. Hormonal misbalances and mutations affect LRP morphogenesis significantly, and the evaluation of LRP abnormalities is addressed as well. Finally, we deal with various molecular markers that can be used for genetic and phenotypic analyses of LR development.

Downregulation of the non-integrin laminin receptor reduces cellular viability by inducing apoptosis in lung and cervical cancer cells.

Directory of Open Access Journals (Sweden)

Kiashanee Moodley

Full Text Available The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR, is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and angiogenesis. This study investigated whether LRP/LR is implicated in the maintenance of cellular viability in lung and cervical cancer cell lines. Here we show a significant reduction in cellular viability in the aforementioned cell lines as a result of the siRNA-mediated downregulation of LRP. This reduction in cellular viability is due to increased apoptotic processes, reflected by the loss of nuclear integrity and the significant increase in the activity of caspase-3. These results indicate that LRP/LR is involved in the maintenance of cellular viability in tumorigenic lung and cervix uteri cells through the blockage of apoptosis. Knockdown of LRP/LR by siRNA might represent an alternative therapeutic strategy for the treatment of lung and cervical cancer.

To Set Up a Logistic Regression Prediction Model for Hepatotoxicity of Chinese Herbal Medicines Based on Traditional Chinese Medicine Theory

Science.gov (United States)

Liu, Hongjie; Li, Tianhao; Zhan, Sha; Pan, Meilan; Ma, Zhiguo; Li, Chenghua

2016-01-01

Aims. To establish a logistic regression (LR) prediction model for hepatotoxicity of Chinese herbal medicines (HMs) based on traditional Chinese medicine (TCM) theory and to provide a statistical basis for predicting hepatotoxicity of HMs. Methods. The correlations of hepatotoxic and nonhepatotoxic Chinese HMs with four properties, five flavors, and channel tropism were analyzed with chi-square test for two-way unordered categorical data. LR prediction model was established and the accuracy of the prediction by this model was evaluated. Results. The hepatotoxic and nonhepatotoxic Chinese HMs were related with four properties (p 0.05). There were totally 12 variables from four properties and five flavors for the LR. Four variables, warm and neutral of the four properties and pungent and salty of five flavors, were selected to establish the LR prediction model, with the cutoff value being 0.204. Conclusions. Warm and neutral of the four properties and pungent and salty of five flavors were the variables to affect the hepatotoxicity. Based on such results, the established LR prediction model had some predictive power for hepatotoxicity of Chinese HMs. PMID:27656240

Drug: D08821 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available D08821 Drug Concentrated human red blood cells; Red cells concentrates -leukocytes... reduced (RCC-LR) (TN); Irradiated red cells concentrates -leukocytes reduced (Ir-RCC-LR) (TN) ... PubChem: 96025504 ...

Diagnosing clinically significant dehydration in children with acute gastroenteritis using noninvasive methods: a meta-analysis.

Science.gov (United States)

Freedman, Stephen B; Vandermeer, Ben; Milne, Andrea; Hartling, Lisa

2015-04-01

To determine the most accurate, noninvasive method of assessing dehydration. The following data sources were searched: electronic databases, gray literature, scientific meetings, reference lists, and authors of unpublished studies. Eligible studies were comparative outpatient evaluations that used an accepted reference standard and were conducted in developed countries in children aged Dehydration Scale (CDS), the "Gorelick" score, and unstructured physician assessment were evaluated in 3, 2, and 5 studies, respectively. Bedside ultrasound, capillary digital videography, and urinary measurements were each evaluated in one study. The CDS had a positive likelihood ratio (LR) range of 1.87-11.79 and a negative LR range of 0.30-0.71 to predict 6% dehydration. When combined with the 4-item Gorelick Score, the positive LR was 1.93 (95% CI 1.07-3.49) and negative LR was of 0.40 (95% CI 0.24-0.68). Unstructured dehydration assessment had a pooled positive LR of 2.13 (95% CI 1.33-3.44) and negative LR of 0.48 (95% CI 0.28-0.82) to detect ≥ 5% dehydration. Overall, the clinical scales evaluated provide some improved diagnostic accuracy. However, test characteristics indicate that their ability to identify children both with and without dehydration is suboptimal. Current evidence does not support the routine use of ultrasound or urinalysis to determine dehydration severity. Copyright © 2015 Elsevier Inc. All rights reserved.

Noninvasive Assessment of Advanced Fibrosis Based on Hepatic Volume in Patients with Nonalcoholic Fatty Liver Disease.

Science.gov (United States)

Hayashi, Tatsuya; Saitoh, Satoshi; Fukuzawa, Kei; Tsuji, Yoshinori; Takahashi, Junji; Kawamura, Yusuke; Akuta, Norio; Kobayashi, Masahiro; Ikeda, Kenji; Fujii, Takeshi; Miyati, Tosiaki; Kumada, Hiromitsu

2017-09-15

Noninvasive liver fibrosis evaluation was performed in patients with nonalcoholic fatty liver disease (NAFLD). We used a quantitative method based on the hepatic volume acquired from gadoxetate disodium-enhanced (Gd-EOB-DTPA-enhanced) magnetic resonance imaging (MRI) for diagnosing advanced fibrosis in patients with NAFLD. A total of 130 patients who were diagnosed with NAFLD and underwent Gd-EOB-DTPA-enhanced MRI were retrospectively included. Histological data were available for 118 patients. Hepatic volumetric parameters, including the left hepatic lobe to right hepatic lobe volume ratio (L/R ratio), were measured. The usefulness of the L/R ratio for diagnosing fibrosis ≥F3-4 and F4 was assessed using the area under the receiver operating characteristic (AUROC) curve. Multiple regression analysis was performed to identify variables (age, body mass index, serum fibrosis markers, and histological features) that were associated with the L/R ratio. The L/R ratio demonstrated good performance in differentiating advanced fibrosis (AUROC, 0.80; 95% confidence interval, 0.72 to 0.88) from cirrhosis (AUROC, 0.87; 95% confidence interval, 0.75 to 0.99). Multiple regression analysis showed that only fibrosis was significantly associated with the L/R ratio (coefficient, 0.121; p<0.0001). The L/R ratio, which is not influenced by pathological parameters other than fibrosis, is useful for diagnosing cirrhosis in patients with NAFLD.

Social defeat alters the acquisition of cocaine self-administration in rats: role of individual differences in cocaine-taking behavior.

Science.gov (United States)

Kabbaj, M; Norton, C S; Kollack-Walker, S; Watson, S J; Robinson, T E; Akil, H

2001-12-01

It is known that social defeat can modulate cocaine self-administration. However, it is unclear whether this psychosocial stressor affects drug-taking behavior to the same extent across all individual animals, particularly those with differing propensities to self-administer psychostimulants. This study examined the effect of social defeat on cocaine self-administration in animals that differ in novelty-seeking behavior that predicts differences in drug self-administration. Male Sprague-Dawley rats were first classified into high-responder (HR) and low-responder (LR) groups. HR and LR rats were categorized based on their locomotor activity in a novel environment, with HR rats exhibiting higher locomotor activity than LR rats. Then, male rats were exposed on four occasions to an aggressive Long Evans male rat over the course of 4 days. Control rats were not exposed to the social defeat. All rats were subsequently implanted with jugular catheters and 3 days later placed into the self-administration box to study the acquisition of cocaine self-administration (0.25 mg per infusion). HR non-defeated animals self-administered more cocaine than the LR non-defeated animals. Following social defeat, the acquisition of cocaine self-administration is significantly delayed in HR rats and enhanced in LR rats. CONCLUSION The unique patterns of responsiveness in the HR and LR animals suggest that social defeat plays a role of equalizer of individual differences in drug-taking behavior.

Simultaneous Microcystis Algicidal and Microcystin Degrading Capability by a Single Acinetobacter Bacterial Strain.

Science.gov (United States)

Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang

2016-11-01

Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10 3 to 1 × 10 7 cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.

Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

Science.gov (United States)

Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

2017-12-01

Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

Acute Exposure to Microcystin-Producing Cyanobacterium Microcystis aeruginosa Alters Adult Zebrafish (Danio rerio Swimming Performance Parameters

Directory of Open Access Journals (Sweden)

Luiza Wilges Kist

2011-01-01

Full Text Available Microcystins (MCs are toxins produced by cyanobacteria (blue-green algae, primarily Microcystis aeruginosa, forming water blooms worldwide. When an organism is exposed to environmental perturbations, alterations in normal behavioral patterns occur. Behavioral repertoire represents the consequence of a diversity of physiological and biochemical alterations. In this study, we assessed behavioral patterns and whole-body cortisol levels of adult zebrafish (Danio rerio exposed to cell culture of the microcystin-producing cyanobacterium M. aeruginosa (MC-LR, strain RST9501. MC-LR exposure (100 μg/L decreased by 63% the distance traveled and increased threefold the immobility time when compared to the control group. Interestingly, no significant alterations in the number of line crossings were found at the same MC-LR concentration and time of exposure. When animals were exposed to 50 and 100 μg/L, MC-LR promoted a significant increase (around 93% in the time spent in the bottom portion of the tank, suggesting an anxiogenic effect. The results also showed that none of the MC-LR concentrations tested promoted significant alterations in absolute turn angle, path efficiency, social behavior, or whole-body cortisol level. These findings indicate that behavior is susceptible to MC-LR exposure and provide evidence for a better understanding of the ecological consequences of toxic algal blooms.

Evidence Based Medicine; Positive and Negative Likelihood Ratios of Diagnostic Tests

Directory of Open Access Journals (Sweden)

Alireza Baratloo

2015-10-01

Full Text Available In the previous two parts of educational manuscript series in Emergency, we explained some screening characteristics of diagnostic tests including accuracy, sensitivity, specificity, and positive and negative predictive values. In the 3rd  part we aimed to explain positive and negative likelihood ratio (LR as one of the most reliable performance measures of a diagnostic test. To better understand this characteristic of a test, it is first necessary to fully understand the concept of sensitivity and specificity. So we strongly advise you to review the 1st part of this series again. In short, the likelihood ratios are about the percentage of people with and without a disease but having the same test result. The prevalence of a disease can directly influence screening characteristics of a diagnostic test, especially its sensitivity and specificity. Trying to eliminate this effect, LR was developed. Pre-test probability of a disease multiplied by positive or negative LR can estimate post-test probability. Therefore, LR is the most important characteristic of a test to rule out or rule in a diagnosis. A positive likelihood ratio > 1 means higher probability of the disease to be present in a patient with a positive test. The further from 1, either higher or lower, the stronger the evidence to rule in or rule out the disease, respectively. It is obvious that tests with LR close to one are less practical. On the other hand, LR further from one will have more value for application in medicine. Usually tests with 0.1 < LR > 10 are considered suitable for implication in routine practice.

Causes and outcome of late referral of children who develop end-stage kidney disease.

Science.gov (United States)

Kennedy, Sean E; Bailey, Rohan; Kainer, Gad

2012-03-01

This study aims to characterise the timing of referral to a paediatric nephrology unit of children who develop end-stage kidney disease (ESKD). This study also aims to determine whether late referral (LR) influences outcomes and to explore factors that may lead to LR. A retrospective case review of all incident patients with ESKD who received renal replacement therapy (RRT) at a single paediatric centre. Time between referral to a paediatric nephrologist and commencement of RRT, demographic and clinical data were collated. Estimated glomerular filtration rate (eGFR) at referral was calculated using height and creatinine. LR was defined as having an eGFR ≤ 30 mL/min/1.73 m(2) when first seen by a paediatric nephrologist. RRT was initiated for 74 patients Children referred before age 1 year (41%) had a more prolonged course before ESKD. Median (interquartile range) eGFR at referral of children > 1 year was 27.2 (9.0-52.0) mL/min/1.73 m(2) . Twenty-two (55%) of these children were referred late (LR) with an eGFR ≤ 30 mL/min/1.73 m(2) . LR patients were more likely to have glomerulonephritis or haemolytic uraemic syndrome and to live in a remote or outer regional area. LR patients had higher urea, lower haemoglobin and were more likely to receive haemodialysis via a vascular catheter. A significant proportion of children who develop ESKD are referred late to nephrology units with potentially preventable complications. Aetiology of renal disease and geographic isolation contribute to LR. © 2011 The Authors. Journal of Paediatrics and Child Health © 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

A population-based validation study of the DCIS Score predicting recurrence risk in individuals treated by breast-conserving surgery alone.

Science.gov (United States)

Rakovitch, Eileen; Nofech-Mozes, Sharon; Hanna, Wedad; Baehner, Frederick L; Saskin, Refik; Butler, Steven M; Tuck, Alan; Sengupta, Sandip; Elavathil, Leela; Jani, Prashant A; Bonin, Michel; Chang, Martin C; Robertson, Susan J; Slodkowska, Elzbieta; Fong, Cindy; Anderson, Joseph M; Jamshidian, Farid; Miller, Dave P; Cherbavaz, Diana B; Shak, Steven; Paszat, Lawrence

2015-07-01

Validated biomarkers are needed to improve risk assessment and treatment decision-making for women with ductal carcinoma in situ (DCIS) of the breast. The Oncotype DX DCIS Score (DS) was shown to predict the risk of local recurrence (LR) in individuals with low-risk DCIS treated by breast-conserving surgery (BCS) alone. Our objective was to confirm these results in a larger population-based cohort of individuals. We used an established population-based cohort of individuals diagnosed with DCIS treated with BCS alone from 1994 to 2003 with validation of treatment and outcomes. Central pathology assessment excluded cases with invasive cancer, DCIS < 2 mm or positive margins. Cox model was used to determine the relationship between independent covariates, the DS (hazard ratio (HR)/50 Cp units (U)) and LR. Tumor blocks were collected for 828 patients. Final evaluable population includes 718 cases, of whom 571 had negative margins. Median follow-up was 9.6 years. 100 cases developed LR following BCS alone (DCIS, N = 44; invasive, N = 57). In the primary pre-specified analysis, the DS was associated with any LR (DCIS or invasive) in ER+ patients (HR 2.26; P < 0.001) and in all patients regardless of ER status (HR 2.15; P < 0.001). DCIS Score provided independent information on LR risk beyond clinical and pathologic variables including size, age, grade, necrosis, multifocality, and subtype (adjusted HR 1.68; P = 0.02). DCIS was associated with invasive LR (HR 1.78; P = 0.04) and DCIS LR (HR 2.43; P = 0.005). The DCIS Score independently predicts and quantifies individualized recurrence risk in a population of patients with pure DCIS treated by BCS alone.

Intermittent clamping of the hepatic pedicle in simultaneous ultrasonography-guided liver resection and colorectal resection with intestinal anastomosis: is it safe?

Science.gov (United States)

De Raffele, Emilio; Mirarchi, Mariateresa; Vaccari, Samuele; Cuicchi, Dajana; Lecce, Ferdinando; Dalla Via, Barbara; Cola, Bruno

2014-12-01

In patients with colorectal cancer (CRC) and synchronous colorectal liver metastases (CRLM) potentially candidates to combined liver (LR) and colorectal resection (CRR), the extent of LR and the need of hepatic pedicle clamping (HPC) in selected cases are considered risk factors for the outcome of the intestinal anastomosis. This study aimed to determine whether intermittent HPC is predictive of anastomotic leakage (AL) and has an adverse effect on the clinical outcome in patients undergoing combined restorative CRR and LR. One hundred six LR have been performed for CRLM in our unit from July 2005. Patients who received CRR with anastomosis and simultaneous intraoperative ultrasonography (IOUS)-guided LR/ablation for resectable CRLM were included in this study. CRR was performed first. Intermittent HPC was decided at the discretion of the liver surgeon. The perioperative outcome was evaluated according to occurrence of AL and overall postoperative morbidity and mortality. Thirty-eight patients underwent simultaneous IOUS-guided LR/ablation and CRR with intestinal anastomosis; 19 underwent intermittent HPC (group ICHPY) while 19 did not (group ICHPN); the mean ± SD (range) duration of clamping in group ICHPY was 58.6 ± 32.2 (10.0-125.0) min. Postoperative results were similar between groups. One asymptomatic AL occurred in group ICHPY (5.2 %). Major postoperative complications were none in group ICHPY and one (5.2 %) in group ICHPN, respectively. One patient in group ICHPY died postoperatively (5.2 %). This study suggests that intermittent HPC during LR is not predictive of AL and has no adverse effect on the overall clinical outcome in patients undergoing combined restorative colorectal surgery and hepatectomy for advanced CRC.

Novel Nitroxide Resuscitation Strategies in Experimental Traumatic Brain Injury

Science.gov (United States)

2010-03-01

conflicting financial interests exist. References Barron, K.D., Dentinger, M.P., Kimelberg, H.K., Nelson, L.R., Bourke , R.S., Keegan, S., Mankes, R...fects of anesthetics on splanchnic arterial blood flow during hemorrhagic shock. J. Appl. Physiol. 76, 2304–2309. Nelson, L.R., Bourke , R.S., Popp...model, in: Neural Trauma. A.J. Popp, R.S. Bourke , L.R. Nelson, H.K. Kimelberg (eds), Raven Press: New York, pps. 297–311. Nelson, T.J., Wall, D.B

Emergence of ultrafast sparsely synchronized rhythms and their responses to external stimuli in an inhomogeneous small-world complex neuronal network.

Science.gov (United States)

Kim, Sang-Yoon; Lim, Woochang

2017-09-01

We consider an inhomogeneous small-world network (SWN) composed of inhibitory short-range (SR) and long-range (LR) interneurons, and investigate the effect of network architecture on emergence of synchronized brain rhythms by varying the fraction of LR interneurons p long . The betweenness centralities of the LR and SR interneurons (characterizing the potentiality in controlling communication between other interneurons) are distinctly different. Hence, in view of the betweenness, SWNs we consider are inhomogeneous, unlike the "canonical" Watts-Strogatz SWN with nearly the same betweenness centralities. For small p long , the load of communication traffic is much concentrated on a few LR interneurons. However, as p long is increased, the number of LR connections (coming from LR interneurons) increases, and then the load of communication traffic is less concentrated on LR interneurons, which leads to better efficiency of global communication between interneurons. Sparsely synchronized rhythms are thus found to emerge when passing a small critical value p long (c) (≃0.16). The population frequency of the sparsely synchronized rhythm is ultrafast (higher than 100 Hz), while the mean firing rate of individual interneurons is much lower (∼30 Hz) due to stochastic and intermittent neural discharges. These dynamical behaviors in the inhomogeneous SWN are also compared with those in the homogeneous Watts-Strogatz SWN, in connection with their network topologies. Particularly, we note that the main difference between the two types of SWNs lies in the distribution of betweenness centralities. Unlike the case of the Watts-Strogatz SWN, dynamical responses to external stimuli vary depending on the type of stimulated interneurons in the inhomogeneous SWN. We consider two cases of external time-periodic stimuli applied to sub-populations of the LR and SR interneurons, respectively. Dynamical responses (such as synchronization suppression and enhancement) to these two cases of

Integration of a Radiosensitivity Molecular Signature Into the Assessment of Local Recurrence Risk in Breast Cancer

International Nuclear Information System (INIS)

Torres-Roca, Javier F.; Fulp, William J.; Caudell, Jimmy J.; Servant, Nicolas; Bollet, Marc A.; Vijver, Marc van de; Naghavi, Arash O.; Harris, Eleanor E.; Eschrich, Steven A.

2015-01-01

Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and

Estimating negative likelihood ratio confidence when test sensitivity is 100%: A bootstrapping approach.

Science.gov (United States)

Marill, Keith A; Chang, Yuchiao; Wong, Kim F; Friedman, Ari B

2017-08-01

Objectives Assessing high-sensitivity tests for mortal illness is crucial in emergency and critical care medicine. Estimating the 95% confidence interval (CI) of the likelihood ratio (LR) can be challenging when sample sensitivity is 100%. We aimed to develop, compare, and automate a bootstrapping method to estimate the negative LR CI when sample sensitivity is 100%. Methods The lowest population sensitivity that is most likely to yield sample sensitivity 100% is located using the binomial distribution. Random binomial samples generated using this population sensitivity are then used in the LR bootstrap. A free R program, "bootLR," automates the process. Extensive simulations were performed to determine how often the LR bootstrap and comparator method 95% CIs cover the true population negative LR value. Finally, the 95% CI was compared for theoretical sample sizes and sensitivities approaching and including 100% using: (1) a technique of individual extremes, (2) SAS software based on the technique of Gart and Nam, (3) the Score CI (as implemented in the StatXact, SAS, and R PropCI package), and (4) the bootstrapping technique. Results The bootstrapping approach demonstrates appropriate coverage of the nominal 95% CI over a spectrum of populations and sample sizes. Considering a study of sample size 200 with 100 patients with disease, and specificity 60%, the lowest population sensitivity with median sample sensitivity 100% is 99.31%. When all 100 patients with disease test positive, the negative LR 95% CIs are: individual extremes technique (0,0.073), StatXact (0,0.064), SAS Score method (0,0.057), R PropCI (0,0.062), and bootstrap (0,0.048). Similar trends were observed for other sample sizes. Conclusions When study samples demonstrate 100% sensitivity, available methods may yield inappropriately wide negative LR CIs. An alternative bootstrapping approach and accompanying free open-source R package were developed to yield realistic estimates easily. This

Integration of a Radiosensitivity Molecular Signature Into the Assessment of Local Recurrence Risk in Breast Cancer

Energy Technology Data Exchange (ETDEWEB)

Torres-Roca, Javier F., E-mail: javier.torresroca@moffitt.org [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Department of Chemical Biology and Molecular Medicine, Moffitt Cancer Center, Tampa, Florida (United States); Fulp, William J. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States); Department of Biostatistics, Moffitt Cancer Center, Tampa, Florida (United States); Caudell, Jimmy J. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Servant, Nicolas [Institut Curie, INSERM U900, Paris (France); Mines ParisTech, Paris (France); Bollet, Marc A. [Institut Curie, INSERM U900, Paris (France); Vijver, Marc van de [Netherlands Cancer Institute, Amsterdam (Netherlands); Naghavi, Arash O. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Harris, Eleanor E. [East Carolina University, Greensborough, North Carolina (United States); Eschrich, Steven A. [Department of Bioinformatics, Moffitt Cancer Center, Tampa, Florida (United States)

2015-11-01

Purpose: Recently, we developed radiosensitivity (RSI), a clinically validated molecular signature that estimates tumor radiosensitivity. In the present study, we tested whether integrating RSI with the molecular subtype refines the classification of local recurrence (LR) risk in breast cancer. Methods and Materials: RSI and molecular subtype were evaluated in 343 patients treated with breast-conserving therapy that included whole-breast radiation therapy with or without a tumor bed boost (dose range 45-72 Gy). The follow-up period for patients without recurrence was 10 years. The clinical endpoint was LR-free survival. Results: Although RSI did not uniformly predict for LR across the entire cohort, combining RSI and the molecular subtype identified a subpopulation with an increased risk of LR: triple negative (TN) and radioresistant (reference TN-radioresistant, hazard ratio [HR] 0.37, 95% confidence interval [CI] 0.15-0.92, P=.02). TN patients who were RSI-sensitive/intermediate had LR rates similar to those of luminal (LUM) patients (HR 0.86, 95% CI 0.47-1.57, P=.63). On multivariate analysis, combined RSI and molecular subtype (P=.004) and age (P=.001) were the most significant predictors of LR. In contrast, integrating RSI into the LUM subtype did not identify additional risk groups. We hypothesized that radiation dose escalation was affecting radioresistance in the LUM subtype and serving as a confounder. An increased radiation dose decreased LR only in the luminal-resistant (LUM-R) subset (HR 0.23, 95% CI 0.05-0.98, P=.03). On multivariate analysis, the radiation dose was an independent variable only in the LUMA/B-RR subset (HR 0.025, 95% CI 0.001-0.946, P=.046), along with age (P=.008), T stage (P=.004), and chemotherapy (P=.008). Conclusions: The combined molecular subtype–RSI identified a novel molecular subpopulation (TN and radioresistant) with an increased risk of LR after breast-conserving therapy. We propose that the combination of RSI and

Artificial neural network model of survival in patients treated with irradiation with and without concurrent chemotherapy for advanced carcinoma of the head and neck

International Nuclear Information System (INIS)

Bryce, Thomas J.; Dewhirst, Mark W.; Floyd, Carey E.; Hars, Vera; Brizel, David M.

1998-01-01

Purpose: This study was performed to investigate the feasibility of predicting survival in squamous cell carcinoma of the head and neck (SCCHN) with an artificial neural network (ANN), and to compare ANN performance with conventional models. Methods and Materials: Data were analyzed from a Phase III trial in which patients with locally advanced SCCHN received hyperfractionated irradiation with or without concurrent cisplatin and 5-fluorouracil. Of the 116 randomized patients, 95 who had 2-year follow-up and all required data were evaluated. ANN and logistic regression (LR) models were constructed to predict 2-year total survival using round-robin cross-validation. A modified staging model was also examined. Results: The best LR model used tumor size, nodal stage, and race to predict survival. The best ANN used nodal stage, tumor size, stage, and resectability, and hemoglobin. Treatment type did not predict 2-year survival and was not included in either model. Using the respective best feature sets, the area under the receiver operating characteristic curve (A z ) for the ANN was 0.78 ± 0.05, showing more accurate overall performance than LR (A z = 0.67 ± 0.05, p = 0.07). At 70% sensitivity, the ANN was 72% specific, while LR was 54% specific (p = 0.08). At 70% specificity, the ANN was 72% sensitive, while LR was 54% sensitive (p = 0.07). When both models used the five predictive variables best for an ANN, A z for LR decreased [A z = 0.61 ± 0.06, p z = 0.60 ± 0.07, p = 0.02 (ANN)]. Conclusions: An ANN modeled 2-year survival in this data set more accurately than LR or staging models and employed predictive variables that could not be used by LR. Further work is planned to confirm these results on larger patient samples, examining longer follow-up to incorporate treatment type into the model

An analysis of the 'costs and effectiveness' of post-mastectomy local-regional radiation therapy

International Nuclear Information System (INIS)

Marks, L.B.; Prosnitz, L.R.; Hardenbergh, P.H.; Winer, E.T.

1997-01-01

Purpose: To estimate the 'cost/effectiveness' ratio for post-mastectomy local-regional radiation therapy (LR-XRT) for patients with breast cancer. As the risk of local-regional recurrence (LRR) is related to the number of positive axillary lymph nodes, the cost/effectiveness ratio of LR-XRT was assessed for a variable number of positive axillary nodes. For overall survival (OS), the cost per additional life-year is estimated as a function of follow-up duration. Methods/Assumptions: Literature data indicate that the risk of LRR is related to the number of positive axillary nodes (e.g. Fowble, Kuske). For example, the LRR rate is ∼10% for patients with negative nodes, increasing to ∼40% for patients with ≥4 positive nodes. Such data are used to linearly relate the number of positive nodes with the risk of LRR. Additional assumptions include: RT reduces the risk of LRR by 67%; local recurrences are treated with exision/biopsy, LR-XRT and systemic chemotherapy; half of the local recurrences are controlled locally and half will require additional salvage treatment with surgery or chemotherapy. The 5, 10 and 15 yr improvements in OS provided by LR-XRT are estimated to be 3, 7, and 10%, respectively, based on the literature (Overgaard, Ragaz, Klefstrom, Rutqvist). For each year following LR-XRT, the accrued life-years gained are estimated from the published survival curves. Professional and technical charges are used as a surrogate for costs, as follows (in thousands): LR-XRT-15; evaluation of recurrence-2; biopsy plus pathology-1; resection plus pathology-7, chemotherapy-10. Results: The cost per LRR prevented with the addition of routine post-mastectomy LR-XRT is shown, as a function of the number of positive axillary nodes. The cost per additional life-year gained with LR-XRT, as a function of follow-up duration, is shown. With increasing follow-up, the cost per life-year gained decreases as the additional life-years accrue. Conclusions: The cost per LRR

Removal of cyanotoxins from surface water resources using reusable molecularly imprinted polymer adsorbents.

Science.gov (United States)

Krupadam, Reddithota J; Patel, Govind P; Balasubramanian, Rajasekhar

2012-06-01

Microcystins (MCs; cyclic heptapeptides) are produced by freshwater cyanobacteria and cause public health concern in potable water supplies. There are more than 60 types of MCs identified to date, of which MC-LR is the most common found worldwide. For MC-LR, the WHO has established a threshold value of 1 μg L(-1) for drinking water. The present MCs removal methods such as coagulation, flocculation, adsorption, and filtration showed low efficiency for removing dissolved MC fraction from surface waters to the stipulated limit prescribed by WHO based on MC health impacts. The search for cost-effective and efficient removal method is still warranted for remediation of dissolved MC-LR-contaminated water resources. Molecularly imprinted polymer (MIP) adsorbent has been prepared using non-covalent imprinting approach. Using MC-LR as a template, itaconic acid as a functional monomer, and ethylene glycol dimethacrylate as a cross-linking monomer, a MIP has been synthesized. Computer simulations were used to design effective binding sites for MC-LR binding in aqueous solutions. Batch binding adsorption assay was followed to determine binding capacity of MIP under the influence of environmental parameters such as total dissolved solids and pH. The adsorptive removal of MC-LR from lake water has been investigated using MIPs. The MIP showed excellent adsorption potential toward MC-LR in aqueous solutions with a binding capacity of 3.64 μg mg(-1) which is about 60% and 70% more than the commercially used powdered activated carbon (PAC) and resin XAD, respectively. Environmental parameters such as total organic carbon (represented as chemical oxygen demand (COD)) and total dissolved solids (TDS) showed no significant interference up to 300 mg L(-1) for MC-LR removal from lake water samples. It was found that the binding sites on PAC and XAD have more affinity toward COD and TDS than the MC-LR. Further, the adsorption capacity of the MIP was evaluated rigorously by its repeated

Oxygen partial pressure modulates 67-kDa laminin receptor expression, leading to altered activity of the green tea polyphenol, EGCG.

Science.gov (United States)

Tsukamoto, Shuntaro; Yamashita, Shuya; Kim, Yoon Hee; Kumazoe, Motofumi; Huang, Yuhui; Yamada, Koji; Tachibana, Hirofumi

2012-09-21

(-)-Epigallocatechin-3-O-gallate (EGCG) exhibits anti-tumor activity mediated via the 67-kDa laminin receptor (67LR). In this study, we found that 67LR protein levels are reduced by exposure to low O(2) levels (5%), without affecting the expression of HIF-1α. We also found that EGCG-induced anti-cancer activity is abrogated under low O(2) levels (5%) in various cancer cells. Notably, treatment with the proteasome inhibitor, prevented down-regulation of 67LR and restored sensitivity to EGCG under 5% O(2). In summary, 67LR expression is highly sensitive to O(2) partial pressure, and the activity of EGCG can be regulated in cancer cells by O(2) partial pressure. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Identifying Contributors of DNA Mixtures by Means of Quantitative Information of STR Typing

DEFF Research Database (Denmark)

Tvedebrink, Torben; Eriksen, Poul Svante; Mogensen, Helle Smidt

2012-01-01

identified using polymorphic genetic markers. However, modern typing techniques supply additional quantitative data, which contain very important information about the observed evidence. This is particularly true for cases of DNA mixtures, where more than one individual has contributed to the observed......Abstract Estimating the weight of evidence in forensic genetics is often done in terms of a likelihood ratio, LR. The LR evaluates the probability of the observed evidence under competing hypotheses. Most often, probabilities used in the LR only consider the evidence from the genomic variation...... biological stain. This article presents a method for including the quantitative information of short tandem repeat (STR) DNA mixtures in the LR. Also, an efficient algorithmic method for finding the best matching combination of DNA mixture profiles is derived and implemented in an on-line tool for two...

Transvaginal ultrasound vs magnetic resonance imaging for diagnosing deep infiltrating endometriosis: systematic review and meta-analysis.

Science.gov (United States)

Guerriero, S; Saba, L; Pascual, M A; Ajossa, S; Rodriguez, I; Mais, V; Alcazar, J L

2018-05-01

To perform a systematic review of studies comparing the accuracy of transvaginal ultrasound (TVS) and magnetic resonance imaging (MRI) in diagnosing deep infiltrating endometriosis (DIE) including only studies in which patients underwent both techniques. An extensive search was carried out in PubMed/MEDLINE and Web of Science for papers from January 1989 to October 2016 comparing TVS and MRI in DIE. Studies were considered eligible for inclusion if they reported on the use of TVS and MRI in the same set of patients for the preoperative detection of endometriosis in pelvic locations in women with clinical suspicion of DIE and using surgical data as a reference standard. Quality was assessed using the QUADAS-2 tool. A random-effects model was used to determine pooled sensitivity, specificity, positive and negative likelihood ratios (LR+ and LR-) and diagnostic odds ratio (DOR). Of 375 citations identified, six studies (n = 424) were considered eligible. For MRI in the detection of DIE in the rectosigmoid, pooled sensitivity was 0.85 (95% CI, 0.78-0.90), specificity was 0.95 (95% CI, 0.83-0.99), LR+ was 18.4 (95% CI, 4.7-72.4), LR- was 0.16 (95% CI, 0.11-0.24) and DOR was 116 (95% CI, 23-585). For TVS in the detection of DIE in the rectosigmoid, pooled sensitivity was 0.85 (95% CI, 0.68-0.94), specificity was 0.96 (95% CI, 0.85-0.99), LR+ was 20.4 (95% CI, 4.7-88.5), LR- was 0.16 (95% CI, 0.07-0.38) and DOR was 127 (95% CI, 14-1126). For MRI in the detection of DIE in the rectovaginal septum, pooled sensitivity was 0.66 (95% CI, 0.51-0.79), specificity was 0.97 (95% CI, 0.89-0.99), LR+ was 22.5 (95% CI, 6.7-76.2), LR- was 0.38 (95% CI, 0.23-0.52) and DOR was 65 (95% CI, 21-204). For TVS in the detection of DIE in the rectovaginal septum, pooled sensitivity was 0.59 (95% CI, 0.26-0.86), specificity was 0.97 (95% CI, 0.94-0.99), LR+ was 23.5 (95% CI, 9.1-60.5), LR- was 0.42 (95% CI, 0.18-0.97) and DOR was 56 (95% CI, 11-275). For MRI in the detection of DIE in the

Radiofrequency Ablation versus Liver Resection for Colorectal Cancer Liver Metastasis: An Updated Systematic Review and Meta-analysis

Directory of Open Access Journals (Sweden)

Yue Han

2016-01-01

Conclusions: Patients with CRCLM gained much more survival benefits from LR than that from RFA. RFA rendered lower rates of morbidities. More well-designed randomized controlled trails comparing the therapeutic value of LR and RFA are warranted.

Local recurrence of prostate cancer after radical prostatectomy is at risk to be missed in {sup 68}Ga-PSMA-11-PET of PET/CT and PET/MRI: comparison with mpMRI integrated in simultaneous PET/MRI

Energy Technology Data Exchange (ETDEWEB)

Freitag, Martin T. [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); Clinical Cooperation Unit Nuclear Medicine, German Cancer Research Center, Heidelberg (Germany); Radtke, Jan P. [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); University Hospital Heidelberg, Department of Urology, Heidelberg (Germany); Afshar-Oromieh, Ali; Flechsig, Paul; Giesel, Frederik; Haberkorn, Uwe [University Hospital Heidelberg, Department of Nuclear Medicine, Heidelberg (Germany); Roethke, Matthias C.; Bonekamp, David; Schlemmer, Heinz-Peter [Department of Radiology, German Cancer Research Center, Heidelberg (Germany); Hadaschik, Boris A.; Hohenfellner, Markus [University Hospital Heidelberg, Department of Urology, Heidelberg (Germany); Gleave, Martin [University of British Columbia, The Vancouver Prostate Centre, Vancouver (Canada); Kopka, Klaus; Eder, Matthias [Division of Radiopharmaceutical Chemistry, German Cancer Research Center, Heidelberg (Germany); Heusser, Thorsten; Kachelriess, Marc [Department of Medical Physics in Radiology, German Cancer Research Center, Heidelberg (Germany); Wieczorek, Kathrin [University Hospital Heidelberg, Institute of Pathology, Heidelberg (Germany); Sachpekidis, Christos; Dimitrakopoulou-Strauss, A. [Clinical Cooperation Unit Nuclear Medicine, German Cancer Research Center, Heidelberg (Germany)

2017-05-15

The positron emission tomography (PET) tracer {sup 68}Ga-PSMA-11, targeting the prostate-specific membrane antigen (PSMA), is rapidly excreted into the urinary tract. This leads to significant radioactivity in the bladder, which may limit the PET-detection of local recurrence (LR) of prostate cancer (PC) after radical prostatectomy (RP), developing in close proximity to the bladder. Here, we analyze if there is additional value of multi-parametric magnetic resonance imaging (mpMRI) compared to the {sup 68}Ga-PSMA-11-PET-component of PET/CT or PET/MRI to detect LR. One hundred and nineteen patients with biochemical recurrence after prior RP underwent both hybrid {sup 68}Ga-PSMA-11-PET/CT{sub low-dose} (1 h p.i.) and -PET/MRI (2-3 h p.i.) including a mpMRI protocol of the prostatic bed. The comparison of both methods was restricted to the abdomen with focus on LR (McNemar). Bladder-LR distance and recurrence size were measured in axial T2w-TSE. A logistic regression was performed to determine the influence of these variables on detectability in {sup 68}Ga-PSMA-11-PET. Standardized-uptake-value (SUV{sub mean}) quantification of LR was performed. There were 93/119 patients that had at least one pathologic finding. In addition, 18/119 Patients (15.1%) were diagnosed with a LR in mpMRI of PET/MRI but only nine were PET-positive in PET/CT and PET/MRI. This mismatch was statistically significant (p = 0.004). Detection of LR using the PET-component was significantly influenced by proximity to the bladder (p = 0.028). The PET-pattern of LR-uptake was classified into three types (1): separated from bladder; (2): fuses with bladder, and (3): obliterated by bladder. The size of LRs did not affect PET-detectability (p = 0.84), mean size was 1.7 ± 0.69 cm long axis, 1.2 ± 0.46 cm short-axis. SUV{sub mean} in nine men was 8.7 ± 3.7 (PET/CT) and 7.0 ± 4.2 (PET/MRI) but could not be quantified in the remaining nine cases (obliterated by bladder). The present study demonstrates

EXPANSINA17 up-regulated by LBD18/ASL20 promotes lateral root formation during the auxin response.

Science.gov (United States)

Lee, Han Woo; Kim, Jungmook

2013-10-01

Expansins are non-hydrolytic cell wall-loosening proteins involved in a variety of plant developmental processes during which cell wall modification occurs. Cell wall remodeling proteins including expansins have been suggested to be involved in cell separation to facilitate the emergence of lateral roots (LRs) through the overlaying tissues of the primary root. LBD18/ASL20 activates EXPANSINA14 (EXPA14) expression by directly binding to the EXPA14 promoter to enhance LR emergence in Arabidopsis thaliana. Here we show that EXPA17 is another target gene regulated by LBD18 to promote LR formation in Arabidopsis. We showed that nuclear translocation of the LBD18:GR fusion protein expressed under the Cauliflower mosaic virus (CaMV) 35S promoter or under the LBD18 promoter by dexamethasone treatment results in an increase in EXPA17 transcript levels. β-Glucuronidase (GUS) expression under the EXPA17 promoter, which is detected only in the roots of the wild type, was reduced in the LR primordium and overlaying tissues in an lbd18 mutant background. The number of emerged LRs of the EXPA17 RNAi (RNA interference) Arabidopsis lines was significantly lower than that of the wild type. Overexpression of EXPA17 in Arabidopsis increased the density of emerged LRs in the presence of auxin compared with the wild type. LR induction experiments with a gravitropic stimulus showed that LR emergence is delayed in the EXPA17 RNAi plants compared with the wild type. In addition, EXPA4 expression was also detected in overlaying tissues of the LR primordium and was inducible by LBD18. Taken together, these results support the notion that LBD18 up-regulates a subset of EXP genes to enhance cell separation to promote LR emergence in Arabidopsis.

Analysis of the use of microcystin-contaminated water in the growth and nutritional quality of the root-vegetable, Daucus carota.

Science.gov (United States)

Machado, J; Azevedo, J; Freitas, M; Pinto, E; Almeida, A; Vasconcelos, V; Campos, A

2017-01-01

Toxic cyanobacterial blooms are often observed in freshwaters and may reflect the increased eutrophication of these environments and alterations in climate. Cyanotoxins, such as microcystins (MCs), are an effective threat to many life forms, ranging from plants to humans. Despite the research conducted to date on cyanotoxins, the risks associated to the use of contaminated water in agriculture require further elucidation. To tackle this aim, a research was conducted with the root-vegetable Daucus carota. The specific aims of this work were the following: (i) to evaluate the effects of MC-LR on the plant growth and photosynthesis; (ii) to evaluate the nutritional quality of carrot roots; and (iii) to measure bioaccumulation. To this purpose, young carrots were grown in soil during 1 month in natural conditions and exposed to Mycrocystis aeruginosa aqueous extracts containing environmentally realistic concentrations of MC-LR (10 and 50 MC-LR μg/L). The results showed that MC-LR may decrease root growth after 28 days of exposure to 50 μg/L and increase photosynthetic efficiency. We also observed changes in mineral and vitamin content in carrots as a result of the exposure to contaminated water. Moreover, MC-LR was detected in carrot roots by ELISA at very low concentration 5.23 ± 0.47 ng MC eq./g FW. The soil retained 52.7 % of the toxin potentially available for plants. This result could be attributed to MC-LR adsorption by soil particles or due to microbial degradation of the toxin. We conclude that the prolonged use of MC-LR-contaminated water may affect crop growth, alter the nutritional value of vegetable products, and potentiate contamination.

Arbuscular Mycorrhizal Fungus Enhances Lateral Root Formation in Poncirus trifoliata (L.) as Revealed by RNA-Seq Analysis.

Science.gov (United States)

Chen, Weili; Li, Juan; Zhu, Honghui; Xu, Pengyang; Chen, Jiezhong; Yao, Qing

2017-01-01

Arbuscular mycorrhizal fungi (AMF) establish symbiosis with most terrestrial plants, and greatly regulate lateral root (LR) formation. Phosphorus (P), sugar, and plant hormones are proposed being involved in this regulation, however, no global evidence regarding these factors is available so far, especially in woody plants. In this study, we inoculated trifoliate orange seedlings ( Poncirus trifoliata L. Raf) with an AMF isolate, Rhizophagus irregularis BGC JX04B. After 4 months of growth, LR formation was characterized, and sugar contents in roots were determined. RNA-Seq analysis was performed to obtain the transcriptomes of LR root tips from non-mycorrhizal and mycorrhizal seedlings. Quantitative real time PCR (qRT-PCR) of selected genes was also conducted for validation. The results showed that AMF significantly increased LR number, as well as plant biomass and shoot P concentration. The contents of glucose and fructose in primary root, and sucrose content in LR were also increased. A total of 909 differentially expressed genes (DEGs) were identified in response to AMF inoculation, and qRT-PCR validated the transcriptomic data. The numbers of DEGs related to P, sugar, and plant hormones were 31, 32, and 25, respectively. For P metabolism, the most up-regulated DEGs mainly encoded phosphate transporter, and the most down-regulated DEGs encoded acid phosphatase. For sugar metabolism, the most up-regulated DEGs encoded polygalacturonase and chitinase. For plant hormones, the most up-regulated DEGs were related to auxin signaling, and the most down-regulated DEGs were related to ethylene signaling. PLS-SEM analysis indicates that P metabolism was the most important pathway by which AMF regulates LR formation in this study. These data reveal the changes of genome-wide gene expression in responses to AMF inoculation in trifoliate orange and provide a solid basis for the future identification and characterization of key genes involved in LR formation induced by AMF.

Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

Directory of Open Access Journals (Sweden)

R. H. Wilkens

2017-07-01

Full Text Available Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005 published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack. In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004 orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

Science.gov (United States)

Wilkens, Roy H.; Westerhold, Thomas; Drury, Anna J.; Lyle, Mitchell; Gorgas, Thomas; Tian, Jun

2017-07-01

Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005) published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack). In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004) orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

Cerebral Targeting of Acupuncture at Combined Acupoints in Treating Essential Hypertension: An Rs-fMRI Study and Curative Effect Evidence

Directory of Open Access Journals (Sweden)

Yanjie Wang

2016-01-01

Full Text Available The study attempted to explore that the synergistic effect of acupoints combination is not a simple superposition of single acupoint’s effect by comparing and analyzing the changes of blood pressure (BP, SF-36, and brain regions after acupuncture treatment. 47 patients were randomly divided into LR3+KI3 group, LR3 group, and KI3 group. Subjects received Rs-fMRI scan, BP measurement, and SF-36 questionnaires before and after treatment and short-term acupuncture treatment. After treatment, there were no significant differences in BP and SF-36 among 3 groups, compared to the case before treatment, SBP of 3 groups decreased, and DBP significantly decreased while vitality and mental health significantly increased in LR3+KI3 group. Both number and scopes of changes of brain regions in LR3+KI3 group were the largest, which mainly included BAs 3, 4, 8, 19, 21, 24, 32, 44, and 45. In conclusion, acupuncture at LR3+KI3 may auxiliarily reduce BP and improve the vitality and mental health of patients, and the changes of brain regions were related to somatesthesia, movement, vision, audition, emotion and mood, language, memory, etc. BAs 4, 9, 10, 24, 31, 32, and 46 may be the targeting brain areas of acupuncture in assisting hypotension. It is suggested that acupoints combination of LR3+KI3 maybe generates a synergistic effect, and it is not simple sum of single acupoint effect.

Tedizolid susceptibility in linezolid- and vancomycin-resistant Enterococcus faecium isolates.

Science.gov (United States)

Klupp, E-M; Both, A; Belmar Campos, C; Büttner, H; König, C; Christopeit, M; Christner, M; Aepfelbacher, M; Rohde, H

2016-12-01

Vancomycin-resistant enterococci (VRE) are of ever-increasing importance, most notably in high-risk patient populations. Therapy options are often limited for these isolates, and apart from tigecycline and daptomycin, oxazolidinone linezolid is frequently administered. The broad usage of linezolid, however, has driven the emergence of linezolid-resistant VRE strains (LR-VRE), further shortening therapeutic options. Second-generation oxazolidinone tedizolid has the advantage of being active against a specific subset of LR-VRE, i.e. isolates expressing the plasmid-encoded chloramphenicol-florfenicol resistance (cfr) gene. Here we tested tedizolid activity in a collection of 30 LR Enterococcus faecium VRE (MIC range 32-256 mg/l) isolated between 2012 and 2015 from clinical and screening specimens. By pulsed field gel electrophoresis (PFGE) isolates were assigned to 16 clonal lineages. In three cases, linezolid-susceptible progenitor isolates of LR-VRE were isolated, thus demonstrating the de-novo emergence of the linezolid-resistant phenotype. PCR did not detect cfr, cfr(B) or novel oxazolidinone resistance gene optrA in LR-VRE. All isolates, however, carried mutations within the 23S rDNA. Compared to linezolid, tedizolid MICs were lower in all isolates (MIC range 2-32 mg/l), but remained above the FDA tedizolid breakpoint for E. faecalis at 0.5 mg/l. Thus, related to the predominant resistance mechanism, tedizolid is of limited value for treatment of most LR-VRE and represents a therapeutic option only for a limited subset of isolates.

Predicting beta-turns in proteins using support vector machines with fractional polynomials.

Science.gov (United States)

Elbashir, Murtada; Wang, Jianxin; Wu, Fang-Xiang; Wang, Lusheng

2013-11-07

β-turns are secondary structure type that have essential role in molecular recognition, protein folding, and stability. They are found to be the most common type of non-repetitive structures since 25% of amino acids in protein structures are situated on them. Their prediction is considered to be one of the crucial problems in bioinformatics and molecular biology, which can provide valuable insights and inputs for the fold recognition and drug design. We propose an approach that combines support vector machines (SVMs) and logistic regression (LR) in a hybrid prediction method, which we call (H-SVM-LR) to predict β-turns in proteins. Fractional polynomials are used for LR modeling. We utilize position specific scoring matrices (PSSMs) and predicted secondary structure (PSS) as features. Our simulation studies show that H-SVM-LR achieves Qtotal of 82.87%, 82.84%, and 82.32% on the BT426, BT547, and BT823 datasets respectively. These values are the highest among other β-turns prediction methods that are based on PSSMs and secondary structure information. H-SVM-LR also achieves favorable performance in predicting β-turns as measured by the Matthew's correlation coefficient (MCC) on these datasets. Furthermore, H-SVM-LR shows good performance when considering shape strings as additional features. In this paper, we present a comprehensive approach for β-turns prediction. Experiments show that our proposed approach achieves better performance compared to other competing prediction methods.

Synergetic downregulation of 67 kDa laminin receptor by the green tea (Camellia sinensis secondary plant compound epigallocatechin gallate: a new gateway in metastasis prevention?

Directory of Open Access Journals (Sweden)

Müller Jakob

2012-12-01

Full Text Available Abstract Background In traditional Chinese medicine, green tea is considered to have a life-prolonging effect, possibly as a result of its rich content of antioxidant tea polyphenols, and hence has the potential to prevent cancer. This study investigated the role of the major tea secondary plant compound epigallocatechin gallate (EGCG for its inhibitory effects on the metastasis-associated 67 kDa laminin receptor (67LR. Methods To clarify the impact of EGCG on siRNA-silenced expression of 67LR, we applied an adenoviral-based intestinal in vitro knockdown model, porcine IPEC-J2 cells. Quantitative real-time polymerase chain reaction was performed to analyze 67LR gene expression following treatment with physiological and pharmacological concentrations of EGCG (1.0 g/l, 0.1 g/l, 0.02 g/l and 0.002 g/l. Results We report co-regulation of EGCG and 67LR, which is known to be an EGCG receptor. siRNA selectively and highly significantly suppressed expression of 67LR under the impact of EGCG in a synergetic manner. Conclusions Our findings suggest that 67LR expression is regulated by EGCG via a negative feedback loop. The explicit occurrence of this effect in synergy with a small RNA pathway and a plant-derived drug reveals a new mode of action. Our findings may help to provide insights into the many unsolved health-promoting activities of other natural pharmaceuticals.

Analysis of license renewal at U.S. Nuclear Power Plants

International Nuclear Information System (INIS)

Nagayama, Munehiro

2017-01-01

The U.S. NRC had implemented the rules for LR (License Renewal) of NPPs (Nuclear Power Plants) and the LR rules allow plus 20-year operation of NPPs adding to initial 40-year term for reactor license. The U.S. NRC has already issued ROL (Renewed Operating License) for over forty NPPs. The Atomic Energy Act do not limit the number of LR, so the fleet of U.S. Nuclear, including agency, industry and academy, is continuing efforts to develop rules for SLR (Subsequent License Renewal). The framework of SLR rules has been developed and there is a plan of implementation of SLR for a pilot plant on FY 2018. The total operating term of a SLR plant is 80-year. The LR/SLR of NPPs is effective for stable power supply, greenhouse gas suppression, maintenance of technology, and securing employment. These profits will return to society. It is important to maintain required function of SSCs (Structure, System, and Components) for period of long term operation of NPPs. The U.S. fleet has established integrated ageing management strategy and each NPPs is developing their maintenance plans for long term operation. These adequate maintenance plans may enable to achieve good capacity factor of LR applied NPPs. In this report, domestic LR position will be considered by referring the good performance of U.S. NPPs which entered long term operation beyond 40-year and some conditions such as energy security. (author)

Diagnostic accuracy of the gravity stress test and clinical signs in cases of isolated supination-external rotation-type lateral malleolar fractures.

Science.gov (United States)

Nortunen, S; Flinkkilä, T; Lantto, I; Kortekangas, T; Niinimäki, J; Ohtonen, P; Pakarinen, H

2015-08-01

We prospectively assessed the diagnostic accuracy of the gravity stress test and clinical findings to evaluate the stability of the ankle mortise in patients with supination-external rotation-type fractures of the lateral malleolus without widening of the medial clear space. The cohort included 79 patients with a mean age of 44 years (16 to 82). Two surgeons assessed medial tenderness, swelling and ecchymosis and performed the external rotation (ER) stress test (a reference standard). A diagnostic radiographer performed the gravity stress test. For the gravity stress test, the positive likelihood ratio (LR) was 5.80 with a 95% confidence interval (CI) of 2.75 to 12.27, and the negative LR was 0.15 (95% CI 0.07 to 0.35), suggesting a moderate change from the pre-test probability. Medial tenderness, both alone and in combination with swelling and/or ecchymosis, indicated a small change (positive LR, 2.74 to 3.25; negative LR, 0.38 to 0.47), whereas swelling and ecchymosis indicated only minimal changes (positive LR, 1.41 to 1.65; negative LR, 0.38 to 0.47). In conclusion, when gravity stress test results are in agreement with clinical findings, the result is likely to predict stability of the ankle mortise with an accuracy equivalent to ER stress test results. When clinical examination suggests a medial-side injury, however, the gravity stress test may give a false negative result. ©2015 The British Editorial Society of Bone & Joint Surgery.

The Case for Extant Life on Mars and Its Possible Detection by the Viking Labeled Release Experiment.

Science.gov (United States)

Levin, Gilbert V; Straat, Patricia Ann

2016-10-01

The 1976 Viking Labeled Release (LR) experiment was positive for extant microbial life on the surface of Mars. Experiments on both Viking landers, 4000 miles apart, yielded similar, repeatable, positive responses. While the authors eventually concluded that the experiment detected martian life, this was and remains a highly controversial conclusion. Many believe that the martian environment is inimical to life and the LR responses were nonbiological, attributed to an as-yet-unidentified oxidant (or oxidants) in the martian soil. Unfortunately, no further metabolic experiments have been conducted on Mars. Instead, follow-on missions have sought to define the martian environment, mostly searching for signs of water. These missions have collected considerable data regarding Mars as a habitat, both past and present. The purpose of this article is to consider recent findings about martian water, methane, and organics that impact the case for extant life on Mars. Further, the biological explanation of the LR and recent nonbiological hypotheses are evaluated. It is concluded that extant life is a strong possibility, that abiotic interpretations of the LR data are not conclusive, and that, even setting our conclusion aside, biology should still be considered as an explanation for the LR experiment. Because of possible contamination of Mars by terrestrial microbes after Viking, we note that the LR data are the only data we will ever have on biologically pristine martian samples. Key Words: Extant life on Mars-Viking Labeled Release experiment-Astrobiology-Extraterrestrial life-Mars. Astrobiology 16, 798-810.

In Vitro Evaluation of Swine-Derived Lactobacillus reuteri: Probiotic Properties and Effects on Intestinal Porcine Epithelial Cells Challenged with Enterotoxigenic Escherichia coli K88.

Science.gov (United States)

Wang, Zhilin; Wang, Li; Chen, Zhuang; Ma, Xianyong; Yang, Xuefen; Zhang, Jian; Jiang, Zongyong

2016-06-28

Probiotics are considered as the best effective alternatives to antibiotics. The aim of this study was to characterize the probiotic potential of lactobacilli for use in swine farming by using in vitro evaluation methods. A total of 106 lactic acid bacterial isolates, originating from porcine feces, were first screened for the capacity to survive stresses considered important for putative probiotic strains. Sixteen isolates showed notable acid and bile resistance, antibacterial activity, and adherence to intestinal porcine epithelial cells (IPEC-1). One isolate, LR1, identified as Lactobacillus reuteri, was selected for extensive study of its probiotic and functional properties in IPEC-1 cell models. L. reuteri LR1 exhibited good adhesion to IPEC-1 cells and could inhibit the adhesion of enterotoxigenic Escherichia coli (ETEC) to IPEC-1 cells. L. reuteri LR1 could also modulate transcript and protein expression of cytokines involved in inflammation in IPEC-1 cells; the Lactobacillus strain inhibited the ETEC-induced expression of proinflammatory transcripts (IL-6 and TNF-α) and protein (IL-6), and increased the level of anti-inflammatory cytokine (IL-10). Measurement of the permeation of FD-4 showed that L. reuteri LR1 could maintain barrier integrity in monolayer IPEC-1 cells exposed to ETEC. Immunolocalization experiments showed L. reuteri LR1 could also prevent ETEC-induced tight junction ZO-1 disruption. Together, these results indicate that L. reuteri LR1 exhibits desirable probiotic properties and could be a potential probiotic for use in swine production.

Comparison of R6 and A16 J estimation methods under combined mechanical and thermal loads with FE results

International Nuclear Information System (INIS)

Nam, Hyun-Suk; Oh, Chang-Young; Kim, Yun-Jae; Jerng, Dong Wook; Ainsworth, Robert A.; Budden, Peter J.; Marie, Stéphane

2015-01-01

This paper compares elastic–plastic values of J calculated using the methods in the UK R6 and the French A16 fitness-for-service procedures with FE results for a vessel with a circumferential surface crack under axial tension and a radial thermal gradient. In the FE analyses, the relative magnitudes and loading sequence of mechanical and thermal loads are systematically varied, together with the material strain hardening exponent. Fully circumferential and semi-elliptical surface crack with two relative crack depths are considered. It is found that the R6 estimates are overall accurate but can be non-conservative at large L_r. The A16 estimates are more conservative than the R6 estimates at small L_r but are conservative even at large L_r. Possible sources of conservatism and non-conservatism in R6 and A16 are discussed. - Highlights: • Accuracy of existing J estimation methods for combined mechanical and thermal loading are compared with FE results. • The methods in the UK R6 and the French A16 procedures are considered. • The R6 estimates are overall accurate but can be non-conservative at large L_r. • The A16 estimates are more conservative than the R6 estimates at small L_r but are conservative even at large L_r. • Possible sources of conservatism and non-conservatism in R6 and A16 are discussed.

Shoot-supplied ammonium targets the root auxin influx carrier AUX1 and inhibits lateral root emergence in Arabidopsis

KAUST Repository

Li, Baohai; Li, Qing; Su, Yanhua; Chen, Hao; Xiong, Liming; Mi, Guohua; Kronzucker, Herbert J.; Shi, Weiming

2011-01-01

. In this study, we show that SSA significantly affects lateral root (LR) development. We show that SSA inhibits lateral root primordium (LRP) emergence, but not LRP initiation, resulting in significantly impaired LR number. We show that the inhibition

Linking local retention, self-recruitment, and persistence in marine metapopulations

KAUST Repository

Lett, Christophe; Nguyen-Huu, Tri; Cuif, Marion; Saenz Agudelo, Pablo; Kaplan, David M.

2015-01-01

Three indices of larval retention have been used in the literature to assess the tendency for self-maintenance of local marine populations: local retention (LR), self-recruitment (SR), and relative local retention (RLR). Only one of these, LR

Automatic luminous reflections detector using global threshold with increased luminosity contrast in images

Science.gov (United States)

Silva, Ricardo Petri; Naozuka, Gustavo Taiji; Mastelini, Saulo Martiello; Felinto, Alan Salvany

2018-01-01

The incidence of luminous reflections (LR) in captured images can interfere with the color of the affected regions. These regions tend to oversaturate, becoming whitish and, consequently, losing the original color information of the scene. Decision processes that employ images acquired from digital cameras can be impaired by the LR incidence. Such applications include real-time video surgeries, facial, and ocular recognition. This work proposes an algorithm called contrast enhancement of potential LR regions, which is a preprocessing to increase the contrast of potential LR regions, in order to improve the performance of automatic LR detectors. In addition, three automatic detectors were compared with and without the employment of our preprocessing method. The first one is a technique already consolidated in the literature called the Chang-Tseng threshold. We propose two automatic detectors called adapted histogram peak and global threshold. We employed four performance metrics to evaluate the detectors, namely, accuracy, precision, exactitude, and root mean square error. The exactitude metric is developed by this work. Thus, a manually defined reference model was created. The global threshold detector combined with our preprocessing method presented the best results, with an average exactitude rate of 82.47%.

Two-step superresolution approach for surveillance face image through radial basis function-partial least squares regression and locality-induced sparse representation

Science.gov (United States)

Jiang, Junjun; Hu, Ruimin; Han, Zhen; Wang, Zhongyuan; Chen, Jun

2013-10-01

Face superresolution (SR), or face hallucination, refers to the technique of generating a high-resolution (HR) face image from a low-resolution (LR) one with the help of a set of training examples. It aims at transcending the limitations of electronic imaging systems. Applications of face SR include video surveillance, in which the individual of interest is often far from cameras. A two-step method is proposed to infer a high-quality and HR face image from a low-quality and LR observation. First, we establish the nonlinear relationship between LR face images and HR ones, according to radial basis function and partial least squares (RBF-PLS) regression, to transform the LR face into the global face space. Then, a locality-induced sparse representation (LiSR) approach is presented to enhance the local facial details once all the global faces for each LR training face are constructed. A comparison of some state-of-the-art SR methods shows the superiority of the proposed two-step approach, RBF-PLS global face regression followed by LiSR-based local patch reconstruction. Experiments also demonstrate the effectiveness under both simulation conditions and some real conditions.

Heat Killed Lactobacillus reuteri GMNL-263 Reduces Fibrosis Effects on the Liver and Heart in High Fat Diet-Hamsters via TGF-β Suppression

Directory of Open Access Journals (Sweden)

Wei-Jen Ting

2015-10-01

Full Text Available Obesity is one of the major risk factors for nonalcoholic fatty liver disease (NAFLD, and NAFLD is highly associated with an increased risk of cardiovascular disease (CVD. Scholars have suggested that certain probiotics may significantly impact cardiovascular health, particularly certain Lactobacillus species, such as Lactobacillus reuteri GMNL-263 (Lr263 probiotics, which have been shown to reduce obesity and arteriosclerosis in vivo. In the present study, we examined the potential of heat-killed bacteria to attenuate high fat diet (HFD-induced hepatic and cardiac damages and the possible underlying mechanism of the positive effects of heat-killed Lr263 oral supplements. Heat-killed Lr263 treatments (625 and 3125 mg/kg-hamster/day were provided as a daily supplement by oral gavage to HFD-fed hamsters for eight weeks. The results show that heat-killed Lr263 treatments reduce fatty liver syndrome. Moreover, heat-killed Lactobacillus reuteri GMNL-263 supplementation in HFD hamsters also reduced fibrosis in the liver and heart by reducing transforming growth factor β (TGF-β expression levels. In conclusion, heat-killed Lr263 can reduce lipid metabolic stress in HFD hamsters and decrease the risk of fatty liver and cardiovascular disease.

Chiral Orientation of Skeletal Muscle Cells Requires Rigid Substrate

Directory of Open Access Journals (Sweden)

Ninghao Zhu

2017-06-01

Full Text Available Reconstitution of tissue morphology with inherent left–right (LR asymmetry is essential for tissue/organ functions. For skeletal muscle, the largest tissue in mammalian organisms, successful myogenesis requires the regulation of the LR asymmetry to form the appropriate muscle alignment. However, the key factor for reproducing the LR asymmetry of skeletal tissues in a controllable, engineering context remains largely unknown. Recent reports indicate that cell chirality may underlie the LR development in tissue morphogenesis. Here, we report that a rigid substrate is required for the chirality of skeletal muscle cells. By using alternating micropatterned cell-adherent and cell-repellent stripes on a rigid substrate, we found that C2C12 skeletal muscle myoblasts exhibited a unidirectional tilted orientation with respect to the stripe boundary. Importantly, such chiral orientation was reduced when soft substrates were used instead. In addition, we demonstrated the key role of actin stress fibers in the formation of the chiral orientation. This study reveals that a rigid substrate is required for the chiral pattern of myoblasts, paving the way for reconstructing damaged muscle tissue with inherent LR asymmetry in the future.

A hybrid genetic algorithm and linear regression for prediction of NOx emission in power generation plant

International Nuclear Information System (INIS)

Bunyamin, Muhammad Afif; Yap, Keem Siah; Aziz, Nur Liyana Afiqah Abdul; Tiong, Sheih Kiong; Wong, Shen Yuong; Kamal, Md Fauzan

2013-01-01

This paper presents a new approach of gas emission estimation in power generation plant using a hybrid Genetic Algorithm (GA) and Linear Regression (LR) (denoted as GA-LR). The LR is one of the approaches that model the relationship between an output dependant variable, y, with one or more explanatory variables or inputs which denoted as x. It is able to estimate unknown model parameters from inputs data. On the other hand, GA is used to search for the optimal solution until specific criteria is met causing termination. These results include providing good solutions as compared to one optimal solution for complex problems. Thus, GA is widely used as feature selection. By combining the LR and GA (GA-LR), this new technique is able to select the most important input features as well as giving more accurate prediction by minimizing the prediction errors. This new technique is able to produce more consistent of gas emission estimation, which may help in reducing population to the environment. In this paper, the study's interest is focused on nitrous oxides (NOx) prediction. The results of the experiment are encouraging.

Genetic Learning of Fuzzy Parameters in Predictive and Decision Support Modelling

Directory of Open Access Journals (Sweden)

Nebot

2012-04-01

Full Text Available In this research a genetic fuzzy system (GFS is proposed that performs discretization parameter learning in the context of the Fuzzy Inductive Reasoning (FIR methodology and the Linguistic Rule FIR (LR-FIR algorithm. The main goal of the GFS is to take advantage of the potentialities of GAs to learn the fuzzification parameters of the FIR and LR-FIR approaches in order to obtain reliable and useful predictive (FIR models and decision support (LR-FIR models. The GFS is evaluated in an e-learning context.

Long-term outcomes of ductal carcinoma in situ of the breast: a systematic review, meta-analysis and meta-regression analysis

International Nuclear Information System (INIS)

Stuart, Kirsty E.; Houssami, Nehmat; Taylor, Richard; Hayen, Andrew; Boyages, John

2015-01-01

To summarize data on long-term ipsilateral local recurrence (LR) and breast cancer death rate (BCDR) for patients with ductal carcinoma in situ (DCIS) who received different treatments. Systematic review and study-level meta-analysis of prospective (n = 5) and retrospective (n = 21) studies of patients with pure DCIS and with median or mean follow-up time of ≥10 years. Meta-regression was performed to assess and adjust for effects of potential confounders – the average age of women, period of initial treatment, and of bias – follow-up duration on recurrence- and death-rates in each treatment group. LR and BCDR rates by local treatment used were reported. Outside of randomized trials, remaining studies were likely to have tailored patient treatment according to the clinical situation. Nine thousand four hundred and four DCIS cases in 9391 patients with 10-year follow-up were included. The adjusted meta-regression LR rate for mastectomy was 2.6 % (95 % CI, 0.8–4.5); breast-conserving surgery with radiotherapy (RT), 13.6 % (95 % CI, 9.8–17.4); breast-conserving surgery without RT, 25.5 % (95 % CI, 18.1–32.9); and biopsy-only (residual predominately low-grade DCIS following inadequate excision), 27.8 % (95 % CI, 8.4–47.1). RT + tamoxifen (TAM) in conservation surgery (CS) patients resulted in lower LR compared to one or no adjuvant treatments: LR rate for CS + RT + TAM, 9.7 %; CS + RT(no TAM), 14.1 %; CS + TAM(no RT), 24.7 %; CS(alone), 25.1 % (linear trend for treatment P < 0.0001). Compared to CS + RT + TAM, a significantly higher invasive LR was observed for CS(alone), odds ratio (OR) 2.61 (P < 0.0001); CS + TAM(no RT), OR 2.52 (P = 0.001); CS + RT(no TAM), OR 1.59 (P = 0.022). BCDR was similar for mastectomy, breast-conserving surgery with or without RT (1.3–2.0 %) and non-significantly higher for biopsy-only (2.7 %). Additionally, the 15-year follow-up was reported where all like-studies had ≥ 15-year data sets; the biopsy-only patients had a

Lesion size affects diagnostic performance of IOTA logistic regression models, IOTA simple rules and risk of malignancy index in discriminating between benign and malignant adnexal masses.

Science.gov (United States)

Di Legge, A; Testa, A C; Ameye, L; Van Calster, B; Lissoni, A A; Leone, F P G; Savelli, L; Franchi, D; Czekierdowski, A; Trio, D; Van Holsbeke, C; Ferrazzi, E; Scambia, G; Timmerman, D; Valentin, L

2012-09-01

To estimate the ability to discriminate between benign and malignant adnexal masses of different size using: subjective assessment, two International Ovarian Tumor Analysis (IOTA) logistic regression models (LR1 and LR2), the IOTA simple rules and the risk of malignancy index (RMI). We used a multicenter IOTA database of 2445 patients with at least one adnexal mass, i.e. the database previously used to prospectively validate the diagnostic performance of LR1 and LR2. The masses were categorized into three subgroups according to their largest diameter: small tumors (diameter IOTA simple rules and the RMI were applied to each of the three groups. Sensitivity, specificity, positive and negative likelihood ratio (LR+, LR-), diagnostic odds ratio (DOR) and area under the receiver-operating characteristics curve (AUC) were used to describe diagnostic performance. A moving window technique was applied to estimate the effect of tumor size as a continuous variable on the AUC. The reference standard was the histological diagnosis of the surgically removed adnexal mass. The frequency of invasive malignancy was 10% in small tumors, 19% in medium-sized tumors and 40% in large tumors; 11% of the large tumors were borderline tumors vs 3% and 4%, respectively, of the small and medium-sized tumors. The type of benign histology also differed among the three subgroups. For all methods, sensitivity with regard to malignancy was lowest in small tumors (56-84% vs 67-93% in medium-sized tumors and 74-95% in large tumors) while specificity was lowest in large tumors (60-87%vs 83-95% in medium-sized tumors and 83-96% in small tumors ). The DOR and the AUC value were highest in medium-sized tumors and the AUC was largest in tumors with a largest diameter of 7-11 cm. Tumor size affects the performance of subjective assessment, LR1 and LR2, the IOTA simple rules and the RMI in discriminating correctly between benign and malignant adnexal masses. The likely explanation, at least in part, is

Diagnostic accuracy of contrast-enhanced ultrasound for the differential diagnosis of hepatocellular carcinoma: ESCULAP versus CEUS-LI-RADS.

Science.gov (United States)

Schellhaas, Barbara; Görtz, Ruediger S; Pfeifer, Lukas; Kielisch, Christian; Neurath, Markus F; Strobel, Deike

2017-09-01

A comparison is made of two contrast-enhanced ultrasound (CEUS) algorithms for the diagnosis of hepatocellular carcinoma (HCC) in high-risk patients: Erlanger Synopsis of Contrast-enhanced Ultrasound for Liver lesion Assessment in Patients at Risk (ESCULAP) and American College of Radiology Contrast-Enhanced Ultrasound-Liver Imaging Reporting and Data System (ACR-CEUS-LI-RADSv.2016). Focal liver lesions in 100 high-risk patients were assessed using both CEUS algorithms (ESCULAP and CEUS-LI-RADSv.2016) for a direct comparison. Lesions were categorized according to size and contrast enhancement in the arterial, portal venous and late phases.For the definite diagnosis of HCC, categories ESCULAP-4, ESCULAP-Tr and ESCULAP-V and CEUS-LI-RADS-LR-5, LR-Tr and LR-5-V were compared. In addition, CEUS-LI-RADS-category LR-M (definitely/probably malignant, but not specific for HCC) and ESCULAP-category C [intrahepatic cholangiocellular carcinoma (ICC)] were compared.Histology, CE-computed tomography and CE-MRI served as reference standards. The reference standard among 100 lesions included 87 HCCs, six ICCs and seven non-HCC-non-ICC-lesions. For the diagnosis of HCC, the diagnostic accuracy of CEUS was significantly higher with ESCULAP versus CEUS-LI-RADS (94.3%/72.4%; pdiagnostic accuracy for ICC (LR-M/ESCULAP-C) was identical with both algorithms (50%), with higher PPV for ESCULAP-C versus LR-M (75 vs. 50%). CEUS-based algorithms contribute toward standardized assessment and reporting of HCC-suspect lesions in high-risk patients. ESCULAP shows significantly higher diagnostic accuracy, sensitivity and negative predictive value with no loss of specificity compared with CEUS-LI-RADS. Both algorithms have an excellent PPV. Arterial hyperenhancement is the key feature for the diagnosis of HCC with CEUS. Washout should not be a necessary prerequisite for the diagnosis of definite HCC. CEUS-LI-RADS in its current version is inferior to ESCULAP for the noninvasive diagnosis of HCC

Polynitroxylated Pegylated Hemoglobin-A Novel, Small Volume Therapeutic for Traumatic Brain Injury Resuscitation: Comparison to Whole Blood and Dose Response Evaluation.

Science.gov (United States)

Brockman, Erik C; Jackson, Travis C; Dixon, C Edward; Bayɪr, Hülya; Clark, Robert S B; Vagni, Vincent; Feldman, Keri; Byrd, Catherine; Ma, Li; Hsia, Carleton; Kochanek, Patrick M

2017-04-01

Resuscitation with polynitroxylated pegylated hemoglobin (PNPH), a pegylated bovine hemoglobin decorated with nitroxides, eliminated the need for fluid administration, reduced intracranial pressure (ICP) and brain edema, and produced neuroprotection in vitro and in vivo versus Lactated Ringer's solution (LR) in experimental traumatic brain injury (TBI) plus hemorrhagic shock (HS). We hypothesized that resuscitation with PNPH would improve acute physiology versus whole blood after TBI+HS and would be safe and effective across a wide dosage range. Anesthetized mice underwent controlled cortical impact and severe HS to mean arterial pressure (MAP) of 25-27 mm Hg for 35 min, then were resuscitated with PNPH, autologous whole blood, or LR. Markers of acute physiology, including mean arterial blood pressure (MAP), heart rate (HR), blood gases/chemistries, and brain oxygenation (PbtO 2 ), were monitored for 90 min on room air followed by 15 min on 100% oxygen. In a second experiment, the protocol was repeated, except mice were resuscitated with PNPH with doses between 2 and 100 mL/kg. ICP and 24 h %-brain water were evaluated. PNPH-resuscitated mice had higher MAP and lower HR post-resuscitation versus blood or LR (p < 0.01). PNPH-resuscitated mice, versus those resuscitated with blood or LR, also had higher pH and lower serum potassium (p < 0.05). Blood-resuscitated mice, however, had higher PbtO 2 versus those resuscitated with LR and PNPH, although PNPH had higher PbtO 2 versus LR (p < 0.05). PNPH was well tolerated across the dosing range and dramatically reduced fluid requirements in all doses-even 2 or 5 mL/kg (p < 0.001). ICP was significantly lower in PNPH-treated mice for most doses tested versus in LR-treated mice, although %-brain water did not differ between groups. Resuscitation with PNPH, versus resuscitation with LR or blood, improved MAP, HR, and ICP, reduced acidosis and hyperkalemia, and was well tolerated and effective

Associations between chlorophyll a and various microcystin-LR health advisory concentrations [version 1; referees: 1 approved, 2 approved with reservations

Directory of Open Access Journals (Sweden)

Jeffrey W. Hollister

2016-02-01

Full Text Available Cyanobacteria harmful algal blooms (cHABs are associated with a wide range of adverse health effects that stem mostly from the presence of cyanotoxins. To help protect against these impacts, several health advisory levels have been set for some toxins. In particular, one of the more common toxins, microcystin-LR, has several advisory levels set for drinking water and recreational use. However, compared to other water quality measures, field measurements of microcystin-LR are not commonly available due to cost and advanced understanding required to interpret results. Addressing these issues will take time and resources. Thus, there is utility in finding indicators of microcystin-LR that are already widely available, can be estimated quickly and in situ, and used as a first defense against high concentrations of microcystin-LR. Chlorophyll a is commonly measured, can be estimated in situ, and has been shown to be positively associated with microcystin-LR. In this paper, we use this association to provide estimates of chlorophyll a concentrations that are indicative of a higher probability of exceeding select health advisory concentrations for microcystin-LR. Using the 2007 National Lakes Assessment and a conditional probability approach, we identify chlorophyll a concentrations that are more likely than not to be associated with an exceedance of a microcystin-LR health advisory level. We look at the recent US EPA health advisories for drinking water as well as the World Health Organization levels for drinking water and recreational use and identify a range of chlorophyll a thresholds. A 50% chance of exceeding one of the microcystin-LR advisory concentrations of 0.3, 1, 1.6, and 2 g/L is associated with chlorophyll a concentration thresholds of 23.4, 67.0, 83.5, and 105.8, respectively. When managing for these various microcystin-LR levels, exceeding these reported chlorophyll a concentrations should be a trigger for

Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154

Science.gov (United States)

Wilkens, Roy; Drury, Anna Joy; Westerhold, Thomas; Lyle, Mitchell; Gorgas, Thomas; Tian, Jun

2017-04-01

Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005) published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack). In this study LR04 is compared to high resolution records collected at all of the sites drilled during Ocean Drilling Program (ODP) Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software - the Code for Ocean Drilling Data (CODD) - is used to check data splices of the Ceara sites and better align out-of-splice data with in-splice data. CODD allows to depth and age scaled core images recovered from core table photos enormously facilitating data analysis. The entire splices of ODP Sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several large enough to affect age models based on orbital tuning. We revised the astronomically tuned age model for the Ceara Rise by tuning darker, more clay rich layers to Northern Hemisphere insolation minima. Then we assembled a regional composite benthic stable isotope record from published data. This new Ceara Rise stack provides a new regional reference section for the equatorial Atlantic covering the last 5 million years with an independent age model compared to the non-linear ice volume models of the LR04 stack. Comparison shows that the benthic δ18O composite is consistent with the LR04 stack from 0 - 4 Ma despite a short interval between 1.80 and 1.90 Ma, where LR04 exhibits 2 maxima but where Ceara Rise contains only 1. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. Our results also point out that precession cycles have been misinterpreted as obliquity in the LR04 stack as suggested by the Ceara Rise composite at 4.2 Ma.

Polynitroxylated Pegylated Hemoglobin—A Novel, Small Volume Therapeutic for Traumatic Brain Injury Resuscitation: Comparison to Whole Blood and Dose Response Evaluation

Science.gov (United States)

Brockman, Erik C.; Jackson, Travis C.; Dixon, C. Edward; Bayɪr, Hülya; Clark, Robert S. B.; Vagni, Vincent; Feldman, Keri; Byrd, Catherine; Ma, Li; Hsia, Carleton

2017-01-01

Abstract Resuscitation with polynitroxylated pegylated hemoglobin (PNPH), a pegylated bovine hemoglobin decorated with nitroxides, eliminated the need for fluid administration, reduced intracranial pressure (ICP) and brain edema, and produced neuroprotection in vitro and in vivo versus Lactated Ringer's solution (LR) in experimental traumatic brain injury (TBI) plus hemorrhagic shock (HS). We hypothesized that resuscitation with PNPH would improve acute physiology versus whole blood after TBI+HS and would be safe and effective across a wide dosage range. Anesthetized mice underwent controlled cortical impact and severe HS to mean arterial pressure (MAP) of 25–27 mm Hg for 35 min, then were resuscitated with PNPH, autologous whole blood, or LR. Markers of acute physiology, including mean arterial blood pressure (MAP), heart rate (HR), blood gases/chemistries, and brain oxygenation (PbtO2), were monitored for 90 min on room air followed by 15 min on 100% oxygen. In a second experiment, the protocol was repeated, except mice were resuscitated with PNPH with doses between 2 and 100 mL/kg. ICP and 24 h %-brain water were evaluated. PNPH-resuscitated mice had higher MAP and lower HR post-resuscitation versus blood or LR (p < 0.01). PNPH-resuscitated mice, versus those resuscitated with blood or LR, also had higher pH and lower serum potassium (p < 0.05). Blood-resuscitated mice, however, had higher PbtO2 versus those resuscitated with LR and PNPH, although PNPH had higher PbtO2 versus LR (p < 0.05). PNPH was well tolerated across the dosing range and dramatically reduced fluid requirements in all doses—even 2 or 5 mL/kg (p < 0.001). ICP was significantly lower in PNPH-treated mice for most doses tested versus in LR-treated mice, although %-brain water did not differ between groups. Resuscitation with PNPH, versus resuscitation with LR or blood, improved MAP, HR, and ICP, reduced acidosis and hyperkalemia, and was well tolerated and

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

assisted pyramiding of Thinopyrum -derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety HD2733 · MONA SINGH N. MALLICK S. CHAND P. KUMARI J. B. SHARMA M. SIVASAMY P. JAYAPRAKASH K. V. PRABHU S. K. JHA ...

Serotonin signaling is a very early step in patterning of the left-right axis in chick and frog embryos

NARCIS (Netherlands)

Fukumoto, T; Kema, IP; Levin, M

2005-01-01

Background: Consistent left-right (LR) asymmetry is a fascinating problem in developmental and evolutionary biology. Conservation of early LR patterning steps among vertebrates as well as involvement of nonprotein small-molecule messengers are very poorly understood. Serotonin (5-HT) is a key

Validation of Likelihood Ratio Methods Used for Forensic Evidence Evaluation: Application in Forensic Fingerprints

NARCIS (Netherlands)

Haraksim, Rudolf

2014-01-01

In this chapter the Likelihood Ratio (LR) inference model will be introduced, the theoretical aspects of probabilities will be discussed and the validation framework for LR methods used for forensic evidence evaluation will be presented. Prior to introducing the validation framework, following

Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

Indian Academy of Sciences (India)

2017-03-20

Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

Emerging Executive Functioning and Motor Development in Infants at High and Low Risk for Autism Spectrum Disorder.

Science.gov (United States)

St John, Tanya; Estes, Annette M; Dager, Stephen R; Kostopoulos, Penelope; Wolff, Jason J; Pandey, Juhi; Elison, Jed T; Paterson, Sarah J; Schultz, Robert T; Botteron, Kelly; Hazlett, Heather; Piven, Joseph

2016-01-01

Existing evidence suggests executive functioning (EF) deficits may be present in children with autism spectrum disorder (ASD) by 3 years of age. It is less clear when, prior to 3 years, EF deficits may emerge and how EF unfold over time. The contribution of motor skill difficulties to poorer EF in children with ASD has not been systematically studied. We investigated the developmental trajectory of EF in infants at high and low familial risk for ASD (HR and LR) and the potential associations between motor skills, diagnostic group, and EF performance. Participants included 186 HR and 76 LR infants. EF (A-not-B), motor skills (Fine and Gross Motor), and cognitive ability were directly assessed at 12 months and 24 months of age. Participants were directly evaluated for ASD at 24 months using DSM-IV-TR criteria and categorized as HR-ASD, HR-Negative, and LR-Negative. HR-ASD and HR-Negative siblings demonstrated less improvement in EF over time compared to the LR-Negative group. Motor skills were associated with group and EF performance at 12 months. No group differences were found at 12 months, but at 24 months, the HR-ASD and HR-Negative groups performed worse than the LR-Negative group overall after controlling for visual reception and maternal education. On reversal trials, the HR-ASD group performed worse than the LR-Negative group. Motor skills were associated with group and EF performance on reversal trials at 24 months. Findings suggest that HR siblings demonstrate altered EF development and that motor skills may play an important role in this process.

Logistic regression and multiple classification analyses to explore risk factors of under-5 mortality in bangladesh

International Nuclear Information System (INIS)

Bhowmik, K.R.; Islam, S.

2016-01-01

Logistic regression (LR) analysis is the most common statistical methodology to find out the determinants of childhood mortality. However, the significant predictors cannot be ranked according to their influence on the response variable. Multiple classification (MC) analysis can be applied to identify the significant predictors with a priority index which helps to rank the predictors. The main objective of the study is to find the socio-demographic determinants of childhood mortality at neonatal, post-neonatal, and post-infant period by fitting LR model as well as to rank those through MC analysis. The study is conducted using the data of Bangladesh Demographic and Health Survey 2007 where birth and death information of children were collected from their mothers. Three dichotomous response variables are constructed from children age at death to fit the LR and MC models. Socio-economic and demographic variables significantly associated with the response variables separately are considered in LR and MC analyses. Both the LR and MC models identified the same significant predictors for specific childhood mortality. For both the neonatal and child mortality, biological factors of children, regional settings, and parents socio-economic status are found as 1st, 2nd, and 3rd significant groups of predictors respectively. Mother education and household environment are detected as major significant predictors of post-neonatal mortality. This study shows that MC analysis with or without LR analysis can be applied to detect determinants with rank which help the policy makers taking initiatives on a priority basis. (author)

Effects of the naturally-occurring contaminant microcystins on the Azolla filiculoides-Anabaena azollae symbiosis.

Science.gov (United States)

Pereira, A L; Monteiro, B; Azevedo, J; Campos, A; Osório, H; Vasconcelos, V

2015-08-01

Harmful algal blooms (HABs) contaminate aquatic ecosystems and are responsible for animal poisoning worldwide. We conducted a toxicity test with the aquatic fern and the biofertilizer, Azolla filiculoides. The sporophytes were exposed to three concentrations (0.01, 0.1 and 1μgmL(-1)) of a microcystin (MC) cyanobacterial crude extract and purified MC-LR. The growth of A. filiculoides decreased only at 1μgmL(-1) crude extract concentration while with MC-LR it decreased at all the tested concentrations, indicating that the presence of other compounds in the crude extract altered toxicity and stimulated the fern growth at lower concentrations (0.01 and 0.1μgmL(-1)). Both phycoerythrocyanin and allophycocyanin levels decreased in all the concentrations of crude extract and MC-LR. The phycocyanin had a marked increase at 0.1μgmL(-1) crude extract concentration and a marked decrease at 1μgmL(-1) MC-LR concentration. These changes in the phycobiliprotein content indicate a shift in the antenna pigments of the cyanobionts of A. filiculoides. The changes in two oxidative stress enzymes, glutathione reductase for the crude extract assay and glutathione peroxidase for MC-LR assay, points towards the induction of stress defense responses. The low bioconcentration factor in both crude extract and MC-LR treatments can suggest the low uptake of microcystins, and indicates that the aquatic fern can be used as a biofertilizer and as animal feed but is not suitable for MC phytoremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

MRI of the sacroiliac joints in spondyloarthritis: the added value of intra-articular signal changes for a 'positive MRI'.

Science.gov (United States)

Laloo, Frederiek; Herregods, N; Jaremko, J L; Verstraete, K; Jans, L

2018-05-01

To determine if intra-articular signal changes at the sacroiliac joint space on MRI have added diagnostic value for spondyloarthritis, when compared to bone marrow edema (BME). A retrospective study was performed on the MRIs of sacroiliac joints of 363 patients, aged 16-45 years, clinically suspected of sacroiliitis. BME of the sacroiliac joints was correlated to intra-articular sacroiliac joint MR signal changes: high T1 signal, fluid signal, ankylosis and vacuum phenomenon (VP). These MRI findings were correlated with final clinical diagnosis. Sensitivity (SN), specificity (SP), likelihood ratios (LR), predictive values and post-test probabilities were calculated. BME had SN of 68.9%, SP of 74.0% and LR+ of 2.6 for diagnosis of spondyloarthritis. BME in absence of intra-articular signal changes had a lower SN and LR+ for spondyloarthritis (SN = 20.5%, LR+ 1.4). Concomitant BME and high T1 signal (SP = 97.2%, LR + = 10.5), BME and fluid signal (SP = 98.6%, LR + = 10.3) or BME and ankylosis (SP = 100%) had higher SP and LR+ for spondyloarthritis. Concomitant BME and VP had low LR+ for spondyloarthritis (SP = 91%, LR + =0.9). When BME was absent, intra-articular signal changes were less prevalent, but remained highly specific for spondyloarthritis. Our results suggest that both periarticular and intra-articular MR signal of the sacroiliac joint should be examined to determine whether an MRI is 'positive' or 'not positive' for sacroiliitis associated with spondyloarthritis.

A nonimaging catheter for measurement of coronary artery lumen area: a first in man pilot study.

Science.gov (United States)

Hermiller, James; Choy, Jenny S; Svendsen, Mark; Bigelow, Brian; Fouts, Andrew M; Hall, Jack; Parr, Kirk; Ball, Michael; Sinha, Anjan; Bhatt, Deepak L; Kassab, Ghassan S

2011-08-01

The objective of this human pilot study was to determine the safety and the level of agreement between a novel nonimaging 2.7 Fr. catheter-based system (LumenRECON, LR) that uses electrical conductance for measurement of lumen cross-sectional area (CSA) with intravascular ultrasound (IVUS) and quantitative coronary angiography (QCA). Based on previous animal studies, we hypothesized the level of agreement between LR and IVUS to be 13%. Accurate and reproducible vessel sizing is essential for optimal percutaneous coronary intervention (PCI). A total of 12 patients were studied to evaluate the safety, accuracy, and reproducibility of the system in comparison with IVUS and QCA. The CSA of coronary arteries was determined by IVUS, QCA, and LR in the distal, proximal, and center of a lesion during standard PCI. A Bland-Altman plot of the LR versus IVUS and QCA show a nonsignificant mean difference between the two measurements of 0.04 and 0.07 mm in diameter, respectively. The root mean square error of LR versus IVUS and QCA was 14.3 and 25.8% of the mean IVUS or QCA diameter, respectively. The mean of the difference between two LR duplicate measurements was nearly zero (0.03 mm) and the repeatability coefficient was within 8.7% of the mean of the two measurements. There were no procedural complications nor were any device-related MACE reported within 30 days of the procedure. This proof of concept pilot study establishes the safety and accuracy of the conductance technology for a pivotal trial of coronary sizing. Copyright © 2011 Wiley-Liss, Inc.

Quantifying predictive capability of electronic health records for the most harmful breast cancer

Science.gov (United States)

Wu, Yirong; Fan, Jun; Peissig, Peggy; Berg, Richard; Tafti, Ahmad Pahlavan; Yin, Jie; Yuan, Ming; Page, David; Cox, Jennifer; Burnside, Elizabeth S.

2018-03-01

Improved prediction of the "most harmful" breast cancers that cause the most substantive morbidity and mortality would enable physicians to target more intense screening and preventive measures at those women who have the highest risk; however, such prediction models for the "most harmful" breast cancers have rarely been developed. Electronic health records (EHRs) represent an underused data source that has great research and clinical potential. Our goal was to quantify the value of EHR variables in the "most harmful" breast cancer risk prediction. We identified 794 subjects who had breast cancer with primary non-benign tumors with their earliest diagnosis on or after 1/1/2004 from an existing personalized medicine data repository, including 395 "most harmful" breast cancer cases and 399 "least harmful" breast cancer cases. For these subjects, we collected EHR data comprised of 6 components: demographics, diagnoses, symptoms, procedures, medications, and laboratory results. We developed two regularized prediction models, Ridge Logistic Regression (Ridge-LR) and Lasso Logistic Regression (Lasso-LR), to predict the "most harmful" breast cancer one year in advance. The area under the ROC curve (AUC) was used to assess model performance. We observed that the AUCs of Ridge-LR and Lasso-LR models were 0.818 and 0.839 respectively. For both the Ridge-LR and LassoLR models, the predictive performance of the whole EHR variables was significantly higher than that of each individual component (pbreast cancer, providing the possibility to personalize care for those women at the highest risk in clinical practice.

Modeling the potential risk factors of bovine viral diarrhea prevalence in Egypt using univariable and multivariable logistic regression analyses

Directory of Open Access Journals (Sweden)

Abdelfattah M. Selim

2018-03-01

Full Text Available Aim: The present cross-sectional study was conducted to determine the seroprevalence and potential risk factors associated with Bovine viral diarrhea virus (BVDV disease in cattle and buffaloes in Egypt, to model the potential risk factors associated with the disease using logistic regression (LR models, and to fit the best predictive model for the current data. Materials and Methods: A total of 740 blood samples were collected within November 2012-March 2013 from animals aged between 6 months and 3 years. The potential risk factors studied were species, age, sex, and herd location. All serum samples were examined with indirect ELIZA test for antibody detection. Data were analyzed with different statistical approaches such as Chi-square test, odds ratios (OR, univariable, and multivariable LR models. Results: Results revealed a non-significant association between being seropositive with BVDV and all risk factors, except for species of animal. Seroprevalence percentages were 40% and 23% for cattle and buffaloes, respectively. OR for all categories were close to one with the highest OR for cattle relative to buffaloes, which was 2.237. Likelihood ratio tests showed a significant drop of the -2LL from univariable LR to multivariable LR models. Conclusion: There was an evidence of high seroprevalence of BVDV among cattle as compared with buffaloes with the possibility of infection in different age groups of animals. In addition, multivariable LR model was proved to provide more information for association and prediction purposes relative to univariable LR models and Chi-square tests if we have more than one predictor.

Clinical Diagnosis of Bordetella Pertussis Infection: A Systematic Review.

Science.gov (United States)

Ebell, Mark H; Marchello, Christian; Callahan, Maria

2017-01-01

Bordetella pertussis (BP) is a common cause of prolonged cough. Our objective was to perform an updated systematic review of the clinical diagnosis of BP without restriction by patient age. We identified prospective cohort studies of patients with cough or suspected pertussis and assessed study quality using QUADAS-2. We performed bivariate meta-analysis to calculate summary estimates of accuracy and created summary receiver operating characteristic curves to explore heterogeneity by vaccination status and age. Of 381 studies initially identified, 22 met our inclusion criteria, of which 14 had a low risk of bias. The overall clinical impression was the most accurate predictor of BP (positive likelihood ratio [LR+], 3.3; negative likelihood ratio [LR-], 0.63). The presence of whooping cough (LR+, 2.1) and posttussive vomiting (LR+, 1.7) somewhat increased the likelihood of BP, whereas the absence of paroxysmal cough (LR-, 0.58) and the absence of sputum (LR-, 0.63) decreased it. Whooping cough and posttussive vomiting have lower sensitivity in adults. Clinical criteria defined by the Centers for Disease Control and Prevention were sensitive (0.90) but nonspecific. Typical signs and symptoms of BP may be more sensitive but less specific in vaccinated patients. The clinician's overall impression was the most accurate way to determine the likelihood of BP infection when a patient initially presented. Clinical decision rules that combine signs, symptoms, and point-of-care tests have not yet been developed or validated. © Copyright 2017 by the American Board of Family Medicine.

Action potential conduction between a ventricular cell model and an isolated ventricular cell

NARCIS (Netherlands)

Wilders, R.; Kumar, R.; Joyner, R. W.; Jongsma, H. J.; Verheijck, E. E.; Golod, D.; van Ginneken, A. C.; Goolsby, W. N.

1996-01-01

We used the Luo and Rudy (LR) mathematical model of the guinea pig ventricular cell coupled to experimentally recorded guinea pig ventricular cells to investigate the effects of geometrical asymmetry on action potential propagation. The overall correspondence of the LR cell model with the recorded

Selection of glutamate-rich protein long synthetic peptides for vaccine development: antigenicity and relationship with clinical protection and immunogenicity

DEFF Research Database (Denmark)

Theisen, M; Dodoo, D; Toure-Balde, A

2001-01-01

Antibodies against three long synthetic peptides (LSPs) derived from the glutamate-rich protein (GLURP) of Plasmodium falciparum were analyzed in three cohorts from Liberia, Ghana, and Senegal. Two overlapping LSPs, LR67 and LR68, are derived from the relatively conserved N-terminal nonrepeat...

Reduced reward anticipation in youth at high-risk for unipolar depression: A preliminary study

Directory of Open Access Journals (Sweden)

Thomas M. Olino

2014-04-01

Full Text Available Offspring of depressed parents are at risk for depression and recent evidence suggests that reduced positive affect (PA may be a marker of risk. We investigated whether self-reports of PA and fMRI-measured striatal response to reward, a neural correlate of PA, are reduced in adolescent youth at high familial risk for depression (HR relative to youth at low familial risk for depression (LR. Functional magnetic resonance imaging assessments were conducted with 14 HR and 12 LR youth. All youth completed an ecological momentary assessment protocol to measure PA in natural settings and a self-report measure of depression symptomatology. Analyses found that HR youth demonstrated lower striatal response than LR youth during both reward anticipation and outcome. However, after controlling for youth self-reports of depression, HR youth demonstrated lower striatal response than LR youth only during reward anticipation. No significant differences were found between HR and LR youth on subjective ratings of PA or depressive symptoms. Results are consistent with previous findings that reduced reward response is a marker of risk for depression, particularly during reward anticipation, even in the absence of (or accounting for disrupted subjective mood. Further examinations of prospective associations between reward response and depression onset are needed.

Male rats that differ in novelty exploration demonstrate distinct patterns of sexual behavior

Science.gov (United States)

Cummings, Jennifer A.; Clinton, Sarah M.; Perry, Adam N.; Akil, Huda; Becker, Jill B.

2014-01-01

High versus low novelty exploration predicts a variety of behavioral differences. For example, rats selectively-bred for high novelty exploration (bred High Responders, bHR) exhibit exaggerated aggression, impulsivity, and proclivity to addictive behaviors compared to low novelty-reactive rats (bred Low Responders, bLRs), which are characterized by a high anxiety/depressive-like phenotype. Since bHR/bLR rats exhibit differences in dopaminergic circuitry and differential response to rewarding stimuli (i.e., psychostimulants, food), the present study examined whether they also differ in another key hedonic behavior – sex. Thus, adult bHR/bLR males were given five 30-min opportunities to engage in sexual activity with a receptive female. Sexual behavior and motivation were examined and compared between the groups. The bHR/bLR phenotype affected both sexual motivation and behavior, with bLR males demonstrating reduced motivation for sex compared with bHR males (i.e., fewer animals copulated, longer latency to engage in sex). The bHR males required more intromissions at a faster pace per ejaculation than did bLR males. Thus, neurobiological differences that affect motivation for drugs of abuse, aggression, and impulsivity in rats also affect sexual motivation and performance. PMID:23398441

[Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

Science.gov (United States)

Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

2009-03-01

Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

Influence of disintegrants in different substrate physical form on dimensional recovery of multi-component tablet.

Science.gov (United States)

Sarkar, Srimanta; Ooi, Shing Ming; Liew, Celine Valeria; Tan, Bing Xun; Heng, Paul Wan Sia

2014-11-20

This study investigated the influence of different disintegrants, present in different substrate physical forms, on dimensional recovery of multi-component tablets prepared at different compression pressures. Formulations containing model drug, metformin, (10%, w/w), different disintegrants (10%, w/w), and lactose (80%, w/w) were compressed directly or after granulation using polyvinyl pyrrolidone (1%, w/w) as binder, into tablets (350 mg, 10mm diameter) at 150, 200, and 250 N/mm(2) compression pressures. Tablets were characterized for immediate dimensional recovery (IR) after ejection from the die, latent dimensional recovery (LR) over 24 h, tensile strength, and disintegration. The IR was predominantly contributed by crystalline components whereas LR was brought about by polymeric materials. With increased compression pressure, higher degree of plastic deformation of the polymeric disintegrants resulted in tablet with lower LR and higher tensile strength. Presence of polyvinyl pyrrolidone in the granules contributed considerably to plastic deformation, and the tablets produced had lower LR, higher tensile strength, and longer disintegration time. This study indicated that use of granules as the feed substrate physical form and a prudent selection of components may enable the coating of resultant tablets immediately after compression without the risk of coat damage due to LR. Copyright © 2014 Elsevier B.V. All rights reserved.

Predictive factors of local-regional recurrences following parotid sparing intensity modulated or 3D conformal radiotherapy for head and neck cancer

International Nuclear Information System (INIS)

Feng, Mary; Jabbari, Siavash; Lin, Alexander; Bradford, Carol R.; Chepeha, Douglas B.; Teknos, Theodoros N.; Worden, Francis P.; Tsien, Christina; Schipper, Matthew J.; Wolf, Gregory T.; Dawson, Laura A.; Eisbruch, Avraham

2005-01-01

Background and purpose: Predictive factors for local-regional (LR) failures after parotid-sparing, Intensity modulated (IMRT) or 3D conformal radiotherapy for head and neck (HN) cancers were assessed. Patients and methods: One hundred and fifty-eight patients with mostly stages III-IV HN squamous cell carcinoma underwent curative bilateral neck irradiation aimed at sparing the parotid glands. Patient, tumor, and treatment factors were analyzed as predictive factors for LR failure. Results: Twenty-three patients had LR recurrence (19 in-field and four marginal). No differences were found in the doses delivered to the PTVs of patients with or without in-field recurrences. In univariate analysis, tumor site was highly predictive for LR failure in both postoperative and definitive RT patients. In postoperative RT patients, pathologic tumor size, margin status, extracapsular extension (ECE) and number of lymph node metastases, were also significantly predictive. Multivariate analysis showed tumor site (oropharynx vs. other sites) to be a significant predictor in all patients, and involved margins and number of involved lymph nodes in postoperative patients. Conclusions: Clinical rather than dosimetric factors predicted for LR failures in this series, and were similar to those reported following standard RT. These factors may aid in the selection of patients for studies of treatment intensification using IMRT

The Landauer resistance and band spectra for the counting quantum Turing machine

International Nuclear Information System (INIS)

Benioff, P.

1996-01-01

In other work, the generalized counting quantum Turing machine (GCQTM) was studied. For any N this machine enumerates the first 2 N integers in succession as binary strings. The generalization consists of associating a potential with read 1 steps only. The Landauer Resistance (LR) and band spectra were determined for the tight binding Hamiltonians associated with the GCQTM for energies below the potential height. Here these calculations are extended to energies both above and below the barrier height. For parameters and potentials in the electron region, the LR fluctuates rapidly between very high and very low values as a function of momentum. The rapidity and extent of the fluctuations increases rapidly with increasing N. For N = 18, the largest value considered, the LR shows good transmission probability as a function of momentum with numerous holes of very high LR values present. This is true for energies both above and below the potential height. It is suggested that the main features of the LR can be explained by coherent superposition of the component waves reflected from or transmitted through or across the 2 N-1 potentials present in the distribution. If this explanation is correct, it provides a dramatic illustration of the effects of quantum nonlocality

Cell shape regulates global histone acetylation in human mammaryepithelial cells

Energy Technology Data Exchange (ETDEWEB)

Le Beyec, Johanne; Xu, Ren; Lee, Sun-Young; Nelson, Celeste M.; Rizki, Aylin; Alcaraz, Jordi; Bissell, Mina J.

2007-02-28

Extracellular matrix (ECM) regulates cell morphology and gene expression in vivo; these relationships are maintained in three-dimensional (3D) cultures of mammary epithelial cells. In the presence of laminin-rich ECM (lrECM), mammary epithelial cells round up and undergo global histone deacetylation, a process critical for their functional differentiation. However, it remains unclear whether lrECM-dependent cell rounding and global histone deacetylation are indeed part of a common physical-biochemical pathway. Using 3D cultures as well as nonadhesive and micropatterned substrata, here we showed that the cell 'rounding' caused by lrECM was sufficient to induce deacetylation of histones H3 and H4 in the absence of biochemical cues. Microarray and confocal analysis demonstrated that this deacetylation in 3D culture is associated with a global increase in chromatin condensation and a reduction in gene expression. Whereas cells cultured on plastic substrata formed prominent stress fibers, cells grown in 3D lrECM or on micropatterns lacked these structures. Disruption of the actin cytoskeleton with cytochalasin D phenocopied the lrECM-induced cell rounding and histone deacetylation. These results reveal a novel link between ECM-controlled cell shape and chromatin structure, and suggest that this link is mediated by changes in the actin cytoskeleton.

Curative Intent Treatment of Hepatocellular Carcinoma - 844 Cases Treated in a General Surgery and Liver Transplantation Center.

Science.gov (United States)

Grigorie, Răzvan; Alexandrescu, Sorin; Smira, Gabriela; Ionescu, Mihnea; Hrehoreţ, Doina; Braşoveanu, Vladislav; Dima, Simona; Ciurea, Silviu; Boeţi, Patricia; Dudus, Ionut; Picu, Nausica; Zamfir, Radu; David, Leonard; Botea, Florin; Gheorghe, Liana; Tomescu, Dana; Lupescu, Ioana; Boroş, Mirela; Grasu, Mugur; Dumitru, Radu; Toma, Mihai; Croitoru, Adina; Herlea, Vlad; Pechianu, Cătălin; Năstase, Anca; Popescu, Irinel

2017-01-01

Background: The objective of this study is to assess the outcome of the patients treated for hepatocellular carcinoma (HCC) in a General Surgery and Liver Transplantation Center. Methods: This retrospective study includes 844 patients diagnosed with HCC and surgically treated with curative intent methods. Curative intent treatment is mainly based on surgery, consisting of liver resection (LR), liver transplantation (LT). Tumor ablation could become the choice of treatment in HCC cases not manageable for surgery (LT or LR). 518 patients underwent LR, 162 patients benefited from LT and in 164 patients radiofrequency ablation (RFA) was performed. 615 patients (73%) presented liver cirrhosis. Results: Mordidity rates of patient treated for HCC was 30% and mortality was 4,3% for the entire study population. Five year overall survival rate was 39 % with statistically significant differences between transplanted, resected, or ablated patients (p 0.05) with better results in case of LT followed by LR and RFA. Conclusions: In HCC patients without liver cirrhosis, liver resection is the treatment of choice. For early HCC occurred on cirrhosis, LT offers the best outcome in terms of overall and disease free survival. RFA colud be a curative method for HCC patients not amenable for LT of LR. Celsius.

Azacitidine in Lower-Risk Myelodysplastic Syndromes: A Meta-Analysis of Data from Prospective Studies.

Science.gov (United States)

Komrokji, Rami; Swern, Arlene S; Grinblatt, David; Lyons, Roger M; Tobiasson, Magnus; Silverman, Lewis R; Sayar, Hamid; Vij, Ravi; Fliss, Albert; Tu, Nora; Sugrue, Mary M

2018-02-01

After erythropoiesis-stimulating agent (ESA) failure, lenalidomide and hypomethylating agents are the only remaining treatment options for most patients with lower-risk myelodysplastic syndromes (LR-MDS). Optimal choice of these agents as front-line therapy in non-del(5q) LR-MDS is unclear. Because azacitidine clinical data mainly describe experience in higher-risk MDS, we performed a meta-analysis of patient-level data to evaluate azacitidine in patients with red blood cell (RBC) transfusion-dependent LR-MDS. We searched English-language articles for prospective phase II and III azacitidine clinical trials and patient registries published between 2000 and 2015, and Embase abstracts from 2015 conferences. Patient-level data from identified relevant studies were provided by investigators. Meta-analyses followed Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Efficacy endpoints were RBC transfusion independence (TI) and Clinical Benefit (RBC-TI, erythroid response, and complete or partial remission, per International Working Group 2006 criteria for MDS). Data for 233 patients from 6 clinical studies and 1 registry study met criteria for inclusion in analyses. Overall, 90.3% of patients had non-del(5q) LR-MDS. Pooled estimates from random-effects models of RBC-TI and Clinical Benefit were 38.9% and 81.1%, respectively; for the ESA-refractory subgroup, they were 40.5% and 77.3%; and for patients with isolated anemia, they were 41.9% and 82.5%. In multivariate analyses, planned use of ≥6 azacitidine treatment cycles was significantly predictive of response. Azacitidine effects in these patients, most with non-del(5q) LR-MDS, were promising and generally similar to those reported for lenalidomide in similar patients. The choice of initial therapy is important because most patients eventually stop responding to front-line therapy and alternatives are limited. Lower-risk myelodysplastic syndromes (LR-MDS) are primarily characterized by

[Effect of different volumes of fluid resuscitation on hemorrhagic shock with pulmonary edema at high altitude in the unacclimated rat].

Science.gov (United States)

Liu, Liang-ming; Hu, De-yao; Liu, Jian-cang; Li, Ping; Liu, Hou-dong; Xiao, Nan; Zhou, Xue-wu; Tian, Kun-lun; Huo, Xiao-ping; Shi, Quan-gui; He, Yan-mei; Yin, Zuo-ming

2003-05-01

To study the effects of different volumes of fluid resuscitation on hemorrhagic shock with pulmonary edema at high altitude in the unacclimated rat. One hundred and twenty-six SD rats transported to Lasa, Tibet, 3 760 meters above the sea level, were anesthetized one week later with sodium pentobarbital (30 mg/kg, intraperitoneal). Hemorrhagic shock with pulmonary edema model was induced by hemorrhage (50 mm Hg for 1 hour, 1 mmHg=0.133 kPa) plus intravenous injection of oleic acid (50 microl/kg). Experiments were then conducted in two parts. Sixty-three rats in part I were equally divided into nine groups (n=7): normal control, hemorrhagic shock control, hemorrhagic shock with pulmonary edema (HSPE) without fluid infusion, HSPE plus infusing lactated Ringer's solution (LR) with 0.5-, 1-, 1.5-, 2- or 3- fold volume shed blood, and 1 volume of LR plus mannitol (10 ml/kg). Hemodynamic parameters including mean arterial blood pressure (MAP), left intraventricular systolic pressure (LVSP) and the maximal change rate of intraventricular pressure rise or decline (+/- dp/dt max) were observed at 15, 30, 60 and 120 minutes after infusion, blood gases were measured at 30 and 120 minutes after infusion and the water content of lung and brain was determined at 120 minutes after infusion. In part II, additional 63 rats were used to observe the effect of different volumes of fluid resuscitation on survival time of HSPE rats. 0.5 volume of LR infusion significantly improved MAP, LVSP and +/- dp/dt max, prolonged the survival time of HSPE animals (all P<0.01), while it did not increase the water content of lung and brain and had no marked influence on blood gases. One volume of LR infusion slightly improved hemodynamic parameters, prolonged the survival time and increased the water content of lung. More than 1 volume of LR infusion including 1.5-, 2- and 3- fold volume LR deteriorated the hemodynamic parameters and decreased the survival time of shocked animal, meanwhile they

75 FR 35510 - License Renewal Interim Staff Guidance Process, Revision 2 Notice of Availability

Science.gov (United States)

2010-06-22

... Related Regulatory Functions.'' An electronic copy of the revised LR-ISG process is available in the NRC's Agencywide Documents Access and Management System (ADAMS) under Accession No. ML100920158. The revised LR-ISG... interim changes to certain NRC license renewal guidance documents. These guidance documents facilitate the...

Nanoimprinted reflecting gratings for long-range surface plasmon polaritons

DEFF Research Database (Denmark)

Pedersen, Rasmus Haugstrup; Boltasseva, Alexandra; Johansen, Dan Mario

2007-01-01

We present a novel design, fabrication, and characterization of reflecting gratings for long-range surface plasmon polaritons (LR-SPPs) at telecom wavelengths. LR-SPP waveguides consisting of a thin (12 nm) gold film embedded in a thick (45 μm) layer of dielectric polymer cladding are structured...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

In this study, logistic regression (LR) and analysis of covariance (ANCOVA) models were used and their performance was assessed. Finally, thelandslide susceptibility classes were produced and an evaluation of models was done by using receiver operating characteristic curves. The area under the curve for LR and ...

Continuons left-right symmetrical model of electroweak interactions

International Nuclear Information System (INIS)

Boyarkin, O.M.

1993-01-01

The left-right model (LR) is suggested which is characterized by the orientation angle of the SU(2) R generator in the group space. This model reproduces all the known LR models. The production processes of gauge bosons at electron-positron and hardon colliders are investigated

75 FR 75704 - Pacific Gas and Electric Company (Diablo Canyon Nuclear Power Plant, Units 1 And 2); Notice of...

Science.gov (United States)

2010-12-06

... NUCLEAR REGULATORY COMMISSION [Docket Nos. 50-275-LR; 50-323-LR] Pacific Gas and Electric Company (Diablo Canyon Nuclear Power Plant, Units 1 And 2); Notice of Appointment of Adjudicatory Employee... Seismologist, Office of Nuclear Material Safety and Safeguards, has been appointed as a Commission adjudicatory...

Dicty_cDB: Contig-U16124-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available ... 52 0.083 1 ( DR077081 ) Lr_CHECF_79G12_M13R Earthworm Head Enriched libra... ...52 0.083 1 ( DR077008 ) Lr_CHECF_64C12_M13R Earthworm Head Enriched libra... 52 0.083 1 ( CX273125 ) 39RDBRT

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

Science.gov (United States)

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

Life review based on remembering specific positive events in active aging.

Science.gov (United States)

Latorre, José M; Serrano, Juan P; Ricarte, Jorge; Bonete, Beatriz; Ros, Laura; Sitges, Esther

2015-02-01

The aim of this study is to evaluate the effectiveness of life review (LR) based on specific positive events in non-depressed older adults taking part in an active aging program. Fifty-five older adults were randomly assigned to an experimental group or an active control (AC) group. A six-session individual training of LR based on specific positive events was carried out with the experimental group. The AC group undertook a "media workshop" of six sessions focused on learning journalistic techniques. Pre-test and post-test measures included life satisfaction, depressive symptoms, experiencing the environment as rewarding, and autobiographical memory (AM) scales. LR intervention decreased depressive symptomatology, improved life satisfaction, and increased specific memories. The findings suggest that practice in AM for specific events is an effective component of LR that could be a useful tool in enhancing emotional well-being in active aging programs, thus reducing depressive symptoms. © The Author(s) 2014.

Opposing nodal and BMP signals regulate left-right asymmetry in the sea urchin larva.

Directory of Open Access Journals (Sweden)

Yi-Jyun Luo

Full Text Available Nodal and BMP signals are important for establishing left-right (LR asymmetry in vertebrates. In sea urchins, Nodal signaling prevents the formation of the rudiment on the right side. However, the opposing pathway to Nodal signaling during LR axis establishment is not clear. Here, we revealed that BMP signaling is activated in the left coelomic pouch, specifically in the veg2 lineage, but not in the small micromeres. By perturbing BMP activities, we demonstrated that BMP signaling is required for activating the expression of the left-sided genes and the formation of the left-sided structures. On the other hand, Nodal signals on the right side inhibit BMP signaling and control LR asymmetric separation and apoptosis of the small micromeres. Our findings show that BMP signaling is the positive signal for left-sided development in sea urchins, suggesting that the opposing roles of Nodal and BMP signals in establishing LR asymmetry are conserved in deuterostomes.

Responses of the antioxidative and biotransformation enzymes in the aquatic fungus Mucor hiemalis exposed to cyanotoxins.

Science.gov (United States)

Balsano, Evelyn; Esterhuizen-Londt, Maranda; Hoque, Enamul; Lima, Stephan Pflugmacher

2017-08-01

To investigate antioxidative and biotransformation enzyme responses in Mucor hiemalis towards cyanotoxins considering its use in mycoremediation applications. Catalase (CAT), glutathione reductase (GR), and glutathione peroxidase (GPx) in M. hiemalis maintained their activities at all tested microcystin-LR (MC-LR) exposure concentrations. Cytosolic glutathione S-transferase (GST) activity decreased with exposure to 100 µg MC-LR l -1 while microsomal GST remained constant. Cylindrospermopsin (CYN) at 100 µg l -1 led to an increase in CAT activity and inhibition of GR, as well as to a concentration-dependent GPx inhibition. Microsomal GST was inhibited at all concentrations tested. β-N-methylamino-L-alanine (BMAA) inhibited GR activity in a concentration-dependent manner, however, CAT, GPx, and GST remained unaffected. M. hiemalis showed enhanced oxidative stress tolerance and intact biotransformation enzyme activity towards MC-LR and BMAA in comparison to CYN, confirming its applicability in bioreactor technology in terms of viability and survival in their presence.

Low frequency phononic band structures in two-dimensional arc-shaped phononic crystals

International Nuclear Information System (INIS)

Xu, Zhenlong; Wu, Fugen; Guo, Zhongning

2012-01-01

The low frequency phononic band structures of two-dimensional arc-shaped phononic crystals (APCs) were studied by the transfer matrix method in cylindrical coordinates. The results showed the first phononic band gaps (PBGs) of APCs from zero Hz with low modes. Locally resonant (LR) gaps were obtained with higher-order rotation symmetry, due to LR frequencies corresponding to the speeds of acoustic waves in the materials. These properties can be efficiently used in a structure for low frequencies that are forbidden, or in a device that permits a narrow window of frequencies. -- Highlights: ► We report a new class of quasi-periodic hetero-structures, arc-shaped phononic crystals (APCs). ► The results show the first PBGs start with zero Hz with low modes. ► Locally resonant (LR) gaps were obtained with higher-order rotation symmetry, due to LR frequencies corresponding to the speeds of acoustic waves in the materials.

Differential diagnosis in patients with ring-like thallium-201 uptake in brain SPECT

Energy Technology Data Exchange (ETDEWEB)

Kinuya, Keiko; Ohashi, Masahiro; Itoh, Syotaro [Tonami General Hospital, Toyama (Japan)] (and others)

2002-09-01

This study was performed to investigate lesions with ring-like thallium-201 ({sup 201}Tl) uptake and to determine whether SPECT provides any information in differential diagnosis. A total of 244 {sup 201}Tl SPECT images were reviewed. In each study, early (15 min postinjection) and late (3 hr) brain SPECT images were obtained with 111 MBq of {sup 201}Tl. The early uptake ratio (ER; lesion to normal brain average count ratio) and the late uptake ratio (LR) and the L/E ratio (ratio of LR to ER) were calculated. Ring-like uptake was observed in pre-therapeutic 26 SPECT images, including ten glioblastoma multiformes (ER, 3.45{+-}0.64; LR, 2.74{+-}0.54; L/E ratio 0.80{+-}0.13), five meningiomas (6.48{+-}2.34; 4.41{+-}1.41; 0.72{+-}0.19), four metastatic lung cancers (3.47{+-}1.23; 2.40{+-}0.98; 0.70{+-}0.14), four brain abscesses (2.48{+-}1.06; 1.59{+-}0.30; 0.78{+-}0.15), one invasive lesion of squamous cell carcinoma from the ethmoid sinus (1.54; 1.52; 0.99), one medulloblastoma (3.53; 3.52; 1.00) and one hematoma (3.32; 2.36; 0.71). The ER of meningioma was significantly higher than those of glioblastoma multiforme (p<0.0005), metastatic lung cancer (p<0.005) and brain abscess (p<0.0005). There were no significant differences among these three entities. The LR of meningioma was significantly higher than those of glioblastoma multiforme (p<0.005), metastatic lung cancer (p<0.005) and brain abscess (p<0.0001). The LR of brain abscess was significantly lower than that of glioblastoma multiforme (p<0.05). The L/E ratio could not differentiate these four entities. High ER and high LR in a lesion with ring-like uptake is likely an indicator of meningioma. The LR of brain abscess was significantly lower than that of glioblastoma multiforme, but {sup 201}Tl SPECT has still difficulty in differentiating abscess from brain tumor. (author)

Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

International Nuclear Information System (INIS)

Azuma, Koichi; Tsurutani, Junji; Sakai, Kazuko; Kaneda, Hiroyasu; Fujisaka, Yasuhito; Takeda, Masayuki; Watatani, Masahiro; Arao, Tokuzo; Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu; Nishio, Kazuto; Nakagawa, Kazuhiko

2011-01-01

Highlights: → A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. → Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. → Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC 50 of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

Switching addictions between HER2 and FGFR2 in HER2-positive breast tumor cells: FGFR2 as a potential target for salvage after lapatinib failure

Energy Technology Data Exchange (ETDEWEB)

Azuma, Koichi [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Tsurutani, Junji, E-mail: tsurutani_j@dotd.med.kindai.ac.jp [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Sakai, Kazuko; Kaneda, Hiroyasu [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Fujisaka, Yasuhito; Takeda, Masayuki [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Watatani, Masahiro [Department of Surgery, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Arao, Tokuzo [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Satoh, Taroh; Okamoto, Isamu; Kurata, Takayasu [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nishio, Kazuto [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohnohigashi, Osakasayama, Osaka 589-8511 (Japan)

2011-04-01

Highlights: {yields} A lapatinib-resistant breast cancer cell line, UACC812 (UACC812/LR), was found to harbor amplification of the FGFR2 gene. {yields} Inhibition of the molecule by a specific inhibitor of FGFR dramatically induced growth inhibition accompanied by cell death. {yields} Immunohistochemical analysis of patients with HER2-positive breast cancer demonstrated an association between FGFR2 expression and poor outcome for lapatinib-containing chemotherapy. -- Abstract: Agents that target HER2 have improved the prognosis of patients with HER2-amplified breast cancers. However, patients who initially respond to such targeted therapy eventually develop resistance to the treatment. We have established a line of lapatinib-resistant breast cancer cells (UACC812/LR) by chronic exposure of HER2-amplified and lapatinib-sensitive UACC812 cells to the drug. The mechanism by which UACC812/LR acquired resistance to lapatinib was explored using comprehensive gene hybridization. The FGFR2 gene in UACC812/LR was highly amplified, accompanied by overexpression of FGFR2 and reduced expression of HER2, and a cell proliferation assay showed that the IC{sub 50} of PD173074, a small-molecule inhibitor of FGFR tyrosine kinase, was 10,000 times lower in UACC812/LR than in the parent cells. PD173074 decreased the phosphorylation of FGFR2 and substantially induced apoptosis in UACC812/LR, but not in the parent cells. FGFR2 appeared to be a pivotal molecule for the survival of UACC812/LR as they became independent of the HER2 pathway, suggesting that a switch of addiction from the HER2 to the FGFR2 pathway enabled cancer cells to become resistant to HER2-targeted therapy. The present study is the first to implicate FGFR in the development of resistance to lapatinib in cancer, and suggests that FGFR-targeted therapy might become a promising salvage strategy after lapatinib failure in patients with HER2-positive breast cancer.

Comparison of the HEART and TIMI Risk Scores for Suspected Acute Coronary Syndrome in the Emergency Department.

Science.gov (United States)

Sun, Benjamin C; Laurie, Amber; Fu, Rongwei; Ferencik, Maros; Shapiro, Michael; Lindsell, Christopher J; Diercks, Deborah; Hoekstra, James W; Hollander, Judd E; Kirk, J Douglas; Peacock, W Frank; Anantharaman, Venkataraman; Pollack, Charles V

2016-03-01

The emergency department evaluation for suspected acute coronary syndrome (ACS) is common, costly, and challenging. Risk scores may help standardize clinical care and screening for research studies. The Thrombolysis in Myocardial Infarction (TIMI) and HEART are two commonly cited risk scores. We tested the null hypothesis that the TIMI and HEART risk scores have equivalent test characteristics. We analyzed data from the Internet Tracking Registry of Acute Coronary Syndromes (i*trACS) from 9 EDs on patients with suspected ACS, 1999-2001. We excluded patients with an emergency department diagnosis consistent with ACS, or without sufficient data to calculate TIMI and HEART scores. The primary outcome was 30-day major adverse cardiovascular events, including all-cause death, acute myocardial infarction, and urgent revascularization. We describe test characteristics of the TIMI and HEART risk scores. The study cohort included 8255 patients with 508 (6.2%) 30-day major adverse cardiovascular events. Receiver operating curve and reclassification analyses favored HEART [c statistic: 0.753, 95% confidence interval (CI): 0.733-0.773; continuous net reclassification improvement: 0.608, 95% CI: 0.527-0.689] over TIMI (c statistic: 0.678, 95% CI: 0.655-0.702). A HEART score 0-3 [negative predictive value (NPV) 0.982, 95% CI: 0.978-0.986; positive predictive value (PPV) 0.103, 95% CI: 0.094-0.113; likelihood ratio (LR) positive 1.76; LR negative 0.28] demonstrates similar or superior NPV/PPV/LR compared with TIMI = 0 (NPV 0.978, 95% CI: 0.971-0.983; PPV 0.077, 95% CI: 0.071-0.084; LR positive 1.28; LR negative 0.35) and TIMI = 0-1 (NPV 0.963, 95% CI: 0.958-0.968; PPV 0.102, 95% CI: 0.092-0.113; LR positive 1.73; LR negative 0.58). The HEART score has better discrimination than TIMI and outperforms TIMI within previously published "low-risk" categories.

The Kinetics of Urea in the Body after Liver Resection in the Experiment

Directory of Open Access Journals (Sweden)

P. N. Savilov

2016-01-01

Full Text Available Purpose. To study urea kinetics in the body after liver resection in the experiment.Material and Methods. Experiments were carried out on 45 white female rats weighing between 180 g and 220 g. Liver resection (LR was performed under ester anesthesia, wherein 15—20% of the organ weight was removed. Urea content was studied in biological fluids (arterial blood, venous — v.porta, v.hepatica, v.renalis — blood, choledochal bile, urine, and tissues of visceral organs (the thyroid gland, lungs, heart, liver, kidneys, spleen, stomach, intestine on days 3, 7, and 14 after LR. Results. LR, while reducing the urea content in the v. hepatica blood, does not lead to similar changes in the arterial blood. This is accompanied by increased urea reabsorption in kidneys and higher v.porta blood urea content, which, depending on the postoperative time, results either from reduced urea excretion into the small intestine lumen or from its greater production by enterocytes followed by metabolite intake into the portal blood flow. The urea intake from hepatocytes into the hepatic bile ducts did not change on day 3 after LR; however, it increased on day 7 and slowed down on day 14. LR caused no changes in the gastric tissues urea content; never theless, it led to its increased content in the duodenal and colonic tissues. Without affecting the cardiac muscleurea content, LR entailed its increase in the lungs and thyroid gland on postoperative days 3, 7, and 14. At the background of absence of similar changes in the arterial blood data indicates promotion of urea production by the cells of these organs or metabolite retention therein.Conclusions. LR not only changes urea kinetics in the portal system organs, but also activates extrahepatic mechanisms aimed at preventing development of the arterial blood urea deficit because of its abnormal intake from the resected organ into the central blood flow.

An integrated omic analysis of hepatic alteration in medaka fish chronically exposed to cyanotoxins with possible mechanisms of reproductive toxicity.

Science.gov (United States)

Qiao, Qin; Le Manach, Séverine; Huet, Hélène; Duvernois-Berthet, Evelyne; Chaouch, Soraya; Duval, Charlotte; Sotton, Benoit; Ponger, Loïc; Marie, Arul; Mathéron, Lucrèce; Lennon, Sarah; Bolbach, Gérard; Djediat, Chakib; Bernard, Cécile; Edery, Marc; Marie, Benjamin

2016-12-01

Cyanobacterial blooms threaten human health as well as the population of other living organisms in the aquatic environment, particularly due to the production of natural toxic components, the cyanotoxin. So far, the most studied cyanotoxins are microcystins (MCs). In this study, the hepatic alterations at histological, proteome and transcriptome levels were evaluated in female and male medaka fish chronically exposed to 1 and 5 μg L -1 microcystin-LR (MC-LR) and to the extract of MC-producing Microcystis aeruginosa PCC 7820 (5 μg L -1 of equivalent MC-LR) by balneation for 28 days, aiming at enhancing our understanding of the potential reproductive toxicity of cyanotoxins in aquatic vertebrate models. Indeed, both MC and Microcystis extract adversely affect reproductive parameters including fecundity and egg hatchability. The liver of toxin treated female fish present glycogen storage loss and cellular damages. The quantitative proteomics analysis revealed that the quantities of 225 hepatic proteins are dysregulated. In particular, a notable decrease in protein quantities of vitellogenin and choriogenin was observed, which could explain the decrease in reproductive output. Liver transcriptome analysis through Illumina RNA-seq reveals that over 100-400 genes are differentially expressed under 5 μg L -1  MC-LR and Microcystis extract treatments, respectively. Ingenuity pathway analysis of the omic data attests that various metabolic pathways, such as energy production, protein biosynthesis and lipid metabolism, are disturbed by both MC-LR and the Microcystis extract, which could provoke the observed reproductive impairment. The transcriptomics analysis also constitutes the first report of the impairment of circadian rhythm-related gene induced by MCs. This study contributes to a better understanding of the potential consequences of chronic exposure of fish to environmental concentrations of cyanotoxins, suggesting that Microcystis extract could impact a

Fresh produce and their soils accumulate cyanotoxins from irrigation water: Implications for public health and food security.

Science.gov (United States)

Lee, Seungjun; Jiang, Xuewen; Manubolu, Manjunath; Riedl, Ken; Ludsin, Stuart A; Martin, Jay F; Lee, Jiyoung

2017-12-01

Microcystin (MC), a hepatotoxin that can adversely affect human health, has become more prevalent in freshwater ecosystems worldwide, owing to an increase in toxic cyanobacteria blooms. While consumption of water and fish are well-documented exposure pathways of MCs to humans, less is known about the potential transfer to humans through consumption of vegetables that have been irrigated with MC-contaminated water. Likewise, the impact of MC on the performance of food crops is understudied. To help fill these information gaps, we conducted a controlled laboratory experiment in which we exposed lettuce, carrots, and green beans to environmentally relevant concentrations of MC-LR (0, 1, 5, and 10μg/L) via two irrigation methods (drip and spray). We used ELISA and LC-MS/MS to quantify MC-LR concentrations and in different parts of the plant (edible vs. inedible fractions), measured plant performance (e.g., size, mass, edible leaves, color), and calculated human exposure risk based on accumulation patterns. MC-LR accumulation was positively dose-dependent, with it being greater in the plants (2.2-209.2μg/kg) than in soil (0-19.4μg/kg). MC-LR accumulation varied among vegetable types, between plant parts, and between irrigation methods. MC-LR accumulation led to reduced crop growth and quality, with MC-LR persisting in the soil after harvest. Observed toxin accumulation patterns in edible fractions of plants also led to estimates of daily MC-LR intake that exceeded both the chronic reference dose (0.003μg/kg of body weight) and total daily intake guidelines (0.04μg/kg of body weight). Because the use of MC-contaminated water is common in many parts of the world, our collective findings highlight the need for guidelines concerning the use of MC-contaminated water in irrigation, as well as consumption of these crops. Copyright © 2017 Elsevier Ltd. All rights reserved.

Rye Bran Modified with Cell Wall-Degrading Enzymes Influences the Kinetics of Plant Lignans but Not of Enterolignans in Multicatheterized Pigs.

Science.gov (United States)

Bolvig, Anne K; Nørskov, Natalja P; van Vliet, Sophie; Foldager, Leslie; Curtasu, Mihai V; Hedemann, Mette S; Sørensen, Jens F; Lærke, Helle N; Bach Knudsen, Knud E

2017-12-01

Background: Whole-grain intake is associated with a lower risk of chronic Western-style diseases, possibly brought about by the high concentration of phytochemicals, among them plant lignans (PLs), in the grains. Objective: We studied whether treatment of rye bran with cell wall-degrading enzymes changed the solubility and kinetics of PLs in multicatheterized pigs. Methods: Ten female Duroc × Danish Landrace × Yorkshire pigs (60.3 ± 2.3 kg at surgery) fitted with permanent catheters were included in an incomplete crossover study. The pigs were fed 2 experimental diets for 1-7 d. The diets were rich in PLs and based on nontreated lignan-rich [LR; lignan concentration: 20.2 mg dry matter (DM)/kg] or enzymatically treated lignan-rich (ENZLR; lignan concentration: 27.8 mg DM/kg) rye bran. Plasma concentrations of PLs and enterolignans were quantified with the use of targeted LC-tandem mass spectrometry. Data were log transformed and analyzed with mixed-effects, 1-compartment, and asymptotic regression models. Results: The availability of PLs was 38% greater in ENZLR than in LR, and the soluble fraction of PLs was 49% in ENZLR compared with 35% in LR diets. PLs appeared in the circulation 30 min after intake of both the ENZLR and LR diets. Postprandially, consumption of ENZLR resulted in a 4-times-greater ( P concentration compared with LR. The area under the curve (AUC) measured 0-360 min after ENZLR intake was ∼2 times higher than after LR intake. A 1-compartment model could describe the postprandial increase in plasma concentration after ENZLR intake, whereas an asymptotic regression model described the plasma concentrations after LR intake. Despite increased available and soluble PLs, ENZLR did not increase plasma enterolignans. Conclusion: The modification of rye bran with cell wall-degrading enzymes resulted in significantly greater plasma concentrations of PLs and the 4-h AUC, particularly syringaresinol, in multicatheterized pigs. © 2017 American Society

Integrated ligand-receptor bioinformatic and in vitro functional analysis identifies active TGFA/EGFR signaling loop in papillary thyroid carcinomas.

Directory of Open Access Journals (Sweden)

Debora Degl'Innocenti

Full Text Available BACKGROUND: Papillary thyroid carcinoma (PTCs, the most frequent thyroid cancer, is usually not life threatening, but may recur or progress to aggressive forms resistant to conventional therapies. A more detailed understanding of the signaling pathways activated in PTCs may help to identify novel therapeutic approaches against these tumors. The aim of this study is to identify signaling pathways activated in PTCs. METHODOLOGY/PRINCIPAL FINDINGS: We examined coordinated gene expression patterns of ligand/receptor (L/R pairs using the L/R database DRLP-rev1 and five publicly available thyroid cancer datasets of gene expression on a total of 41 paired PTC/normal thyroid tissues. We identified 26 (up and 13 (down L/R pairs coordinately and differentially expressed. The relevance of these L/R pairs was confirmed by performing the same analysis on REarranged during Transfection (RET/PTC1-infected thyrocytes with respect to normal thyrocytes. TGFA/EGFR emerged as one of the most tightly regulated L/R pair. Furthermore, PTC clinical samples analyzed by real-time RT-PCR expressed EGFR transcript levels similar to those of 5 normal thyroid tissues from patients with pathologies other than thyroid cancer, whereas significantly elevated levels of TGFA transcripts were only present in PTCs. Biochemical analysis of PTC cell lines demonstrated the presence of EGFR on the cell membrane and TGFA in conditioned media. Moreover, conditioned medium of the PTC cell line NIM-1 activated EGFR expressed on HeLa cells, culminating in both ERK and AKT phosphorylation. In NIM-1 cells harboring BRAF mutation, TGFA stimulated proliferation, contributing to PI3K/AKT activation independent of MEK/ERK signaling. CONCLUSIONS/SIGNIFICANCE: We compiled a reliable list of L/R pairs associated with PTC and validated the biological role of one of the emerged L/R pair, the TGFA/EGFR, in this cancer, in vitro. These data provide a better understanding of the factors involved in the

Evaluation of direct and indirect ethanol biomarkers using a likelihood ratio approach to identify chronic alcohol abusers for forensic purposes.

Science.gov (United States)

Alladio, Eugenio; Martyna, Agnieszka; Salomone, Alberto; Pirro, Valentina; Vincenti, Marco; Zadora, Grzegorz

2017-02-01

The detection of direct ethanol metabolites, such as ethyl glucuronide (EtG) and fatty acid ethyl esters (FAEEs), in scalp hair is considered the optimal strategy to effectively recognize chronic alcohol misuses by means of specific cut-offs suggested by the Society of Hair Testing. However, several factors (e.g. hair treatments) may alter the correlation between alcohol intake and biomarkers concentrations, possibly introducing bias in the interpretative process and conclusions. 125 subjects with various drinking habits were subjected to blood and hair sampling to determine indirect (e.g. CDT) and direct alcohol biomarkers. The overall data were investigated using several multivariate statistical methods. A likelihood ratio (LR) approach was used for the first time to provide predictive models for the diagnosis of alcohol abuse, based on different combinations of direct and indirect alcohol biomarkers. LR strategies provide a more robust outcome than the plain comparison with cut-off values, where tiny changes in the analytical results can lead to dramatic divergence in the way they are interpreted. An LR model combining EtG and FAEEs hair concentrations proved to discriminate non-chronic from chronic consumers with ideal correct classification rates, whereas the contribution of indirect biomarkers proved to be negligible. Optimal results were observed using a novel approach that associates LR methods with multivariate statistics. In particular, the combination of LR approach with either Principal Component Analysis (PCA) or Linear Discriminant Analysis (LDA) proved successful in discriminating chronic from non-chronic alcohol drinkers. These LR models were subsequently tested on an independent dataset of 43 individuals, which confirmed their high efficiency. These models proved to be less prone to bias than EtG and FAEEs independently considered. In conclusion, LR models may represent an efficient strategy to sustain the diagnosis of chronic alcohol consumption

Validation of High-Risk Computed Tomography Features for Detection of Local Recurrence After Stereotactic Body Radiation Therapy for Early-Stage Non-Small Cell Lung Cancer

Energy Technology Data Exchange (ETDEWEB)

Peulen, Heike [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Mantel, Frederick [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Department of Radiation Oncology, University Hospital Zurich, Zurich (Switzerland); Guckenberger, Matthias [Department of Radiation Oncology, University of Wuerzburg, Wuerzburg (Germany); Belderbos, José [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands); Werner-Wasik, Maria [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Hope, Andrew; Giuliani, Meredith [Department of Radiation Oncology University of Toronto and Princess Margaret Cancer Center, Toronto, Ontario (Canada); Grills, Inga [Department of Radiation Oncology Beaumont Hospital, Royal Oak, Michigan (United States); Sonke, Jan-Jakob, E-mail: j.sonke@nki.nl [Department of Radiation Oncology, Netherlands Cancer Institute, Amsterdam (Netherlands)

2016-09-01

Purpose: Fibrotic changes after stereotactic body radiation therapy (SBRT) for stage I non-small cell lung cancer (NSCLC) are difficult to distinguish from local recurrences (LR), hampering proper patient selection for salvage therapy. This study validates previously reported high-risk computed tomography (CT) features (HRFs) for detection of LR in an independent patient cohort. Methods and Materials: From a multicenter database, 13 patients with biopsy-proven LR were matched 1:2 to 26 non-LR control patients based on dose, planning target volume (PTV), follow-up time, and lung lobe. Tested HRFs were enlarging opacity, sequential enlarging opacity, enlarging opacity after 12 months, bulging margin, linear margin disappearance, loss of air bronchogram, and craniocaudal growth. Additionally, 2 new features were analyzed: the occurrence of new unilateral pleural effusion, and growth based on relative volume, assessed by manual delineation. Results: All HRFs were significantly associated with LR except for loss of air bronchogram. The best performing HRFs were bulging margin, linear margin disappearance, and craniocaudal growth. Receiver operating characteristic analysis of the number of HRFs to detect LR had an area under the curve (AUC) of 0.97 (95% confidence interval [CI] 0.9-1.0), which was identical to the performance described in the original report. The best compromise (closest to 100% sensitivity and specificity) was found at ≥4 HRFs, with a sensitivity of 92% and a specificity of 85%. A model consisting of only 2 HRFs, bulging margin and craniocaudal growth, resulted in a sensitivity of 85% and a specificity of 100%, with an AUC of 0.96 (95% CI 0.9-1.0) (HRFs ≥2). Pleural effusion and relative growth did not significantly improve the model. Conclusion: We successfully validated CT-based HRFs for detection of LR after SBRT for early-stage NSCLC. As an alternative to number of HRFs, we propose a simplified model with the combination of the 2 best HRFs

Likelihood ratio data to report the validation of a forensic fingerprint evaluation method

NARCIS (Netherlands)

Ramos, Daniel; Haraksim, Rudolf; Meuwly, Didier

2017-01-01

Data to which the authors refer to throughout this article are likelihood ratios (LR) computed from the comparison of 5–12 minutiae fingermarks with fingerprints. These LRs data are used for the validation of a likelihood ratio (LR) method in forensic evidence evaluation. These data present a

77 FR 21813 - Changes to the Generic Aging Lessons Learned (GALL) Report Revision 2 AMP XI.M41, “Buried and...

Science.gov (United States)

2012-04-11

... NUCLEAR REGULATORY COMMISSION [NRC-2012-0055] Changes to the Generic Aging Lessons Learned (GALL) Report Revision 2 AMP XI.M41, ``Buried and Underground Piping and Tanks'' AGENCY: Nuclear Regulatory... Guidance (LR-ISG), LR-ISG-2011-03, ``Changes to GALL Report Revision 2 Aging Management Program (AMP) XI...

Neural and environmental factors impacting maternal behavior differences in high- versus low-novelty-seeking rats.

Science.gov (United States)

Clinton, Sarah M; Bedrosian, Tracy A; Abraham, Antony D; Watson, Stanley J; Akil, Huda

2010-04-01

Selective breeding of rats exhibiting differences in novelty-induced locomotion revealed that this trait predicts several differences in emotional behavior. Bred High Responders (bHRs) show exaggerated novelty-induced locomotion, aggression, and psychostimulant self-administration, compared to bred Low Responders (bLRs), which are inhibited and prone to anxiety- and depression-like behavior. Our breeding studies highlight the heritability of the bHR/bLR phenotypes, although environmental factors like maternal care also shape some aspects of these traits. We previously reported that HR vs. LR mothers act differently, but it was unclear whether their behaviors were genetically driven or influenced by their pups. The present study (a) used cross-fostering to evaluate whether the bHR/bLR maternal styles are inherent to mothers and/or are modulated by pups; and (b) assessed oxytocin and oxytocin receptor mRNA expression to examine possible underpinnings of bHR/bLR maternal differences. While bHR dams exhibited less maternal behavior than bLRs during the dark/active phase, they were very attentive to pups during the light phase, spending greater time passive nursing and in contact with pups compared to bLRs. Cross-fostering only subtly changed bHR and bLR dams' behavior, suggesting that their distinct maternal styles are largely inherent to the mothers. We also found elevated oxytocin mRNA levels in the supraoptic nucleus of the hypothalamus in bHR versus bLR dams, which may play some role in driving their behavior differences. Overall these studies shed light on the interplay between the genetics of mothers and infants in driving differences in maternal style. Copyright 2010 Elsevier Inc. All rights reserved.