WorldWideScience

Sample records for linear polyatomic molecules

  1. Attosecond-recollision-controlled selective fragmentation of polyatomic molecules.

    Science.gov (United States)

    Xie, Xinhua; Doblhoff-Dier, Katharina; Roither, Stefan; Schöffler, Markus S; Kartashov, Daniil; Xu, Huailiang; Rathje, Tim; Paulus, Gerhard G; Baltuška, Andrius; Gräfe, Stefanie; Kitzler, Markus

    2012-12-14

    Control over various fragmentation reactions of a series of polyatomic molecules (acetylene, ethylene, 1,3-butadiene) by the optical waveform of intense few-cycle laser pulses is demonstrated experimentally. We show both experimentally and theoretically that the responsible mechanism is inelastic ionization from inner-valence molecular orbitals by recolliding electron wave packets, whose recollision energy in few-cycle ionizing laser pulses strongly depends on the optical waveform. Our work demonstrates an efficient and selective way of predetermining fragmentation and isomerization reactions in polyatomic molecules on subfemtosecond time scales.

  2. Free and binary rotation of polyatomic molecules

    International Nuclear Information System (INIS)

    Konyukhov, V K

    2003-01-01

    A modification of the quantum-mechanical theory of rotation of polyatomic molecules (binary rotation) is proposed, which is based on the algebra and representations of the SO(4) group and allows the introduction of the concept of parity, as in atomic spectroscopy. It is shown that, if an asymmetric top molecule performing binary rotation finds itself in a spatially inhomogeneous electric field, its rotational levels acquire the additional energy due to the quadrupole moment. The existence of the rotational states of polyatomic molecules that cannot transfer to the free rotation state is predicted. In particular, the spin isomers of a water molecule, which corresponds to such states, can have different absolute values of the adsorption energy due to the quadrupole interaction of the molecule with a surface. The difference in the adsorption energies allows one to explain qualitatively the behaviour of the ortho- and para-molecules of water upon their adsorption on the surface of solids in accordance with experimental data. (laser applications and other topics in quantum electronics)

  3. Method for preparation and readout of polyatomic molecules in single quantum states

    Science.gov (United States)

    Patterson, David

    2018-03-01

    Polyatomic molecular ions contain many desirable attributes of a useful quantum system, including rich internal degrees of freedom and highly controllable coupling to the environment. To date, the vast majority of state-specific experimental work on molecular ions has concentrated on diatomic species. The ability to prepare and read out polyatomic molecules in single quantum states would enable diverse experimental avenues not available with diatomics, including new applications in precision measurement, sensitive chemical and chiral analysis at the single-molecule level, and precise studies of Hz-level molecular tunneling dynamics. While cooling the motional state of a polyatomic ion via sympathetic cooling with a laser-cooled atomic ion is straightforward, coupling this motional state to the internal state of the molecule has proven challenging. Here we propose a method for readout and projective measurement of the internal state of a trapped polyatomic ion. The method exploits the rich manifold of technically accessible rotational states in the molecule to realize robust state preparation and readout with far less stringent engineering than quantum logic methods recently demonstrated on diatomic molecules. The method can be applied to any reasonably small (≲10 atoms) polyatomic ion with an anisotropic polarizability.

  4. selective excitation of vibrational modes of polyatomic molecule

    Indian Academy of Sciences (India)

    Abstract. Mode-selective dynamics of triatomic molecule in the electronic ground state under continuous wave laser pulse is investigated for the discrete vibrational bound states. A non-perturbative approach has been used to analyse the vibrational couplings and dynamics of the molecule. Keywords. Polyatomic molecule ...

  5. Multiple photon infrared processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Harrison, R.G.; Butcher, S.R.

    1980-01-01

    This paper reviews current understanding of the process of multiple photon excitation and dissociation of polyatomic molecules, whereby in the presence of an intense infrared laser field a molecule may absorb upwards of 30 photons. The application of this process to new photochemistry and in particular laser isotope separation is also discussed. (author)

  6. Electrondriven processes in polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    McKoy, Vincent [California Inst. of Technology (CalTech), Pasadena, CA (United States)

    2017-03-20

    This project developed and applied scalable computational methods to obtain information about low-energy electron collisions with larger polyatomic molecules. Such collisions are important in modeling radiation damage to living systems, in spark ignition and combustion, and in plasma processing of materials. The focus of the project was to develop efficient methods that could be used to obtain both fundamental scientific insights and data of practical value to applications.

  7. Vibrational relaxation induced population inversions in laser pumped polyatomic molecules

    International Nuclear Information System (INIS)

    Shamah, I.; Flynn, G.; Columbia Univ., New York

    1981-01-01

    Conditions for population inversion in laser pumped polyatomic molecules are described. For systems which exhibit metastable vibrational population distributions, large, long lived inversions are possible even when the vibrational modes are strongly coupled by rapid collisional vibration-vibration (V-V) energy transfer. Overtone states of a hot mode are found to invert with respect to fundamental levels of a cold mode even at V-V steady state. Inversion persists for a V-T/R relaxation time. A gain of 4 m -1 for the 2ν 3 → ν 2 transition in CH 3 F (lambda approx. 15.9 μ) was found assuming a spontaneous emission lifetime of 10 s for this transition. General equations are derived which can be used to determine the magnitude of population inversion in any laser pumped, vibrationally metastable, polyatomic molecule. A discussion of factors controlling the population maxima of different vibrational states in optically pumped, V-V equilibrated metastable polyatomics is also given. (orig./WL)

  8. Collision cross section calculations for polyatomic ions considering rotating diatomic/linear gas molecules

    International Nuclear Information System (INIS)

    Larriba-Andaluz, Carlos; Hogan, Christopher J.

    2014-01-01

    Structural characterization of ions in the gas phase is facilitated by measurement of ion collision cross sections (CCS) using techniques such as ion mobility spectrometry. Further information is gained from CCS measurement when comparison is made between measurements and accurately predicted CCSs for model ion structures and the gas in which measurements are made. While diatomic gases, namely molecular nitrogen and air, are being used in CCS measurement with increasingly prevalency, the majority of studies in which measurements are compared to predictions use models in which gas molecules are spherical or non-rotating, which is not necessarily appropriate for diatomic gases. Here, we adapt a momentum transfer based CCS calculation approach to consider rotating, diatomic gas molecule collisions with polyatomic ions, and compare CCS predictions with a diatomic gas molecule to those made with a spherical gas molecular for model spherical ions, tetra-alkylammonium ions, and multiply charged polyethylene glycol ions. CCS calculations are performed using both specular-elastic and diffuse-inelastic collisions rules, which mimic negligible internal energy exchange and complete thermal accommodation, respectively, between gas molecule and ion. The influence of the long range ion-induced dipole potential on calculations is also examined with both gas molecule models. In large part we find that CCSs calculated with specular-elastic collision rules decrease, while they increase with diffuse-inelastic collision rules when using diatomic gas molecules. Results clearly show the structural model of both the ion and gas molecule, the potential energy field between ion and gas molecule, and finally the modeled degree of kinetic energy exchange between ion and gas molecule internal energy are coupled to one another in CCS calculations, and must be considered carefully to obtain results which agree with measurements

  9. Discrete Velocity Models for Polyatomic Molecules Without Nonphysical Collision Invariants

    Science.gov (United States)

    Bernhoff, Niclas

    2018-05-01

    An important aspect of constructing discrete velocity models (DVMs) for the Boltzmann equation is to obtain the right number of collision invariants. Unlike for the Boltzmann equation, for DVMs there can appear extra collision invariants, so called spurious collision invariants, in plus to the physical ones. A DVM with only physical collision invariants, and hence, without spurious ones, is called normal. The construction of such normal DVMs has been studied a lot in the literature for single species, but also for binary mixtures and recently extensively for multicomponent mixtures. In this paper, we address ways of constructing normal DVMs for polyatomic molecules (here represented by that each molecule has an internal energy, to account for non-translational energies, which can change during collisions), under the assumption that the set of allowed internal energies are finite. We present general algorithms for constructing such models, but we also give concrete examples of such constructions. This approach can also be combined with similar constructions of multicomponent mixtures to obtain multicomponent mixtures with polyatomic molecules, which is also briefly outlined. Then also, chemical reactions can be added.

  10. Desorption of organic molecules with fast incident atomic and polyatomic ions

    International Nuclear Information System (INIS)

    Hunt, J.E.; Salehpour, M.; Fishel, D.L.

    1989-01-01

    In 1974, Macfarlane and coworkers introduced a new mass spectrometric technique based on desorption-ionization of sample molecules from solid targets by the impact of fast heavy ions (fission fragments) from 252 Cf. The process of ion-induced desorption of molecular ions from surfaces is not yet fully understood, although a large amount of experimental data related to the mechanism has been published. This paper concerns the use of fast incident polyatomic ions to induce desorption of secondary molecular ions of valine and chlorophyll from surfaces. Polyatomic ions are unique in that they are a collection of temporally and spatially correlated atoms. The main finding in this study is that incident polyatomic ions produce drastic enhancements in the secondary ion yields over atomic ions. Also, two types of nonlinear effects in desorption have been observed and will be discussed

  11. Energy distribution in dissociations of polyatomic molecules

    International Nuclear Information System (INIS)

    Koernig, S.A.

    1989-01-01

    In this thesis studies are reported of fragmentation processes in polyatomic molecules. In order to find out which dessocaciation reactions take place, how they are brought about by the internal energy of the reactant, and to investigate the structure of the dissociating 'transition state', the fragment mass and the corresponding kinetic energy release (KER) are determined by differential translational spectroscopy using a position and time sensitive two-particle coincidence detector. The results are interpreted using the statistical theory of unimolecular dissociation. It turns out that the standard assumptions of the theory, especially in calculating KER-distributions, are not realistic in all molecules considered. Dissociation is induced by the neutralization with alkali metal vapour. In ch. 2 the experimental method and the analysis of the data (dissociation pathways, branching ratios and ε-d-distributions) are introduced and exemplified by measurements of cyclohexane, which represents the upper limit in precursor and fragment mass accessible in the apparatus. In ch. 3 a study is reported of the molecules methylchloride (CH 3 Cl) and the acetylradical (CH 3 CO). In spite of their similar geometric structures, completely different dissociation mechanisms have been found. Methylchloride dissociates via a repulsive state; acetyl radicals show energy scrambling. The energy distribution from dissociating acetyl exemplifies dynamical effects in the dissociation. In ch. 4 an investigation of a number of prototype hydrocarbons is presented. The dissociation pathways of several small linear alkanes indicate that neutralization takes place to unknown repulsive potentials, of which the position and steepness are determined from the kinetic energy release. (author). 118 refs.; 40 figs.; 5 tabs

  12. Calculations on isotope separation by laser induced photodissociation of polyatomic molecules. Final report

    International Nuclear Information System (INIS)

    Lamb, W.E. Jr.

    1978-11-01

    This report describes research on the theory of isotope separation produced by the illumination of polyatomic molecules by intense infrared laser radiation. Newton's equations of motion were integrated for the atoms of the SF 6 molecule including the laser field interaction. The first year's work has been largely dedicated to obtaining a suitable interatomic potential valid for arbitrary configurations of the seven particles. This potential gives the correct symmetry of the molecule, the equilibrium configuration, the frequencies of the six distinct normal modes of oscillation and the correct (or assumed) value of the total potential energy of the molecule. Other conditions can easily be imposed in order to obtain a more refined potential energy function, for example, by making allowance for anharmonicity data. A suitable expression was also obtained for the interaction energy between a laser field and the polyatomic molecule. The electromagnetic field is treated classically, and it would be easily possible to treat the cases of time dependent pulses, frequency modulation and noise

  13. Vacuum ultraviolet photoionization and photodissociation of polyatomic molecules and radicals

    Energy Technology Data Exchange (ETDEWEB)

    Ng, C.Y. [Iowa State Univ., Ames (United States)

    1993-12-01

    In the past decade, tremendous progress has been made in understanding the photodissociation (PD) dynamics of triatomic molecules. However, the PD study of radicals, especially polyatomic radicals, has remained essentially an unexplored research area. Detailed state-to-state PD cross sections for radicals in the UV and VUV provide challenges not only for dynamical calculations, but also for ab initio quantum chemical studies. The authors have developed a laser based pump-probe apparatus for the measurement of absolute PD cross sections for CH{sub 3}S and HS is summarized.

  14. Vibration-rotation band intensities in the IR spectra of polyatomic molecules

    International Nuclear Information System (INIS)

    El'kin, M.D.; Kosterina, E.K.; Berezin

    1995-01-01

    Using the curvilinear vibrational coordinates for a nuclear subsystem, expressions for the effective dipole-moment operators are derived in order to analyze the vibrational-rotational transitions in the IR spectra of polyatomic rigid molecules. The explicit expressions obtained for the intensities of hot bands allow one to estimate the influence of the vibration-rotation interaction within the framework of the adopted molecular-vibration model. The suggested method is shown to be suitable for Raman spectra analysis. 12 refs

  15. A brief introduction to molecular orbital theory of simple polyatomic molecules for undergraduate chemistry students

    Directory of Open Access Journals (Sweden)

    Ione M. Baibich

    2012-01-01

    Full Text Available A simple, four-step method for better introducing undergraduate students to the fundamentals of molecular orbital (MO theory of the polyatomic molecules H2O, NH3, BH3 and SiH4 using group theory is reported. These molecules serve to illustrate the concept of ligand group orbitals (LGOs and subsequent construction of MO energy diagrams on the basis of molecular symmetry requirements.

  16. Electron collision data for polyatomic molecules in plasma processing and environmental processes

    International Nuclear Information System (INIS)

    Tanaka, H.; Kitajima, M.; Cho, H.

    2002-01-01

    The experimental studies for electron-polyatomic molecule collision are reviewed in connection with the plasma processing and environmental issues. Recent developments in electron scattering experiments on the differential cross section measurements for various processes such as elastic scattering, vibrational, and electronic excitations are summarized from high to low energy regions (1-100 eV). The need for cross-section data for a broad variety of molecular species is also discussed because there is an urgent need to develop an international program to provide the scientific and technological communities with authoritative cross sections for electron-molecule interactions

  17. Selective excitation of a vibrational level within the electronic ground state of a polyatomic molecule with ultra pulses

    CSIR Research Space (South Africa)

    de Clercq, L

    2010-09-01

    Full Text Available Coherent control of the upper vibrational level populations in the electronic ground state of a polyatomic molecule was simulated. Results indicate that selective excitation of a specific upper state level is possible...

  18. Energy distribution in selected fragment vibrations in dissociation processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Band, Y.B.; Freed, K.F.

    1977-01-01

    The full quantum theory of dissociation processes in polyatomic molecules is converted to a form enabling the isolation of a selected fragment vibration. This form enables the easy evaluation of the probability distribution for energy partitioning between this vibration and all other degrees of freedom that results from the sudden Franck--Condon rearrangement process. The resultant Franck--Condon factors involve the square of the one-dimensional overlap integral between effective oscillator wavefunctions and the wavefunctions for the selected fragment vibration, a form that resembles the simple golden rule model for polyatomic dissociation and reaction processes. The full quantum theory can, therefore, be viewed as providing both a rigorous justification for certain generic aspects of the simple golden rule model as well as providing a number of important generalizations thereof. Some of these involve dealing with initial bound state vibrational excitation, explicit molecule, fragment and energy dependence of the effective oscillator, and the incorporation of all isotopic dependence. In certain limiting situations the full quantum theory yields simple, readily usable analytic expressions for the frequency and equilibrium position of the effective oscillator. Specific applications are presented for the direct photodissociation of HCN, DCN, and CO 2 where comparisons between the full theory and the simple golden rule are presented. We also discuss the generalizations of the previous theory to enable the incorporation of effects of distortion in the normal modes as a function of the reaction coordinate on the repulsive potential energy surface

  19. Bayesian optimization for constructing potential energy surfaces of polyatomic molecules with the smallest number of ab initio calculations

    Science.gov (United States)

    Vargas-Hernandez, Rodrigo A.; v Krems, Roman

    2017-04-01

    We examine the application of kernel methods of machine learning for constructing potential energy surfaces (PES) of polyatomic molecules. In particular, we illustrate the application of Bayesian optimization with Gaussian processes as an efficient method for sampling the configuration space of polyatomic molecules. Bayesian optimization relies on two key components: a prior over an objective function and a mechanism for sampling the configuration space. We use Gaussian processes to model the objective function and various acquisition functions commonly used in computer science to quantify the accuracy of sampling. The PES is obtained through an iterative process of adding ab initio points at the locations maximizing the acquisition function and re-trainig the Gaussian process with new points added. We sample different PESs with one or many acquisition functions and show how the acquisition functions affect the construction of the PESs.

  20. Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.

    Science.gov (United States)

    Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D

    2017-06-01

    X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is

  1. Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations

    Science.gov (United States)

    Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.

    2018-04-01

    Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.

  2. Rotational partition functions for linear molecules

    International Nuclear Information System (INIS)

    McDowell, R.S.

    1988-01-01

    An accurate closed-form expression for the rotational partition function of linear polyatomic molecules in 1 summation electronic states is derived, including the effect of nuclear spin (significant at very low temperatures) and of quartic and sextic centrifugal distortion terms (significant at moderate and high temperatures). The proper first-order quantum correction to the classical rigid-rotator partition function is shown to yield Q/sub r/ ≅β -1 exp(β/3), where βequivalenthcB/kT and B is the rotational constant in cm -1 ; for β≥0.2 additional power-series terms in β are necessary. Comparison between the results of this treatment and exact summations are made for HCN and C 2 H 2 at temperatures from 2 to 5000 K, including separate evaluation of the contributions of nuclear spin and centrifugal distortion

  3. Polyad quantum numbers and multiple resonances in anharmonic vibrational studies of polyatomic molecules.

    Science.gov (United States)

    Krasnoshchekov, Sergey V; Stepanov, Nikolay F

    2013-11-14

    In the theory of anharmonic vibrations of a polyatomic molecule, mixing the zero-order vibrational states due to cubic, quartic and higher-order terms in the potential energy expansion leads to the appearance of more-or-less isolated blocks of states (also called polyads), connected through multiple resonances. Such polyads of states can be characterized by a common secondary integer quantum number. This polyad quantum number is defined as a linear combination of the zero-order vibrational quantum numbers, attributed to normal modes, multiplied by non-negative integer polyad coefficients, which are subject to definition for any particular molecule. According to Kellman's method [J. Chem. Phys. 93, 6630 (1990)], the corresponding formalism can be conveniently described using vector algebra. In the present work, a systematic consideration of polyad quantum numbers is given in the framework of the canonical Van Vleck perturbation theory (CVPT) and its numerical-analytic operator implementation for reducing the Hamiltonian to the quasi-diagonal form, earlier developed by the authors. It is shown that CVPT provides a convenient method for the systematic identification of essential resonances and the definition of a polyad quantum number. The method presented is generally suitable for molecules of significant size and complexity, as illustrated by several examples of molecules up to six atoms. The polyad quantum number technique is very useful for assembling comprehensive basis sets for the matrix representation of the Hamiltonian after removal of all non-resonance terms by CVPT. In addition, the classification of anharmonic energy levels according to their polyad quantum numbers provides an additional means for the interpretation of observed vibrational spectra.

  4. Probing strong-field electron-nuclear dynamics of polyatomic molecules using proton motion

    International Nuclear Information System (INIS)

    Markevitch, Alexei N.; Smith, Stanley M.; Levis, Robert J.; Romanov, Dmitri A.

    2007-01-01

    Proton ejection during Coulomb explosion is studied for several structure-related organic molecules (anthracene, anthraquinone, and octahydroanthracene) subjected to 800 nm, 60 fs laser pulses at intensities from 0.50 to 4.0x10 14 W cm -2 . The proton kinetic energy distributions are found to be markedly structure specific. The distributions are bimodal for anthracene and octahydroanthracene and trimodal for anthraquinone. Maximum (cutoff) energies of the distributions range from 50 eV for anthracene to 83 eV for anthraquinone. The low-energy mode (∼10 eV) is most pronounced in octahydroanthracene. The dependence of the characteristic features of the distributions on the laser intensity provides insights into molecular specificity of such strong-field phenomena as (i) nonadiabatic charge localization and (ii) field-mediated restructuring of polyatomic molecules polarized by a strong laser field

  5. Prospects of using the second-order perturbation theory of the MP2 type in the theory of electron scattering by polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Čársky, Petr [J. Heyrovský Institute of Physical Chemistry, Academy of Sciences of the Czech Republic, v.i.i., Dolejškova 3, 18223 Prague 8 (Czech Republic)

    2015-01-22

    So far the second-order perturbation theory has been only applied to the hydrogen molecule. No application was attempted for another molecule, probably because of technical difficulties of such calculations. The purpose of this contribution is to show that the calculations of this type are now feasible on larger polyatomic molecules even on commonly used computers.

  6. Towards efficient ab initio calculations of electron scattering by polyatomic molecules: II. Efficient evaluation of exchange integrals

    Czech Academy of Sciences Publication Activity Database

    Čársky, Petr

    2010-01-01

    Roč. 43, č. 17 (2010), s. 175204 ISSN 0953-4075 R&D Projects: GA MŠk OC09079; GA MŠk(CZ) OC10046; GA ČR GA202/08/0631 Institutional research plan: CEZ:AV0Z40400503 Keywords : ab initio calculations * electron scattering * polyatomic molecules Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.902, year: 2010

  7. Studies of electron collisions with polyatomic molecules using distributed-memory parallel computers

    International Nuclear Information System (INIS)

    Winstead, C.; Hipes, P.G.; Lima, M.A.P.; McKoy, V.

    1991-01-01

    Elastic electron scattering cross sections from 5--30 eV are reported for the molecules C 2 H 4 , C 2 H 6 , C 3 H 8 , Si 2 H 6 , and GeH 4 , obtained using an implementation of the Schwinger multichannel method for distributed-memory parallel computer architectures. These results, obtained within the static-exchange approximation, are in generally good agreement with the available experimental data. These calculations demonstrate the potential of highly parallel computation in the study of collisions between low-energy electrons and polyatomic gases. The computational methodology discussed is also directly applicable to the calculation of elastic cross sections at higher levels of approximation (target polarization) and of electronic excitation cross sections

  8. Theoretical study of molecular vibration and Application to linear triatomic molecules: case of OCS

    International Nuclear Information System (INIS)

    Andrianavalomahefa, A.

    2014-01-01

    Our aim is to give a theoretical approach to the calculation of vibrational energy levels of polyatomic molecules. By using matrix calculation, we have to solve an eigenvalue equation that gives normal vibration frequencies of the system. A basis change introduces normal coordinates of vibration, which diagonalize the Hamiltonian. The harmonic approximation gives a rough evaluation of parameters which describe the system. Then, we introduce nonlinear terms to take into account the anharmonicity of interatomic bounds. Morse oscillator gives good approximation for diatomic molecules. We consider cubic and quartic potential terms for polyatomic molecules. We treat the problem both in classical and quantum approach. The results thus obtained are applied to study longitudinal vibration of carbonyl sulfide. [fr

  9. An exact variational method to calculate rovibrational spectra of polyatomic molecules with large amplitude motion

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hua-Gen, E-mail: hgy@bnl.gov [Division of Chemistry, Department of Energy and Photon Sciences, Brookhaven National Laboratory, Upton, New York 11973-5000 (United States)

    2016-08-28

    We report a new full-dimensional variational algorithm to calculate rovibrational spectra of polyatomic molecules using an exact quantum mechanical Hamiltonian. The rovibrational Hamiltonian of system is derived in a set of orthogonal polyspherical coordinates in the body-fixed frame. It is expressed in an explicitly Hermitian form. The Hamiltonian has a universal formulation regardless of the choice of orthogonal polyspherical coordinates and the number of atoms in molecule, which is suitable for developing a general program to study the spectra of many polyatomic systems. An efficient coupled-state approach is also proposed to solve the eigenvalue problem of the Hamiltonian using a multi-layer Lanczos iterative diagonalization approach via a set of direct product basis set in three coordinate groups: radial coordinates, angular variables, and overall rotational angles. A simple set of symmetric top rotational functions is used for the overall rotation whereas a potential-optimized discrete variable representation method is employed in radial coordinates. A set of contracted vibrationally diabatic basis functions is adopted in internal angular variables. Those diabatic functions are first computed using a neural network iterative diagonalization method based on a reduced-dimension Hamiltonian but only once. The final rovibrational energies are computed using a modified Lanczos method for a given total angular momentum J, which is usually fast. Two numerical applications to CH{sub 4} and H{sub 2}CO are given, together with a comparison with previous results.

  10. Computer system for structure recognition of polyatomic molecules by i. r. , n. m. r. , u. v. and m. s. methods

    Energy Technology Data Exchange (ETDEWEB)

    Gribov, L A; Elyashberg, M E; Serov, V V [USSR Academy of Sciences, Moscow (USSR). V.I. Vernadsky Institute of Geochemistry and Analytical Chemistry

    1977-12-15

    A system of algorithms and programs for the recognition of the structures of polyatomic molecules by means of i.r., n.m.r., u.v. and mass spectra is described. Examples of structures identified are cited. The results are promising and suggest that the system could be used for the identification of complex organic compounds.

  11. Z-dependent perturbation theory and its application to polyatomic molecules

    International Nuclear Information System (INIS)

    Galvan, D.H.

    1986-01-01

    Z-dependent perturbation theory is applied to study the ground states of simple diatomic and triatomic molecules in order to calculate the total third-order energies for these systems. The systems studied are H 2 + , H 2 , H 3 + , HeH +2 , HeH + , and HeH 2 +2 . The total energies are compared with exact energy values, as well as Hartree-Fock values, and the author's results are a considerable improvement over second-order energies for most internuclear distances, and consistently better than Hartree-Fock calculations for all internuclear distances. Compared with variational methods, this method is simpler and more efficient. In order to calculate total energies up to third order, the wave functions necessary will be two-center, one electron or one-center, two-electron wave functions, at most. Hence, the most complicated integrals that have to be performed are three-center, two-electron integrals, and four-center, one-electron integrals, no matter how complex the molecular system. More importantly, the results obtained for the one-electron diatomic molecular ion are directly incorporated into the calculations for polyatomic systems

  12. Communication: General variational approach to nuclear-quadrupole coupling in rovibrational spectra of polyatomic molecules

    Science.gov (United States)

    Yachmenev, Andrey; Küpper, Jochen

    2017-10-01

    A general algorithm for computing the quadrupole-hyperfine effects in the rovibrational spectra of polyatomic molecules is presented for the case of ammonia (NH3). The method extends the general variational approach TROVE [J. Mol. Spectrosc. 245, 126-140 (2007)] by adding the extra term in the Hamiltonian that describes the nuclear quadrupole coupling, with no inherent limitation on the number of quadrupolar nuclei in a molecule. We applied the new approach to compute the nitrogen-nuclear-quadrupole hyperfine structure in the rovibrational spectrum of NH143. These results agree very well with recent experimental spectroscopic data for the pure rotational transitions in the ground vibrational and ν2 states and the rovibrational transitions in the ν1, ν3, 2ν4, and ν1 + ν3 bands. The computed hyperfine-resolved rovibrational spectrum of ammonia will be beneficial for the assignment of experimental rovibrational spectra, further detection of ammonia in interstellar space, and studies of the proton-to-electron mass variation.

  13. Half-space problem of unsteady evaporation and condensation of polyatomic gas

    Science.gov (United States)

    Inaba, Masashi; Yano, Takeru

    2016-11-01

    On the basis of polyatomic version of the ellipsoidal-statistical Bhatnager-Gross-Krook (ES-BGK) model, we consider time-periodic gas flows in a semi-infinite expanse of an initially equilibrium polyatomic gas (methanol) bounded by its planar condensed phase. The kinetic boundary condition at the vapor-liquid interface is assumed to be the complete condensation condition with periodically time-varying macroscopic variables (temperature, saturated vapor density and velocity of the interface), and the boundary condition at infinity is the local equilibrium distribution function. The time scale of variation of macroscopic variables is assumed to be much larger than the mean free time of gas molecules, and the variations of those from a reference state are assumed to be sufficiently small. We numerically investigate thus formulated time-dependent half-space problem for the polyatomic version of linearized ES-BGK model equation with the finite difference method for the case of the Strouhal number Sh=0.01 and 0.1. It is shown that the amplitude of the mass flux at the interface is the maximum, and the phase difference in time between the mass flux and v∞ - vℓ (v∞: vapor velocity at infinity, vℓ: velocity of the vapor-liquid interface) is the minimum absolute value, when the phase difference in time between the liquid surface temperature (the saturated vapor density) and the velocity of interface is close to zero.

  14. Molecular eigenstate spectroscopy: Application to the intramolecular dynamics of some polyatomic molecules in the 3000 to 7000 cm-1 region

    International Nuclear Information System (INIS)

    Perry, D.S.

    1991-05-01

    This project uses high resolution infrared spectroscopy to probe the mechanism of intramolecular vibrational redistribution (IVR) in isolated polyatomic molecules. We have found only vibrationally anharmonic coupling in the C-H stretch region of 1-butyne but rotationally mediated coupling is evident in similar spectra of ethanol. The ''keyhole'' model of IVR was developed to account for the similarities and differences between these molecules. The concepts of the model are being implemented numerically in random matrix calculations. A second F-center laser has been purchased and is now being set up to develop an infrared double resonance technique which can be applied to this problem. 4 refs., 5 figs

  15. NATO Advanced Research Workshop on Dynamics of Polyatomic Van der Waals Complexes

    CERN Document Server

    Janda, Kenneth

    1991-01-01

    This publication is the Proceedings of the NATO Advanced Research Workshop (ARW) on the Dynamics of Polyatomic Van der Waals Molecules held at the Chateau de Bonas, Castera-Verduzan, France, from August 21 through August 26, 1989. Van der Waals complexes provide important model problems for understanding energy transfer and dissipation. These processes can be described in great detail for Van der Waals complexes, and the insight gained from such studies can be applied to more complicated chemical problems that are not amenable to detailed study. The workshop concentrated on the current questions and future prospects for extend­ ing our highly detailed knowledge of triatomic Van der Waals molecule dynamics to polyatomic molecules and clusters (one molecule surrounded by several, or up to sev­ eral tens of, atoms). Both experimental and theoretical studies were discussed, with particular emphasis on the dynamical behavior of dissociation as observed in the dis­ tributions of quantum states of the dissociatio...

  16. Polyatomic Trilobite Rydberg Molecules in a Dense Random Gas.

    Science.gov (United States)

    Luukko, Perttu J J; Rost, Jan-Michael

    2017-11-17

    Trilobites are exotic giant dimers with enormous dipole moments. They consist of a Rydberg atom and a distant ground-state atom bound together by short-range electron-neutral attraction. We show that highly polar, polyatomic trilobite states unexpectedly persist and thrive in a dense ultracold gas of randomly positioned atoms. This is caused by perturbation-induced quantum scarring and the localization of electron density on randomly occurring atom clusters. At certain densities these states also mix with an s state, overcoming selection rules that hinder the photoassociation of ordinary trilobites.

  17. Variational treatment of electron-polyatomic-molecule scattering calculations using adaptive overset grids

    Science.gov (United States)

    Greenman, Loren; Lucchese, Robert R.; McCurdy, C. William

    2017-11-01

    The complex Kohn variational method for electron-polyatomic-molecule scattering is formulated using an overset-grid representation of the scattering wave function. The overset grid consists of a central grid and multiple dense atom-centered subgrids that allow the simultaneous spherical expansions of the wave function about multiple centers. Scattering boundary conditions are enforced by using a basis formed by the repeated application of the free-particle Green's function and potential Ĝ0+V ̂ on the overset grid in a Born-Arnoldi solution of the working equations. The theory is shown to be equivalent to a specific Padé approximant to the T matrix and has rapid convergence properties, in both the number of numerical basis functions employed and the number of partial waves employed in the spherical expansions. The method is demonstrated in calculations on methane and CF4 in the static-exchange approximation and compared in detail with calculations performed with the numerical Schwinger variational approach based on single-center expansions. An efficient procedure for operating with the free-particle Green's function and exchange operators (to which no approximation is made) is also described.

  18. Generalization of the linear algebraic method to three dimensions

    International Nuclear Information System (INIS)

    Lynch, D.L.; Schneider, B.I.

    1991-01-01

    We present a numerical method for the solution of the Lippmann-Schwinger equation for electron-molecule collisions. By performing a three-dimensional numerical quadrature, this approach avoids both a basis-set representation of the wave function and a partial-wave expansion of the scattering potential. The resulting linear equations, analogous in form to the one-dimensional linear algebraic method, are solved with the direct iteration-variation method. Several numerical examples are presented. The prospect for using this numerical quadrature scheme for electron-polyatomic molecules is discussed

  19. The origin of small and large molecule behavior in the vibrational relaxation of highly excited molecules

    International Nuclear Information System (INIS)

    Gordon, R.J.

    1990-01-01

    An explanation is proposed for the qualitatively different types of behavior that have been reported for the vibrational relaxation of highly excited diatomic and polyatomic molecules. It is argued that all of the diatomic molecules that have been studied in bulk relax adiabatically at room temperature. In contrast, large polyatomic molecules have low frequency modes which act at ''doorway'' modes for the rest of the molecules, producing an impulsive relaxation mechanism. The theoretical work of Nesbitt and Hynes showed that impulsive collisions result in an exponential decay of the average vibrational energy of a Morse oscillator, whereas adiabatic collisions produce nonexponential power law behavior. We propose that this result explains a large body of data for the vibrational relaxation of small and large molecules

  20. Multi-layer Lanczos iteration approach to calculations of vibrational energies and dipole transition intensities for polyatomic molecules

    International Nuclear Information System (INIS)

    Yu, Hua-Gen

    2015-01-01

    We report a rigorous full dimensional quantum dynamics algorithm, the multi-layer Lanczos method, for computing vibrational energies and dipole transition intensities of polyatomic molecules without any dynamics approximation. The multi-layer Lanczos method is developed by using a few advanced techniques including the guided spectral transform Lanczos method, multi-layer Lanczos iteration approach, recursive residue generation method, and dipole-wavefunction contraction. The quantum molecular Hamiltonian at the total angular momentum J = 0 is represented in a set of orthogonal polyspherical coordinates so that the large amplitude motions of vibrations are naturally described. In particular, the algorithm is general and problem-independent. An application is illustrated by calculating the infrared vibrational dipole transition spectrum of CH based on the ab initio T8 potential energy surface of Schwenke and Partridge and the low-order truncated ab initio dipole moment surfaces of Yurchenko and co-workers. A comparison with experiments is made. The algorithm is also applicable for Raman polarizability active spectra

  1. Thermal ion-molecule reactions in oxygen-containing molecules

    International Nuclear Information System (INIS)

    Kumakura, Minoru

    1981-02-01

    The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)

  2. Cross sections and oscillator strengths for electron-impact excitation of electronic states in polyatomic molecules. Application examples of the BEf- scaling model in optically-allowed transitions

    International Nuclear Information System (INIS)

    Kato, H.; Kawahara, H.; Hoshino, M.

    2009-12-01

    Integral cross sections for optically allowed electronic-state excitations by electron impact, are reviewed for polyatomic molecules by applying the Binary-Encounter-Bethe (BEB) scaling model. Following the context of the present review, the scaling model originally proposed by Yong-Ki Kim to determine electron-impact cross sections for ionization of atoms and molecules is also summarized briefly for its wide range of applications [Electron-Impact Cross Section Database, NIST, Y.-K. Kim]. The present report not only focuses on the need for the cross-section data, but also elucidates the verification of the scaling model in the general application for atoms and molecules. Since this report is for a data base, it is summarized for data base users by citing (copying) the descriptions in the original papers and the references within those papers in the style of a textbook. (author)

  3. Molecular extended thermodynamics of rarefied polyatomic gases and wave velocities for increasing number of moments

    Energy Technology Data Exchange (ETDEWEB)

    Arima, Takashi, E-mail: tks@stat.nitech.ac.jp [Center for Social Contribution and Collaboration, Nagoya Institute of Technology (Japan); Mentrelli, Andrea, E-mail: andrea.mentrelli@unibo.it [Department of Mathematics and Research Center of Applied Mathematics (CIRAM), University of Bologna (Italy); Ruggeri, Tommaso, E-mail: tommaso.ruggeri@unibo.it [Department of Mathematics and Research Center of Applied Mathematics (CIRAM), University of Bologna (Italy)

    2014-06-15

    Molecular extended thermodynamics of rarefied polyatomic gases is characterized by two hierarchies of equations for moments of a suitable distribution function in which the internal degrees of freedom of a molecule is taken into account. On the basis of physical relevance the truncation orders of the two hierarchies are proven to be not independent on each other, and the closure procedures based on the maximum entropy principle (MEP) and on the entropy principle (EP) are proven to be equivalent. The characteristic velocities of the emerging hyperbolic system of differential equations are compared to those obtained for monatomic gases and the lower bound estimate for the maximum equilibrium characteristic velocity established for monatomic gases (characterized by only one hierarchy for moments with truncation order of moments N) by Boillat and Ruggeri (1997) (λ{sub (N)}{sup E,max})/(c{sub 0}) ⩾√(6/5 (N−1/2 )),(c{sub 0}=√(5/3 k/m T)) is proven to hold also for rarefied polyatomic gases independently from the degrees of freedom of a molecule. -- Highlights: •Molecular extended thermodynamics of rarefied polyatomic gases is studied. •The relation between two hierarchies of equations for moments is derived. •The equivalence of maximum entropy principle and entropy principle is proven. •The characteristic velocities are compared to those of monatomic gases. •The lower bound of the maximum characteristic velocity is estimated.

  4. Molecular extended thermodynamics of rarefied polyatomic gases and wave velocities for increasing number of moments

    International Nuclear Information System (INIS)

    Arima, Takashi; Mentrelli, Andrea; Ruggeri, Tommaso

    2014-01-01

    Molecular extended thermodynamics of rarefied polyatomic gases is characterized by two hierarchies of equations for moments of a suitable distribution function in which the internal degrees of freedom of a molecule is taken into account. On the basis of physical relevance the truncation orders of the two hierarchies are proven to be not independent on each other, and the closure procedures based on the maximum entropy principle (MEP) and on the entropy principle (EP) are proven to be equivalent. The characteristic velocities of the emerging hyperbolic system of differential equations are compared to those obtained for monatomic gases and the lower bound estimate for the maximum equilibrium characteristic velocity established for monatomic gases (characterized by only one hierarchy for moments with truncation order of moments N) by Boillat and Ruggeri (1997) (λ (N) E,max )/(c 0 ) ⩾√(6/5 (N−1/2 )),(c 0 =√(5/3 k/m T)) is proven to hold also for rarefied polyatomic gases independently from the degrees of freedom of a molecule. -- Highlights: •Molecular extended thermodynamics of rarefied polyatomic gases is studied. •The relation between two hierarchies of equations for moments is derived. •The equivalence of maximum entropy principle and entropy principle is proven. •The characteristic velocities are compared to those of monatomic gases. •The lower bound of the maximum characteristic velocity is estimated

  5. Multiphoton dissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Schulz, P.A.

    1979-10-01

    The dynamics of infrared multiphoton excitation and dissociation of SF 6 was investigated under collision free conditions by a crossed laser-molecular beam method. In order to understand the excitation mechanism and to elucidate the requirements of laser intensity and energy fluence, a series of experiments were carried out to measure the dissociation yield dependences on energy fluence, vibrational temperature of SF 6 , the pulse duration of the CO 2 laser and the frequency in both one and two laser experiments. Translational energy distributions of the SF 5 dissociation product measured by time of flight and angular distributions and the dissociation lifetime of excited SF 6 as inferred from the observation of secondary dissociation of SF 5 into SF 4 and F during the laser pulse suggest that the dynamics of dissociation of excited molecules is dominated by complete energy randomization and rapid intramolecular energy transfer on a nanosecond timescale, and can be adequately described by RRKM theory. An improved phenomenological model including the initial intensity dependent excitation, a rate equation describing the absorption and stimulated emission of single photons, and the unimolecular dissociation of excited molecules is constructed based on available experimental results. The model shows that the energy fluence of the laser determines the excitation of molecules in the quasi-continuum and the excess energy with which molecules dissociate after the laser pulse. The role played by the laser intensity in multiphoton dissociation is more significant than just that of overcoming the intensity dependent absorption in the lowest levels. 63 references

  6. Ion transmission in a linear radiofrequency spectrometer

    International Nuclear Information System (INIS)

    Gomet, J.-C.

    1975-01-01

    A linear radiofrequency spectrometer is used for the purpose of experimental determination of the absolute ionization cross sections of various ions obtained by electron impact on polyatomic molecules. The transmission of the apparatus is studied: it does not only depend on the mass resolution of the spectrometer, but also on the nature of ions. It is affected by charge transfers, especially for the parent ions. An empiric way of correction of the apparatus function is given which allows the use at 10 -6 Torr [fr

  7. Wave equation of a nonlinear triatomic molecule and the adiabatic correction to the Born--Oppenheimer approximation

    International Nuclear Information System (INIS)

    Bardo, R.D.; Wolfsberg, M.

    1977-01-01

    The wave equation for a nonlinear polyatomic molecule is formulated in molecule-fixed coordinates by a method originally due to Hirschfelder and Wigner. Application is made to a triatomic molecule, and the wave equation is explicitly presented in a useful molecule-fixed coordinate system. The formula for the adiabatic correction to the Born--Oppenheimer approximation for a triatomic molecule is obtained. The extension of the present formulation to larger polyatomic molecules is pointed out. Some terms in the triatomic molecule wave equation are discussed in detail

  8. Sequential nonadiabatic excitation of large molecules and ions driven by strong laser fields

    International Nuclear Information System (INIS)

    Markevitch, Alexei N.; Levis, Robert J.; Romanov, Dmitri A.; Smith, Stanley M.; Schlegel, H. Bernhard; Ivanov, Misha Yu.

    2004-01-01

    Electronic processes leading to dissociative ionization of polyatomic molecules in strong laser fields are investigated experimentally, theoretically, and numerically. Using time-of-flight ion mass spectroscopy, we study the dependence of fragmentation on laser intensity for a series of related molecules and report regular trends in this dependence on the size, symmetry, and electronic structure of a molecule. Based on these data, we develop a model of dissociative ionization of polyatomic molecules in intense laser fields. The model is built on three elements: (i) nonadiabatic population transfer from the ground electronic state to the excited-state manifold via a doorway (charge-transfer) transition; (ii) exponential enhancement of this transition by collective dynamic polarization of all electrons, and (iii) sequential energy deposition in both neutral molecules and resulting molecular ions. The sequential nonadiabatic excitation is accelerated by a counterintuitive increase of a large molecule's polarizability following its ionization. The generic theory of sequential nonadiabatic excitation forms a basis for quantitative description of various nonlinear processes in polyatomic molecules and ions in strong laser fields

  9. A simple model for correcting the zero point energy problem in classical trajectory simulations of polyatomic molecules

    International Nuclear Information System (INIS)

    Miller, W.H.; Hase, W.L.; Darling, C.L.

    1989-01-01

    A simple model is proposed for correcting problems with zero point energy in classical trajectory simulations of dynamical processes in polyatomic molecules. The ''problems'' referred to are that classical mechanics allows the vibrational energy in a mode to decrease below its quantum zero point value, and since the total energy is conserved classically this can allow too much energy to pool in other modes. The proposed model introduces hard sphere-like terms in action--angle variables that prevent the vibrational energy in any mode from falling below its zero point value. The algorithm which results is quite simple in terms of the cartesian normal modes of the system: if the energy in a mode k, say, decreases below its zero point value at time t, then at this time the momentum P k for that mode has its sign changed, and the trajectory continues. This is essentially a time reversal for mode k (only exclamation point), and it conserves the total energy of the system. One can think of the model as supplying impulsive ''quantum kicks'' to a mode whose energy attempts to fall below its zero point value, a kind of ''Planck demon'' analogous to a Brownian-like random force. The model is illustrated by application to a model of CH overtone relaxation

  10. Mechanism and models for collisional energy transfer in highly excited large polyatomic molecules

    International Nuclear Information System (INIS)

    Gilbert, R. G.

    1995-01-01

    Collisional energy transfer in highly excited molecules (say, 200-500 kJ mol -1 above the zero-point energy of reactant, or of product, for a recombination reaction) is reviewed. An understanding of this energy transfer is important in predicting and interpreting the pressure dependence of gas-phase rate coefficients for unimolecular and recombination reactions. For many years it was thought that this pressure dependence could be calculated from a single energy-transfer quantity, such as the average energy transferred per collision. However, the discovery of 'super collisions' (a small but significant fraction of collisions which transfer abnormally large amounts of energy) means that this simplistic approach needs some revision. The 'ordinary' (non-super) component of the distribution function for collisional energy transfer can be quantified either by empirical models (e.g., an exponential-down functional form) or by models with a physical basis, such as biased random walk (applicable to monatomic or diatomic collision partners) or ergodic (for polyatomic collision partners) treatments. The latter two models enable approximate expressions for the average energy transfer to be estimated from readily available molecular parameters. Rotational energy transfer, important for finding the pressure dependence for recombination reactions, can for these purposes usually be taken as transferring sufficient energy so that the explicit functional form is not required to predict the pressure dependence. The mechanism of 'ordinary' energy transfer seems to be dominated by low-frequency modes of the substrate, whereby there is sufficient time during a vibrational period for significant energy flow between the collision partners. Super collisions may involve sudden energy flow as an outer atom of the substrate is squashed between the substrate and the bath gas, and then is moved away from the interaction by large-amplitude motion such as a ring vibration or a rotation; improved

  11. Wave packet formulation of the boomerang model for resonant electron--molecule scattering

    International Nuclear Information System (INIS)

    McCurdy, C.W.; Turner, J.L.

    1983-01-01

    A time-dependent formulation of the boomerang model for resonant electron--molecule scattering is presented in terms of a wave packet propagating on the complex potential surface of the metastable anion. The results of calculations using efficient semiclassical techniques for propagating the wave packet are found to be in excellent agreement with full quantum-mechanical calculations of vibrational excitation cross sections in e - --N 2 scattering. The application of the wave packet formulation as a computational and conceptual approach to the problem of resonant collisions with polyatomic molecules is discussed in the light of recent wave packet calculations on polyatomic photodissociation and Raman spectra

  12. Dispersion interaction between an atom and linear molecule

    International Nuclear Information System (INIS)

    Carvalho, I.L. de

    1987-01-01

    The Jacobi-Csanak method is adapted to the calculation of the dipole-dipole, dipole-quadrupole, quadrupole-dipole, and quadrupole-quadrupole terms of the dispersion energy of an atom-linear molecule system. The angle-dependent parts of the Born amplitudes for the linear molecule are represented by real spherical harmonics. The dispersion energy is finite at all distances and reproduces the usual expression in the asymptotic region (R≥4.7 (angstrom)). In the intermediary region (2.4(angstrom) ≤ R [pt

  13. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  14. Conserved linear dynamics of single-molecule Brownian motion

    Science.gov (United States)

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  15. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  16. Controlling the nanoscale morphology of organic films deposited by polyatomic ions

    CERN Document Server

    Hanley, L; Fuoco, E R; Ahu-Akin, F; Wijesundara, M B J; Li, Maozhen; Tikhonov, A; Schlossman, M

    2003-01-01

    Hyperthermal polyatomic ion beams can be used to fabricate thin film nanostructures with controlled morphology. Several experiments are described in which mass-selected and non-mass-selected polyatomic ion beams are used to create nanometer thick films with controlled surface and buried interface morphologies. Fluorocarbon and thiophenic films are grown on silicon wafers and/or polystyrene from 5 to 200 eV C sub 3 F sub 5 sup + or C sub 4 H sub 4 S sup + ions, respectively. X-ray photoelectron spectroscopy, atomic force microscopy, X-ray reflectivity, and scanning electron microscopy are utilized to analyze the morphology and chemistry of these films. Polyatomic ions are found to control film morphology on the nanoscale through variation of the incident ion energy, ion structure and/or substrate.

  17. A linear algebraic approach to electron-molecule collisions

    International Nuclear Information System (INIS)

    Collins, L.A.; Schnieder, B.I.

    1982-01-01

    The linear algebraic approach to electron-molecule collisions is examined by firstly deriving the general set of coupled integrodifferential equations that describe electron collisional processes and then describing the linear algebraic approach for obtaining a solution to the coupled equations. Application of the linear algebraic method to static-exchange, separable exchange and effective optical potential, is examined. (U.K.)

  18. Energy storage and redistribution in molecules

    International Nuclear Information System (INIS)

    Hinze, J.

    1983-01-01

    This book presents information on the following topics: chemistry and spectroscopy of molecules at high levels of excitation; energy and phase randomization in large molecules as probed by laser spectroscopy; intramolecular processes in isolated polyatomic molecules; pulse-probe measurements in low-temperature, low-pressure SF 6 ; the photodissociation dynamics of H 2 S and CF 3 NO; photofragment spectroscopy of the NO 2 dissociation; preparation, laser spectroscopy and predissociation of alkali dimers in supersonic nozzle beams; excited states of small molecules - collisional quenching and photodissociation; quantum-state-resolved scattering of lithium hydride; and molecular negative ions

  19. Linear algebraic approach to electron-molecule collisions

    International Nuclear Information System (INIS)

    Schneider, B.I.; Collins, L.A.

    1983-01-01

    The various levels of sophistication of the linear algebraic method are discussed and its application to electron-molecule collisions of H 2 , N 2 LiH, LiF and HCl is described. 13 references, 2 tables

  20. Reaction dynamics in polyatomic molecular systems

    Energy Technology Data Exchange (ETDEWEB)

    Miller, W.H. [Lawrence Berkeley Laboratory, CA (United States)

    1993-12-01

    The goal of this program is the development of theoretical methods and models for describing the dynamics of chemical reactions, with specific interest for application to polyatomic molecular systems of special interest and relevance. There is interest in developing the most rigorous possible theoretical approaches and also in more approximate treatments that are more readily applicable to complex systems.

  1. Research directed at developing a classical theory to describe isotope separation of polyatomic molecules illuminated by intense infrared radiation. Final report, May 7-September 30, 1979

    International Nuclear Information System (INIS)

    Lamb, W.E. Jr.

    1981-12-01

    This final report describes research on the theory of isotope separation produced by the illumination of polyatomic molecules by intense infrared laser radiation. This process is investigated by treating the molecule, sulfur hexafluoride, as a system of seven classical particles that obey the Newtonian equations of motion. A minicomputer is used to integrate these differential equations. The particles are acted on by interatomic forces, and by the time-dependent electric field of the laser. We have a very satisfactory expression for the interaction of the laser and the molecule which is compatible with infrared absorption and spectroscopic data. The interatomic potential is capable of improvement, and progress on this problem is still being made. We have made several computer runs of the dynamical behavior of the molecule using a reasonably good model for the interatomic force law. For the laser parameters chosen, we find that typically the molecule passes quickly through the resonance region into the quasi-continuum and even well into the real continuum before dissociation actually occurs. When viewed on a display terminal, the motions are exceedingly complex. As an aid to the visualization of the process, we have made a number of 16 mm movies depicting a three-dimensional representation of the motion of the seven particles. These show even more clearly the enormous complexity of the motions, and make clear the desirability of finding ways of characterizing the motion in simple ways without giving all of the numerical detail. One of the ways to do this is to introduce statistical parameters such as a temperature associated with the distribution of kinetic energies of the single particle. We have made such an analysis of our data runs, and have found favorable indications that such methods will prove useful in keeping track of the dynamical histories

  2. Polyatomic ions in inductively coupled plasma-mass spectrometry

    International Nuclear Information System (INIS)

    Ferguson, Jill Wisnewski; Dudley, Timothy J.; Sears, Kyle C.; McIntyre, Sally M.; Gordon, Mark S.; Houk, R.S.

    2009-01-01

    Several polyatomic ions in inductively coupled plasma-mass spectrometry are studied experimentally and by computational methods. Novel calculations based on spin-restricted open shell second order perturbation theory (ZAPT2) and coupled cluster (CCSD(T)) theory are performed to determine the energies, structures and partition functions of the ions. These values are combined with experimental data to evaluate a dissociation constant and gas kinetic temperature (T gas ) value. In our opinion, the resulting T gas value can sometimes be interpreted to deduce the location where the polyatomic ion of interest is generated. The dissociation of N 2 H + to N 2 + leads to a calculated T gas of 4550 to 4900 K, depending on the computational data used. The COH + to CO + system yields a similar temperature, which is not surprising considering the similar energies and structures of COH + and N 2 H + . The dissociation of H 2 CO + to HCO + leads to a much lower T gas ( 2 COH + to HCOH + generates a T gas value between those from the other H x CO + ions studied here. All of these measured T gas values correspond to formation of extra polyatomic ion in the interface or extraction region. The computations reveal the existence of isomers such as HCO + and COH + , and H 2 CO + and HCOH + , which have virtually the same m/z values and need to be considered in the interpretation of results.

  3. Rotational and vibrational synthetic spectra of linear parent molecules in comets

    International Nuclear Information System (INIS)

    Crovisier, J.

    1987-01-01

    We evaluate and model the excitation conditions of linear parent molecules in cometary atmospheres. The model is valid for most linear molecules without electronic angular momentum. It takes into account collisions and infrared excitation. The molecule rotational population distribution is computed as a function of distance to nucleus. The line intensities of the strongest parallel and perpendicular fundamental vibrational bands, as well as the pure rotational lines, can then be evaluated. This model is applied to several candidate parent molecules, for observing conditions corresponding to available or planned instruments, either ground-based or aboard aircrafts, satellites or space probes

  4. Elastic scattering of low energy electrons by hydrogen molecule

    International Nuclear Information System (INIS)

    Freitas, L.C.G.; Mu-Tao, L.; Botelho, L.F.

    1987-01-01

    The coherent version of the Renormalized Multiple-Centre Potential Model (RMPM) has been extended to treat the elastic scattering of low energy electrons by H2 molecule. The intramolecular Multiple Scattering (MS) effect has also been included. The comparison against the experimental data shows that the inclusion of the MS improves significantly with experiment. The extension of the present method to study electron-polyatomic molecule interaction is also discussed. (author) [pt

  5. Molecular eigenstate spectroscopy: Application to the intramolecular dynamics of some polyatomic molecules in the 3000 to 7000 cm{sup {minus}1} region

    Energy Technology Data Exchange (ETDEWEB)

    Perry, D.S. [Univ. of Akron, OH (United States)

    1993-12-01

    Intramolecular vibrational redistribution (IVR) appears to be a universal property of polyatomic molecules in energy regions where the vibrational density of states is greater than about 5 to 30 states per cm{sup {minus}1}. Interest in IVR stems from its central importance to the spectroscopy, photochemistry, and reaction kinetics of these molecules. A bright state, {var_phi}{sub s}, which may be a C-H stretching vibration, carries the oscillator strength from the ground state. This bright state may mix with bath rotational-vibrational levels to form a clump of molecular eigenstates, each of which carries a portion of the oscillator strength from the ground state. In this work the authors explicitly resolve transitions to each of these molecular eigenstates. Detailed information about the nature of IVR is contained in the frequencies and intensities of the observed discrete transitions. The primary goal of this research is to probe the coupling mechanisms by which IVR takes place. The most fundamental distinction to be made is between anharmonic coupling which is independent of molecular rotation and rotationally-mediated coupling. The authors are also interested in the rate at which IVR takes place. Measurements are strictly in the frequency domain but information is obtained about the decay of the zero order state, {var_phi}{sub s}, which could be prepared in a hypothetical experiment as a coherent excitation of the clump of molecular eigenstates. As the coherent superposition dephases, the energy would flow from the initially prepared mode into nearby overtones and combinations of lower frequency vibrational modes. The decay of the initially prepared mode is related to a pure sequence infrared absorption spectrum by a Fourier transform.

  6. Capability of LEP-type surfaces to describe noncollinear reactions 2 - Polyatomic systems

    CERN Document Server

    Espinosa-Garcia, Joaquin

    2001-01-01

    In this second article of the series, the popular LEP-type surface for collinear reaction paths and a "bent" surface, which involves a saddle point geometry with a nonlinear central angle, were used to examine the capacity of LEP-type surfaces to describe the kinetics and dynamics of noncollinear reaction paths in polyatomic systems. Analyzing the geometries, vibrational frequencies, curvature along the reaction path (to estimate the tunneling effect and the reaction coordinate-bound modes coupling), and the variational transition- state theory thermal rate constants for the NH//3 + O(**3P) reaction, we found that the "collinear" LEP-type and the "bent" surfaces for this polyatomic system show similar behavior, thus allowing a considerable saving in time and computational effort. This agreement is especially encouraging for this polyatomic system because in the Cs symmetry the reaction proceeds via two electronic states of symmetries **3A prime and **3A double prime , which had to be independently calibrated....

  7. Theoretical simulations of atomic and polyatomic bombardment of an organic overlayer on a metallic substrate

    CERN Document Server

    Krantzman, K D; Delcorte, A; Garrison, B J

    2003-01-01

    Our previous molecular dynamics simulations on initial test systems have laid the foundation for understanding some of the effects of polyatomic bombardment. In this paper, we describe simulations of the bombardment of a more realistic model system, an overlayer of sec-butyl-terminated polystyrene tetramers on a Ag left brace 1 1 1 right brace substrate. We have used this model system to study the bombardment with Xe and SF sub 5 projectiles at kinetic energies ranging from 0.50 to 5.0 keV. SF sub 5 sputters more molecules than Xe, but a higher percentage of these are damaged rather than ejected intact when the bombarding energy is greater than 0.50 keV. Therefore, at energies comparable to experimental values, the efficiency, measured as the yield-to-damage ratio, is greater with Xe than SF sub 5. Stable and intact molecules are generally produced by upward moving substrate atoms, while fragments are produced by the upward and lateral motion of reflected projectile atoms and fragments from the target molecul...

  8. The importance of Rydberg orbitals in dissociative ionization of small hydrocarbon molecules in intense laser fields.

    Science.gov (United States)

    Jochim, Bethany; Siemering, R; Zohrabi, M; Voznyuk, O; Mahowald, J B; Schmitz, D G; Betsch, K J; Berry, Ben; Severt, T; Kling, Nora G; Burwitz, T G; Carnes, K D; Kling, M F; Ben-Itzhak, I; Wells, E; de Vivie-Riedle, R

    2017-06-30

    Much of our intuition about strong-field processes is built upon studies of diatomic molecules, which typically have electronic states that are relatively well separated in energy. In polyatomic molecules, however, the electronic states are closer together, leading to more complex interactions. A combined experimental and theoretical investigation of strong-field ionization followed by hydrogen elimination in the hydrocarbon series C 2 D 2 , C 2 D 4 and C 2 D 6 reveals that the photofragment angular distributions can only be understood when the field-dressed orbitals rather than the field-free orbitals are considered. Our measured angular distributions and intensity dependence show that these field-dressed orbitals can have strong Rydberg character for certain orientations of the molecule relative to the laser polarization and that they may contribute significantly to the hydrogen elimination dissociative ionization yield. These findings suggest that Rydberg contributions to field-dressed orbitals should be routinely considered when studying polyatomic molecules in intense laser fields.

  9. Coincidence imaging of polyatomic molecules via laser-induced Coulomb explosion

    International Nuclear Information System (INIS)

    Gagnon, J; Corkum, P B; Bhardwaj, V R; Lee, Kevin F; Rayner, D M

    2008-01-01

    We extend laser-induced Coulomb explosion imaging to retrieve the structure of the five-atom dichloromethane (CH 2 Cl 2 ) molecule by developing coincidence imaging and geometry optimization techniques. By detecting all five atoms in coincidence, we show that, from the measured velocity vectors, the geometry of the molecules can be reconstructed.

  10. Theoretical studies on nuclear spin selective quantum dynamics of non-linear molecules; Theoretische Untersuchung zur Quantendynamik der Kernspinisomere nicht-linearer Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Grohmann, Thomas

    2012-05-31

    In this thesis the wave packet dynamics of nuclear spin isomers of polyatomic molecules after interaction with static and time-dependent magnetic fields and moderate intense nonresonant laser pulses is investigated. In particular, the process of inducing (internal) molecular rotation as well as alignment of molecules by manipulating their rotational or rotational-torsional degrees of freedom is studied. In the first part of the thesis all theoretical concepts for identifying nuclear spin isomers and for describing their quantum dynamics will be discussed. Especially the symmetrization postulate and themolecular symmetry group will be introduced and illustrated for some examples of molecules. These concepts will be extended to the case of identifying nuclear spin isomers in the presence of an external field. In the second part it is shown for nitromethane that magnetic fields are able to induce unidirectional rotations in opposite directions for different nuclear spin isomers of molecules containing methyl groups if the dipolar interaction is included. Additionally, it is demonstrated that different nuclear spin isomers of a chemical compound may show different alignment after the interaction with a moderate intense laser pulse. As shown for the rigid symmetric top propadien and the rigid asymmetric tops ethene and analogues, distinct pairs of nuclear spin isomers show at certain points in time a complementary behavior: while one isomer is showing alignment the partner isomer is showing anti-alignment. Moreover, it is illustrated that not every nuclear spin isomer can be aligned equally efficient. The alignment of non-rigid molecules is considered as well. As an example for a molecule with feasible torsion in the electronic ground state, the alignment of diboron tetrafluoride is investigated. It becomes apparent that not only rotational but also the torsional dynamics of the molecules is nuclear spin selective; different nuclear spin isomers have at distinct points

  11. Double differential cross sections for methane molecules at intermediate energies

    International Nuclear Information System (INIS)

    Yavuz, Murat; Ozer, Zehra Nur; Ulu, Melike; Dogan, Mevlut; Okumus, Nimet; Sahlaoui, Mohammed; Benmansour, Houda; Bouamoud, Mammar

    2014-01-01

    Double differential cross sections (DDCS) can be obtained by the measurements of energy and angular distributions of one of the two outgoing electrons by a detector. In this pespective, we used methane molecule as a target that is reasonable to expect to understand ionization mechanisms of polyatomic molecular systems.

  12. Investigations into the origins of polyatomic ions in inductively coupled plasma-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    McIntyre, Sally M. [Iowa State Univ., Ames, IA (United States)

    2010-01-01

    An inductively coupled plasma-mass spectrometer (ICP-MS) is an elemental analytical instrument capable of determining nearly all elements in the periodic table at limits of detection in the parts per quadrillion and with a linear analytical range over 8-10 orders of magnitude. Three concentric quartz tubes make up the plasma torch. Argon gas is spiraled through the outer tube and generates the plasma powered by a looped load coil operating at 27.1 or 40.6 MHz. The argon flow of the middle channel is used to keep the plasma above the innermost tube through which solid or aqueous sample is carried in a third argon stream. A sample is progressively desolvated, atomized and ionized. The torch is operated at atmospheric pressure. To reach the reduced pressures of mass spectrometers, ions are extracted through a series of two, approximately one millimeter wide, circular apertures set in water cooled metal cones. The space between the cones is evacuated to approximately one torr. The space behind the second cone is pumped down to, or near to, the pressure needed for the mass spectrometer (MS). The first cone, called the sampler, is placed directly in the plasma plume and its position is adjusted to the point where atomic ions are most abundant. The hot plasma gas expands through the sampler orifice and in this expansion is placed the second cone, called the skimmer. After the skimmer traditional MS designs are employed, i.e. quadrupoles, magnetic sectors, time-of-flight. ICP-MS is the leading trace element analysis technique. One of its weaknesses are polyatomic ions. This dissertation has added to the fundamental understanding of some of these polyatomic ions, their origins and behavior. Although mainly continuing the work of others, certain novel approaches have been introduced here. Chapter 2 includes the first reported efforts to include high temperature corrections to the partition functions of the polyatomic ions in ICP-MS. This and other objections to preceeding

  13. Boron- and iron-bearing molecules in laser-induced plasma

    Energy Technology Data Exchange (ETDEWEB)

    Gaft, M.; Nagli, L.; Eliezer, N.; Groisman, Y.

    2015-08-01

    Boron combines with alkali-earth elements, such as Ca, Mg, and Sr and with oxygen to form molecules in LIP of boron-bearing minerals with strong and characteristic band emission. It may be supposed that those bands are of CaBO{sub 2}, MgBO{sub 2} and SrBO{sub 2} type. Besides, emission of BO, BO{sub 2} and FeO is also detected. - Highlights: • We studied laser-induced breakdown spectra of B with Ca, Mg and Sr in air. • Emission of polyatomic molecules was found. • Molecules of FeO were found in laser-induced plasma in air.

  14. Symmetry Adaptation of the Rotation-Vibration Theory for Linear Molecules

    Directory of Open Access Journals (Sweden)

    Katy L. Chubb

    2018-04-01

    Full Text Available A numerical application of linear-molecule symmetry properties, described by the D ∞ h point group, is formulated in terms of lower-order symmetry groups D n h with finite n. Character tables and irreducible representation transformation matrices are presented for D n h groups with arbitrary n-values. These groups can subsequently be used in the construction of symmetry-adapted ro-vibrational basis functions for solving the Schrödinger equations of linear molecules. Their implementation into the symmetrisation procedure based on a set of “reduced” vibrational eigenvalue problems with simplified Hamiltonians is used as a practical example. It is shown how the solutions of these eigenvalue problems can also be extended to include the classification of basis-set functions using ℓ, the eigenvalue (in units of ℏ of the vibrational angular momentum operator L ^ z . This facilitates the symmetry adaptation of the basis set functions in terms of the irreducible representations of D n h . 12 C 2 H 2 is used as an example of a linear molecule of D ∞ h point group symmetry to illustrate the symmetrisation procedure of the variational nuclear motion program Theoretical ROVibrational Energies (TROVE.

  15. Multiple scattering of ions in polyatomic materials

    International Nuclear Information System (INIS)

    Eastham, D.A.

    1980-01-01

    The equations which determine small angle multiple scattering in the thin polyatomic layers are evaluated numerically for certain cases. A simple approximate method for calculating the scattering in terms of an average target charge which is a function of the target thickness is given and compared with the exact numerical value. The results agree to better than 5% over a wide range of target composition and thickness. (orig.)

  16. Research directed at developing a classical theory to describe isotope separation of polyatomic molecules illuminated by intense infrared radiation. Final report, May 7-September 30, 1979, extension December 31, 1979

    International Nuclear Information System (INIS)

    Lamb, W.E. Jr.

    1981-12-01

    This final report describes research on the theory of isotope separation produced by the illumination of polyatomic molecules by intense infrared laser radiation. This process is investigated by treating the molecule, sulfur hexafluoride, as a system of seven classical particles that obey the Newtonian equations of motion. A minicomputer is used to integrate these differential equations. The particles are acted on by interatomic forces, and by the time-dependent electric field of the laser. We have a very satisfactory expression for the interaction of the laser and the molecule which is compatible with infrared absorption and spectroscopic data. The interatomic potential is capable of improvement, and progress on this problem is still being made. We have made several computer runs of the dynamical behavior of the molecule using a reasonably good model for the interatomic force law. For the laser parameters chosen, we find that typically the molecule passes quickly through the resonance region into the quasi-continuum and even well into the real continuum before dissociation actually occurs. When viewed on a display terminal, the motions are exceedingly complex. As an aid to the visualization of the process, we have made a number of 16 mm movies depicting a three-dimensional representation of the motion of the seven particles. These show even more clearly the enormous complexity of the motions, and make clear the desirability of finding ways of characterizing the motion in simple ways without giving all of the numerical detail. One of the ways to do this is to introduce statistical parameters such as a temperature associated with the distribution of kinetic energies of the single particle. We have made such an analysis of our data runs, and have found favorable indications that such methods will prove useful in keeping track of the dynamical histories

  17. An On-the-Fly Surface-Hopping Program JADE for Nonadiabatic Molecular Dynamics of Polyatomic Systems: Implementation and Applications.

    Science.gov (United States)

    Du, Likai; Lan, Zhenggang

    2015-04-14

    Nonadiabatic dynamics simulations have rapidly become an indispensable tool for understanding ultrafast photochemical processes in complex systems. Here, we present our recently developed on-the-fly nonadiabatic dynamics package, JADE, which allows researchers to perform nonadiabatic excited-state dynamics simulations of polyatomic systems at an all-atomic level. The nonadiabatic dynamics is based on Tully's surface-hopping approach. Currently, several electronic structure methods (CIS, TDHF, TDDFT(RPA/TDA), and ADC(2)) are supported, especially TDDFT, aiming at performing nonadiabatic dynamics on medium- to large-sized molecules. The JADE package has been interfaced with several quantum chemistry codes, including Turbomole, Gaussian, and Gamess (US). To consider environmental effects, the Langevin dynamics was introduced as an easy-to-use scheme into the standard surface-hopping dynamics. The JADE package is mainly written in Fortran for greater numerical performance and Python for flexible interface construction, with the intent of providing open-source, easy-to-use, well-modularized, and intuitive software in the field of simulations of photochemical and photophysical processes. To illustrate the possible applications of the JADE package, we present a few applications of excited-state dynamics for various polyatomic systems, such as the methaniminium cation, fullerene (C20), p-dimethylaminobenzonitrile (DMABN) and its primary amino derivative aminobenzonitrile (ABN), and 10-hydroxybenzo[h]quinoline (10-HBQ).

  18. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  19. Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules

    Science.gov (United States)

    Sitek, A.; Machnikowski, P.

    2008-11-01

    We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.

  20. Electron scattering resonances and dissociative attachment in polyatomic molecules

    International Nuclear Information System (INIS)

    Olthoff, J.K.

    1985-01-01

    A relatively new technique, electron transmission spectroscopic, is now being used to investigate the unoccupied valence molecular orbitals of many chemical compounds. Electron-transmission spectroscopy measures the energy of negative ion states that arise from electron capture into unoccupied molecular orbitals. Additional information about the unoccupied orbitals may be obtained if the negative ion decays by way of dissociation. Determination of the identity, kinetic energy, and production rates of stable ion fragments supplies information about the shape and position of the potential energy curves which describe the electronic states of the molecule and the anion. Used together, photoelectron, electron transmission, and dissociation data can produce a complete picture of a molecule's valence electronic structure. For this work, a time-of-flight mass spectrometer was attached to an electron transmission spectrometer to observe negative ion fragments due to dissociative attachment. The mass spectrometer measures the identify and kinetic energy of stable negative ions as a function of incident electron energy. Electron transmission spectra and ion production data were acquired for many compounds in four chemical categories

  1. Validations of CNDOL approximate Hamiltonian as a fast and reliable method to obtain vertical excitation energies in polyatomic systems

    International Nuclear Information System (INIS)

    Montero-Alejo, Ana L.; Gonzalez-Santana, Susana; Montero-Cabrera, Luis A.; Hernandez-Rodriguez, Erix Wiliam; Fuentes-Montero, Maria Elena; Bunge-Molina, Carlos F.; Gonzalez, Augusto

    2008-01-01

    Theoretical prediction of vertical excitation energies and an estimation of charge distributions of polyatomic systems can be calculated, through the configuration interaction of single (CIS) excited determinants procedure, with the CNDOL (Complete Neglect of Differential Overlap considering the l azimuthal quantum number) Hamiltonians. This method does not use adjusted parameters to fit experimental data and only employ a priori data on atomic orbitals and simple formulas to substitute large computations of electronic integrals. In this sense, different functions for bi-electron integrals have been evaluated in order to improve the approximate Hamiltonian. The reliability of predictions and theoretical consistence has been tested with a benchmark set of organic molecules that covers important classes of chromophores including polyenes and other unsaturated aliphatic compounds, aromatic, hydrocarbons, heterocycles, carbonyl compounds, and nucleobases. The calculations are done at identical geometries (MP2) with the same basis set (6-31G) for these medium-sized molecules and the obtained results were statistically compared with other analogous methods and experimental data. The accuracy of prediction of each CNDOL vertical transitions energy increases while the active space is more complete allowing the best variational optimization of CIS matrices i.e. molecular excited states. Moreover and due to the feasible computation procedure for large polyatomic systems, the studies have been extended, as a preliminary work, in the field of optoelectronic materials for photovoltaic applications. Hence, the excitation energies of different conjugated Phenyl-cored Thiophene Dendrimers optimized by DFT (Density Functional Theory) were calculated and show good agreement with the experiment data. The predicted charge distribution during the excitation contributes to understand the photophysics process on these kind materials. (Full text)

  2. Rotation driven translational diffusion of polyatomic ions in water: A novel mechanism for breakdown of Stokes-Einstein relation

    Science.gov (United States)

    Banerjee, Puja; Yashonath, Subramanian; Bagchi, Biman

    2017-04-01

    While most of the existing theoretical and simulation studies have focused on simple, spherical, halide and alkali ions, many chemically, biologically, and industrially relevant electrolytes involve complex non-spherical polyatomic ions like nitrate, chlorate, and sulfate to name only a few. Interestingly, some polyatomic ions in spite of being larger in size show anomalously high diffusivity and therefore cause a breakdown of the venerable Stokes-Einstein (S-E) relation between the size and diffusivity. Here we report a detailed analysis of the dynamics of anions in aqueous potassium nitrate (KNO3) and aqueous potassium acetate (CH3COOK) solutions. The two ions, nitrate (-NO3) and acetate (CH3-CO2 ), with their similar size show a large difference in diffusivity values. We present evidence that the translational motion of these polyatomic ions is coupled to the rotational motion of the ion. We show that unlike the acetate ion, nitrate ion with a symmetric charge distribution among all periphery oxygen atoms shows a faster rotational motion with large amplitude rotational jumps which enhances its translational motion due to translational-rotational coupling. By creating a family of modified-charge model systems, we have analysed the rotational motion of asymmetric polyatomic ions and the contribution of it to the translational motion. These model systems help clarifying and establishing the relative contribution of rotational motion in enhancing the diffusivity of the nitrate ion over the value predicted by the S-E relation and also over the other polyatomic ions having asymmetric charge distribution like the acetate ion. In the latter case, reduced rotational motion results in lower diffusivity values than those with symmetric charge distribution. We propose translational-rotational coupling as a general mechanism of the breakdown of the S-E relation in the case of polyatomic ions.

  3. Coherent Bichromatic Force Deflection of Molecules

    Science.gov (United States)

    Kozyryev, Ivan; Baum, Louis; Aldridge, Leland; Yu, Phelan; Eyler, Edward E.; Doyle, John M.

    2018-02-01

    We demonstrate the effect of the coherent optical bichromatic force on a molecule, the polar free radical strontium monohydroxide (SrOH). A dual-frequency retroreflected laser beam addressing the X˜2Σ+↔A˜2Π1 /2 electronic transition coherently imparts momentum onto a cryogenic beam of SrOH. This directional photon exchange creates a bichromatic force that transversely deflects the molecules. By adjusting the relative phase between the forward and counterpropagating laser beams we reverse the direction of the applied force. A momentum transfer of 70 ℏk is achieved with minimal loss of molecules to dark states. Modeling of the bichromatic force is performed via direct numerical solution of the time-dependent density matrix and is compared with experimental observations. Our results open the door to further coherent manipulation of molecular motion, including the efficient optical deceleration of diatomic and polyatomic molecules with complex level structures.

  4. Direct simulation Monte Carlo modeling of relaxation processes in polyatomic gases

    Science.gov (United States)

    Pfeiffer, M.; Nizenkov, P.; Mirza, A.; Fasoulas, S.

    2016-02-01

    Relaxation processes of polyatomic molecules are modeled and implemented in an in-house Direct Simulation Monte Carlo code in order to enable the simulation of atmospheric entry maneuvers at Mars and Saturn's Titan. The description of rotational and vibrational relaxation processes is derived from basic quantum-mechanics using a rigid rotator and a simple harmonic oscillator, respectively. Strategies regarding the vibrational relaxation process are investigated, where good agreement for the relaxation time according to the Landau-Teller expression is found for both methods, the established prohibiting double relaxation method and the new proposed multi-mode relaxation. Differences and applications areas of these two methods are discussed. Consequently, two numerical methods used for sampling of energy values from multi-dimensional distribution functions are compared. The proposed random-walk Metropolis algorithm enables the efficient treatment of multiple vibrational modes within a time step with reasonable computational effort. The implemented model is verified and validated by means of simple reservoir simulations and the comparison to experimental measurements of a hypersonic, carbon-dioxide flow around a flat-faced cylinder.

  5. Direct simulation Monte Carlo modeling of relaxation processes in polyatomic gases

    International Nuclear Information System (INIS)

    Pfeiffer, M.; Nizenkov, P.; Mirza, A.; Fasoulas, S.

    2016-01-01

    Relaxation processes of polyatomic molecules are modeled and implemented in an in-house Direct Simulation Monte Carlo code in order to enable the simulation of atmospheric entry maneuvers at Mars and Saturn’s Titan. The description of rotational and vibrational relaxation processes is derived from basic quantum-mechanics using a rigid rotator and a simple harmonic oscillator, respectively. Strategies regarding the vibrational relaxation process are investigated, where good agreement for the relaxation time according to the Landau-Teller expression is found for both methods, the established prohibiting double relaxation method and the new proposed multi-mode relaxation. Differences and applications areas of these two methods are discussed. Consequently, two numerical methods used for sampling of energy values from multi-dimensional distribution functions are compared. The proposed random-walk Metropolis algorithm enables the efficient treatment of multiple vibrational modes within a time step with reasonable computational effort. The implemented model is verified and validated by means of simple reservoir simulations and the comparison to experimental measurements of a hypersonic, carbon-dioxide flow around a flat-faced cylinder

  6. Direct simulation Monte Carlo modeling of relaxation processes in polyatomic gases

    Energy Technology Data Exchange (ETDEWEB)

    Pfeiffer, M., E-mail: mpfeiffer@irs.uni-stuttgart.de; Nizenkov, P., E-mail: nizenkov@irs.uni-stuttgart.de; Mirza, A., E-mail: mirza@irs.uni-stuttgart.de; Fasoulas, S., E-mail: fasoulas@irs.uni-stuttgart.de [Institute of Space Systems, University of Stuttgart, Pfaffenwaldring 29, D-70569 Stuttgart (Germany)

    2016-02-15

    Relaxation processes of polyatomic molecules are modeled and implemented in an in-house Direct Simulation Monte Carlo code in order to enable the simulation of atmospheric entry maneuvers at Mars and Saturn’s Titan. The description of rotational and vibrational relaxation processes is derived from basic quantum-mechanics using a rigid rotator and a simple harmonic oscillator, respectively. Strategies regarding the vibrational relaxation process are investigated, where good agreement for the relaxation time according to the Landau-Teller expression is found for both methods, the established prohibiting double relaxation method and the new proposed multi-mode relaxation. Differences and applications areas of these two methods are discussed. Consequently, two numerical methods used for sampling of energy values from multi-dimensional distribution functions are compared. The proposed random-walk Metropolis algorithm enables the efficient treatment of multiple vibrational modes within a time step with reasonable computational effort. The implemented model is verified and validated by means of simple reservoir simulations and the comparison to experimental measurements of a hypersonic, carbon-dioxide flow around a flat-faced cylinder.

  7. Electron re-scattering from aligned linear molecules using the R-matrix method

    International Nuclear Information System (INIS)

    Harvey, A G; Tennyson, J

    2009-01-01

    Electron re-scattering in a strong laser field provides an important probe of molecular structure and processes. The laser field drives the ionization of the molecule, followed by acceleration and subsequent recollision of the electron with the parent molecular ion, the scattered electrons carry information about the nuclear geometry and electronic states of the molecular ion. It is advantageous in strong field experiments to work with aligned molecules, which introduces extra physics compared to the standard gas-phase, electron-molecule scattering problem. The formalism for scattering from oriented linear molecules is presented and applied to H 2 and CO 2 . Differential cross sections are presented for (re-)scattering by these systems concentrating on the most common, linear alignment. In H 2 these cross sections show significant angular structure which, particularly for a scattering angle of 90 deg., are predicted to vary significantly between re-collisions stimulated by an even or an odd number of photons. In CO 2 these cross sections are zero indicating the necessity of using non-parallel alignment with this molecule.

  8. Ab initio calculations on collisions of low energy electrons with polyatomic molecules

    International Nuclear Information System (INIS)

    Rescigno, T.N.

    1991-01-01

    The Kohn variational method is one of simplest, and oldest, techniques for performing scattering calculations. Nevertheless, a number of formal problems, as well as practical difficulties associated with the computation of certain required matrix elements, delayed its application to electron--molecule scattering problems for many years. This paper will describe the recent theoretical and computational developments that have made the ''complex'' Kohn variational method a practical tool for carrying out calculations of low energy electron--molecule scattering. Recent calculations on a number of target molecules will also be summarized. 41 refs., 7 figs

  9. Accurate and approximate thermal rate constants for polyatomic chemical reactions

    International Nuclear Information System (INIS)

    Nyman, Gunnar

    2007-01-01

    In favourable cases it is possible to calculate thermal rate constants for polyatomic reactions to high accuracy from first principles. Here, we discuss the use of flux correlation functions combined with the multi-configurational time-dependent Hartree (MCTDH) approach to efficiently calculate cumulative reaction probabilities and thermal rate constants for polyatomic chemical reactions. Three isotopic variants of the H 2 + CH 3 → CH 4 + H reaction are used to illustrate the theory. There is good agreement with experimental results although the experimental rates generally are larger than the calculated ones, which are believed to be at least as accurate as the experimental rates. Approximations allowing evaluation of the thermal rate constant above 400 K are treated. It is also noted that for the treated reactions, transition state theory (TST) gives accurate rate constants above 500 K. TST theory also gives accurate results for kinetic isotope effects in cases where the mass of the transfered atom is unchanged. Due to neglect of tunnelling, TST however fails below 400 K if the mass of the transferred atom changes between the isotopic reactions

  10. Research Directed at Developing a Classical Theory to Describe Isotope Separation of Polyatomic Molecules Illuminated by Intense Infrared Radiation. Final Report for period May 7, 1979 to September 30, 1979; Extension December 31, 1997

    Science.gov (United States)

    Lamb, W. E. Jr.

    1981-12-01

    This final report describes research on the theory of isotope separation produced by the illumination of polyatomic molecules by intense infrared laser radiation. This process is investigated by treating the molecule, sulfur hexafluoride, as a system of seven classical particles that obey the Newtonian equations of motion. A minicomputer is used to integrate these differential equations. The particles are acted on by interatomic forces, and by the time-dependent electric field of the laser. We have a very satisfactory expression for the interaction of the laser and the molecule which is compatible with infrared absorption and spectroscopic data. The interatomic potential is capable of improvement, and progress on this problem is still being made. We have made several computer runs of the dynamical behavior of the molecule using a reasonably good model for the interatomic force law. For the laser parameters chosen, we find that typically the molecule passes quickly through the resonance region into the quasi-continuum and even well into the real continuum before dissociation actually occurs. When viewed on a display terminal, the motions are exceedingly complex. As an aid to the visualization of the process, we have made a number of 16 mm movies depicting a three-dimensional representation of the motion of the seven particles. These show even more clearly the enormous complexity of the motions, and make clear the desirability of finding ways of characterizing the motion in simple ways without giving all of the numerical detail. One of the ways to do this is to introduce statistical parameters such as a temperature associated with the distribution of kinetic energies of the single particle. We have made such an analysis of our data runs, and have found favorable indications that such methods will prove useful in keeping track of the dynamical histories.

  11. Application of the generator coordinates method to the intra-molecular proton tunneling in the malonaldehyde molecule

    International Nuclear Information System (INIS)

    Schmidt, Andre Campos Kersten

    1995-01-01

    The effects of different vibrational modes on the isomerization process of polyatomic molecules, or solvent's effects on reaction rates are object of up-to-date interest. In general, such many body phenomena are, in principle, multidimensional, and they first require a reduction of relevant degrees of freedom. In order to investigated, some aspects of the intra-molecular proton tunneling on a malonaldehyde molecule, we use the Generator Coordinate Method. The model used to describe such a process is the so-called System-Bath model, where the system is the reaction coordinate and the bath are the intrinsic degrees of freedom (vibrational modes of the molecule), which are described by a harmonic oscillator set linearly coupled to the system. The reduction of the multidimensional problem to the effective unidimensional one is done using a energy related variational principle on the intrinsic degrees of freedom. we obtained analytically a effective Hamiltonian where the effects of the various degrees of freedom reveal themselves in the appearance of a effective mass and in changes of the shape of the potential barrier. The analyticity of the method was crucial on identifying clearly the roles played by the different physical parameters involved. (author)

  12. The synthesis of complex molecules in interstellar clouds

    Science.gov (United States)

    Huntress, W. T., Jr.; Mitchell, G. F.

    1979-01-01

    The abundances of polyatomic molecules that may be formed by CH3(+) radiative association reactions in dense interstellar molecular clouds are reevaluated. The formation of a number of complex interstellar molecules via radiative association reactions involving ionic precursors other than CH3(+) is also investigated; these additional precursors include CH3O(+), CH3CO(+), CH5(+), HCO(+), NO(+), H2CN(+), C2H2(+), and NH3(+). The results indicate that the postulated gas-phase ion-molecule radiative association reactions could potentially explain the synthesis of most of the more complex species observed in dense molecular clouds such as Sgr B2. It is concluded, however, that in order to be conclusive, laboratory data are needed to show whether or not these reactions proceed at the required rates at low temperatures.

  13. Time-Dependent Wave Packet Dynamics Calculations of Cross Sections for Ultracold Scattering of Molecules

    Science.gov (United States)

    Huang, Jiayu; Liu, Shu; Zhang, Dong H.; Krems, Roman V.

    2018-04-01

    Because the de Broglie wavelength of ultracold molecules is very large, the cross sections for collisions of molecules at ultracold temperatures are always computed by the time-independent quantum scattering approach. Here, we report the first accurate time-dependent wave packet dynamics calculation for reactive scattering of ultracold molecules. Wave packet dynamics calculations can be applied to molecular systems with more dimensions and provide real-time information on the process of bond rearrangement and/or energy exchange in molecular collisions. Our work thus makes possible the extension of rigorous quantum calculations of ultracold reaction properties to polyatomic molecules and adds a new powerful tool for the study of ultracold chemistry.

  14. Linear-algebraic approach to electron-molecule collisions: General formulation

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.

    1981-01-01

    We present a linear-algebraic approach to electron-molecule collisions based on an integral equations form with either logarithmic or asymptotic boundary conditions. The introduction of exchange effects does not alter the basic form or order of the linear-algebraic equations for a local potential. In addition to the standard procedure of directly evaluating the exchange integrals by numerical quadrature, we also incorporate exchange effects through a separable-potential approximation. Efficient schemes are developed for reducing the number of points and channels that must be included. The method is applied at the static-exchange level to a number of molecular systems including H 2 , N 2 , LiH, and CO 2

  15. On the calculation of internal forces in mechanically stressed polyatomic molecules

    International Nuclear Information System (INIS)

    Avdoshenko, Stanislav M.; Konda, Sai Sriharsha M.; Makarov, Dmitrii E.

    2014-01-01

    We discuss how to define and to compute internal forces in a molecule subjected to mechanical stress. Because of the inherently many-body character of intramolecular interactions, internal forces cannot be uniquely defined without specifying a set of internal coordinates used to describe the molecular structure. When such a set is comprised of 3N − 6 interactomic distances (N being the number of atoms) and includes the bond lengths of interest, we show that the associated forces, while satisfying the equation F = ∂V/∂R (where R is the bond length, F is the internal force in this bond, and V is the potential energy of the molecule), can be determined from the molecular geometry alone. We illustrate these ideas using several toy models ranging from small molecules to a graphene sheet and show that the magnitude of the internal force in a bond is not necessarily a good predictor of its strength in response to mechanical loading. At the same time, analysis of internal forces reveals interesting phenomena such as the force multiplication effect, where weak external forces may, e.g., be used to break strong bonds, and offers insight into the catch-bond phenomenon where chemical reactivity is suppressed through application of a force

  16. Positron scattering by molecules: implementation of the C-tilde-functional

    International Nuclear Information System (INIS)

    Silva Lino, Jorge Luiz da

    1995-01-01

    In this work, we present a formulation called the C-Functional to study collisions of low-energy positron by molecules. This formalism is based on the Schwinger Multichannel Method for positrons which although being a quite general method (it is applicable to polyatomic molecules and include polarization and multichannel coupling) is limited to the use of trial wavefunctions consisting only of square integrable basis functions (Gaussian Cartesian Function). In principle this is not a problem, considering that the Schwinger type of methods require a good description of the scattering wavefunction only in the region where the potential is non-zero. However, there exist some situations (long range potentials) where the SMC has consequences. The C-functional (CF) consists in writing the wavefunctions as a sum of a plane-wave plus a combination of trial functions (where the combination is variationally determined). The basic difference between the 2 cases (SMC and CF) is the presence in the CF amplitude of the First (FBA) and Second Born terms. Aiming the preservation of important features of the SMG, we have developed general codes (applicable to polyatomic targets) to evaluate these terms. To illustrate the CF method we show elastic cross sections ti He and H 2 . (author)

  17. Application of the R-matrix method to photoionization of molecules.

    Science.gov (United States)

    Tashiro, Motomichi

    2010-04-07

    The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

  18. Importance of the alignment of polar π conjugated molecules inside carbon nanotubes in determining second-order non-linear optical properties.

    Science.gov (United States)

    Yumura, Takashi; Yamamoto, Wataru

    2017-09-20

    We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the

  19. Excitonic Coupling in Linear and Trefoil Trimer Perylenediimide Molecules Probed by Single-Molecule Spectroscopy

    KAUST Repository

    Yoo, Hyejin

    2012-10-25

    Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.

  20. Excitonic Coupling in Linear and Trefoil Trimer Perylenediimide Molecules Probed by Single-Molecule Spectroscopy

    KAUST Repository

    Yoo, Hyejin; Furumaki, Shu; Yang, Jaesung; Lee, Ji-Eun; Chung, Heejae; Oba, Tatsuya; Kobayashi, Hiroyuki; Rybtchinski, Boris; Wilson, Thea M.; Wasielewski, Michael R.; Vacha, Martin; Kim, Dongho

    2012-01-01

    Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.

  1. Molecular dynamics study of kinetic boundary condition at an interface between a polyatomic vapor and its condensed phase

    OpenAIRE

    Ishiyama, Tatsuya; Yano, Takeru; Fujikawa, Shigeo

    2004-01-01

    The kinetic boundary condition for the Boltzmann equation at an interface between a polyatomic vapor and its liquid phase is investigated by the numerical method of molecular dynamics, with particular emphasis on the functional form of the evaporation part of the boundary condition, including the evaporation coefficient. The present study is an extension of a previous one for argon [Ishiyama, Yano, and Fujikawa, Phys. Fluids 16, 2899 (2004)] to water and methanol, typical examples of polyatom...

  2. Application of the method of continued fractions for electron scattering by linear molecules

    International Nuclear Information System (INIS)

    Lee, M.-T.; Iga, I.; Fujimoto, M.M.; Lara, O.; Brasilia Univ., DF

    1995-01-01

    The method of continued fractions (MCF) of Horacek and Sasakawa is adapted for the first time to study low-energy electron scattering by linear molecules. Particularly, we have calculated the reactance K-matrices for an electron scattered by hydrogen molecule and hydrogen molecular ion as well as by a polar LiH molecule in the static-exchange level. For all the applications studied herein. the calculated physical quantities converge rapidly, even for a strongly polar molecule such as LiH, to the correct values and in most cases the convergence is monotonic. Our study suggests that the MCF could be an efficient method for studying electron-molecule scattering and also photoionization of molecules. (Author)

  3. One-dimensional treatment of polyatomic crystals by the Laplace transform method

    International Nuclear Information System (INIS)

    Rosato, A.; Santana, P.H.A.

    1976-01-01

    The one dimensional periodic potential problem is solved using the Laplace transform method and a condensed expression for the relation E x k and effective mass for one electron in a polyatomic structure is determined. Applications related to the effect of the asymmetry of the potential upon the one dimensional band structure are discussed [pt

  4. Path-integral approach to resonant electron-molecule scattering

    International Nuclear Information System (INIS)

    Winterstetter, M.; Domcke, W.

    1993-01-01

    A path-integral formulation of resonant electron-molecule scattering is developed within the framework of the projection-operator formalism of scattering theory. The formation and decay of resonances is treated in real time as a quantum-mechanical electronic-tunneling process, modified by the coupling of the electronic motion with the nuclear degrees of freedom. It is shown that the electronic continuum can be summed over in the path-integral formulation, resulting formally in the path integral for an effective two-state system with coupling to vibrations. The harmonic-oscillator approximation is adopted for the vibrational motion in the present work. Approximation methods are introduced which render the numerical evaluation of the sum over paths feasible for up to ∼10 3 elementary time slices. The theory is numerically realized for simple but nontrivial models representing the 2 Π g d-wave shape resonance in e - +N 2 collisions and the 2 Σ u + p-wave shape resonance in e - +H 2 collisions, respectively. The accuracy of the path-integral results is assessed by comparison with exact numerical reference data for these models. The essential virtue of the path-integral approach is the fact that the computational effort scales at most linearly with the number of vibrational degrees of freedom. The path-integral method is thus well suited to treat electron collisions with polyatomic molecules and molecular aggregates

  5. Constructing Potential Energy Surfaces for Polyatomic Systems: Recent Progress and New Problems

    Directory of Open Access Journals (Sweden)

    J. Espinosa-Garcia

    2012-01-01

    Full Text Available Different methods of constructing potential energy surfaces in polyatomic systems are reviewed, with the emphasis put on fitting, interpolation, and analytical (defined by functional forms approaches, based on quantum chemistry electronic structure calculations. The different approaches are reviewed first, followed by a comparison using the benchmark H + CH4 and the H + NH3 gas-phase hydrogen abstraction reactions. Different kinetics and dynamics properties are analyzed for these reactions and compared with the available experimental data, which permits one to estimate the advantages and disadvantages of each method. Finally, we analyze different problems with increasing difficulty in the potential energy construction: spin-orbit coupling, molecular size, and more complicated reactions with several maxima and minima, which test the soundness and general applicability of each method. We conclude that, although the field of small systems, typically atom-diatom, is mature, there still remains much work to be done in the field of polyatomic systems.

  6. The role of the dynamic pressure in stationary heat conduction of a rarefied polyatomic gas

    Energy Technology Data Exchange (ETDEWEB)

    Arima, Takashi, E-mail: arima@kanagawa-u.ac.jp [Department of Mechanical Engineering, Faculty of Engineering, Kanagawa University, Yokohama 221-8686 (Japan); Barbera, Elvira, E-mail: ebarbera@unime.it [Department of Mathematics and Computer Science, University of Messina, V.le F. D' Alcontres 31, 98166 Messina (Italy); Brini, Francesca, E-mail: francesca.brini@unibo.it [Department of Mathematics, University of Bologna, via Saragozza 8, 40123 Bologna (Italy); Sugiyama, Masaru, E-mail: sugiyama@nitech.ac.jp [Graduate School of Engineering, Nagoya Institute of Technology, Nagoya 466-8555 (Japan)

    2014-07-18

    The effect of the dynamic pressure (non-equilibrium pressure) on stationary heat conduction in a rarefied polyatomic gas at rest is elucidated by the theory of extended thermodynamics. It is shown that this effect is observable in a non-polytropic gas. Numerical studies are presented for a para-hydrogen gas as a typical example. - Highlights: • Heat transfer problem in polyatomic rarefied gases is studied in different domains. • Non-zero dynamic pressure is predicted in non-polytropic gases. • The effect of dynamic pressure can be observed indirectly in an experiment. • The case of para-hydrogen is analyzed as an example. • Navier–Stokes, Fourier, and Extended Thermodynamics predictions are compared.

  7. Study on infrared multiphoton excitation of the linear triatomic molecule by the Lie-algebra approach

    International Nuclear Information System (INIS)

    Feng, H.; Zheng, Y.; Ding, S.

    2007-01-01

    Infrared multiphoton vibrational excitation of the linear triatomic molecule has been studied using the quadratic anharmonic Lie-algebra model, unitary transformations, and Magnus approximation. An explicit Lie-algebra expression for the vibrational transition probability is obtained by using a Lie-algebra approach. This explicit Lie-algebra expressions for time-evolution operator and vibrational transition probabilities make the computation clearer and easier. The infrared multiphoton vibrational excitation of the DCN linear tri-atomic molecule is discussed as an example

  8. Spectroscopic and dynamical studies of highly energized small polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Field, R.W.; Silbey, R.J. [Massachusetts Institute of Technology, Cambridge (United States)

    1993-12-01

    The authors have initiated a program to perform spectroscopic and dynamic studies of small molecules. Large amplitude motions in excited acetylene were discussed along with plans to record the dispersed fluorescence (DF) and the stimulated emission pumping (SEP) spectra. SEP spectra were reported for the formyl radical. A Fourier transform spectrometer was discussed with respect to its ability to probe the structure of radicals. This instrument is capable of performing studies using various techniques such as magnetic rotation spectroscopy and sub-Doppler sideband-OODR Zeman (SOODRZ) spectroscopy.

  9. Molecular physics. Theoretical principles and experimental methods

    International Nuclear Information System (INIS)

    Demtroeder, W.

    2005-01-01

    This advanced textbook comprehensively explains important principles of diatomic and polyatomic molecules and their spectra in two separate, distinct parts. The first part concentrates on the theoretical aspects of molecular physics, whereas the second part of the book covers experimental techniques, i.e. laser, Fourier, NMR, and ESR spectroscopies, used in the fields of physics, chemistry, biolog, and material science. Appropriate for undergraduate and graduate students in physics and chemistry with a knowledge of atomic physics and familiar with the basics of quantum mechanics. From the contents: - Electronic States of Molecules, - Rotation, Oscillation and Potential Curves of Diatomic Molecules, - The Spectra of Diatomic Molecules, - Molecule Symmetries and Group Theory, - Rotation and Oscillations of Polyatomic Molecules, - Electronic States of Polyatomic Molecules, - The Spectra of Polyatomic Molecules, - Collapse of the Born-Oppenheimer-Approximation, Disturbances in Molecular Spectra, - Molecules in Disturbing Fields, - Van-der-Waals-Molecules and Cluster, - Experimental Techniques in Molecular Physics. (orig.)

  10. Potential energy surface from spectroscopic data in the photodissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Kim, Hwa Joong; Kim, Young Sik

    2001-01-01

    The time-dependent tracking inversion method is studied to extract the potential energy surface of the electronic excited state in the photodissociation of triatomic molecules. Based on the relay of the regularized inversion procedure and time-dependent wave packet propagation, the algorithm extracts the underlying potential energy surface piece by tracking the time-dependent data, which can be synthesized from Raman excitation profiles. We have demonstrated the algorithm to extract the potential energy surface of electronic excited state for NO 2 molecule where the wave packet split on a saddle-shaped surface. Finally, we describe the merits of the time-dependent tracking inversion method compared with the time-dependent inversion method and discussed several extensions of the algorithm

  11. Structure of deformable diatomic molecules: a modified n-butane liquid

    International Nuclear Information System (INIS)

    Jang, Seanea; Kim, Soonchul; Lee, Songhi

    2005-01-01

    The density functional approximation for polyatomic molecules, which is based on the bridge function of the intermolecular interaction, was developed and applied to investigate the thermodynamic and the structural properties of deformable diatomic molecules. The Percus trick was employed to calculate the uniform structure of modified n-butane. The calculated static correlation functions were used to predict the density behaviors of a modified n-butane liquid at liquid-solid interfaces. The theoretical results show that (i) at low densities, the hypernetted-chain (HNC) equation compares with the density functional approximation based on the bridge function and that (ii) the relative population between the gauche and the trans states strongly affects the liquid structure at liquid-solid interfaces.

  12. Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap

    Science.gov (United States)

    Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael

    2013-05-01

    In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.

  13. Electron ionization of open/closed chain isocarbonic molecules relevant in plasma processing: Theoretical cross sections

    International Nuclear Information System (INIS)

    Patel, Umang R.; Joshipura, K. N.; Pandya, Siddharth H.; Kothari, Harshit N.

    2014-01-01

    In this paper, we report theoretical electron impact ionization cross sections from threshold to 2000 eV for isocarbonic open chain molecules C 4 H 6 , C 4 H 8 , C 4 F 6 including their isomers, and closed chain molecules c-C 4 H 8 and c-C 4 F 8 . Theoretical formalism employed presently, viz., Complex Scattering Potential-ionization contribution method has been used successfully for a variety of polyatomic molecules. The present ionization calculations are very important since results available for the studied targets are either scarce or none. Our work affords comparison of C 4 containing hydrocarbon versus fluorocarbon molecules. Comparisons of the present ionization cross sections are made wherever possible, and new ionization data are also presented

  14. Kinetic theory of two-temperature polyatomic plasmas

    Science.gov (United States)

    Orlac'h, Jean-Maxime; Giovangigli, Vincent; Novikova, Tatiana; Roca i Cabarrocas, Pere

    2018-03-01

    We investigate the kinetic theory of two-temperature plasmas for reactive polyatomic gas mixtures. The Knudsen number is taken proportional to the square root of the mass ratio between electrons and heavy-species, and thermal non-equilibrium between electrons and heavy species is allowed. The kinetic non-equilibrium framework also requires a weak coupling between electrons and internal energy modes of heavy species. The zeroth-order and first-order fluid equations are derived by using a generalized Chapman-Enskog method. Expressions for transport fluxes are obtained in terms of macroscopic variable gradients and the corresponding transport coefficients are expressed as bracket products of species perturbed distribution functions. The theory derived in this paper provides a consistent fluid model for non-thermal multicomponent plasmas.

  15. Collisions of polyatomic ions with surfaces: incident energy partitioning and chemical reactions

    International Nuclear Information System (INIS)

    Zabka, J.; Roithova, J.; Dolejsek, Z.; Herman, Z.

    2002-01-01

    Collision of polyatomic ions with surfaces were investigated in ion-surface scattering experiments to obtain more information on energy partitioning in ion-surface collision and on chemical reactions at surfaces. Mass spectra, translation energy and angular distributions of product ions were measured in dependence on the incident energy and the incident angle of polyatomic projectiles. From these data distributions of energy fractions resulting in internal excitation of the projectile, translation energy of the product ions, and energy absorbed by the surface were determined. The surface investigated were a standard stainless steel surface, covered by hydrocarbons, carbon surfaces at room and elevated temperatures, and several surfaces covered by a self-assembled monolayers (C 12 -hydrocarbon SAM, C 11 -perfluorohydrocarbon SAM, and C 11 hydrocarbon with terminal -COOH group SAM). The main processes observed at collision energies of 10 - 50 eV were: neutralization of the ions at surfaces, inelastic scattering and dissociations of the projectile ions, quasi elastic scattering of the projectile ions, and chemical reactions with the surface material (usually hydrogen-atom transfer reactions). The ion survival factor was estimated to be a few percent for even-electron ions (like protonated ethanol ion, C 2 H 5 O + , CD 5 + ) and about 10 - 10 2 times lower for radical ions (like ethanol and benzene molecular ions, CD 4 + ). In the polyatomic ion -surface energy transfer experiments, the ethanol molecular ion was used as a well-characterized projectile ion. The results with most of the surfaces studied showed in the collision energy range of 13 - 32 eV that most collisions were strongly inelastic with about 6 - 8 % of the incident projectile energy transformed into internal excitation of the projectile (independent of the incident angle) and led partially to its further dissociation in a unimolecular way after the interaction with the surface. The incident energy

  16. Polyatomic ions from a high current ion implanter driven by a liquid metal ion source

    Science.gov (United States)

    Pilz, W.; Laufer, P.; Tajmar, M.; Böttger, R.; Bischoff, L.

    2017-12-01

    High current liquid metal ion sources are well known and found their first application as field emission electric propulsion thrusters in space technology. The aim of this work is the adaption of such kind of sources in broad ion beam technology. Surface patterning based on self-organized nano-structures on, e.g., semiconductor materials formed by heavy mono- or polyatomic ion irradiation from liquid metal (alloy) ion sources (LMAISs) is a very promising technique. LMAISs are nearly the only type of sources delivering polyatomic ions from about half of the periodic table elements. To overcome the lack of only very small treated areas by applying a focused ion beam equipped with such sources, the technology taken from space propulsion systems was transferred into a large single-end ion implanter. The main component is an ion beam injector based on high current LMAISs combined with suited ion optics allocating ion currents in the μA range in a nearly parallel beam of a few mm in diameter. Different types of LMAIS (needle, porous emitter, and capillary) are presented and characterized. The ion beam injector design is specified as well as the implementation of this module into a 200 kV high current ion implanter operating at the HZDR Ion Beam Center. Finally, the obtained results of large area surface modification of Ge using polyatomic Bi2+ ions at room temperature from a GaBi capillary LMAIS will be presented and discussed.

  17. Conformational Effects in Non-Stoichiometric Complexes of Two Hyperbranched Molecules with a Linear Polyelectrolyte

    Directory of Open Access Journals (Sweden)

    Alexey Lyulin

    2012-01-01

    Full Text Available We report results from Brownian dynamics computer simulations of systems comprised by two terminally charged hyperbranched molecules preferentially branched in the periphery, with an oppositely charged linear chain of varying length. Comparison of the findings from the present study to stoichiometric counterparts and to analogous dendrimer-based complexes, reveal that the presence of the second hyperbranched molecule incurs significant changes in the conformational characteristics of both components of the complex. Instead of step-like changes in the average size and shape of the hyperbranched component that were noted in the previously studied stoichiometric systems, a rather smooth change is observed upon increase of the length of the linear component. In addition, a markedly different behavior is also noticed in the conformational characteristics of the linear chain when compared to that in similar dendrimer-based systems. The above findings are consistent with the higher degree of deformability of the peripherally branched molecules which allow appropriate rearrangements in shape in order to accommodate the favorable Coulombic interactions between the two components of the complex. This behavior offers new insight towards the design of more efficient hyperbranched-based systems which can take advantage of the multifunctionality and the structural properties of the highly branched polymer components.

  18. Low-energy positron interactions with atoms and molecules

    International Nuclear Information System (INIS)

    Surko, C M; Gribakin, G F; Buckman, S J

    2005-01-01

    This paper is a review of low-energy positron interactions with atoms and molecules. Processes of interest include elastic scattering, electronic and vibrational excitation, ionization, positronium formation and annihilation. An overview is presented of the currently available theoretical and experimental techniques to study these phenomena, including the use of trap-based positron beam sources to study collision processes with improved energy resolution. State-resolved measurements of electronic and vibrational excitation cross sections and measurement of annihilation rates in atoms and molecules as a function of incident positron energy are discussed. Where data are available, comparisons are made with analogous electron scattering cross sections. Resonance phenomena, common in electron scattering, appear to be less common in positron scattering. Possible exceptions include the sharp onsets of positron-impact electronic and vibrational excitation of selected molecules. Recent energy-resolved studies of positron annihilation in hydrocarbons containing more than a few carbon atoms provide direct evidence that vibrational Feshbach resonances underpin the anomalously large annihilation rates observed for many polyatomic species. We discuss open questions regarding this process in larger molecules, as well as positron annihilation in smaller molecules where the theoretical picture is less clear. (topical review)

  19. Mixed Quantum/Classical Theory for Molecule-Molecule Inelastic Scattering: Derivations of Equations and Application to N2 + H2 System.

    Science.gov (United States)

    Semenov, Alexander; Babikov, Dmitri

    2015-12-17

    The mixed quantum classical theory, MQCT, for inelastic scattering of two molecules is developed, in which the internal (rotational, vibrational) motion of both collision partners is treated with quantum mechanics, and the molecule-molecule scattering (translational motion) is described by classical trajectories. The resultant MQCT formalism includes a system of coupled differential equations for quantum probability amplitudes, and the classical equations of motion in the mean-field potential. Numerical tests of this theory are carried out for several most important rotational state-to-state transitions in the N2 + H2 system, in a broad range of collision energies. Besides scattering resonances (at low collision energies) excellent agreement with full-quantum results is obtained, including the excitation thresholds, the maxima of cross sections, and even some smaller features, such as slight oscillations of energy dependencies. Most importantly, at higher energies the results of MQCT are nearly identical to the full quantum results, which makes this approach a good alternative to the full-quantum calculations that become computationally expensive at higher collision energies and for heavier collision partners. Extensions of this theory to include vibrational transitions or general asymmetric-top rotor (polyatomic) molecules are relatively straightforward.

  20. Systematic studies of molecular vibrational anharmonicity and vibration-rotation interaction by self-consistent-field higher derivative methods: Applications to asymmetric and symmetric top and linear polyatomic molecules

    International Nuclear Information System (INIS)

    Clabo, D.A. Jr.

    1987-04-01

    Inclusion of the anharmonicity normal mode vibrations [i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface] is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules

  1. Systematic studies of molecular vibrational anharmonicity and vibration-rotation interaction by self-consistent-field higher derivative methods: Applications to asymmetric and symmetric top and linear polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Clabo, D.A. Jr.

    1987-04-01

    Inclusion of the anharmonicity normal mode vibrations (i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface) is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules.

  2. Can Internal Conversion BE Controlled by Mode-Specific Vibrational Excitation in Polyatomic Molecules

    Science.gov (United States)

    Portnov, Alexander; Epshtein, Michael; Bar, Ilana

    2017-06-01

    Nonadiabatic processes, dominated by dynamic passage of reactive fluxes through conical intersections (CIs) are considered to be appealing means for manipulating reaction paths. One approach that is considered to be effective in controlling the course of dissociation processes is the selective excitation of vibrational modes containing a considerable component of motion. Here, we have chosen to study the predissociation of the model test molecule, methylamine and its deuterated isotopologues, excited to well-characterized quantum states on the first excited electronic state, S_{1}, by following the N-H(D) bond fission dynamics through sensitive H(D) photofragment probing. The branching ratios between slow and fast H(D) photofragments, the internal energies of their counter radical photofragments and the anisotropy parameters for fast H photofragments, confirm correlated anomalies for predissociation initiated from specific rovibronic states, reflecting the existence of a dynamic resonance in each molecule. This resonance strongly depends on the energy of the initially excited rovibronic states, the evolving vibrational mode on the repulsive S_{1} part during N-H(D) bond elongation, and the manipulated passage through the CI that leads to radicals excited with C-N-H(D) bending and preferential perpendicular bond breaking, relative to the photolyzing laser polarization, in molecules containing the NH_{2} group. The indicated resonance plays an important role in the bifurcation dynamics at the CI and can be foreseen to exist in other photoinitiated processes and to control their outcome.

  3. An exactly solvable model for multiphoton excitation of polyatomic molecules in the presence of collisions

    International Nuclear Information System (INIS)

    Strekalov, M L

    2013-01-01

    A theoretical study has been made on the non-stationary phenomena in the relaxation of highly vibrationally excited molecules under laser radiation giving rise to these molecules. An exact analytical solution to the master equation has been obtained in terms of Meixner polynomials with regard to VV and VT processes. The time-dependent vibrational distribution is used to obtain analytical expressions for the mean number of photons, stored on the vibrational degrees of freedom and transferred to a thermal bath. Using the latter result, an explicit expression is given for the average energy transfer as a function of time. Its dependence on the partial pressure of absorbing molecules has also been established. (paper)

  4. Detection of kinetic change points in piece-wise linear single molecule motion

    Science.gov (United States)

    Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.

    2018-03-01

    Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.

  5. Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

    Science.gov (United States)

    Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

    2015-07-13

    We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

  6. The second-order description of rotational non-equilibrium effects in polyatomic gases

    Science.gov (United States)

    Myong, Rho Shin

    2017-11-01

    The conventional description of gases is based on the physical laws of conservation (mass, momentum, and energy) in conjunction with the first-order constitutive laws, the two-century old so-called Navier-Stokes-Fourier (NSF) equation based on a critical assumption made by Stokes in 1845 that the bulk viscosity vanishes. While the Stokes' assumption is certainly legitimate in the case of dilute monatomic gases, ever increasing evidences, however, now indicate that such is not the case, in particular, in the case of polyatomic gases-like nitrogen and carbon dioxide-far-from local thermal equilibrium. It should be noted that, from room temperature acoustic attenuation data, the bulk viscosity for carbon dioxide is three orders of magnitude larger than its shear viscosity. In this study, this fundamental issue in compressible gas dynamics is revisited and the second-order constitutive laws are derived by starting from the Boltzmann-Curtiss kinetic equation. Then the topology of the second-order nonlinear coupled constitutive relations in phase space is investigated. Finally, the shock-vortex interaction problem where the strong interaction of two important thermal (translational and rotational) non-equilibrium phenomena occurs is considered in order to highlight the rotational non-equilibrium effects in polyatomic gases. This work was supported by the National Research Foundation of South Korea (NRF 2017-R1A2B2-007634).

  7. Laser ablation-inductively coupled plasma-mass spectrometry: Examinations of the origins of polyatomic ions and advances in the sampling of particulates

    Energy Technology Data Exchange (ETDEWEB)

    Witte, Travis [Iowa State Univ., Ames, IA (United States)

    2011-01-01

    This dissertation provides a general introduction to Inductively coupled plasma-mass spectrometry (ICP-MS) and laser ablation (LA) sampling, with an examination of analytical challenges in the employment of this technique. It discusses the origin of metal oxide ions (MO+) in LA-ICP-MS, as well as the effect of introducing helium and nitrogen to the aerosol gas flow on the formation of these polyatomic interferences. It extends the study of polyatomic ions in LA-ICP-MS to metal argide (MAr+) species, an additional source of possible significant interferences in the spectrum. It describes the application of fs-LA-ICP-MS to the determination of uranium isotope ratios in particulate samples.

  8. Damage functions generation for polyatomic materials irradiated in test reactors

    International Nuclear Information System (INIS)

    Alberman, A.; Lesueur, D.

    1987-06-01

    Neutron exposure parameters in polyatomic materials is of great importance for fusion technology programs. The COMPOSI code computes the number of displaced atoms of sub-lattice ''j'' induced by one atom of sub-lattice ''i'' either by direct collision or through intermediate knocked atom. The code uses Lindhard equations; it is solved by iterative process. The atomic displacements cross-sections, as a function of neutron energy are derived by folding previous results with ''i'' type PKA. Moreover the COMPOSI code may include recoils from charged particles e.g.: Alpha + Triton from Li 6 capture in Li Al 0 2 . These responses in various spectra are discussed [fr

  9. Interaction of VUV-photons with molecules. Spectroscopy and dynamics of molecular superexcited states

    International Nuclear Information System (INIS)

    Hatano, Y.

    2002-01-01

    Complete text of publication follows. A survey is given of recent progress in experimental studies of the interaction of VUV-photons with molecules, i.e., those of photoabsorption, photoionization, and photodissociation of molecules in the excitation photon energy range of 10-50 eV, with a particular emphasis placed on current understanding of the spectroscopy and dynamics of formed molecular superexcited states. These studies are of great importance in understanding the interaction of ionizing radiation with matter. Molecules studied are ranged from simple diatomic and triatomic molecules to polyatomic molecules such as hydrocarbons. Most of the observed molecular superexcited states are assigned to high Rydber states which are vibrationally, doubly, or inner-core excited and converge to each of ion states. Non-Rydberg superexcited states are also observed. Dissociation into neutral fragments in comparison with ionization is of unexpectedly great importance in the observed decay of each of these state-assigned superexcited molecules. Dissociation dynamics as well as its products of superexcited states are remarkably different from those of lower excited states below about ionization thresholds. Some remarks are also presented of molecules in the condensed phase

  10. Positron scattering by molecules: implementation of the C-tilde-functional; Espalhamento de positrons por moleculas: implementacao do funcional-C-tilde

    Energy Technology Data Exchange (ETDEWEB)

    Silva Lino, Jorge Luiz da

    1995-12-31

    In this work, we present a formulation called the C-Functional to study collisions of low-energy positron by molecules. This formalism is based on the Schwinger Multichannel Method for positrons which although being a quite general method (it is applicable to polyatomic molecules and include polarization and multichannel coupling) is limited to the use of trial wavefunctions consisting only of square integrable basis functions (Gaussian Cartesian Function). In principle this is not a problem, considering that the Schwinger type of methods require a good description of the scattering wavefunction only in the region where the potential is non-zero. However, there exist some situations (long range potentials) where the SMC has consequences. The C-functional (CF) consists in writing the wavefunctions as a sum of a plane-wave plus a combination of trial functions (where the combination is variationally determined). The basic difference between the 2 cases (SMC and CF) is the presence in the CF amplitude of the First (FBA) and Second Born terms. Aiming the preservation of important features of the SMG, we have developed general codes (applicable to polyatomic targets) to evaluate these terms. To illustrate the CF method we show elastic cross sections ti He and H{sub 2}. (author) 36 refs., 46 figs., 19 tabs.

  11. Photodissociation dynamics of polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hequan [Iowa State Univ., Ames, IA (United States)

    1998-02-23

    This report consists of five studies as follows: A laser photofragmentation time-of-flight mass spectrometric study of acetophenone at 193 and 248 nm; A 193 nm laser photofragmentation time-of-flight mass spectrometric study of dimethylsulfoxide; 193 nm laser photofragmentation time-of-flight mass spectrometric study of HSCH2CH2SH; Thiophene biradical decay of the primary laser photofragmentation product at 193 nm; and Scattering cross sections for O(3P)[SO(X,3Σ-)] + He[Ne, Ar, Kr]. Chapters are included for the introduction and general conclusions.

  12. Hydrodynamic limits of kinetic equations for polyatomic and reactive gases

    Directory of Open Access Journals (Sweden)

    Bisi M.

    2017-03-01

    Full Text Available Starting from a kinetic BGK-model for a rarefied polyatomic gas, based on a molecular structure of discrete internal energy levels, an asymptotic Chapman-Enskog procedure is developed in the asymptotic continuum limit in order to derive consistent fluid-dynamic equations for macroscopic fields at Navier-Stokes level. In this way, the model allows to treat the gas as a mixture of mono-atomic species. Explicit expressions are given not only for dynamical pressure, but also for shear stress, diffusion velocities, and heat flux. The analysis is shown to deal properly also with a mixture of reactive gases, endowed for simplicity with translational degrees of freedom only, in which frame analogous results can be achieved.

  13. Ion mobilities in diatomic gases: measurement versus prediction with non-specular scattering models.

    Science.gov (United States)

    Larriba, Carlos; Hogan, Christopher J

    2013-05-16

    Ion/electrical mobility measurements of nanoparticles and polyatomic ions are typically linked to particle/ion physical properties through either application of the Stokes-Millikan relationship or comparison to mobilities predicted from polyatomic models, which assume that gas molecules scatter specularly and elastically from rigid structural models. However, there is a discrepancy between these approaches; when specular, elastic scattering models (i.e., elastic-hard-sphere scattering, EHSS) are applied to polyatomic models of nanometer-scale ions with finite-sized impinging gas molecules, predictions are in substantial disagreement with the Stokes-Millikan equation. To rectify this discrepancy, we developed and tested a new approach for mobility calculations using polyatomic models in which non-specular (diffuse) and inelastic gas-molecule scattering is considered. Two distinct semiempirical models of gas-molecule scattering from particle surfaces were considered. In the first, which has been traditionally invoked in the study of aerosol nanoparticles, 91% of collisions are diffuse and thermally accommodating, and 9% are specular and elastic. In the second, all collisions are considered to be diffuse and accommodating, but the average speed of the gas molecules reemitted from a particle surface is 8% lower than the mean thermal speed at the particle temperature. Both scattering models attempt to mimic exchange between translational, vibrational, and rotational modes of energy during collision, as would be expected during collision between a nonmonoatomic gas molecule and a nonfrozen particle surface. The mobility calculation procedure was applied considering both hard-sphere potentials between gas molecules and the atoms within a particle and the long-range ion-induced dipole (polarization) potential. Predictions were compared to previous measurements in air near room temperature of multiply charged poly(ethylene glycol) (PEG) ions, which range in morphology from

  14. Interrogating the vibrational relaxation of highly excited polyatomics with time-resolved diode laser spectroscopy: C6H6, C6D6, and C6F6+CO2

    International Nuclear Information System (INIS)

    Sedlacek, A.J.; Weston, R.E. Jr.; Flynn, G.W.

    1991-01-01

    The vibrational relaxation of highly excited ground state benzene, benzene d 6 , and hexafluorobenzene by CO 2 has been investigated with high resolution diode laser spectroscopy. The vibrationally hot polyatomics are formed by single photon 248 nm excitation to the S 1 state followed by rapid radiationless transitions. It has been found that in all cases less than 1% of the energy initially present in the polyatomics is deposited into the high frequency mode of CO 2 (ν 3 ). An investigation of the CO 2 (00 0 1) nascent rotational distribution under single collision conditions reveals that very little rotational excitation accompanies vibrational energy transfer to the ν 3 mode. The CO 2 (ν 3 ) rotational states can be described by temperatures, T rot , as follows: C 6 H 6 , T rot =360±30 K; C 6 D 6 , T rot =350±35 K and C 6 F 6 , T rot =340±23 K. An estimate of left-angle ΔE right-angle ν3 , the mean energy transferred to the CO 2 ν 3 mode per collision, suggests that as the availability of low frequency modes in the excited molecule increases, less energy is deposited into the high frequency mode of CO 2 . Finally, evidence is presented suggesting that even at moderate laser fluences, the two-photon ionization of benzene can lead to substantial CO 2 ν 3 excitation via electron+CO 2 inelastic collisions

  15. Lanczos-driven coupled-cluster damped linear response theory for molecules in polarizable environments

    DEFF Research Database (Denmark)

    List, Nanna Holmgaard; Coriani, Sonia; Kongsted, Jacob

    2014-01-01

    are specifically motivated by a twofold aim: (i) computation of core excitations in realistic surroundings and (ii) examination of the effect of the differential response of the environment upon excitation solely related to the CC multipliers (herein denoted the J matrix) in computations of excitation energies......We present an extension of a previously reported implementation of a Lanczos-driven coupled-cluster (CC) damped linear response approach to molecules in condensed phases, where the effects of a surrounding environment are incorporated by means of the polarizable embedding formalism. We...... and transition moments of polarizable-embedded molecules. Numerical calculations demonstrate that the differential polarization of the environment due to the first-order CC multipliers provides only minor contributions to the solvatochromic shift for all transitions considered. We thus complement previous works...

  16. Contribution to the understanding of ion-gas reactions in ICP-MS collision reaction cells: application to the resolution of isobaric and polyatomic interferences

    International Nuclear Information System (INIS)

    Quemet, A.

    2012-01-01

    Inductively Coupled Plasma Mass Spectrometry (ICP-MS) emerged as the most essential technique in inorganic analytical chemistry thanks to its numerous assets, particularly its flexibility, its sensitivity and its reproducibility. As part of the elementary and isotopic analysis of irradiated fuel and transmutation target, the analyst is faced with a complex mass spectrum, due to the presence of many radionuclides. ICP-MS can not differentiate ions with the same mass, which induces isobaric and polyatomic interferences when the ions at the same mass are different chemical species. Last generations of ICP-MS have introduced collision reaction cells. It can in situ reduce these isobaric or polyatomic interferences. The cell is a multipole (quadrupole, hexapole or octupole) device filled with a collision and/or reaction gas. The gas molecules collide or possibly react with the ion beam, which eliminates or reduces interferences. Such resolution of interferences is based on the difference of chemical behaviours between the analyte and the interfering species: the choice of the gas is crucial. A better understanding of the 'ion - gas' reaction should help choosing the reacting gases. Three ICP-MS, with the different cell geometries, were used for this study: Perkin Elmer Elan DRC e (quadrupole), Thermo Fischer X serie II (hexapole) and Agilent Technologies 7700x (octupole). The effects of the cell geometry on different experimental parameters and on the resolution of the 56 Fe + / 40 Ar 16 O + polyatomic interferences were examined to measure iron at trace or ultra-trace level. This preliminary study was applied to measure iron as impurities in uranium oxide, the method was then validated with a Certified Reference Material. The reactivities of transition metals (Zr, Ru, Pd, Ag, Cd, Sn), lanthanides (La, Ce, Nd, Sm, Eu, Gd, Dy, Er and Yb) and actinides (U, Np, Pu, Am and Cm), elements of interest in the nuclear field, are studied with numerous gases (O 2 , CO, CO 2 , N 2

  17. Interference effects during the reradiation of ultrashort electromagnetic pulses by polyatomic systems

    Energy Technology Data Exchange (ETDEWEB)

    Makarov, D. N.; Matveev, V. I., E-mail: mezon98@mail.ru [Lomonosov Northern (Arctic) Federal University (Russian Federation)

    2013-11-15

    A theory of the reradiation of ultrashort electromagnetic pulses by arbitrary polyatomic systems of isolated complex atoms has been developed. The technique used allows the spatial inhomogeneity of the field of an ultrashort pulse and photon momenta in reradiation processes to be accurately taken into account. The angular distributions of the reradiation spectra have been obtained for an arbitrary number of atoms in the system. The processes of interference between the photon emission amplitudes are shown to give rise to characteristic “diffraction” maxima. We consider one-dimensional, two-dimensional, and three-dimensional rectangular lattices as examples as well as planar and cylindrical structures as models of planar nanosystems and nanotubes.

  18. Application of the generator coordinates method to the intra-molecular proton tunneling in the malonaldehyde molecule; Aplicacao do metodo das coordenadas geradoras ao processo de tunelamento do proton intramolecular na molecula de malonaldeido

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Andre Campos Kersten

    1995-12-31

    The effects of different vibrational modes on the isomerization process of polyatomic molecules, or solvent`s effects on reaction rates are object of up-to-date interest. In general, such many body phenomena are, in principle, multidimensional, and they first require a reduction of relevant degrees of freedom. In order to investigated, some aspects of the intra-molecular proton tunneling on a malonaldehyde molecule, we use the Generator Coordinate Method. The model used to describe such a process is the so-called System-Bath model, where the system is the reaction coordinate and the bath are the intrinsic degrees of freedom (vibrational modes of the molecule), which are described by a harmonic oscillator set linearly coupled to the system. The reduction of the multidimensional problem to the effective unidimensional one is done using a energy related variational principle on the intrinsic degrees of freedom. we obtained analytically a effective Hamiltonian where the effects of the various degrees of freedom reveal themselves in the appearance of a effective mass and in changes of the shape of the potential barrier. The analyticity of the method was crucial on identifying clearly the roles played by the different physical parameters involved. (author) 17 refs., 29 figs.

  19. Linear-algebraic approach to electronic excitation of atoms and molecules by electron impact

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.

    1983-01-01

    A linear-algebraic method, based on an integral equations formulation, is applied to the excitation of atoms and molecules by electron impact. Various schemes are devised for treating the one-electron terms that sometimes cause instabilities when directly incorporated into the solution matrix. These include introducing Lagrange undetermined multipliers and correlation terms. Good agreement between the method and other computational techniques is obtained for electron scattering for hydrogenic and Li-like atomic ions and for H 2 + in two- to five-state close-coupling calculations

  20. Semiclassical spectral quantization: Application to two and four coupled molecular degrees of freedom

    International Nuclear Information System (INIS)

    De Leon, N.; Heller, E.J.

    1984-01-01

    Semiclassical quantization of the quasiperiodic vibrational motion of molecules is usually based on Einstein--Brillouin--Keller (EBK) conditions for the quantization of the classical actions. Explicit use of the EBK conditions for molecular systems of K degrees of freedom requires K quantization conditions. Therefore, explicit use of the EBK conditions becomes increasingly difficult if not impossible for polyatomic systems of three or more degrees of freedom. In this paper we propose a semiclassical quantization method which makes explicit use of phase coherence of the de Broglie wave associated with the trajectory rather than the EBK conditions. We show that taking advantage of phase coherence reduces the K quantization conditions to a single quantum condition: regardless of the number of degrees of freedom. For reasons that will become obvious we call this method ''spectral quantization.'' Polyatomic vibrational wave functions and energy eigenvalues are generated from quasiperiodic classical trajectories. The spectral method is applied to an ABA linear triatomic molecule with two degrees of freedom and to an anharmonic model of the molecule cyanoacetylene. The usefulness of the technique is demonstrated in this latter calculation since the cyanoacetylene model will have four coupled vibrational degrees of freedom

  1. Low energy elastic electron scattering from polyatomic targets

    International Nuclear Information System (INIS)

    Khakoo, M A

    2008-01-01

    New differential cross-section measurements for elastic electron scattering from ethylene (C 2 H 4 ), three primary alcohols, methanol (CH 3 OH), ethanol (C 2 H 5 OH) and propanol (C 3 H 7 OH) are reported. The measurements are obtained using the relative flow method with a thin aperture as the collimating target gas source. The relative flow method is applied without the molecular diameters restriction imposed by the relative flow pressure condition on helium (the calibrating gas) and the unknown gases (the primary alcohols). The experimental data were taken at incident electron energies of 1eV, 2eV, 5eV, 10eV, 15eV, 20eV, 30eV, 50eV and 100eV, but only a brief survey of these results will be made here. The experimental results are compared to theoretical differential cross-sections are obtained by using the variational multi-channel Schwinger method. Initial comparisons between theory and experiment show that present theory is well-able to model low electron scattering from these polyatomic targets.

  2. Revival structures of linear molecules in a field-free alignment condition as probed by high-order harmonic generation

    International Nuclear Information System (INIS)

    Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.

    2006-01-01

    Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.

  3. Application of the weak-field asymptotic theory to the analysis of tunneling ionization of linear molecules

    DEFF Research Database (Denmark)

    Madsen, Lars Bojer; Tolstikhin, Oleg I.; Morishita, Toru

    2012-01-01

    The recently developed weak-field asymptotic theory [ Phys. Rev. A 84 053423 (2011)] is applied to the analysis of tunneling ionization of a molecular ion (H2+), several homonuclear (H2, N2, O2) and heteronuclear (CO, HF) diatomic molecules, and a linear triatomic molecule (CO2) in a static...... electric field. The dependence of the ionization rate on the angle between the molecular axis and the field is determined by a structure factor for the highest occupied molecular orbital. This factor is calculated using a virtually exact discrete variable representation wave function for H2+, very accurate...... Hartree-Fock wave functions for the diatomics, and a Hartree-Fock quantum chemistry wave function for CO2. The structure factors are expanded in terms of standard functions and the associated structure coefficients, allowing the determination of the ionization rate for any orientation of the molecule...

  4. Polarization and ellipticity of high-order harmonics from aligned molecules generated by linearly polarized intense laser pulses

    International Nuclear Information System (INIS)

    Le, Anh-Thu; Lin, C. D.; Lucchese, R. R.

    2010-01-01

    We present theoretical calculations for polarization and ellipticity of high-order harmonics from aligned N 2 , CO 2 , and O 2 molecules generated by linearly polarized lasers. Within the rescattering model, the two polarization amplitudes of the harmonics are determined by the photo-recombination amplitudes for photons emitted with polarization parallel or perpendicular to the direction of the same returning electron wave packet. Our results show clear species-dependent polarization states, in excellent agreement with experiments. We further note that the measured polarization ellipse of the harmonic furnishes the needed parameters for a 'complete' experiment in molecules.

  5. Rational extended thermodynamics of a rarefied polyatomic gas with molecular relaxation processes

    Science.gov (United States)

    Arima, Takashi; Ruggeri, Tommaso; Sugiyama, Masaru

    2017-10-01

    We present a more refined version of rational extended thermodynamics of rarefied polyatomic gases in which molecular rotational and vibrational relaxation processes are treated individually. In this case, we need a triple hierarchy of the moment system and the system of balance equations is closed via the maximum entropy principle. Three different types of the production terms in the system, which are suggested by a generalized BGK-type collision term in the Boltzmann equation, are adopted. In particular, the rational extended thermodynamic theory with seven independent fields (ET7) is analyzed in detail. Finally, the dispersion relation of ultrasonic wave derived from the ET7 theory is confirmed by the experimental data for CO2, Cl2, and Br2 gases.

  6. Earle K. Plyler Prize Lecture: The Three Pillars of Ultrafast Molecular Science - Time, Phase, Intensity

    Science.gov (United States)

    Stolow, Albert

    We discuss the probing and control of molecular wavepacket dynamics in the context of three main `pillars' of light-matter interaction: time, phase, intensity. Time: Using short, coherent laser pulses and perturbative matter-field interactions, we study molecular wavepackets with a focus on the ultrafast non-Born-Oppenheimer dynamics, that is, the coupling of electronic and nuclear motions. Time-Resolved Photoelectron Spectroscopy (TRPES) is a powerful ultrafast probe of these processes in polyatomic molecules because it is sensitive both electronic and vibrational dynamics. Ideally, one would like to observe these ultrafast processes from the molecule's point of view - the Molecular Frame - thereby avoiding loss of information due to orientational averaging. This can be achieved by Time-Resolved Coincidence Imaging Spectroscopy (TRCIS) which images 3D recoil vectors of both photofragments and photoelectrons, in coincidence and as a function of time, permitting direct Molecular Frame imaging of valence electronic dynamics during a molecular dynamics. Phase: Using intermediate strength non-perturbative interactions, we apply the second order (polarizability) Non-Resonant Dynamic Stark Effect (NRDSE) to control molecular dynamics without any net absorption of light. NRDSE is also the interaction underlying molecular alignment and applies to field-free 1D of linear molecules and field-free 3D alignment of general (asymmetric) molecules. Using laser alignment, we can transiently fix a molecule in space, yielding a more general approach to direct Molecular Frame imaging of valence electronic dynamics during a chemical reaction. Intensity: In strong (ionizing) laser fields, a new laser-matter physics emerges for polyatomic systems wherein both the single active electron picture and the adiabatic electron response, both implicit in the standard 3-step models, can fail dramatically. This has important consequences for all attosecond strong field spectroscopies of

  7. Linear theory of sound waves with evaporation and condensation

    International Nuclear Information System (INIS)

    Inaba, Masashi; Watanabe, Masao; Yano, Takeru

    2012-01-01

    An asymptotic analysis of a boundary-value problem of the Boltzmann equation for small Knudsen number is carried out for the case when an unsteady flow of polyatomic vapour induces reciprocal evaporation and condensation at the interface between the vapour and its liquid phase. The polyatomic version of the Boltzmann equation of the ellipsoidal statistical Bhatnagar–Gross–Krook (ES-BGK) model is used and the asymptotic expansions for small Knudsen numbers are applied on the assumptions that the Mach number is sufficiently small compared with the Knudsen number and the characteristic length scale divided by the characteristic time scale is comparable with the speed of sound in a reference state, as in the case of sound waves. In the leading order of approximation, we derive a set of the linearized Euler equations for the entire flow field and a set of the boundary-layer equations near the boundaries (the vapour–liquid interface and simple solid boundary). The boundary conditions for the Euler and boundary-layer equations are obtained at the same time when the solutions of the Knudsen layers on the boundaries are determined. The slip coefficients in the boundary conditions are evaluated for water vapour. A simple example of the standing sound wave in water vapour bounded by a liquid water film and an oscillating piston is demonstrated and the effect of evaporation and condensation on the sound wave is discussed. (paper)

  8. Calculations on isotope separation by laser induced photodissociation of polyatomic molecules. Progress report, February 1, 1977--June 30, 1978

    International Nuclear Information System (INIS)

    Lamb, W.E. Jr.

    1978-07-01

    The molecule SF 6 is treated as a classical dynamical system obeying Newton's laws of motion. This report describes how the current SF 6 potential is determined. The initial approach is described in terms of a pair of Lennard--Jones potential functions with arbitrary coefficients. A method for determining the potential constants is developed. The SF 6 spectrum was reproduced by including three-body forces. By specifying certain parameters such as the 1/r 6 F-F constant and the total dissociation energy of the molecule, a satisfactory global potential was obtained. The laser-molecule interaction energy was developed

  9. Comparison of two screening corrections to the additivity rule for the calculation of electron scattering from polyatomic molecules

    International Nuclear Information System (INIS)

    Blanco, F.; Rosado, J.; Illana, A.; Garcia, G.

    2010-01-01

    The SCAR and EGAR procedures have been proposed in order to extend to lower energies the applicability of the additivity rule for calculation of electron-molecule total cross sections. Both those approximate treatments arise after considering geometrical screening corrections due to partial overlapping of atoms in the molecule, as seen by the incident electrons. The main features, results and limitations of both treatments are put here in comparison by means of their application to some different sized species.

  10. Evaluation of synthetic linear motor-molecule actuation energetics

    OpenAIRE

    Brough, Branden; Northrop, Brian H.; Schmidt, Jacob J.; Tseng, Hsian-Rong; Houk, Kendall N.; Stoddart, J. Fraser; Ho, Chih-Ming

    2006-01-01

    By applying atomic force microscope (AFM)-based force spectroscopy together with computational modeling in the form of molecular force-field simulations, we have determined quantitatively the actuation energetics of a synthetic motor-molecule. This multidisciplinary approach was performed on specifically designed, bistable, redox-controllable [2]rotaxanes to probe the steric and electrostatic interactions that dictate their mechanical switching at the single-molecule level. The fusion of expe...

  11. A BGK model for reactive mixtures of polyatomic gases with continuous internal energy

    Science.gov (United States)

    Bisi, M.; Monaco, R.; Soares, A. J.

    2018-03-01

    In this paper we derive a BGK relaxation model for a mixture of polyatomic gases with a continuous structure of internal energies. The emphasis of the paper is on the case of a quaternary mixture undergoing a reversible chemical reaction of bimolecular type. For such a mixture we prove an H -theorem and characterize the equilibrium solutions with the related mass action law of chemical kinetics. Further, a Chapman-Enskog asymptotic analysis is performed in view of computing the first-order non-equilibrium corrections to the distribution functions and investigating the transport properties of the reactive mixture. The chemical reaction rate is explicitly derived at the first order and the balance equations for the constituent number densities are derived at the Euler level.

  12. Ion beam studies - part 4. The use of multiply-charged and polyatomic ions in an implantation accelerator

    International Nuclear Information System (INIS)

    Freeman, J.H.; Chivers, D.J.; Gard, G.A.

    1976-12-01

    Polyatomic and multiply-charged ion provide a convenient means of extending the energy range of an implanted accelerator. The molecular species are also of interest in certain special bombardment studies. This report considers some of the factors which affect the production and utilisation of such beams. It introduces the concepts of hetero- and auto-contamination, and particular attention is given to the modification of the charge or mass of the ions resulting from inelastic collisions in the various beams transport regions of the accelerator. (author)

  13. Collision dynamics of methyl radicals and highly vibrationally excited molecules using crossed molecular beams

    International Nuclear Information System (INIS)

    Chu, P.M.Y.

    1991-10-01

    The vibrational to translational (V→T) energy transfer in collisions between large highly vibrationally excited polyatomics and rare gases was investigated by time-of-flight techniques. Two different methods, UV excitation followed by intemal conversion and infrared multiphoton excitation (IRMPE), were used to form vibrationally excited molecular beams of hexafluorobenzene and sulfur hexafluoride, respectively. The product translational energy was found to be independent of the vibrational excitation. These results indicate that the probability distribution function for V→T energy transfer is peaked at zero. The collisional relaxation of large polyatomic molecules with rare gases most likely occurs through a rotationally mediated process. Photodissociation of nitrobenzene in a molecular beam was studied at 266 nm. Two primary dissociation channels were identified including simple bond rupture to produce nitrogen dioxide and phenyl radical and isomerization to form nitric oxide and phenoxy radical. The time-of-flight spectra indicate that simple bond rupture and isomerization occurs via two different mechanisms. Secondary dissociation of the phenoxy radicals to carbon monoxide and cyclopentadienyl radicals was observed as well as secondary photodissociation of phenyl radical to give H atom and benzyne. A supersonic methyl radical beam source is developed. The beam source configuration and conditions were optimized for CH 3 production from the thermal decomposition of azomethane. Elastic scattering of methyl radical and neon was used to differentiate between the methyl radicals and the residual azomethane in the molecular beam

  14. Laser fluorimetry of mixtures of polyatomic organic compounds using artificial neural networks

    International Nuclear Information System (INIS)

    Dolenko, S A; Gerdova, I V; Dolenko, T A; Fadeev, V V

    2001-01-01

    New possibilities of laser fluorimetry offered by the use of algorithms for solving inverse problems based on artificial neural networks are demonstrated. A two-component mixture of polyatomic organic compounds is analysed by three methods of laser fluorimetry: a direct analysis of the fluorescence band, the kinetic fluorimetry (when durations of the laser pulse and the detector gate pulse are comparable with the fluorescence lifetimes or exceed them), and the saturation fluorimetry. The numerical experiments showed that the use of artificial neural networks in these methods provides a high practical stability of the solution of inverse problems and ensures a high sensitivity and a high accuracy of determining the contribution of components to fluorescence and of measuring molecular photophysical parameters, which can be used for the identification of components. (laser applications and other topics in quantum electronics)

  15. Linear Ion Traps in Space: The Mars Organic Molecule Analyzer (MOMA) Instrument and Beyond

    Science.gov (United States)

    Arevalo, Ricardo; Brinckerhoff, William; Mahaffy, Paul; van Amerom, Friso; Danell, Ryan; Pinnick, Veronica; Li, Xiang; Hovmand, Lars; Getty, Stephanie; Grubisic, Andrej; Goesmann, Fred; Cottin, Hervé

    2015-11-01

    Historically, quadrupole mass spectrometer (QMS) instruments have been used to explore a wide survey of planetary targets in our solar system, from Venus (Pioneer Venus) to Saturn (Cassini-Huygens). However, linear ion trap (LIT) mass spectrometers have found a niche as smaller, versatile alternatives to traditional quadrupole analyzers.The core astrobiological experiment of ESA’s ExoMars Program is the Mars Organic Molecule Analyzer (MOMA) onboard the ExoMars 2018 rover. The MOMA instrument is centered on a linear (or 2-D) ion trap mass spectrometer. As opposed to 3-D traps, LIT-based instruments accommodate two symmetrical ion injection pathways, enabling two complementary ion sources to be used. In the case of MOMA, these two analytical approaches are laser desorption mass spectrometry (LDMS) at Mars ambient pressures, and traditional gas chromatography mass spectrometry (GCMS). The LIT analyzer employed by MOMA also offers: higher ion capacity compared to a 3-D trap of the same volume; redundant detection subassemblies for extended lifetime; and, a link to heritage QMS designs and assembly logistics. The MOMA engineering test unit (ETU) has demonstrated the detection of organics in the presence of wt.%-levels of perchlorate, effective ion enhancement via stored waveform inverse Fourier transform (SWIFT), and derivation of structural information through tandem mass spectrometry (MS/MS).A more progressive linear ion trap mass spectrometer (LITMS), funded by the NASA ROSES MatISSE Program, is being developed at NASA GSFC and promises to augment the capabilities of the MOMA instrument by way of: an expanded mass range (i.e., 20 - 2000 Da); detection of both positive and negative ions; spatially resolved (<1 mm) characterization of individual rock core layers; and, evolved gas analysis and GCMS with pyrolysis up to 1300° C (enabling breakdown of refractory phases). The Advanced Resolution Organic Molecule Analyzer (AROMA) instrument, being developed through NASA

  16. How to determine the handedness of single molecules using Coulomb explosion imaging

    International Nuclear Information System (INIS)

    Pitzer, Martin

    2017-01-01

    This tutorial is based on a doctoral thesis that was shortlisted for the 2016 AMOP dissertation prize of the German Physical Society (DPG). The principal achievement of the thesis was to use Coulomb explosion imaging (CEI) to determine the microscopic handedness (‘chirality’) of molecular structures on a single-molecule level. It thus shows how a technique developed in atomic physics can address a long-standing problem in chemistry. Owing to these disparate backgrounds, the tutorial has two facets: on the one hand, the history of molecular chirality and recent developments are very briefly reviewed. On the other hand, an account is given of different experimental approaches to CEI, on the physical processes in light-induced Coulomb explosion and—most importantly—on the aspects that are relevant when designing and performing such an experiment. As structural chirality occurs only in polyatomic molecules, special attention will be given to multiple ionization and multi-coincidence measurements. A short discussion of the results presented in earlier papers is given, followed by an outlook on experiments that are under way or can realistically be performed within the next years. (phd tutorial)

  17. Three methods to measure RH bond energies

    International Nuclear Information System (INIS)

    Berkowitz, J.; Ellison, G.B.; Gutman, D.

    1993-01-01

    In this paper the authors compare and contrast three powerful methods for experimentally measuring bond energies in polyatomic molecules. The methods are: radical kinetics; gas phase acidity cycles; and photoionization mass spectroscopy. The knowledge of the values of bond energies are a basic piece of information to a chemist. Chemical reactions involve the making and breaking of chemical bonds. It has been shown that comparable bonds in polyatomic molecules, compared to the same bonds in radicals, can be significantly different. These bond energies can be measured in terms of bond dissociation energies

  18. Study of two examples of non linear interaction of a laser wave with matter: laser-induced damage of dielectrics and non linear optical properties of organometallic molecules in solution

    International Nuclear Information System (INIS)

    Gaudry, Jean-Baptiste

    2000-01-01

    This research thesis reports the study of two mechanisms of non linear interaction of a laser wave with matter. More particularly, it reports the experimental investigation of non linear optical properties of organometallic molecules in solution, as well as the damage of perfect silica under laser irradiation by using simulation codes. As far as optical properties are concerned, the author highlights the influence of the electronic configuration of the metal present in the organometallic compound, and the influence of the ligand on the second-order non-linear response. As far as the simulation is concerned, some experimental results have been reproduced. This work can be useful for the investigation of the extrinsic damage of imperfect materials, and for the design of experiments of transient measurements of excited silica [fr

  19. Using polyatomic primary ions to probe an amino acid and a nucleic base in water ice

    Energy Technology Data Exchange (ETDEWEB)

    Conlan, X.A. [Surface Analysis Research Centre, School of Chemical Engineering and Analytical Science, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom)]. E-mail: x.conlan@postgrad.manchester.ac.uk; Biddulph, G.X. [Surface Analysis Research Centre, School of Chemical Engineering and Analytical Science, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom)]. E-mail: G.Biddulph@postgrad.manchester.ac.uk; Lockyer, N.P. [Surface Analysis Research Centre, School of Chemical Engineering and Analytical Science, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom); Vickerman, J.C. [Surface Analysis Research Centre, School of Chemical Engineering and Analytical Science, University of Manchester, P.O. Box 88, Manchester M60 1QD (United Kingdom)]. E-mail: John.Vickerman@manchester.ac.uk

    2006-07-30

    In this study on pure water ice, we show that protonated water species [H{sub 2}O] {sub n}H{sup +} are more prevalent than (H{sub 2}O) {sub n} {sup +} ions after bombardment by Au{sup +} monoatomic and Au{sub 3} {sup +} and C{sub 60} {sup +} polyatomic projectiles. This data also reveals significant differences in water cluster yields under bombardment by these three projectiles. The amino acid alanine and the nucleic base adenine in solution have been studied and have been shown to have an effect on the water cluster ion yields observed using an Au{sub 3} {sup +} ion beam.

  20. Nuclear spin-spin coupling constants of linear carbon chains terminated by coronene molecules: a first principles study

    International Nuclear Information System (INIS)

    Oliveira, Joao Paulo Cavalcante; Mota, F. de Brito; Rivelino, Roberto

    2011-01-01

    Full text. Carbon nano wires made of long linear atomic chains have attracted considerable interest due to their potential applications in nano electronics. We report a density-functional-theory study of the nuclear spin-spin coupling constants for nano assemblies made of two coronene molecules bridged by carbon linear chains, considering distinct sizes and spin multiplicities. Also, we examine the effects of two terminal conformations (syn and anti) of the terminal anchor pieces on the magnetic properties of the carbon chains via 13 C NMR calculations. Our results reveal that simplified chemical models such as those based on cumulenes or polyynes are not appropriate to describe the linear chains with sp 2 terminations. For these types of atomic chains, the electronic ground state of the even-numbered chains can be singlet or triplet, whereas the ground state of the odd-numbered chains can be doublet or quartet. We discuss how the 13 C NMR chemical shift absorption is affected by increasing the size and changing the parity of the linear carbon chains. We have found that the J coupling constants between the carbon atoms in the linear chains present a well-defined pattern, in good accordance with our electronic structure calculations. For example, in the -C 4 - units we obtain couplings of 43.8, 114.5, 84.6, 114.5, and 43.8 Hz from one end to the other

  1. High resolution studies of the origins of polyatomic ions in inductively coupled plasma-mass spectrometry, Part I. Identification methods and effects of neutral gas density assumptions, extraction voltage, and cone material

    International Nuclear Information System (INIS)

    Ferguson, Jill Wisnewski; Houk, R.S.

    2006-01-01

    Common polyatomic ions (ArO + , NO + , H 2 O + , H 3 O + , Ar 2 + , ArN + , OH + , ArH + , O 2 + ) in inductively coupled plasma-mass spectrometry (ICP-MS) are identified using high mass resolution and studied using kinetic gas temperatures (T gas ) determined from a dissociation reaction approach. Methods for making accurate mass measurements, confirming ion identifications, and correcting for mass bias are discussed. The effects of sampler and skimmer cone composition and extraction voltage on polyatomic ion formation are also explored. Neutral species densities at several locations in the extraction interface are estimated and the corresponding effects of the T gas value are calculated. The results provide information about the origins of background ions and indicate possible locations for their formation or removal

  2. Effects of collisions on linear and non-linear spectroscopic line shapes

    International Nuclear Information System (INIS)

    Berman, P.R.

    1978-01-01

    A fundamental physical problem is the determination of atom-atom, atom-molecule and molecule-molecule differential and total scattering cross sections. In this work, a technique for studying atomic and molecular collisions using spectroscopic line shape analysis is discussed. Collisions occurring within an atomic or molecular sample influence the sample's absorptive or emissive properties. Consequently the line shapes associated with the linear or non-linear absorption of external fields by an atomic system reflect the collisional processes occurring in the gas. Explicit line shape expressions are derived characterizing linear or saturated absorption by two-or three-level 'active' atoms which are undergoing collisions with perturber atoms. The line shapes may be broadened, shifted, narrowed, or distorted as a result of collisions which may be 'phase-interrupting' or 'velocity-changing' in nature. Systematic line shape studies can be used to obtain information on both the differential and total active atom-perturber scattering cross sections. (Auth.)

  3. Effect of the dynamic pressure on the shock wave structure in a rarefied polyatomic gas

    Energy Technology Data Exchange (ETDEWEB)

    Taniguchi, Shigeru, E-mail: taniguchi@stat.nitech.ac.jp; Sugiyama, Masaru, E-mail: sugiyama@nitech.ac.jp [Graduate School of Engineering, Nagoya Institute of Technology, Nagoya 466-8555 (Japan); Arima, Takashi, E-mail: tks@stat.nitech.ac.jp [Center for Social Contribution and Collaboration, Nagoya Institute of Technology, Nagoya 466-8555 (Japan); Ruggeri, Tommaso, E-mail: tommaso.ruggeri@unibo.it [Department of Mathematics and Research Center of Applied Mathematics (CIRAM), University of Bologna, Bologna (Italy)

    2014-01-15

    We study the shock wave structure in a rarefied polyatomic gas based on a simplified model of extended thermodynamics in which the dissipation is due only to the dynamic pressure. In this case the differential system is very simple because it is a variant of Euler system with a new scalar equation for the dynamic pressure [T. Arima, S. Taniguchi, T. Ruggeri, and M. Sugiyama, Phys. Lett. A 376, 2799–2803 (2012)]. It is shown that this theory is able to describe the three types of the shock wave structure observed in experiments: the nearly symmetric shock wave structure (Type A, small Mach number), the asymmetric structure (Type B, moderate Mach number), and the structure composed of thin and thick layers (Type C, large Mach number)

  4. Laser excitation of SF6: spectroscopy and coherent pulse propagation effects

    International Nuclear Information System (INIS)

    Cantrell, C.D.; Makarov, A.A.; Louisell, W.H.

    1978-01-01

    Recent theoretical studies of coherent propagation effects in SF 6 and other polyatomic molecules are summarized beginning with an account of relevant aspects of the high-resolution spectroscopy of the ν 3 band of SF 6 . A laser pulse propagating in a molecular gas can acquire new frequencies which were not initially present in the pulse, and, in fact, a wave is coherently generated at the frequency of every molecular transition accessible from the initial molecular energy levels. The possible consequences of coherent generation of sidebands for the multiple-photon excitation of SF 6 and other polyatomic molecules are discussed

  5. Universal imaging: Dissociative ionization of polyatomic molecules, chemical dynamics beamline 9.0.2

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, M.; Chen, D.; Suits, A.G. [Ernest Orlando Lawrence Berkeley National Lab., CA (United States)

    1997-04-01

    A third endstation was recently added to the Chemical Dynamics beamline, designed to exploit the high flux broadband undulator light for a range of studies of reactive scattering, photochemistry and photoionization processes using time-of-flight mass spectroscopy coupled with position-sensitive detection. Two molecular beam sources are fixed at right angles, with the undulator light, or laser beams, intersecting the molecular beams at 45{degrees}. To date, beamline experiments have included a study of dissociative photoionization of a variety of molecules including N{sub 2}O and SF{sub 6}. In this mode, a single molecular beam source is used, with the tunable undulator light inducing, in SF{sub 6} for example, the process SF{sub 6} {r_arrow} SF{sub 6}{sup +} + e{sup {minus}} {r_arrow} SF{sub 5}{sup +} + F + e{sup {minus}}. The SF{sub 5}{sup +} ions are accelerated up the flight tube, mass selected and detected as a function of position on a phosphor screen viewed by a CCD camera. The position directly reveals the recoil speed (or translational energy release) and angular distribution for the dissociative ionization process. Furthermore, this measurement is obtained for all recoil speeds and angles simultaneously. Such detailed angular information has not previously been obtained for dissociative ionization processes; typically ion time-of-flight profiles are deconvoluted to yield rough insight into the angular distributions. The recorded image is actually a 2-dimensional projection of the nascent 3-dimensional velocity distribution, but established tomographic techniques enable the authors to reconstruct the 3-D distribution.

  6. Symbolic derivation of high-order Rayleigh-Schroedinger perturbation energies using computer algebra: Application to vibrational-rotational analysis of diatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, John M. [Kansas State Univ., Manhattan, KS (United States). Dept. of Chemistry

    1997-01-01

    Rayleigh-Schroedinger perturbation theory is an effective and popular tool for describing low-lying vibrational and rotational states of molecules. This method, in conjunction with ab initio techniques for computation of electronic potential energy surfaces, can be used to calculate first-principles molecular vibrational-rotational energies to successive orders of approximation. Because of mathematical complexities, however, such perturbation calculations are rarely extended beyond the second order of approximation, although recent work by Herbert has provided a formula for the nth-order energy correction. This report extends that work and furnishes the remaining theoretical details (including a general formula for the Rayleigh-Schroedinger expansion coefficients) necessary for calculation of energy corrections to arbitrary order. The commercial computer algebra software Mathematica is employed to perform the prohibitively tedious symbolic manipulations necessary for derivation of generalized energy formulae in terms of universal constants, molecular constants, and quantum numbers. As a pedagogical example, a Hamiltonian operator tailored specifically to diatomic molecules is derived, and the perturbation formulae obtained from this Hamiltonian are evaluated for a number of such molecules. This work provides a foundation for future analyses of polyatomic molecules, since it demonstrates that arbitrary-order perturbation theory can successfully be applied with the aid of commercially available computer algebra software.

  7. Optical Control of Internal Conversion in Pyrazine

    Science.gov (United States)

    Barry, Grant; Singha, Sima; Hu, Zhan; Seideman, Tamar; Gordon, Robert

    2014-03-01

    We apply quantum control schemes previously reserved for atoms and small molecules to more complex polyatomic molecules. Pyrazine was chosen as a model polyatomic molecule for its well-studied conical intersection seam between the S1 and S2 potential energy surfaces (PESs). Using shaped ultraviolet femtosecond laser pulses, we demonstrate optical control of the excited state dynamics of this molecule under collisionless conditions. This was achieved in a pump-probe experiment by employing a genetic algorithm programmed to suppress ionization of the pyrazine molecules at a preselected time. Our findings indicate that the optimized pulses localize the wave packet for times up to 1.5 ps at a location on the coupled S1/S2 PESs where ionization is energetically forbidden. Our approach is general and does not require knowledge of the molecular Hamiltonian. Funding provided by National Science Foundation grant no. CHE-0848198.

  8. Electronic excitation of atoms and molecules by electron impact in a linear algebraic, separable potential approach

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.

    1984-01-01

    The linear algebraic, separable potential approach is applied to the electronic excitation of atoms and molecules by electron impact. By representing the exchange and off-diagonal direct terms on a basis, the standard set of coupled inelastic equations is reduced to a set of elastic inhomogeneous equations. The procedure greatly simplifies the formulation by allowing a large portion of the problem to be handled by standard bound-state techniques and by greatly reducing the order of the scattering equations that must be solved. Application is made to the excitation of atomic hydrogen in the three-state close-coupling (1s, 2s, 2p) approximation. (author)

  9. Linear electric field time-of-flight ion mass spectrometer

    Science.gov (United States)

    Funsten, Herbert O [Los Alamos, NM; Feldman, William C [Los Alamos, NM

    2008-06-10

    A linear electric field ion mass spectrometer having an evacuated enclosure with means for generating a linear electric field located in the evacuated enclosure and means for injecting a sample material into the linear electric field. A source of pulsed ionizing radiation injects ionizing radiation into the linear electric field to ionize atoms or molecules of the sample material, and timing means determine the time elapsed between ionization of atoms or molecules and arrival of an ion out of the ionized atoms or molecules at a predetermined position.

  10. Theory of attosecond delays in molecular photoionization.

    Science.gov (United States)

    Baykusheva, Denitsa; Wörner, Hans Jakob

    2017-03-28

    We present a theoretical formalism for the calculation of attosecond delays in molecular photoionization. It is shown how delays relevant to one-photon-ionization, also known as Eisenbud-Wigner-Smith delays, can be obtained from the complex dipole matrix elements provided by molecular quantum scattering theory. These results are used to derive formulae for the delays measured by two-photon attosecond interferometry based on an attosecond pulse train and a dressing femtosecond infrared pulse. These effective delays are first expressed in the molecular frame where maximal information about the molecular photoionization dynamics is available. The effects of averaging over the emission direction of the electron and the molecular orientation are introduced analytically. We illustrate this general formalism for the case of two polyatomic molecules. N 2 O serves as an example of a polar linear molecule characterized by complex photoionization dynamics resulting from the presence of molecular shape resonances. H 2 O illustrates the case of a non-linear molecule with comparably simple photoionization dynamics resulting from a flat continuum. Our theory establishes the foundation for interpreting measurements of the photoionization dynamics of all molecules by attosecond metrology.

  11. On the Peculiar Molecular Shape and Size Dependence of the Dynamics of Fluids confined in a Small-Pore Metal-Organic Framework

    KAUST Repository

    Skarmoutsos, Ioannis

    2018-05-15

    Force field based-Molecular dynamics simulations were deployed to systematically explore the dynamics of confined molecules of different shapes and sizes, i.e. linear (CO2 and N2) and spherical (CH4) fluids, in a model small pore system, i.e. the Metal-Organic Framework SIFSIX-2-Cu-i. These computations unveil an unprecedented molecular symmetry dependence of the translational and rotational dynamics of fluids confined in channel-like nanoporous materials. In particular this peculiar behaviour is reflected by the extremely slow decay of the Legendre reorientational correlation functions of even-parity order for the linear fluids which is associated to jump-like orientation flips, while the spherical fluid shows a very fast decay taking place in a sub-picosecond time scale. Such a fundamental understanding is relevant to diverse disciplines such as in chemistry, physics, biology and materials science where diatomic or polyatomic molecules of different shapes/sizes diffuse through nanopores.

  12. Numerical-analytic implementation of the higher-order canonical Van Vleck perturbation theory for the interpretation of medium-sized molecule vibrational spectra.

    Science.gov (United States)

    Krasnoshchekov, Sergey V; Isayeva, Elena V; Stepanov, Nikolay F

    2012-04-12

    Anharmonic vibrational states of semirigid polyatomic molecules are often studied using the second-order vibrational perturbation theory (VPT2). For efficient higher-order analysis, an approach based on the canonical Van Vleck perturbation theory (CVPT), the Watson Hamiltonian and operators of creation and annihilation of vibrational quanta is employed. This method allows analysis of the convergence of perturbation theory and solves a number of theoretical problems of VPT2, e.g., yields anharmonic constants y(ijk), z(ijkl), and allows the reliable evaluation of vibrational IR and Raman anharmonic intensities in the presence of resonances. Darling-Dennison and higher-order resonance coupling coefficients can be reliably evaluated as well. The method is illustrated on classic molecules: water and formaldehyde. A number of theoretical conclusions results, including the necessity of using sextic force field in the fourth order (CVPT4) and the nearly vanishing CVPT4 contributions for bending and wagging modes. The coefficients of perturbative Dunham-type Hamiltonians in high-orders of CVPT are found to conform to the rules of equality at different orders as earlier proven analytically for diatomic molecules. The method can serve as a good substitution of the more traditional VPT2.

  13. Manipulation of polyatomic molecules with the scanning tunnelling microscope at room temperature: chlorobenzene adsorption and desorption from Si(111)-(7 x 7)

    International Nuclear Information System (INIS)

    Sloan, P A; Palmer, R E

    2006-01-01

    We report the imaging of chlorobenzene molecules chemisorbed on the Si(111)-(7 x 7) surface at room temperature with the scanning tunnelling microscope, and the desorption of the molecules by the tunnelling current. Detailed voltage-dependent imaging (at positive bias) allows the elucidation of the number and orientation of all the adsorbate configurations in the 7 x 7 unit cell. At negative bias the adsorbate was observed to affect the imaging properties of neighbouring half unit cells. The threshold voltage required for desorption of the chlorobenzene molecules was invariant to small changes in the tip-state, the adsorption site (corner adatom, middle adatom, faulted or unfaulted half of the unit cell) and the kind of doping of the substrate (n or p type)

  14. Structure factors for tunneling ionization rates of molecules: General Hartree-Fock-based integral representation

    Science.gov (United States)

    Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.

    2017-07-01

    In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.

  15. Application of R-matrix theory to resonant reactive electron-molecule scattering: Vibrational excitation and dissociative attachment of N2 and F2

    International Nuclear Information System (INIS)

    Wong, C.F.; Light, J.C.

    1984-01-01

    Based on the R-matrix approach of Schneider et al. [J. Phys. B 12, L 365 (1979)] to reactive electron-molecule scattering, a new propagative R-matrix method (PRMM) is presented which is more appropriate for polyatomic systems. The new method should be useful in other calculations where complicated integrals need to be propagated. We also introduce an effective R-matrix model (ERMM) in which the usual resonance parameters (potential and width) can be used as input in model R-matrix calculations. The PRMM and ERMM have been applied to the electron-N 2 system and the electron-F 2 system. The results agree very well with previous calculations for both vibrationally inelastic scattering and dissociative attachment when identical potentials and parameters are used

  16. Kinetics of elementary atom and radical reactions: Progress report

    International Nuclear Information System (INIS)

    Gordon, R.J.

    1986-01-01

    Our research program is concerned with the kinetics of elementary gas phase reactions and energy transfer involving polyatomic molecules. We report here on three ongoing projects: The reaction of oxygen atoms with hydrogen molecules, the electronic relaxation of NH radicals, and the vibrational relaxation of highly excited SF 6 molecules. 10 refs., 5 figs

  17. Atomic and molecular physics

    International Nuclear Information System (INIS)

    Anderson, V.E.; Cox, J.T.; Huynh, Q.A.

    1975-01-01

    Topics covered include: electron attachment to SO 2 in high pressure gases; long-lived parent negative ions formed via nuclear-excited Feshbach resonances, part IV, a systematic study of NO 2 -containing benzene derivatives; threshold-electron excitation and compound-negative-ion states of aromatic hydrocarbons; linking of existing data on electron-molecule interactions in gases with those in the liquid phase; slowing down of subexcitation electrons in polyatomic gases; electron mobilities in high-pressure gases (''quasi-liquids''); measurement of the mobility of excess electrons in liquids; potential energy function of an excess electron in a nonpolar liquid; electron mobilities in gases and liquids; photophysics of aromatic hydrocarbons; synthesis of electron-molecule interactions with benzene and benzene derivatives; and spin-off of basic studies on electron attachment to, and elastic scattering from, polyatomic molecules. 14 figures, 2 tables

  18. Reference interaction site model with hydrophobicity induced density inhomogeneity: An analytical theory to compute solvation properties of large hydrophobic solutes in the mixture of polyatomic solvent molecules

    International Nuclear Information System (INIS)

    Cao, Siqin; Sheong, Fu Kit; Huang, Xuhui

    2015-01-01

    Reference interaction site model (RISM) has recently become a popular approach in the study of thermodynamical and structural properties of the solvent around macromolecules. On the other hand, it was widely suggested that there exists water density depletion around large hydrophobic solutes (>1 nm), and this may pose a great challenge to the RISM theory. In this paper, we develop a new analytical theory, the Reference Interaction Site Model with Hydrophobicity induced density Inhomogeneity (RISM-HI), to compute solvent radial distribution function (RDF) around large hydrophobic solute in water as well as its mixture with other polyatomic organic solvents. To achieve this, we have explicitly considered the density inhomogeneity at the solute-solvent interface using the framework of the Yvon-Born-Green hierarchy, and the RISM theory is used to obtain the solute-solvent pair correlation. In order to efficiently solve the relevant equations while maintaining reasonable accuracy, we have also developed a new closure called the D2 closure. With this new theory, the solvent RDFs around a large hydrophobic particle in water and different water-acetonitrile mixtures could be computed, which agree well with the results of the molecular dynamics simulations. Furthermore, we show that our RISM-HI theory can also efficiently compute the solvation free energy of solute with a wide range of hydrophobicity in various water-acetonitrile solvent mixtures with a reasonable accuracy. We anticipate that our theory could be widely applied to compute the thermodynamic and structural properties for the solvation of hydrophobic solute

  19. Surface-ionization field mass-spectrometry studies of nonequilibrium surface ionization

    International Nuclear Information System (INIS)

    Blashenkov, Nikolai M; Lavrent'ev, Gennadii Ya

    2007-01-01

    The ionization of polyatomic molecules on tungsten and tungsten oxide surfaces is considered for quasiequilibrium or essentially nonequilibrium conditions (in the latter case, the term nonequilibrium surface ionization is used for adsorbate ionization). Heterogeneous reactions are supposed to proceed through monomolecular decay of polyatomic molecules or fragments of multimolecular complexes. The nonequilibrium nature of these reactions is established. The dependences of the current density of disordered ions on the surface temperature, electric field strength, and ionized particle energy distribution are obtained in analytical form. Heterogeneous dissociation energies, the ionization potentials of radicals, and the magnitude of reaction departure from equilibrium are determined from experimental data, as are energy exchange times between reaction products and surfaces, the number of molecules in molecular complexes, and the number of effective degrees of freedom in molecules and complexes. In collecting the data a new technique relying on surface-ionization field mass-spectrometry was applied. (instruments and methods of investigation)

  20. Internal correction of spectral interferences and mass bias for selenium metabolism studies using enriched stable isotopes in combination with multiple linear regression.

    Science.gov (United States)

    Lunøe, Kristoffer; Martínez-Sierra, Justo Giner; Gammelgaard, Bente; Alonso, J Ignacio García

    2012-03-01

    The analytical methodology for the in vivo study of selenium metabolism using two enriched selenium isotopes has been modified, allowing for the internal correction of spectral interferences and mass bias both for total selenium and speciation analysis. The method is based on the combination of an already described dual-isotope procedure with a new data treatment strategy based on multiple linear regression. A metabolic enriched isotope ((77)Se) is given orally to the test subject and a second isotope ((74)Se) is employed for quantification. In our approach, all possible polyatomic interferences occurring in the measurement of the isotope composition of selenium by collision cell quadrupole ICP-MS are taken into account and their relative contribution calculated by multiple linear regression after minimisation of the residuals. As a result, all spectral interferences and mass bias are corrected internally allowing the fast and independent quantification of natural abundance selenium ((nat)Se) and enriched (77)Se. In this sense, the calculation of the tracer/tracee ratio in each sample is straightforward. The method has been applied to study the time-related tissue incorporation of (77)Se in male Wistar rats while maintaining the (nat)Se steady-state conditions. Additionally, metabolically relevant information such as selenoprotein synthesis and selenium elimination in urine could be studied using the proposed methodology. In this case, serum proteins were separated by affinity chromatography while reverse phase was employed for urine metabolites. In both cases, (74)Se was used as a post-column isotope dilution spike. The application of multiple linear regression to the whole chromatogram allowed us to calculate the contribution of bromine hydride, selenium hydride, argon polyatomics and mass bias on the observed selenium isotope patterns. By minimising the square sum of residuals for the whole chromatogram, internal correction of spectral interferences and mass

  1. Molecular vibrations the theory of infrared and Raman vibrational spectra

    CERN Document Server

    Wilson, E Bright; Cross, Paul C

    1980-01-01

    Pedagogical classic and essential reference focuses on mathematics of detailed vibrational analyses of polyatomic molecules, advancing from application of wave mechanics to potential functions and methods of solving secular determinant.

  2. Molecular structure studies by 3D imaging of fast ion beams

    International Nuclear Information System (INIS)

    Kanter, E.P.; Vager, Z.; Both, G.; Cooney, P.J.; Faibis, A.; Koenig, W.; Zabransky, B.J.; Zajfman, D.

    1986-01-01

    The use of the Coulomb-explosion technique combined with a radically new multi-particle detector, extremely thin film targets, and low-excitation ion source has enabled, for the first time, direct measurements of the complete stereochemistry of complex polyatomic molecular ions. We outline the methods used and present results for protonated acetylene (C 2 H 3 + ) and the methane cation (CH 4 + ) as examples. We demonstrate the techniques by which these methods can be generalized to determine directly vibrational motions in polyatomic molecules. 24 refs., 4 figs

  3. The inherent dynamics of a molecular liquid: Geodesic pathways through the potential energy landscape of a liquid of linear molecules

    Science.gov (United States)

    Jacobson, Daniel; Stratt, Richard M.

    2014-05-01

    Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.

  4. Quantum coherent π-electron rotations in a non-planar chiral molecule induced by using a linearly polarized UV laser pulse

    Science.gov (United States)

    Mineo, Hirobumi; Fujimura, Yuichi

    2015-06-01

    We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.

  5. Molecules with linear pi-conjugated pathways between all substituents : Omniconjugation

    NARCIS (Netherlands)

    van der Veen, M.H.; Rispens, M.T; Jonkman, H.T.; Hummelen, J.C.

    In this paper, omniconjugation is introduced as a topological phenomenon in pi-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully pi-conjugated pathways between all subdstituents attached to them. Surprisingly, until now such topologies have never

  6. Molecules with Linear π-Conjugated Pathways between All Substituents : Omniconjugation

    NARCIS (Netherlands)

    Veen, Marleen H. van der; Rispens, Minze T.; Jonkman, Harry T.; Hummelen, Jan C.

    2004-01-01

    In this paper, omniconjugation is introduced as a topological phenomenon in π-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully π-conjugated pathways between all substituents attached to them. Surprisingly, until now such topologies have never

  7. A practical approach to temperature effects in dissociative electron attachment cross sections using local complex potential theory

    International Nuclear Information System (INIS)

    Sugioka, Yuji; Takayanagi, Toshiyuki

    2012-01-01

    Highlights: ► Dissociative electron attachment cross sections for polyatomic molecules are calculated by a simple theoretical approach. ► Temperature effects can be reasonably reproduced with the present model. ► All the degrees-of-freedom are taken into account in the present dynamics approach. -- Abstract: We propose a practical computational scheme to obtain temperature dependence of dissociative electron attachment cross sections to polyatomic molecules within a local complex potential theory formalism. First we perform quantum path-integral molecular dynamics simulations on the potential energy surface for the neutral molecule in order to sample initial nuclear configurations as well as momenta. Classical trajectories are subsequently integrated on the potential energy surface for the anionic state and survival probabilities are simultaneously calculated along the obtained trajectories. We have applied this simple scheme to dissociative electron attachment processes to H 2 O and CF 3 Cl, for which several previous studies are available from both the experimental and theoretical sides.

  8. A practical approach to temperature effects in dissociative electron attachment cross sections using local complex potential theory

    Energy Technology Data Exchange (ETDEWEB)

    Sugioka, Yuji [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan)

    2012-09-11

    Highlights: Black-Right-Pointing-Pointer Dissociative electron attachment cross sections for polyatomic molecules are calculated by a simple theoretical approach. Black-Right-Pointing-Pointer Temperature effects can be reasonably reproduced with the present model. Black-Right-Pointing-Pointer All the degrees-of-freedom are taken into account in the present dynamics approach. -- Abstract: We propose a practical computational scheme to obtain temperature dependence of dissociative electron attachment cross sections to polyatomic molecules within a local complex potential theory formalism. First we perform quantum path-integral molecular dynamics simulations on the potential energy surface for the neutral molecule in order to sample initial nuclear configurations as well as momenta. Classical trajectories are subsequently integrated on the potential energy surface for the anionic state and survival probabilities are simultaneously calculated along the obtained trajectories. We have applied this simple scheme to dissociative electron attachment processes to H{sub 2}O and CF{sub 3}Cl, for which several previous studies are available from both the experimental and theoretical sides.

  9. Ultrafast dissociation: An unexpected tool for probing molecular dynamics

    International Nuclear Information System (INIS)

    Morin, Paul; Miron, Catalin

    2012-01-01

    Highlights: ► Ultrafast dissociation has been investigated by means of XPS and mass spectrometry. ► The interplay between electron relaxation and molecular dynamics is evidenced. ► Extension toward polyatomics, clusters, adsorbed molecules is considered. ► Quantum effects (spectral hole, angular effects) evidence the molecular field anisotropy. -- Abstract: Ultrafast dissociation following core–shell excitation into an antibonding orbital led to the early observation in HBr of atomic Auger lines associated to the decay of dissociated excited atoms. The purpose of this article is to review the very large variety of systems where such a situation has been encountered, extending from simple diatomic molecules toward more complex systems like polyatomics, clusters, or adsorbed molecules. Interestingly, this phenomenon has revealed an extremely rich and powerful tool for probing nuclear dynamics and its subtle interplay with electron relaxation occurring on a comparable time scale. Consequently this review covers a surprisingly large period, starting in 1986 and still ongoing.

  10. The synthesis and properties of linear A-π-D-π-A type organic small molecule containing diketopyrrolopyrrole terminal units

    Science.gov (United States)

    Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia

    2017-08-01

    A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.

  11. Computer simulation of molecular absorption spectra for asymmetric top molecules

    International Nuclear Information System (INIS)

    Bende, A.; Tosa, V.; Cosma, V.

    2001-01-01

    The effective Hamiltonian formalism has been used to develop a model for infrared multiple-photon absorption (IRMPA) process in asymmetric top molecules. Assuming a collisionless regime, the interaction between the molecule and laser field can be described by the time-dependent Schroedinger equation. By using the rotating wave approximation and Laplace transformation, the time-dependent problem reduces to a time-independent eigen problem for an effective Hamiltonian which can be solved only numerically for a real vibrational-rotational structure of polyatomic molecule. The vibrational-rotational structure is assumed to be an anharmonic oscillator coupled to an asymmetric rigid rotor. The main assumptions taken into account for this model are the following: (1) the excitation is coherent, i.e. the collision (if present during the laser pulse) does not influence the excitation; (2) the excitation starts from the ground state and is near resonant to a normal mode, thus, the rotating wave approximation can be applied; (3) after absorbing N photons the vibrational energy of the excited mode leak into a quasicontinuum; (4) the thermal population of the ground state is given by the Maxwell-Boltzmann distribution law. The energy levels of the asymmetric top molecules cannot be represented by an explicit formula analogous to that for the symmetric top, according to quantum mechanics, but we can consider it a deviation from the prolate or oblate case of the symmetric top, and we can find in the same manner the selection rules of the asymmetric case using the selection rules for the symmetric case. The infrared bands of asymmetric top molecules are not resolved, but if the dispersion used is not too small, so that the envelopes of the bands can be distinguished from simple maxima, it is possible to draw conclusions as to the type of the bands. In this case, the simulation of the absorption spectra can give us some important information about the types of these bands. In

  12. Extended Thermodynamics of Rarefied Polyatomic Gases: 15-Field Theory Incorporating Relaxation Processes of Molecular Rotation and Vibration

    Directory of Open Access Journals (Sweden)

    Takashi Arima

    2018-04-01

    Full Text Available After summarizing the present status of Rational Extended Thermodynamics (RET of gases, which is an endeavor to generalize the Navier–Stokes and Fourier (NSF theory of viscous heat-conducting fluids, we develop the molecular RET theory of rarefied polyatomic gases with 15 independent fields. The theory is justified, at mesoscopic level, by a generalized Boltzmann equation in which the distribution function depends on two internal variables that take into account the energy exchange among the different molecular modes of a gas, that is, translational, rotational, and vibrational modes. By adopting the generalized Bhatnagar, Gross and Krook (BGK-type collision term, we derive explicitly the closed system of field equations with the use of the Maximum Entropy Principle (MEP. The NSF theory is derived from the RET theory as a limiting case of small relaxation times via the Maxwellian iteration. The relaxation times introduced in the theory are shown to be related to the shear and bulk viscosities and heat conductivity.

  13. Linear optical response of finite systems using multishift linear system solvers

    Energy Technology Data Exchange (ETDEWEB)

    Hübener, Hannes; Giustino, Feliciano [Department of Materials, University of Oxford, Oxford OX1 3PH (United Kingdom)

    2014-07-28

    We discuss the application of multishift linear system solvers to linear-response time-dependent density functional theory. Using this technique the complete frequency-dependent electronic density response of finite systems to an external perturbation can be calculated at the cost of a single solution of a linear system via conjugate gradients. We show that multishift time-dependent density functional theory yields excitation energies and oscillator strengths in perfect agreement with the standard diagonalization of the response matrix (Casida's method), while being computationally advantageous. We present test calculations for benzene, porphin, and chlorophyll molecules. We argue that multishift solvers may find broad applicability in the context of excited-state calculations within density-functional theory and beyond.

  14. Enhanced sensitivity to a possible variation of the proton-to-electron mass ratio in ammonia

    Czech Academy of Sciences Publication Activity Database

    Owens, A.; Yurchenko, S. N.; Thiel, W.; Špirko, Vladimír

    2016-01-01

    Roč. 93, č. 5 (2016), č. článku 052506. ISSN 2469-9926 Institutional support: RVO:61388963 Keywords : precision measurements * polyatomic molecules * accurate prediction Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.925, year: 2016

  15. Viscous properties of isotropic fluids composed of linear molecules: departure from the classical Navier-Stokes theory in nano-confined geometries.

    Science.gov (United States)

    Hansen, J S; Daivis, Peter J; Todd, B D

    2009-10-01

    In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.

  16. Full Alignment of Molecules Using Elliptically Polarized Light

    DEFF Research Database (Denmark)

    Larsen, Jakob Juul; Hald, Kasper; Seideman, Tamar

    When a molecule with an anisotropic polarizability is placed in a strong nonresonant laser field the interaction occurs through the induced dipole moment. The outcome is that the molecule experiences an angular dependent potential energy. It is now well established that a linearly polarized laser...... field can be used to align molecules along their axis of highest polarizability. Here we demonstrate, theoretically and experimentally, that an elliptically polarized laser field can be used to simultaneously force two axes of a molecule into alignment through the same mechanism. Due to the rigidity...

  17. Aligning molecules with intense nonresonant laser fields

    DEFF Research Database (Denmark)

    Larsen, J.J.; Safvan, C.P.; Sakai, H.

    1999-01-01

    Molecules in a seeded supersonic beam are aligned by the interaction between an intense nonresonant linearly polarized laser field and the molecular polarizability. We demonstrate the general applicability of the scheme by aligning I2, ICl, CS2, CH3I, and C6H5I molecules. The alignment is probed...... by mass selective two dimensional imaging of the photofragment ions produced by femtosecond laser pulses. Calculations on the degree of alignment of I2 are in good agreement with the experiments. We discuss some future applications of laser aligned molecules....

  18. Linear ubiquitination signals in adaptive immune responses.

    Science.gov (United States)

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Excited states 2

    CERN Document Server

    Lim, Edward C

    2013-01-01

    Excited States, Volume 2 is a collection of papers that deals with molecules in the excited states. The book describes the geometries of molecules in the excited electronic states. One paper describes the geometries of a diatomic molecule and of polyatomic molecules; it also discusses the determination of the many excited state geometries of molecules with two, three, or four atoms by techniques similar to diatomic spectroscopy. Another paper introduces an ordered theory related to excitons in pure and mixed molecular crystals. This paper also presents some experimental data such as those invo

  20. High mass accuracy and high mass resolving power FT-ICR secondary ion mass spectrometry for biological tissue imaging

    NARCIS (Netherlands)

    Smith, D.F.; Kiss, A.; Leach, F.E.; Robinson, E.W.; Paša-Tolić, L.; Heeren, R.M.A.

    2013-01-01

    Biological tissue imaging by secondary ion mass spectrometry has seen rapid development with the commercial availability of polyatomic primary ion sources. Endogenous lipids and other small bio-molecules can now be routinely mapped on the sub-micrometer scale. Such experiments are typically

  1. Calculations on the vibrational level density in highly excited formaldehyde

    International Nuclear Information System (INIS)

    Rashev, Svetoslav; Moule, David C.

    2003-01-01

    The object of the present work is to develop a model that provides realistic estimates of the vibrational level density in polyatomic molecules in a given electronic state, at very high (chemically relevant) vibrational excitation energies. For S 0 formaldehyde (D 2 CO), acetylene, and a number of triatomics, the estimates using conventional spectroscopic formulas have yielded densities at the dissociation threshold, very much lower than the experimentally measured values. In the present work we have derived a general formula for the vibrational energy levels of a polyatomic molecule, which is a generalization of the conventional Dunham spectroscopic expansion. Calculations were performed on the vibrational level density in S 0 D 2 CO, H 2 C 2 , and NO 2 at excitation energies in the vicinity of the dissociation limit, using the newly derived formula. The results from the calculations are in reasonable agreement with the experimentally measured data

  2. A new crossed molecular beam apparatus using time-sliced ion velocity imaging technique

    International Nuclear Information System (INIS)

    Wu Guorong; Zhang Weiqing; Pan Huilin; Shuai Quan; Jiang Bo; Dai Dongxu; Yang Xueming

    2008-01-01

    A new crossed molecular beam apparatus has been constructed for investigating polyatomic chemical reactions using the time-sliced ion velocity map imaging technique. A unique design is adopted for one of the two beam sources and allows us to set up the molecular beam source either horizontally or vertically. This can be conveniently used to produce versatile atomic or radical beams from photodissociation and as well as electric discharge. Intensive H-atom beam source with high speed ratio was produced by photodissociation of the HI molecule and was reacted with the CD 4 molecule. Vibrational-state resolved HD product distribution was measured by detecting the CD 3 product. Preliminary results were also reported on the F+SiH 4 reaction using the discharged F atom beam. These results demonstrate that this new instrument is a powerful tool for investigating chemical dynamics of polyatomic reactions.

  3. Impulsive Laser Induced Alignment of Molecules Dissolved in Helium Nanodroplets

    DEFF Research Database (Denmark)

    Pentlehner, Dominik; H. Nielsen, Jens; Slenczka, Alkwin

    2013-01-01

    We show that a 450 fs nonresonant, moderately intense, linearly polarized laser pulse can induce field-free molecular axis alignment of methyliodide (CH3I) molecules dissolved in a helium nanodroplet. Time-resolved measurements reveal rotational dynamics much slower than that of isolated molecules...

  4. Mechanical response of collagen molecule under hydrostatic compression

    International Nuclear Information System (INIS)

    Saini, Karanvir; Kumar, Navin

    2015-01-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

  5. Mechanical response of collagen molecule under hydrostatic compression.

    Science.gov (United States)

    Saini, Karanvir; Kumar, Navin

    2015-04-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights

  6. Mechanical response of collagen molecule under hydrostatic compression

    Energy Technology Data Exchange (ETDEWEB)

    Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin

    2015-04-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

  7. Cold guided beams of polar molecules

    International Nuclear Information System (INIS)

    Motsch, Michael

    2010-01-01

    This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion

  8. On the Mass of Atoms in Molecules: Beyond the Born-Oppenheimer Approximation

    Science.gov (United States)

    Scherrer, Arne; Agostini, Federica; Sebastiani, Daniel; Gross, E. K. U.; Vuilleumier, Rodolphe

    2017-07-01

    Describing the dynamics of nuclei in molecules requires a potential energy surface, which is traditionally provided by the Born-Oppenheimer or adiabatic approximation. However, we also need to assign masses to the nuclei. There, the Born-Oppenheimer picture does not account for the inertia of the electrons, and only bare nuclear masses are considered. Nowadays, experimental accuracy challenges the theoretical predictions of rotational and vibrational spectra and requires the participation of electrons in the internal motion of the molecule. More than 80 years after the original work of Born and Oppenheimer, this issue has still not been solved, in general. Here, we present a theoretical and numerical framework to address this problem in a general and rigorous way. Starting from the exact factorization of the electron-nuclear wave function, we include electronic effects beyond the Born-Oppenheimer regime in a perturbative way via position-dependent corrections to the bare nuclear masses. This maintains an adiabaticlike point of view: The nuclear degrees of freedom feel the presence of the electrons via a single potential energy surface, whereas the inertia of electrons is accounted for and the total mass of the system is recovered. This constitutes a general framework for describing the mass acquired by slow degrees of freedom due to the inertia of light, bounded particles; thus, it is applicable not only in electron-nuclear systems but in light-heavy nuclei or ions as well. We illustrate this idea with a model of proton transfer, where the light particle is the proton and the heavy particles are the oxygen atoms to which the proton is bounded. Inclusion of the light-particle inertia allows us to gain orders of magnitude in accuracy. The electron-nuclear perspective is adopted, instead, to calculate position-dependent mass corrections using density functional theory for a few polyatomic molecules at their equilibrium geometry. These data can serve as input for the

  9. On the Mass of Atoms in Molecules: Beyond the Born-Oppenheimer Approximation

    Directory of Open Access Journals (Sweden)

    Arne Scherrer

    2017-08-01

    Full Text Available Describing the dynamics of nuclei in molecules requires a potential energy surface, which is traditionally provided by the Born-Oppenheimer or adiabatic approximation. However, we also need to assign masses to the nuclei. There, the Born-Oppenheimer picture does not account for the inertia of the electrons, and only bare nuclear masses are considered. Nowadays, experimental accuracy challenges the theoretical predictions of rotational and vibrational spectra and requires the participation of electrons in the internal motion of the molecule. More than 80 years after the original work of Born and Oppenheimer, this issue has still not been solved, in general. Here, we present a theoretical and numerical framework to address this problem in a general and rigorous way. Starting from the exact factorization of the electron-nuclear wave function, we include electronic effects beyond the Born-Oppenheimer regime in a perturbative way via position-dependent corrections to the bare nuclear masses. This maintains an adiabaticlike point of view: The nuclear degrees of freedom feel the presence of the electrons via a single potential energy surface, whereas the inertia of electrons is accounted for and the total mass of the system is recovered. This constitutes a general framework for describing the mass acquired by slow degrees of freedom due to the inertia of light, bounded particles; thus, it is applicable not only in electron-nuclear systems but in light-heavy nuclei or ions as well. We illustrate this idea with a model of proton transfer, where the light particle is the proton and the heavy particles are the oxygen atoms to which the proton is bounded. Inclusion of the light-particle inertia allows us to gain orders of magnitude in accuracy. The electron-nuclear perspective is adopted, instead, to calculate position-dependent mass corrections using density functional theory for a few polyatomic molecules at their equilibrium geometry. These data can

  10. Depolarization of fluorescence of polyatomic molecules in noble gas solvents

    Science.gov (United States)

    Blokhin, A. P.; Gelin, M. F.; Kalosha, I. I.; Matylitsky, V. V.; Erohin, N. P.; Barashkov, M. V.; Tolkachev, V. A.

    2001-10-01

    The collisional depolarization of fluorescence is studied for p-quarterphenyl (PQP) in He, Ar, Xe solvents, under pressures ranging from zero to nearly atmospheric. The results are interpreted within the Keilson-Storer model of the orientational relaxation and smooth rigid body collision dynamics. This allows us to estimate the rate of the angular momentum scrambling due to encounters of PQP with its partners. The collisions are shown to be neither strong nor weak, so that the averaged number of encounters giving rise to the PQP angular momentum randomization equals to 33 (PQP-He), 4.5 (PQP-Ar), and 2.1 (PQP-Xe).

  11. Excited-state potential-energy surfaces of metal-adsorbed organic molecules from linear expansion Δ-self-consistent field density-functional theory (ΔSCF-DFT).

    Science.gov (United States)

    Maurer, Reinhard J; Reuter, Karsten

    2013-07-07

    Accurate and efficient simulation of excited state properties is an important and much aspired cornerstone in the study of adsorbate dynamics on metal surfaces. To this end, the recently proposed linear expansion Δ-self-consistent field method by Gavnholt et al. [Phys. Rev. B 78, 075441 (2008)] presents an efficient alternative to time consuming quasi-particle calculations. In this method, the standard Kohn-Sham equations of density-functional theory are solved with the constraint of a non-equilibrium occupation in a region of Hilbert-space resembling gas-phase orbitals of the adsorbate. In this work, we discuss the applicability of this method for the excited-state dynamics of metal-surface mounted organic adsorbates, specifically in the context of molecular switching. We present necessary advancements to allow for a consistent quality description of excited-state potential-energy surfaces (PESs), and illustrate the concept with the application to Azobenzene adsorbed on Ag(111) and Au(111) surfaces. We find that the explicit inclusion of substrate electronic states modifies the topologies of intra-molecular excited-state PESs of the molecule due to image charge and hybridization effects. While the molecule in gas phase shows a clear energetic separation of resonances that induce isomerization and backreaction, the surface-adsorbed molecule does not. The concomitant possibly simultaneous induction of both processes would lead to a significantly reduced switching efficiency of such a mechanism.

  12. Molecular-beam studies of primary photochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y.T.

    1982-12-01

    Application of the method of molecular-beam photofragmentation translational spectroscopy to the investigation of primary photochemical processes of polyatomic molecules is described. Examples will be given to illustrate how information concerning the energetics, dynamics, and mechanism of dissociation processes can be obtained from the precise measurements of angular and velocity distributions of products in an experiment in which a well-defined beam of molecules is crossed with a laser.

  13. Molecular-beam studies of primary photochemical processes

    International Nuclear Information System (INIS)

    Lee, Y.T.

    1982-12-01

    Application of the method of molecular-beam photofragmentation translational spectroscopy to the investigation of primary photochemical processes of polyatomic molecules is described. Examples will be given to illustrate how information concerning the energetics, dynamics, and mechanism of dissociation processes can be obtained from the precise measurements of angular and velocity distributions of products in an experiment in which a well-defined beam of molecules is crossed with a laser

  14. Construction and maintenance of SUNY facilities at the National Synchrotron Light Source. Progress report, 1 July 1983-1 July 1984. Final report

    International Nuclear Information System (INIS)

    Bigeleisen, J.

    1984-01-01

    Research reported includes beamline facilities, X-21 beamline update, SUNY-PRT participation in the design and commissioning of the CHESS crystallography facility, surface physics, material and structure studies using EXAFS, x-ray standing wave studies of surfaces and interfaces, and surface diffraction of adsorbed polyatomic molecules

  15. Dynamics of elliptic breathers in saturable nonlinear media with linear anisotropy

    International Nuclear Information System (INIS)

    Liang, Guo; Guo, Qi; Shou, Qian; Ren, Zhanmei

    2014-01-01

    We have introduced a class of dynamic elliptic breathers in saturable nonlinear media with linear anisotropy. Two kinds of evolution behavior for the dynamic breathers, rotations and molecule-like librations, are both predicted by the variational approach, and confirmed in numerical simulations. The dynamic elliptic breathers can rotate even though they have no initial orbital angular momentum (OAM). As the media are linear anisotropic, OAM is no longer conserved, and hence the angular velocity is not constant but a periodic function of the propagation distance. When the linear anisotropy is large enough, the dynamic elliptic breathers librate like molecules. The dynamic elliptic breathers are present in media with not only saturable nonlinearity but also nonlocal nonlinearity; indeed, they are universal in nonlinear media with linear anisotropy. (paper)

  16. Capillary condensation of short-chain molecules.

    Science.gov (United States)

    Bryk, Paweł; Pizio, Orest; Sokolowski, Stefan

    2005-05-15

    A density-functional study of capillary condensation of fluids of short-chain molecules confined to slitlike pores is presented. The molecules are modeled as freely jointed tangent spherical segments with a hard core and with short-range attractive interaction between all the segments. We investigate how the critical parameters of capillary condensation of the fluid change when the pore width decreases and eventually becomes smaller than the nominal linear dimension of the single-chain molecule. We find that the dependence of critical parameters for a fluid of dimers and of tetramers on pore width is similar to that of the monomer fluid. On the other hand, for a fluid of chains consisting of a larger number of segments we observe an inversion effect. Namely, the critical temperature of capillary condensation decreases with increasing pore width for a certain interval of values of the pore width. This anomalous behavior is also influenced by the interaction between molecules and pore walls. We attribute this behavior to the effect of conformational changes of molecules upon confinement.

  17. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria

    Science.gov (United States)

    Valach, Matus; Farkas, Zoltan; Fricova, Dominika; Kovac, Jakub; Brejova, Brona; Vinar, Tomas; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Lang, B. Franz; Nosek, Jozef

    2011-01-01

    Mitochondrial genome diversity in closely related species provides an excellent platform for investigation of chromosome architecture and its evolution by means of comparative genomics. In this study, we determined the complete mitochondrial DNA sequences of eight Candida species and analyzed their molecular architectures. Our survey revealed a puzzling variability of genome architecture, including circular- and linear-mapping and multipartite linear forms. We propose that the arrangement of large inverted repeats identified in these genomes plays a crucial role in alterations of their molecular architectures. In specific arrangements, the inverted repeats appear to function as resolution elements, allowing genome conversion among different topologies, eventually leading to genome fragmentation into multiple linear DNA molecules. We suggest that molecular transactions generating linear mitochondrial DNA molecules with defined telomeric structures may parallel the evolutionary emergence of linear chromosomes and multipartite genomes in general and may provide clues for the origin of telomeres and pathways implicated in their maintenance. PMID:21266473

  18. Control of π-Electron Rotations in Chiral Aromatic Molecules Using Intense Laser Pulses

    Science.gov (United States)

    Kanno, Manabu; Kono, Hirohiko; Fujimura, Yuichi

    Our recent theoretical studies on laser-induced π-electron rotations in chiral aromatic molecules are reviewed. π electrons of a chiral aromatic molecule can be rotated along its aromatic ring by a nonhelical, linearly polarized laser pulse. An ansa aromatic molecule with a six-membered ring, 2,5-dichloro[n](3,6) pyrazinophane, which belongs to a planar-chiral molecule group, and its simplified molecule 2,5-dichloropyrazine are taken as model molecules. Electron wavepacket simulations in the frozen-molecular-vibration approximation show that the initial direction of π-electron rotation depends on the polarization direction of a linearly polarized laser pulse applied. Consecutive unidirectional rotation can be achieved by applying a sequence of linearly polarized pump and dump pulses to prevent reverse rotation. Optimal control simulations of π-electron rotation show that another controlling factor for unidirectional rotation is the relative optical phase between the different frequency components of an incident pulse in addition to photon polarization direction. Effects of nonadiabatic coupling between π-electron rotation and molecular vibrations are also presented, where the constraints of the frozen approximation are removed. The angular momentum gradually decays mainly owing to nonadiabatic coupling, while the vibrational amplitudes greatly depend on their rotation direction. This suggests that the direction of π-electron rotation on an attosecond timescale can be identified by detecting femtosecond molecular vibrations.

  19. Effective charge model in the theory of infrared intensities and its application for study of charge di.stribution in the molecules of organometallic compounds

    International Nuclear Information System (INIS)

    Aleksanyan, V.T.; Samvelyan, S.Kh.

    1984-01-01

    General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated

  20. Study the multi-photon absorption process in two types of molecules

    International Nuclear Information System (INIS)

    Al-azawi, H.R.

    1986-01-01

    The aim of the present work was to study the multi-photon absorption process in two types of molecules; spherical top such as SF 6 molecules and assymetric top such as CHOOH and C 2 H 4 molecules. This work also aimed to study the effect of buffer gas pressure (Ar), which is transparent to the infrared (IR) laser on the multiphoton absorption of both types of molecules. A pulsed (TEA) CO 2 laser was used as a source which generates multi-lines in the IR-region of the spectrum and an optoacoustic detector was used to detect the energy absorbed by the molecules. In this study, the relaxation process was found to be faster in the heavy molecules than that in the light ones. A limit in the Ar pressure was observed. Below this limit, the gas acted as an active buffer gas and above it, the multi-photon absorption process was quenched. This work also aimed to study the multi-photon absorption spectrum for the CHOOH molecules in the range (1067-1090 cm -1 ). This spectrum was found to be consistent with the linear absorption spectrum obtained for the same range. The density of the vibrational states as a function of the vibrational energy was studied for the molecules SF 6 , CHOOH and C 2 H 4 . The results were used to interpret (i) the difference in the energy absorbed by difference molecules at the same energy density and (ii) the non-linearity in the multi-photon absorption for CHOOH molecules. 1 tab.; 40 figs.; 70 refs

  1. Interference in acetylene intersystem crossing acts as the molecular analog of Young's double-slit experiment

    NARCIS (Netherlands)

    de Groot, M.; Field, R.W.; Buma, W.J.

    2009-01-01

    We report on an experimental approach that reveals crucial details of the composition of singlet-triplet mixed eigenstates in acetylene. Intersystem crossing in this prototypical polyatomic molecule embodies the mixing of the lowest excited singlet state (S1) with 3 triplet states (T1, T2, and T3).

  2. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2014-02-12

    Feb 12, 2014 ... We simulate adaptive feedback control to coherently shape a femtosecond infrared laser pulse by means of a 4f-spatial light modulator in order to selectively excite the rovibrational modes of a polyatomic molecule. We preferentially populate an arbitrarily chosen upper rovibrational level by only employing ...

  3. Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules.

    Science.gov (United States)

    Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo

    2010-11-01

    Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity

  4. Nonlinear Hamiltonian mechanics applied to molecular dynamics theory and computational methods for understanding molecular spectroscopy and chemical reactions

    CERN Document Server

    Farantos, Stavros C

    2014-01-01

    This brief presents numerical methods for describing and calculating invariant phase space structures, as well as solving the classical and quantum equations of motion for polyatomic molecules. Examples covered include simple model systems to realistic cases of molecules spectroscopically studied. Vibrationally excited and reacting molecules are nonlinear dynamical systems, and thus, nonlinear mechanics is the proper theory to elucidate molecular dynamics by investigating invariant structures in phase space. Intramolecular energy transfer, and the breaking and forming of a chemical bond have now found a rigorous explanation by studying phase space structures.

  5. Recent progress in the theory of dissociative attachment: From diatomics to biomolecules

    International Nuclear Information System (INIS)

    Fabrikant, Ilya I

    2010-01-01

    We present a summary of recent progress in theoretical studies of low-energy dissociative electron attachment (DEA) to halogen molecules and polyatomic molecules based on the resonance R-matrix theory. It explains many observed features in DEA cross sections including low-energy behavior, threshold resonances and cusps. It also gives correct description of the temperature dependence of the attachment rate coefficients. More recently the theory was applied to two molecules of biological interest, formic acid and glycine. DEA mechanisms in these systems are very similar to those in hydrogen halides.

  6. Carbon 13 nuclear magnetic resonance chemical shifts empiric calculations of polymers by multi linear regression and molecular modeling

    International Nuclear Information System (INIS)

    Da Silva Pinto, P.S.; Eustache, R.P.; Audenaert, M.; Bernassau, J.M.

    1996-01-01

    This work deals with carbon 13 nuclear magnetic resonance chemical shifts empiric calculations by multi linear regression and molecular modeling. The multi linear regression is indeed one way to obtain an equation able to describe the behaviour of the chemical shift for some molecules which are in the data base (rigid molecules with carbons). The methodology consists of structures describer parameters definition which can be bound to carbon 13 chemical shift known for these molecules. Then, the linear regression is used to determine the equation significant parameters. This one can be extrapolated to molecules which presents some resemblances with those of the data base. (O.L.). 20 refs., 4 figs., 1 tab

  7. Photon-assisted tunneling in a Fe-8 single-molecule magnet

    OpenAIRE

    Sorace, L.; Wernsdorfer, W.; Thirion, C.; Barra, A. L.; Pacchioni, M.; Mailly, D.; Barbara, B.

    2003-01-01

    The low temperature spin dynamics of a Fe8 Single-Molecule Magnet was studied under circularly polarized electromagnetic radiation allowing us to establish clearly photon-assisted tunneling. This effect, while linear at low power, becomes highly non-linear above a relatively low power threshold. This non-linearity is attributed to the nature of the coupling of the sample to the thermostat.These results are of great importance if such systems are to be used as quantum computers.

  8. Molecular electronics--resonant transport through single molecules.

    Science.gov (United States)

    Lörtscher, Emanuel; Riel, Heike

    2010-01-01

    The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.

  9. A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui

    2010-04-20

    Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.

  10. On a simple way to calculate electronic resonances for polyatomic molecules

    Czech Academy of Sciences Publication Activity Database

    Horáček, J.; Paidarová, Ivana; Čurík, Roman

    2015-01-01

    Roč. 143, č. 18 (2015), č. článku 184102. ISSN 0021-9606 R&D Projects: GA ČR GAP208/11/0452; GA MŠk LD14088 Institutional support: RVO:61388955 Keywords : analytical continuation * coupling-constant * diacetylene Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.894, year: 2015

  11. Single photon excimer laser photodissociation of highly vibrationally excited polyatomic molecules

    International Nuclear Information System (INIS)

    Tiee, J.J.; Wampler, F.B.; Rice, W.W.

    1980-01-01

    The ir + uv photodissociation of SF 6 has been performed using CO 2 and ArF lasers. The two-color photolysis significantly enhances the photodissociation process over ArF irradiation alone and is found to preserve the initial isotopic specificity of the ir excitation process

  12. Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge.

    Science.gov (United States)

    Korobenko, A; Milner, V

    2016-05-06

    We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.

  13. Control strategies for laser separation of carbon isotopes

    Indian Academy of Sciences (India)

    Laser isotope separation (LIS) by infrared laser chemistry of polyatomic molecules has come a long way since its discovery. The last decade has seen considerable efforts in scaling up of the process for light elements like carbon, oxygen and silicon. These efforts aim at ways to improve both the enrichment factor and the ...

  14. Implementation of polyatomic MCTDHF capability

    Science.gov (United States)

    Haxton, Daniel; Jones, Jeremiah; Rescigno, Thomas; McCurdy, C. William; Ibrahim, Khaled; Williams, Sam; Vecharynski, Eugene; Rouet, Francois-Henry; Li, Xiaoye; Yang, Chao

    2015-05-01

    The implementation of the Multiconfiguration Time-Dependent Hartree-Fock method for poly- atomic molecules using a cartesian product grid of sinc basis functions will be discussed. The focus will be on two key components of the method: first, the use of a resolution-of-the-identity approximation; sec- ond, the use of established techniques for triple Toeplitz matrix algebra using fast Fourier transform over distributed memory architectures (MPI 3D FFT). The scaling of two-electron matrix element transformations is converted from O(N4) to O(N log N) by including these components. Here N = n3, with n the number of points on a side. We test the prelim- inary implementation by calculating absorption spectra of small hydro- carbons, using approximately 16-512 points on a side. This work is supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under the Early Career program, and by the offices of BES and Advanced Scientific Computing Research, under the SciDAC program.

  15. Quantum Monte Carlo for vibrating molecules

    International Nuclear Information System (INIS)

    Brown, W.R.; Lawrence Berkeley National Lab., CA

    1996-08-01

    Quantum Monte Carlo (QMC) has successfully computed the total electronic energies of atoms and molecules. The main goal of this work is to use correlation function quantum Monte Carlo (CFQMC) to compute the vibrational state energies of molecules given a potential energy surface (PES). In CFQMC, an ensemble of random walkers simulate the diffusion and branching processes of the imaginary-time time dependent Schroedinger equation in order to evaluate the matrix elements. The program QMCVIB was written to perform multi-state VMC and CFQMC calculations and employed for several calculations of the H 2 O and C 3 vibrational states, using 7 PES's, 3 trial wavefunction forms, two methods of non-linear basis function parameter optimization, and on both serial and parallel computers. In order to construct accurate trial wavefunctions different wavefunctions forms were required for H 2 O and C 3 . In order to construct accurate trial wavefunctions for C 3 , the non-linear parameters were optimized with respect to the sum of the energies of several low-lying vibrational states. In order to stabilize the statistical error estimates for C 3 the Monte Carlo data was collected into blocks. Accurate vibrational state energies were computed using both serial and parallel QMCVIB programs. Comparison of vibrational state energies computed from the three C 3 PES's suggested that a non-linear equilibrium geometry PES is the most accurate and that discrete potential representations may be used to conveniently determine vibrational state energies

  16. Photoexcitation circular dichroism in chiral molecules

    Science.gov (United States)

    Beaulieu, S.; Comby, A.; Descamps, D.; Fabre, B.; Garcia, G. A.; Géneaux, R.; Harvey, A. G.; Légaré, F.; Mašín, Z.; Nahon, L.; Ordonez, A. F.; Petit, S.; Pons, B.; Mairesse, Y.; Smirnova, O.; Blanchet, V.

    2018-05-01

    Chiral effects appear in a wide variety of natural phenomena and are of fundamental importance in science, from particle physics to metamaterials. The standard technique of chiral discrimination—photoabsorption circular dichroism—relies on the magnetic properties of a chiral medium and yields an extremely weak chiral response. Here, we propose and demonstrate an orders of magnitude more sensitive type of circular dichroism in neutral molecules: photoexcitation circular dichroism. This technique does not rely on weak magnetic effects, but takes advantage of the coherent helical motion of bound electrons excited by ultrashort circularly polarized light. It results in an ultrafast chiral response and the efficient excitation of a macroscopic chiral density in an initially isotropic ensemble of randomly oriented chiral molecules. We probe this excitation using linearly polarized laser pulses, without the aid of further chiral interactions. Our time-resolved study of vibronic chiral dynamics opens a way to the efficient initiation, control and monitoring of chiral chemical change in neutral molecules at the level of electrons.

  17. Photoelectron spectroscopy

    International Nuclear Information System (INIS)

    Price, W.C.

    1974-01-01

    A survey is given of the development of x-ray and ultraviolet photoelectron spectroscopy. Applications of photoelectron spectroscopy to studies of atomic electronic configurations are discussed, including photoelectron spectra of hydrides isoelectronic with the inert gases; photoelectron spectra of the halogen derivatives of methane; photoelectron spectra of multiple bonded diatomic molecules; spectra and structure of some multiple bonded polyatomic molecules; spectra and structure of triatomic molecules; and methods of orbital assignment of bands in photoelectron spectra. Physical aspects are considered, including intensities; selection rules; dependence of cross section on photoelectron energy; autoionization; angular distribution of photoelectrons; electron-molecule interactions; and transient species. (26 figures, 54 references) (U.S.)

  18. Structural, Spectroscopic (FT-IR, Raman and NMR, Non-linear Optical (NLO, HOMO-LUMO and Theoretical (DFT/CAM-B3LYP Analyses of N-Benzyloxycarbonyloxy-5-Norbornene-2,3-Dicarboximide Molecule

    Directory of Open Access Journals (Sweden)

    Nuri ÖZTÜRK

    2018-02-01

    Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.

  19. Momentum densities in chemistry

    International Nuclear Information System (INIS)

    Coplan, M.A.; Tossell, J.A.; Moore, J.H.

    1982-01-01

    A principal interest of the Maryland (e,2e) group is the electronic structure of polyatomic molecules. Potentially, (e,2e) spectroscopy offers great advantages over conventional spectroscopy, photoelectron spectroscopy and even electron and x-ray diffraction. The realization of these advantages depends on the solution of a number of experimental and theoretical problems which are discussed here

  20. Quenching reactions of electronically excited atoms

    International Nuclear Information System (INIS)

    Setser, D.W.

    2001-01-01

    The two-body, thermal quenching reactions of electronically excited atoms are reviewed using excited states of Ar, Kr, and Xe atoms as examples. State-specific interstate relaxation and excitation-transfer reactions with atomic colliders are discussed first. These results then are used to discuss quenching reactions of excited-state atoms with diatomic and polyatomic molecules, the latter have large cross sections, and the reactions can proceed by excitation transfer and by reactive quenching. Excited states of molecules are not considered; however, a table of quenching rate constants is given for six excited-state molecules in an appendix

  1. Study by photo-ionization of some simple poly-atomic molecules and calculation of the Franck-Condon factors; Etude par photo-ionization de quelques molecules poly-atomiques simples et calcul des facteurs de Franck-Condon

    Energy Technology Data Exchange (ETDEWEB)

    Botter, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1968-02-01

    The photo-ionization yield curves for C{sub 2}H{sub 2}, C{sub 2}D{sub 2}, C{sub 2}H{sub 4} and C{sub 2}H{sub 2}D{sub 2} have been determined using a mass spectrometer coupled with an U.V. monochromator. Besides exhibiting a stair case structure near threshold due to the excitation of vibrational levels in the ion ground state, all the curves have broad maxima corresponding to auto-ionization phenomena. The ionization potentials of these molecules have been measured, together with the appearance potentials of the main ion-fragments. The excitation probabilities for the vibrational levels during ionization, or Franck-Condon factors, have been calculated for C{sub 2}H{sub 2} and C{sub 2}D{sub 2} using the method developed by Sharp and Rosenstock. Good agreement is generally obtained between the calculated values and those obtained experimentally from the photo-ionization yield curves. The preceding calculation method is then extended to the case where the electronic transition occurs with changes in the geometrical structure of the molecule (in particular, changes of symmetry). The Franck-Condon factors have been determined for NH{sub 3} (symmetry changes) and for H{sub 2}O (changes in the equilibrium angle). Calculations show that there is generally considerable excitation of the combination bands. (author) [French] Les courbes de rendement de photoionisation pour C{sub 2}H{sub 2}, C{sub 2}D{sub 2}, C{sub 2}H{sub 4} et C{sub 2}H{sub 2}D{sub 2} determinees a l'aide d'un spectrometre de masse auquel etait couple un monochromateur U.V. En plus d'une structure en escalier au voisinage du seuil, due a l'excitation de niveaux vibrationnels dans l'ion a l'etat fondamental, toutes les courbes presentent des maxima tres aplatis correspondant a des phenomenes d'auto-ionisation. Les potentiels d'ionisation de ces molecules ont ete mesures ainsi que les potentiels d'apparition des principaux ions fragments. Les probabilites d'excitation de niveaux de vibration au cours de l

  2. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    Science.gov (United States)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  3. About the correlation between atomic charge fluctuations in a molecule

    International Nuclear Information System (INIS)

    Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.

    1987-01-01

    In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt

  4. Supersonic molecular beam electric resonance spectroscopy and van der Waals molecules

    International Nuclear Information System (INIS)

    Luftman, H.S.

    1982-09-01

    A supersonic molecular beam electric resonance (MBER) spectrometer was built to study the radiofrequency spectra of weakly bound gas phase van der Waals molecules. The instrument and its operating characteristics are described in detail. Sample mass spectra of Ar-ClF gas mixtures are also presented as an illustration of the synthesis of van der Waals molecules. The Stark focusing process for linear polar molecules is discussed and computer-simulated using both second order perturbation and variational methods. Experimental refocusing spectra of OCS and ClF are studied and compared with these trajectory calculations. Though quantitative fitting is poor, there are strong qualitative indicators that the central part of a supersonic beam consists of molecules with a significantly greater population in the lowest energy rotational states than generally assumed. Flop in as opposed to flop out resonance signals for OCS are also numerically predicted and observed. The theoretical properties of the MBER spectrum for linear molecules are elaborated upon with special emphasis on line shape considerations. MBER spectra of OCS and ClF under a variety of conditions are presented and discussed in context to these predictions. There is some uncertainty expressed both in our own modeling and in the manner complex MBER spectra have been analyzed in the past. Finally, an electrostatic potential model is used to quantitatively describe the class of van der Waals molecules Ar-MX, where MX is an alkali halide. Energetics and equilibrium geometries are calculated. The validity of using an electrostatic model to predict van der Waals bond properties is critically discussed

  5. Laser isotope and isomer separations: History and trends

    International Nuclear Information System (INIS)

    Letok'ov, V.S.

    1990-01-01

    Paper will review history and principles of laser isotope and nuclear isomer separation: laser multistep photoionization of isotopic and isomeric atoms, laser IR-UV two-step photodissociation of molecules, laser IR multiphoton photodissociation of polyatomic molecules. The comparison and areas of applications of these methods will be considered. Paper will discuss a present state of art of technology of these methods in practical scale in various countries. In conclusion the trends of research in this field including applications of laser-separated isotopes and isomers will be considered

  6. Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra

    International Nuclear Information System (INIS)

    Le, Van-Hoang; Nguyen, Ngoc-Ty; Jin, C; Le, Anh-Thu; Lin, C D

    2008-01-01

    We illustrate an iterative method for retrieving the internuclear separations of N 2 , O 2 and CO 2 molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible

  7. Conductance mechanism in a linear non-conjugated trimethylsilyl-acetylene molecule: tunneling through localized states

    NARCIS (Netherlands)

    Petrov, E.G.; Marchenko, A.; Kapitanchuk, O.; Katsonis, Nathalie Hélène; Fichou, D.

    2014-01-01

    The conductance properties of 1,3-(trimethylsilyl)-1-tridecene-6,12-diyne, a non-conjugated trimethylsil-acetylene molecule have been investigated both experimentally and theoretically. Based on scanning tunnelling spectroscopy experiments, a discussion on the mechanisms controlling the charge

  8. Molecular-beam electric-resonance studies of linear triatomic molecules

    International Nuclear Information System (INIS)

    Reinartz, J.M.L.J.

    1976-01-01

    In the present work, the MBER technique has been employed to investigate the spectra of the high temperature species KCN and CsOH and at low temperatures the spectra of five different isotopic species of OCS in natural mixture and the most abundant isotopic species of N 2 O and ClCN. For the low temperature species, spectra in the ground state and in the first excited state of the bending mode have been obtained. Bending vibrational effects on hyperfine constants and on electric and magnetic constants have been deduced from these spectra. The introduction of nozzle beam sources has been a factor of great importance for this study. For the ground states, high resolution spectra have been obtained both in external electric and in combined parallel electric and magnetic fields. These spectra could well be explained by the known theories for molecules in a 1 Σ state to within an experimental accuracy of about 50-150 Hz. Extension of the theory needed for the interpretation of the spectra for excited bending states is given. Hyperfine properties and electric and magnetic constants have been obtained with very high accuracy from the analysis of the frequencies of the observed transitions within one rotational state (ΔJ = 0 transitions)

  9. Single-Molecule Imaging Reveals Topology Dependent Mutual Relaxation of Polymer Chains

    KAUST Repository

    Abadi, Maram; Serag, Maged F.; Habuchi, Satoshi

    2015-01-01

    The motion and relaxation of linear and cyclic polymers under entangled conditions are investigated by means of a newly developed single-molecule tracking technique, cumulative-area (CA) tracking. CA tracking enables simultaneous quantitative characterization of the diffusion mode, diffusion rate, and relaxation time that have been impossible with a widely used conventional single-molecule localization and tracking method, by analyzing cumulative areas occupied by the moving molecule. Using the novel approach, we investigate the motion and relaxation of entangled cyclic polymers, which have been an important but poorly understood question. Fluorescently labeled 42 kbp linear or cyclic tracer dsDNAs in concentrated solutions of unlabeled linear or cyclic DNAs are used as model systems. We show that CA tracking can explicitly distinguish topology-dependent diffusion mode, rate, and relaxation time, demonstrating that the method provides an invaluable tool for characterizing topological interaction between the entangled chains. We further demonstrate that the current models proposed for the entanglement between cyclic polymers which are based on cyclic chains moving through an array of fixed obstacles cannot correctly describe the motion of the cyclic chain under the entangled conditions. Our results rather suggest the mutual relaxation of the cyclic chains, which underscore the necessity of developing a new model to describe the motion of cyclic polymer under the entangled conditions based on the mutual interaction of the chains.

  10. Single-Molecule Imaging Reveals Topology Dependent Mutual Relaxation of Polymer Chains

    KAUST Repository

    Abadi, Maram

    2015-08-24

    The motion and relaxation of linear and cyclic polymers under entangled conditions are investigated by means of a newly developed single-molecule tracking technique, cumulative-area (CA) tracking. CA tracking enables simultaneous quantitative characterization of the diffusion mode, diffusion rate, and relaxation time that have been impossible with a widely used conventional single-molecule localization and tracking method, by analyzing cumulative areas occupied by the moving molecule. Using the novel approach, we investigate the motion and relaxation of entangled cyclic polymers, which have been an important but poorly understood question. Fluorescently labeled 42 kbp linear or cyclic tracer dsDNAs in concentrated solutions of unlabeled linear or cyclic DNAs are used as model systems. We show that CA tracking can explicitly distinguish topology-dependent diffusion mode, rate, and relaxation time, demonstrating that the method provides an invaluable tool for characterizing topological interaction between the entangled chains. We further demonstrate that the current models proposed for the entanglement between cyclic polymers which are based on cyclic chains moving through an array of fixed obstacles cannot correctly describe the motion of the cyclic chain under the entangled conditions. Our results rather suggest the mutual relaxation of the cyclic chains, which underscore the necessity of developing a new model to describe the motion of cyclic polymer under the entangled conditions based on the mutual interaction of the chains.

  11. Multiple ionization dynamics of molecules in intense laser fields

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2005-01-01

    A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)

  12. Controlling the branching ratio of photodissociation using aligned molecules

    DEFF Research Database (Denmark)

    Larsen, J.J.; Wendt-Larsen, I.; Stapelfeldt, H.

    1999-01-01

    Using a sample of iodine molecules, aligned by a strong, linearly polarized laser pulse, we control the branching ratio of the I+I and I+I* photodissociation channels by a factor of 26. The control relies on selective photoexcitation of two potential curves that each correlate adiabatically...

  13. Study of the In2O3 molecule in the free state and in the crystal

    Science.gov (United States)

    Kaplan, Ilya G.; Miranda, Ulises; Trakhtenberg, Leonid I.

    2018-03-01

    The nanomaterials based on the In2O3 molecule are widely used as catalysts and sensors among other applications. In the present study, we discuss the possibility of using nanoclusters of In2O3 as molecular photomotors. A comparative analysis of the electronic structure of the In2O3 molecule in the free state and in the crystal is performed. For the free In2O3 molecule the geometry of its lowest structures, V-shape and linear, was optimised at the CCSD(T) level, which is the most precise computational method applied up to date to study In2O3. Using experimental crystallographic data, we determined the geometry of In2O3 in the crystal. It has a zigzag, not symmetric structure and possesses a dipole moment with magnitude slightly smaller than that of the V-structure of the free molecule (the linear structure due to its symmetry has no dipole moment). According to the Natural Atomic population analysis, the chemical structure of the linear In2O3 can be represented as O = In-O-In = O; the V-shaped molecule has the similar double- and single-bond structure. The construction of nanoclusters from ´bricksʼ of In2O3 with geometry extracted from crystal (or nanoclusters extracted directly from crystal) and their use as photo-driven molecular motors are discussed.

  14. The dipole moments of the linear polycarbon monosulfides

    International Nuclear Information System (INIS)

    Murakami, Akinori

    1989-01-01

    The dipole moments of the linear polycarbon monosulfides, CS, C 2 S and C 3 S molecule (radical)s were calculated by ab initio SCF-CI method. The equilibrium geometries of the C n S molecules were obtained by MP3 method using the 6-31G** basis set. From the split balencetype (MIDI-4) to the Huzinaga's well tempered extended type(WT) were used to evaluate dipole moments. Final results were obtained using the WT+2d basis set and CI calculation. The calculated dipole moment of the CS molecule, 1.96 debye, is in good agreement with experimental one. The dipole moment of the C 2 S radical is calculated to be 2.81 debye and 3.66 debye for C 3 S molecule. The calculated dipole moments of the C n S will be accurate with in 0.1 debye(5%)

  15. Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra

    Energy Technology Data Exchange (ETDEWEB)

    Le, Van-Hoang; Nguyen, Ngoc-Ty [Department of Physics, University of Pedagogy, 280 An Duong Vuong, Ward 5, Ho Chi Minh City (Viet Nam); Jin, C; Le, Anh-Thu; Lin, C D [J. R. Macdonald Laboratory, Department of Physics, Kansas State University, Manhattan, KS 66506 (United States)

    2008-04-28

    We illustrate an iterative method for retrieving the internuclear separations of N{sub 2}, O{sub 2} and CO{sub 2} molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible.

  16. Effect of dipole polarizability on positron binding by strongly polar molecules

    International Nuclear Information System (INIS)

    Gribakin, G F; Swann, A R

    2015-01-01

    A model for positron binding to polar molecules is considered by combining the dipole potential outside the molecule with a strongly repulsive core of a given radius. Using existing experimental data on binding energies leads to unphysically small core radii for all of the molecules studied. This suggests that electron–positron correlations neglected in the simple model play a large role in determining the binding energy. We account for these by including the polarization potential via perturbation theory and non-perturbatively. The perturbative model makes reliable predictions of binding energies for a range of polar organic molecules and hydrogen cyanide. The model also agrees with the linear dependence of the binding energies on the polarizability inferred from the experimental data (Danielson et al 2009 J. Phys. B: At. Mol. Opt. Phys. 42 235203). The effective core radii, however, remain unphysically small for most molecules. Treating molecular polarization non-perturbatively leads to physically meaningful core radii for all of the molecules studied and enables even more accurate predictions of binding energies to be made for nearly all of the molecules considered. (paper)

  17. Zero-phonon-line emission of single molecules for applications in quantum information processing

    Science.gov (United States)

    Kiraz, Alper; Ehrl, M.; Mustecaplioglu, O. E.; Hellerer, T.; Brauchle, C.; Zumbusch, A.

    2005-07-01

    A single photon source which generates transform limited single photons is highly desirable for applications in quantum optics. Transform limited emission guarantees the indistinguishability of the emitted single photons. This, in turn brings groundbreaking applications in linear optics quantum information processing within an experimental reach. Recently, self-assembled InAs quantum dots and trapped atoms have successfully been demonstrated as such sources for highly indistinguishable single photons. Here, we demonstrate that nearly transform limited zero-phonon-line (ZPL) emission from single molecules can be obtained by using vibronic excitation. Furthermore we report the results of coincidence detection experiments at the output of a Michelson-type interferometer. These experiments reveal Hong-Ou-Mandel correlations as a proof of the indistinguishability of the single photons emitted consecutively from a single molecule. Therefore, single molecules constitute an attractive alternative to single InAs quantum dots and trapped atoms for applications in linear optics quantum information processing. Experiments were performed with a home-built confocal microscope keeping the sample in a superfluid liquid Helium bath at 1.4K. We investigated terrylenediimide (TDI) molecules highly diluted in hexadecane (Shpol'skii matrix). A continuous wave single mode dye laser was used for excitation of vibronic transitions of individual molecules. From the integral fluorescence, the ZPL of single molecules was selected with a spectrally narrow interference filter. The ZPL emission was then sent to a scanning Fabry-Perot interferometer for linewidth measurements or a Michelson-type interferometer for coincidence detection.

  18. Hydrated proton and hydroxide charge transfer at the liquid/vapor interface of water

    Energy Technology Data Exchange (ETDEWEB)

    Soniat, Marielle; Rick, Steven W., E-mail: srick@uno.edu [Department of Chemistry, University of New Orleans, New Orleans, Louisiana 70148 (United States); Kumar, Revati [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70808 (United States)

    2015-07-28

    The role of the solvated excess proton and hydroxide ions in interfacial properties is an interesting scientific question with applications in a variety of aqueous behaviors. The role that charge transfer (CT) plays in interfacial behavior is also an unsettled question. Quantum calculations are carried out on clusters of water with an excess proton or a missing proton (hydroxide) to determine their CT. The quantum results are applied to analysis of multi-state empirical valence bond trajectories. The polyatomic nature of the solvated excess proton and hydroxide ion results in directionally dependent CT, depending on whether a water molecule is a hydrogen bond donor or acceptor in relation to the ion. With polyatomic molecules, CT also depends on the intramolecular bond distances in addition to intermolecular distances. The hydrated proton and hydroxide affect water’s liquid/vapor interface in a manner similar to monatomic ions, in that they induce a hydrogen-bonding imbalance at the surface, which results in charged surface waters. This hydrogen bond imbalance, and thus the charged waters at the surface, persists until the ion is at least 10 Å away from the interface.

  19. Hydrated proton and hydroxide charge transfer at the liquid/vapor interface of water

    International Nuclear Information System (INIS)

    Soniat, Marielle; Rick, Steven W.; Kumar, Revati

    2015-01-01

    The role of the solvated excess proton and hydroxide ions in interfacial properties is an interesting scientific question with applications in a variety of aqueous behaviors. The role that charge transfer (CT) plays in interfacial behavior is also an unsettled question. Quantum calculations are carried out on clusters of water with an excess proton or a missing proton (hydroxide) to determine their CT. The quantum results are applied to analysis of multi-state empirical valence bond trajectories. The polyatomic nature of the solvated excess proton and hydroxide ion results in directionally dependent CT, depending on whether a water molecule is a hydrogen bond donor or acceptor in relation to the ion. With polyatomic molecules, CT also depends on the intramolecular bond distances in addition to intermolecular distances. The hydrated proton and hydroxide affect water’s liquid/vapor interface in a manner similar to monatomic ions, in that they induce a hydrogen-bonding imbalance at the surface, which results in charged surface waters. This hydrogen bond imbalance, and thus the charged waters at the surface, persists until the ion is at least 10 Å away from the interface

  20. Determination of local concentration of H2O molecules and gas temperature in the process of hydrogen – oxygen gas mixture heating by means of linear and nonlinear laser spectroscopy

    International Nuclear Information System (INIS)

    Kozlov, D N; Kobtsev, V D; Stel'makh, O M; Smirnov, Valery V; Stepanov, E V

    2013-01-01

    Employing the methods of linear absorption spectroscopy and nonlinear four-wave mixing spectroscopy using laserinduced gratings we have simultaneously measured the local concentrations of H 2 O molecules and the gas temperature in the process of the H 2 – O 2 mixture heating. During the measurements of the deactivation rates of pulsed-laser excited singlet oxygen O 2 (b 1 Σ + g ) in collisions with H 2 in the range 294 – 850 K, the joint use of the two methods made it possible to determine the degree of hydrogen oxidation at a given temperature. As the mixture is heated, H 2 O molecules are formed by 'dark' reactions of H 2 with O 2 in the ground state. The experiments have shown that the measurements of tunable diode laser radiation absorption along an optical path through the inhomogeneously heated gas mixture in a cell allows high-accuracy determination of the local H 2 O concentration in the O 2 laser excitation volume, if the gas temperature in this volume is known. When studying the collisional deactivation of O 2 (b 1 Σ + g ) molecules, the necessary measurements of the local temperature can be implemented using laser-induced gratings, arising due to spatially periodic excitation of O 2 (X 3 Σ - g ) molecules to the b 1 Σ + g state by radiation of the pump laser of the four-wave mixing spectrometer. (laser spectroscopy)

  1. Uni- and tridimensional alignment of molecules by femto-second laser pulse

    International Nuclear Information System (INIS)

    Rouzee, Arnaud

    2007-01-01

    This thesis is devoted to the study of the alignment of linear and asymmetric top molecules generated by an intense laser pulse. In the case of short pulses with respect to molecular rotation, periodic alignment appears in field-free conditions after the extinction of the field. We study theoretically and experimentally the effects of intensity, temperature and polarization of the electric field on produced alignment. If the field is linearly polarized, the interaction leads to the alignment of the most polarizable axis of the molecule. If the field is elliptically polarized, the pulse can generate a simultaneous alignment of the three principal axes of inertia of an asymmetric top molecule (3-D alignment). This alignment can be characterized experimentally using pump-probe techniques which exploit the optical properties of the medium. They require the use of a second pulse of low intensity temporally delayed. Three techniques were exploited during this thesis. The first technique measures a depolarization due to the birefringence of the medium when the molecules are aligned. The second is based on the defocusing of the pulse on a gradient of index created following the space variation of alignment with respect to the spatial profile of the field. The last involves the creation of a grading of index to the intersection of two intense pulses, which causes the diffraction of the probe. Finally, we show experimentally that the birefringence technique can be used to quantify the 3-D alignment of an asymmetric top molecule like ethylene. (author) [fr

  2. Single-molecule study on polymer diffusion in a melt state: Effect of chain topology

    KAUST Repository

    Habuchi, Satoshi

    2013-08-06

    We report a new methodology for studying diffusion of individual polymer chains in a melt state, with special emphasis on the effect of chain topology. A perylene diimide fluorophore was incorporated into the linear and cyclic poly(THF)s, and real-time diffusion behavior of individual chains in a melt of linear poly(THF) was measured by means of a single-molecule fluorescence imaging technique. The combination of mean squared displacement (MSD) and cumulative distribution function (CDF) analysis demonstrated the broad distribution of diffusion coefficient of both the linear and cyclic polymer chains in the melt state. This indicates the presence of spatiotemporal heterogeneity of the polymer diffusion which occurs at much larger time and length scales than those expected from the current polymer physics theory. We further demonstrated that the cyclic chains showed marginally slower diffusion in comparison with the linear counterparts, to suggest the effective suppression of the translocation through the threading-entanglement with the linear matrix chains. This coincides with the higher activation energy for the diffusion of the cyclic chains than of the linear chains. These results suggest that the single-molecule imaging technique provides a powerful tool to analyze complicated polymer dynamics and contributes to the molecular level understanding of the chain interaction. © 2013 American Chemical Society.

  3. Single-molecule study on polymer diffusion in a melt state: Effect of chain topology

    KAUST Repository

    Habuchi, Satoshi; Fujiwara, Susumu; Yamamoto, Takuya; Vá cha, Martin; Tezuka, Yasuyuki

    2013-01-01

    We report a new methodology for studying diffusion of individual polymer chains in a melt state, with special emphasis on the effect of chain topology. A perylene diimide fluorophore was incorporated into the linear and cyclic poly(THF)s, and real-time diffusion behavior of individual chains in a melt of linear poly(THF) was measured by means of a single-molecule fluorescence imaging technique. The combination of mean squared displacement (MSD) and cumulative distribution function (CDF) analysis demonstrated the broad distribution of diffusion coefficient of both the linear and cyclic polymer chains in the melt state. This indicates the presence of spatiotemporal heterogeneity of the polymer diffusion which occurs at much larger time and length scales than those expected from the current polymer physics theory. We further demonstrated that the cyclic chains showed marginally slower diffusion in comparison with the linear counterparts, to suggest the effective suppression of the translocation through the threading-entanglement with the linear matrix chains. This coincides with the higher activation energy for the diffusion of the cyclic chains than of the linear chains. These results suggest that the single-molecule imaging technique provides a powerful tool to analyze complicated polymer dynamics and contributes to the molecular level understanding of the chain interaction. © 2013 American Chemical Society.

  4. Photoelectron angular distributions from strong-field ionization of oriented molecules

    DEFF Research Database (Denmark)

    Holmegaard, Lotte; Hansen, Jonas Lerche; Kalhøj, Line

    2010-01-01

    The combination of ultrafast light sources with detection of molecular-frame photoelectron angular distributions (MFPADs) is setting new standards for detailed interrogation of molecular dynamics. However, until recently measurement of MFPADs relied on determining the molecular orientation after...... ionization, which is limited to species and processes where ionization leads to fragmentation. An alternative is to fix the molecular frame before ionization. The only demonstrations of such spatial orientation involved aligned small linear nonpolar molecules. Here we extend these techniques to the general...... class of polar molecules. Carbonylsulphide and benzonitrile molecules, fixed in space by combined laser and electrostatic fields, are ionized with intense, circularly polarized 30-fs laser pulses. For carbonylsulphide and benzonitrile oriented in one dimension, the MFPADs exhibit pronounced anisotropies...

  5. Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

    Science.gov (United States)

    Granger, Devin Benjamin

    Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and

  6. Electron collisions and rovibrational action spectroscopy of cold H3+ molecules

    International Nuclear Information System (INIS)

    Kreckel, H; Petrignani, A; Berg, M; Bing, D; Reinhardt, S; Altevogt, S; Buhr, H; Froese, M; Hoffmann, J; Jordon-Thaden, B; Krantz, C; Lestinsky, M; Mendes, M; Novotny, O; Novotny, S; Pedersen, H B; Orlov, D A; Mikosch, J; Wester, R; Plasil, R; GlosIk, J; Schwalm, D; Zajfman, D; Wolf, A

    2007-01-01

    Electron recombination of H 3 + has found a lot of attention due to its outstanding relevance for the chemistry of the interstellar medium (ISM) and its role as a benchmark for the treatment of dissociative recombination (DR) of polyatomic ions. We report DR measurements performed at the TSR storage ring utilizing a cryogenic ion trap injector. Furthermore, a chemical probing spectroscopy technique is described that allows for a very sensitive monitoring of the populated states inside the ion injector. Since H 3 + exists in two different nuclear spin modifications, a controlled manipulation of the ortho/para fraction is needed in order to perform state-selective measurements

  7. Some kinetic and spectroscopic evidence on intramolecular relaxation processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Quack, M.

    1983-01-01

    The description and definition of intramolecular vibrational relaxation processes is discussed within the framework of the quantum mechanical and statistical mechanical equations of motion. The evidence from quite different experimental sources is summarized under the common aspect of vibrational relaxation. Although much of the evidence remains ambiguous, there is good indication that a localized vibrational excitation relaxes typically in 0.1 to 10 picoseconds, which is long compared to many optical and reactive processes

  8. Photo absorption studies of polyatomic molecules using Indus 1 synchrotron radiation source

    International Nuclear Information System (INIS)

    Saraswathy, P.; Sunanda, K.; Aparna, S.; Rajashekar, B.N.; Das, N.C.

    2004-06-01

    The Photophysics beamline is a medium resolution beamline designed for carrying out photo absorption and fluorescence experiments using the synchrotron radiation source Indus-l. This beamline has been commissioned recently and is in operation. An experimental setup for gas phase absorption studies has been developed and installed. Absorption spectra of a few polyatomicmolecules viz. benzene, ammonia, carbon disulphide and acetone were recorded in the wavelength region 1500 -3000 A. The results from this study indicated the satisfactory performance of the beam line as well as the experimental setup. Details of the first set of absorption experiments carried out are discussed in this report. (author)

  9. Large Amplitude Motions in Polyatomic Molecule Spectra: Intramolecular Vibrational Redistribution and Isomerization

    National Research Council Canada - National Science Library

    Field, Robert

    1997-01-01

    Through Stimulated Emission Pumping (SEP) studies of highly excited vibrational levels of the electronic ground state of HCP, the spectroscopic signatures of bond breaking isomer/atom (HCP right arrow HPC...

  10. Metal atom oxidation laser

    International Nuclear Information System (INIS)

    Jensen, R.J.; Rice, W.W.; Beattie, W.H.

    1975-01-01

    A chemical laser which operates by formation of metal or carbon atoms and reaction of such atoms with a gaseous oxidizer in an optical resonant cavity is described. The lasing species are diatomic or polyatomic in nature and are readily produced by exchange or other abstraction reactions between the metal or carbon atoms and the oxidizer. The lasing molecules may be metal or carbon monohalides or monoxides

  11. Vibrational motion in a symmetric, double minimum potential

    DEFF Research Database (Denmark)

    Spanget-Larsen, Jens

    2015-01-01

    Molecular vibrational motion in a symmetric, double minimum potential is treated by means of a quartic model potential, by reference to the tables published by Jaan Laane and the results of harmonic analyses for the stationary points. The inversion vibration of ammonia is treated in detail. - Not...... on the harmonic approximation for polyatomic molecules are appended. - Presented at a NORFA Workshop in Hirtshals, Denmark, August 1997....

  12. Femtosecond photodissociation dynamics of I studied by ion imaging

    DEFF Research Database (Denmark)

    Larsen, J.J.; Bjerre, N.; Mørkbak, N.J.

    1998-01-01

    on imaging is employed to analyze the fragments from timed Coulomb explosion studies of femtosecond (fs) molecular dynamics. The technique provides high detection efficiency and direct recording of the two-dimensional velocity of all ionized fragments. We illustrate the approach by studying...... agreement with quantum mechanical wave packet simulations. We discuss the perspectives for extending the studies to photochemical reactions of small polyatomic molecules...

  13. Quantification of protein based on single-molecule counting by total internal reflection fluorescence microscopy with adsorption equilibrium

    International Nuclear Information System (INIS)

    Wang Lei; Xu Guang; Shi Zhikun; Jiang Wei; Jin Wenrui

    2007-01-01

    We developed a sensitive single-molecule imaging method for quantification of protein by total internal reflection fluorescence microscopy with adsorption equilibrium. In this method, the adsorption equilibrium of protein was achieved between solution and glass substrate. Then, fluorescence images of protein molecules in a evanescent wave field were taken by a highly sensitive electron multiplying charge coupled device. Finally, the number of fluorescent spots corresponding to the protein molecules in the images was counted. Alexa Fluor 488-labeled goat anti-rat IgG(H + L) was chosen as the model protein. The spot number showed an excellent linear relationship with protein concentration. The concentration linear range was 5.4 x 10 -11 to 8.1 x 10 -10 mol L -1

  14. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  15. Structures, Bonding, and Energetics of Potential Triatomic Circumstellar Molecules Containing Group 15 and 16 Elements.

    Science.gov (United States)

    Turner, Walter E; Agarwal, Jay; Schaefer, Henry F

    2015-12-03

    The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.

  16. Investigation into the behavior of metal-argon polyatomic ions (MAr+) in the extraction region of inductively coupled plasma-mass spectrometry

    International Nuclear Information System (INIS)

    Ebert, Chris H.; Witte, Travis M.; Houk, R.S.

    2012-01-01

    The abundances of metal-argon polyatomic ions (MAr + ) are determined in inductively coupled plasma-mass spectrometry (ICP-MS). The ratios of MAr + abundance to that for M + ions are measured experimentally. These ratios are compared to expected values, calculated for typical plasma conditions using spectroscopic data. For all metals studied (Ti, V, Cr, Mn, Fe, Co, Ni, Cu, and Zn), the measured ratios are significantly lower than the calculated ratios. Increasing the plasma potential (and thereby increasing the ion kinetic energy) by means of a homemade guard electrode with a wide gap further reduces the MAr + /M + ratio. Implementing a skimmer cone designed for high transmission of light ions increases the MAr + abundance. Considering this evidence, the scarcity of MAr + ions is attributed to collision induced dissociation (CID), likely due to a shock wave at the tip of or in the throat of the skimmer cone. - Highlights: ► MAr + ions are less abundant in the mass spectrum than expected from the ICP. ► Increasing the plasma potential reduces their abundance further. ► The extraction lens voltage does not greatly affect the MAr + abundances. ► The weakly-bound MAr + ions are probably dissociated by collisions during extraction.

  17. Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules

    Science.gov (United States)

    Deng, Y.; You, L.; Yi, S.

    2018-05-01

    An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.

  18. An improved theoretical value for Zsub(eff) for low-energy positron-hydrogen-molecule scattering

    International Nuclear Information System (INIS)

    Armour, E.A.G.; Baker, D.J.

    1986-01-01

    The value of Zsub(eff), the effective number of electrons per molecule available to the positron for annihilation, is calculated for low-energy positron-hydrogen-molecule scattering using a scattering wavefunction containing terms in which the positron-electron distance is included linearly as a factor. The results at very low energy are much closer to the experimental value than any that have been obtained previously. (author)

  19. Evaporation of Lennard-Jones fluids.

    Science.gov (United States)

    Cheng, Shengfeng; Lechman, Jeremy B; Plimpton, Steven J; Grest, Gary S

    2011-06-14

    Evaporation and condensation at a liquid/vapor interface are ubiquitous interphase mass and energy transfer phenomena that are still not well understood. We have carried out large scale molecular dynamics simulations of Lennard-Jones (LJ) fluids composed of monomers, dimers, or trimers to investigate these processes with molecular detail. For LJ monomers in contact with a vacuum, the evaporation rate is found to be very high with significant evaporative cooling and an accompanying density gradient in the liquid domain near the liquid/vapor interface. Increasing the chain length to just dimers significantly reduces the evaporation rate. We confirm that mechanical equilibrium plays a key role in determining the evaporation rate and the density and temperature profiles across the liquid/vapor interface. The velocity distributions of evaporated molecules and the evaporation and condensation coefficients are measured and compared to the predictions of an existing model based on kinetic theory of gases. Our results indicate that for both monatomic and polyatomic molecules, the evaporation and condensation coefficients are equal when systems are not far from equilibrium and smaller than one, and decrease with increasing temperature. For the same reduced temperature T/T(c), where T(c) is the critical temperature, these two coefficients are higher for LJ dimers and trimers than for monomers, in contrast to the traditional viewpoint that they are close to unity for monatomic molecules and decrease for polyatomic molecules. Furthermore, data for the two coefficients collapse onto a master curve when plotted against a translational length ratio between the liquid and vapor phase.

  20. A fitting program for potential energy surfaces of bent triatomic molecules

    International Nuclear Information System (INIS)

    Searles, D.J.; Nagy-Felsobuki, E.I. von

    1992-01-01

    A program has been developed in order to fit analytical power series expansions (Dunham, Simon-Parr-Finlan, Ogilvie and their exponential variants) and Pade approximants to discrete ab initio potential energy surfaces of non-linear triatomic molecules. The program employs standard least-squares fitting techniques using the singular decomposition method in order to dampen the higher-order coefficients (if deemed necessary) without significantly degrading the fit. The program makes full use of the symmetry of a triatomic molecule and so addresses the D 3h , C 2v and C S cases. (orig.)

  1. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. Single-Molecule Rotational Switch on a Dangling Bond Dimer Bearing.

    Science.gov (United States)

    Godlewski, Szymon; Kawai, Hiroyo; Kolmer, Marek; Zuzak, Rafał; Echavarren, Antonio M; Joachim, Christian; Szymonski, Marek; Saeys, Mark

    2016-09-27

    One of the key challenges in the construction of atomic-scale circuits and molecular machines is to design molecular rotors and switches by controlling the linear or rotational movement of a molecule while preserving its intrinsic electronic properties. Here, we demonstrate both the continuous rotational switching and the controlled step-by-step single switching of a trinaphthylene molecule adsorbed on a dangling bond dimer created on a hydrogen-passivated Ge(001):H surface. The molecular switch is on-surface assembled when the covalent bonds between the molecule and the dangling bond dimer are controllably broken, and the molecule is attached to the dimer by long-range van der Waals interactions. In this configuration, the molecule retains its intrinsic electronic properties, as confirmed by combined scanning tunneling microscopy/spectroscopy (STM/STS) measurements, density functional theory calculations, and advanced STM image calculations. Continuous switching of the molecule is initiated by vibronic excitations when the electrons are tunneling through the lowest unoccupied molecular orbital state of the molecule. The switching path is a combination of a sliding and rotation motion over the dangling bond dimer pivot. By carefully selecting the STM conditions, control over discrete single switching events is also achieved. Combined with the ability to create dangling bond dimers with atomic precision, the controlled rotational molecular switch is expected to be a crucial building block for more complex surface atomic-scale devices.

  3. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan

    2013-05-01

    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  4. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan

    2013-01-01

    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  5. Ultrafast molecular imaging by laser-induced electron diffraction

    International Nuclear Information System (INIS)

    Peters, M.; Nguyen-Dang, T. T.; Cornaggia, C.; Saugout, S.; Charron, E.; Keller, A.; Atabek, O.

    2011-01-01

    We address the feasibility of imaging geometric and orbital structures of a polyatomic molecule on an attosecond time scale using the laser-induced electron diffraction (LIED) technique. We present numerical results for the highest molecular orbitals of the CO 2 molecule excited by a near-infrared few-cycle laser pulse. The molecular geometry (bond lengths) is determined within 3% of accuracy from a diffraction pattern which also reflects the nodal properties of the initial molecular orbital. Robustness of the structure determination is discussed with respect to vibrational and rotational motions with a complete interpretation of the laser-induced mechanisms.

  6. Nonlinear vs. linear biasing in Trp-cage folding simulations

    Energy Technology Data Exchange (ETDEWEB)

    Spiwok, Vojtěch, E-mail: spiwokv@vscht.cz; Oborský, Pavel; Králová, Blanka [Department of Biochemistry and Microbiology, University of Chemistry and Technology, Prague, Technická 3, Prague 6 166 28 (Czech Republic); Pazúriková, Jana [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Křenek, Aleš [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Center CERIT-SC, Masaryk Univerzity, Šumavská 416/15, 602 00 Brno (Czech Republic)

    2015-03-21

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  7. Surface-enhanced resonance Raman scattering spectroscopy of single R6G molecules

    Institute of Scientific and Technical Information of China (English)

    Zhou Zeng-Hui; Liu Li; Wang Gui-Ying; Xu Zhi-Zhan

    2006-01-01

    Surface-enhanced resonance Raman scattering (SERRS) of Rhodamine 6G (R6G) adsorbed on colloidal silver clusters has been studied. Based on the great enhancement of the Raman signal and the quench of the fluorescence, the SERRS spectra of R6G were recorded for the samples of dye colloidal solution with different concentrations. Spectral inhomogeneity behaviours from single molecules in the dried sample films were observed with complementary evidences, such as spectral polarization, spectral diffusion, intensity fluctuation of vibrational lines and even "breathing" of the molecules. Sequential spectra observed from a liquid sample with an average of 0.3 dye molecules in the probed volume exhibited the expected Poisson distribution for actually measuring 0, 1 or 2 molecules. Difference between the SERRS spectra of R6G excited by linearly and circularly polarized light were experimentally measured.

  8. Linearly Polarized IR Spectroscopy Theory and Applications for Structural Analysis

    CERN Document Server

    Kolev, Tsonko

    2011-01-01

    A technique that is useful in the study of pharmaceutical products and biological molecules, polarization IR spectroscopy has undergone continuous development since it first emerged almost 100 years ago. Capturing the state of the science as it exists today, "Linearly Polarized IR Spectroscopy: Theory and Applications for Structural Analysis" demonstrates how the technique can be properly utilized to obtain important information about the structure and spectral properties of oriented compounds. The book starts with the theoretical basis of linear-dichroic infrared (IR-LD) spectroscop

  9. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  10. A variable hard sphere-based phenomenological inelastic collision model for rarefied gas flow simulations by the direct simulation Monte Carlo method

    Energy Technology Data Exchange (ETDEWEB)

    Prasanth, P S; Kakkassery, Jose K; Vijayakumar, R, E-mail: y3df07@nitc.ac.in, E-mail: josekkakkassery@nitc.ac.in, E-mail: vijay@nitc.ac.in [Department of Mechanical Engineering, National Institute of Technology Calicut, Kozhikode - 673 601, Kerala (India)

    2012-04-01

    A modified phenomenological model is constructed for the simulation of rarefied flows of polyatomic non-polar gas molecules by the direct simulation Monte Carlo (DSMC) method. This variable hard sphere-based model employs a constant rotational collision number, but all its collisions are inelastic in nature and at the same time the correct macroscopic relaxation rate is maintained. In equilibrium conditions, there is equi-partition of energy between the rotational and translational modes and it satisfies the principle of reciprocity or detailed balancing. The present model is applicable for moderate temperatures at which the molecules are in their vibrational ground state. For verification, the model is applied to the DSMC simulations of the translational and rotational energy distributions in nitrogen gas at equilibrium and the results are compared with their corresponding Maxwellian distributions. Next, the Couette flow, the temperature jump and the Rayleigh flow are simulated; the viscosity and thermal conductivity coefficients of nitrogen are numerically estimated and compared with experimentally measured values. The model is further applied to the simulation of the rotational relaxation of nitrogen through low- and high-Mach-number normal shock waves in a novel way. In all cases, the results are found to be in good agreement with theoretically expected and experimentally observed values. It is concluded that the inelastic collision of polyatomic molecules can be predicted well by employing the constructed variable hard sphere (VHS)-based collision model.

  11. Controlling translational motion of neutral molecules in inhomogeneous electric fields

    International Nuclear Information System (INIS)

    Yamakita, Yoshihiro

    2006-01-01

    Hydrogen molecules are excited to Rydberg states with n=16, 17 in the presence of inhomogeneous field of an electric dipole by a vacuum ultraviolet-ultraviolet double resonance scheme. The large dipole moment produced in Stark eigenstates leads to strong forces on the molecules in the inhomogeneous electric field. Deflection and deceleration are demonstrated for a pulsed supersonic beam containing the H 2 molecules in the n=16, 17, N + =2, M J =0 Rydberg states. The Rydberg states are found to survive for over 100 μs after the dipole field is switched off. The Rydberg states have a special stability with respect to decay by predissociation. Complete deceleration to the zero mean velocity is numerically demonstrated for H 2 molecules in the higher linear low-field-seeking n=16, M J =0 Rydberg states by using a symplectic integrator of the fourth order. The calculations show that the initial velocity of 900 ms -1 with translational temperature 1 K is decelerated to 0 ms -1 with 13 mK. (author)

  12. Novel linear polymers able to inhibit bacterial quorum sensing.

    Science.gov (United States)

    Cavaleiro, Eliana; Duarte, Ana Sofia; Esteves, Ana Cristina; Correia, António; Whitcombe, Michael J; Piletska, Elena V; Piletsky, Sergey A; Chianella, Iva

    2015-05-01

    Bacterial phenotypes, such as biofilm formation, antibiotic resistance and virulence expression, are associated with quorum sensing. Quorum sensing is a density-dependent regulatory system of gene expression controlled by specific signal molecules, such as N-acyl homoserine lactones (AHLs), produced and released by bacteria. This study reports the development of linear polymers capable to attenuate quorum sensing by adsorption of AHLs. Linear polymers were synthesized using MMA as backbone monomer and methacrylic acid and itaconic acid as functional monomers. Two different quorum sensing-controlled phenotypes, Vibrio fischeri bioluminescence and Aeromonas hydrophila biofilm formation, were evaluated to test the polymers' efficiency. Results showed that both phenotypes were significantly affected by the polymers, with the itaconic acid-containing material being more effective than the methacrylic acid one. The polymer inhibitory effects were reverted by the addition of lactones, confirming attenuation of quorum sensing through sequestration of signal molecules. The polymers also showed no cytotoxicity when tested using a mammalian cell line. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Single-molecule imaging reveals topological isomer-dependent diffusion by 4-armed star and dicyclic 8-shaped polymers

    KAUST Repository

    Habuchi, Satoshi

    2015-04-21

    Diffusion dynamics of topological isomers of polymer molecules was investigated at the single-molecule level in a melt state by employing the fluorophore-incorporated 4-armed star and the corresponding doubly-cyclized, 8-shaped poly(THF) chains. While the single-molecule fluorescence imaging experiment revealed that the diffusion of the 4-armed star polymer was described by a single Gaussian distribution, the diffusion of the 8-shaped polymer exhibited a double Gaussian distribution behaviour. We reasoned that the two 8-shaped polymeric isomers have distinct diffusion modes in the melt state, although ensemble-averaged experimental methods cannot detect differences in overall conformational state of the isomers. The single-molecule experiments suggested that one of the 8-shaped polymeric isomer, having the horizontally oriented form, causes an efficient threading with the linear matrix chains which leads to the slower diffusion compared with the corresponding 4-armed star polymer, while the other 8-shaped polymeric isomer, having the vertically oriented form, displayed faster diffusion by the suppression of effective threading with the linear matrix chains due to its contracted chain conformation.

  14. Magnetic field modification of ultracold molecule-molecule collisions

    International Nuclear Information System (INIS)

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

    2009-01-01

    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  15. Tunneling induced dark states and the controllable resonance fluorescence spectrum in quantum dot molecules

    International Nuclear Information System (INIS)

    Tian, Si-Cong; Tong, Cun-Zhu; Ning, Yong-Qiang; Qin, Li; Liu, Yun; Wan, Ren-Gang

    2014-01-01

    Optical spectroscopy, a powerful tool for probing and manipulating quantum dots (QDs), has been used to investigate the resonance fluorescence spectrum from linear triple quantum dot molecules controlled by tunneling, using atomic physics methods. Interesting features such as quenching and narrowing of the fluorescence are observed. In such molecules the tunneling between the quantum dots can also induce a dark state. The results are explained by the transition properties of the dressed states generated by the coupling of the laser and the tunneling. Unlike the atomic system, in such quantum dot molecules quantum coherence can be induced using tunneling, requiring no coupling lasers, which will allow tunneling controllable quantum dot molecules to be applied to quantum optics and photonics. (paper)

  16. Fast Arc-Annotated Subsequence Matching in Linear Space

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li

    2010-01-01

    is deleted any arc with an endpoint in that base is also deleted. Arc-annotated strings where the arcs are "nested" are a natural model of RNA molecules that captures both the primary and secondary structure of these. The arc-preserving subsequence problem for nested arc-annotated strings is basic primitive...... for investigating the function of RNA molecules. Gramm et al. [ACM Trans. Algorithms 2006] gave an algorithm for this problem using O(nm) time and space, where m and n are the lengths of P and Q, respectively. In this paper we present; a new algorithm using O(nm) time and O(n+m,) space, thereby matching...... the previous time bound while significantly reducing the space from a quadratic term to linear. This is essential to process large RNA molecules where the space is a likely to be a bottleneck. To obtain our result we introduce several novel ideas which may be of independent interest for related problems on arc...

  17. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  18. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  19. Tunnel current across linear homocatenated germanium chains

    International Nuclear Information System (INIS)

    Matsuura, Yukihito

    2014-01-01

    The electronic transport properties of germanium oligomers catenating into linear chains (linear Ge chains) have been theoretically studied using first principle methods. The conduction mechanism of a Ge chain sandwiched between gold electrodes was analyzed based on the density of states and the eigenstates of the molecule in a two-probe environment. Like that of silicon chains (Si chains), the highest occupied molecular orbital of Ge chains contains the extended σ-conjugation of Ge 4p orbitals at energy levels close to the Fermi level; this is in contrast to the electronic properties of linear carbon chains. Furthermore, the conductance of a Ge chain is expected to decrease exponentially with molecular length L. The decay constant β, which is defined as e −βL , of a Ge chain is similar to that of a Si chain, whereas the conductance of the Ge chains is higher than that of Si chains even though the Ge–Ge bond length is longer than the Si–Si bond length

  20. Non-linear osmosis

    Science.gov (United States)

    Diamond, Jared M.

    1966-01-01

    1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254

  1. Detecting high-density ultracold molecules using atom–molecule collision

    International Nuclear Information System (INIS)

    Chen, Jun-Ren; Kao, Cheng-Yang; Chen, Hung-Bin; Liu, Yi-Wei

    2013-01-01

    Utilizing single-photon photoassociation, we have achieved ultracold rubidium molecules with a high number density that provides a new efficient approach toward molecular quantum degeneracy. A new detection mechanism for ultracold molecules utilizing inelastic atom–molecule collision is demonstrated. The resonant coupling effect on the formation of the X 1 Σ + g ground state 85 Rb 2 allows for a sufficient number of more deeply bound ultracold molecules, which induced an additional trap loss and heating of the co-existing atoms owing to the inelastic atom–molecule collision. Therefore, after the photoassociation process, the ultracold molecules can be investigated using the absorption image of the ultracold rubidium atoms mixed with the molecules in a crossed optical dipole trap. The existence of the ultracold molecules was then verified, and the amount of accumulated molecules was measured. This method detects the final produced ultracold molecules, and hence is distinct from the conventional trap loss experiment, which is used to study the association resonance. It is composed of measurements of the time evolution of an atomic cloud and a decay model, by which the number density of the ultracold 85 Rb 2 molecules in the optical trap was estimated to be >5.2 × 10 11 cm −3 . (paper)

  2. Dependence of energy per molecule on sputtering yields with reactive gas cluster ions

    International Nuclear Information System (INIS)

    Toyoda, Noriaki; Yamada, Isao

    2010-01-01

    Gas cluster ions show dense energy deposition on a target surface, which result in the enhancement of chemical reactions. In reactive sputtering with gas cluster ions, the energy per atom or molecule plays an important role. In this study, the average cluster size (N, the number of atoms or molecules in a cluster ion) was controlled; thereby the dependences of the energy per molecule on the sputtering yields of carbon by CO 2 cluster ions and that of Si by SF 6 /Ar mixed gas cluster ions were investigated. Large CO 2 cluster ions with energy per molecule of 1 eV showed high reactive sputtering yield of an amorphous carbon film. However, these ions did not cause the formation of large craters on a graphite surface. It is possible to achieve very low damage etching by controlling the energy per molecule of reactive cluster ions. Further, in the case of SF 6 /Ar mixed cluster ions, it was found that reactive sputtering was enhanced when a small amount of SF 6 gas (∼10%) was mixed with Ar. The reactive sputtering yield of Si by one SF 6 molecule linearly increased with the energy per molecule.

  3. Giant Magnetoresistance in Carbon Nanotubes with Single-Molecule Magnets TbPc2.

    Science.gov (United States)

    Krainov, Igor V; Klier, Janina; Dmitriev, Alexander P; Klyatskaya, Svetlana; Ruben, Mario; Wernsdorfer, Wolfgang; Gornyi, Igor V

    2017-07-25

    We present experimental results and a theoretical model for the gate-controlled spin-valve effect in carbon nanotubes with side-attached single-molecule magnets TbPc 2 (Terbium(III) bis-phthalocyanine). These structures show a giant magnetoresistance up to 1000% in experiments on single-wall nanotubes that are tunnel-coupled to the leads. The proposed theoretical model combines the spin-dependent Fano effect with Coulomb blockade and predicts a spin-spin interaction between the TbPc 2 molecules, mediated by conducting electrons via the charging effect. This gate-tuned interaction is responsible for the stable magnetic ordering of the inner spins of the molecules in the absence of magnetic field. In the case of antiferromagnetic arrangement, electrons with either spin experience the scattering by the molecules, which results in blocking the linear transport. In strong magnetic fields, the Zeeman energy exceeds the effective antiferromagnetic coupling and one species of electrons is not scattered by molecules, which leads to a much lower total resistance at the resonant values of gate voltage, and hence to a supramolecular spin-valve effect.

  4. Fabrication of Low Noise Borosilicate Glass Nanopores for Single Molecule Sensing.

    Directory of Open Access Journals (Sweden)

    Jayesh A Bafna

    Full Text Available We show low-cost fabrication and characterization of borosilicate glass nanopores for single molecule sensing. Nanopores with diameters of ~100 nm were fabricated in borosilicate glass capillaries using laser assisted glass puller. We further achieve controlled reduction and nanometer-size control in pore diameter by sculpting them under constant electron beam exposure. We successfully fabricate pore diameters down to 6 nm. We next show electrical characterization and low-noise behavior of these borosilicate nanopores and compare their taper geometries. We show, for the first time, a comprehensive characterization of glass nanopore conductance across six-orders of magnitude (1M-1μM of salt conditions, highlighting the role of buffer conditions. Finally, we demonstrate single molecule sensing capabilities of these devices with real-time translocation experiments of individual λ-DNA molecules. We observe distinct current blockage signatures of linear as well as folded DNA molecules as they undergo voltage-driven translocation through the glass nanopores. We find increased signal to noise for single molecule detection for higher trans-nanopore driving voltages. We propose these nanopores will expand the realm of applications for nanopore platform.

  5. An Update on the Non-Mass-Dependent Isotope Fractionation under Thermal Gradient

    Science.gov (United States)

    Sun, Tao; Niles, Paul; Bao, Huiming; Socki, Richard; Liu, Yun

    2013-01-01

    Mass flow and compositional gradient (elemental and isotope separation) occurs when flu-id(s) or gas(es) in an enclosure is subjected to a thermal gradient, and the phenomenon is named thermal diffusion. Gas phase thermal diffusion has been theoretically and experimentally studied for more than a century, although there has not been a satisfactory theory to date. Nevertheless, for isotopic system, the Chapman-Enskog theory predicts that the mass difference is the only term in the thermal diffusion separation factors that differs one isotope pair to another,with the assumptions that the molecules are spherical and systematic (monoatomic-like structure) and the particle collision is elastic. Our previous report indicates factors may be playing a role because the Non-Mass Dependent (NMD) effect is found for both symmetric and asymmetric, linear and spherical polyatomic molecules over a wide range of temperature (-196C to +237C). The observed NMD phenomenon in the simple thermal-diffusion experiments demands quantitative validation and theoretical explanation. Besides the pressure and temperature dependency illustrated in our previous reports, efforts are made in this study to address issues such as the role of convection or molecular structure and whether it is a transient, non-equilibrium effect only.

  6. Nonsequential double ionization of D2 molecules with intense 20-fs pulses

    DEFF Research Database (Denmark)

    Sakai, H.; Larsen, J.J.; Wendt-Larsen, I.

    2003-01-01

    The kinetic-energy distribution of D+ fragments obtained from the ionization of D2 molecules with intense 20-fs pulses includes a high-energy component extending up to ˜10 eV. These fragments are only present for linearly, or slightly elliptically, polarized light. Both the maximum kinetic...

  7. Linear and nonlinear properties of chalcogenide glasses in the terahertz frequency

    DEFF Research Database (Denmark)

    Zalkovskij, Maksim; Malureanu, Radu; Popescu, A.

    2014-01-01

    Terahertz (THz) waves have the potential to improve a wide range of devices in the space, defense and semiconductor industries as well as offering the possibility of investigating various molecules of interest in biology, medicine, art etc. For this reason, THz sources, detectors and passive linear...

  8. Performance of the Linear Ion Trap Mass Spectrometer for the Mars Organic Molecule Analyzer (MOMA) Investigation on the 2018 Exomars Rover

    Science.gov (United States)

    Arevalo, Ricardo, Jr.; Brinckerhoff, William B.; Pinnick, Veronica T.; van Amerom, Friso H. W.; Danell, Ryan M.; Li, Xiang; Getty, Stephanie; Hovmand, Lars; Atanassova, Martina; Mahaffy, Paul R.; hide

    2014-01-01

    The 2018 ExoMars rover mission includes the Mars Organic Molecule Analyzer (MOMA) investigation. MOMA will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from degradation derived from cosmic radiation and/or oxidative chemical reactions. When combined with the complement of instruments in the rover's Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds. The MOMA investigation is led by the Max Planck Institute for Solar System Research (MPS) with the mass spectrometer subsystem provided by NASA GSFC. MOMA's linear ion trap mass spectrometer (ITMS) is designed to analyze molecular composition of: (i) gas evolved from pyrolyzed powder samples and separated in a gas chromatograph; and, (ii) ions directly desorbed from crushed solid samples at Mars ambient pressure, as enabled by a pulsed UV laser system, fast-actuating aperture valve and capillary ion inlet. Breadboard ITMS and associated electronics have been advanced to high end-to-end fidelity in preparation for flight hardware delivery to Germany in 2015.

  9. A study on the electro-oxidation and electropolymerization of a new OPE linear molecule by EQCM and in situ FTIR spectroelectrochemistry

    International Nuclear Information System (INIS)

    Luo Jiao; Liu Meiling; Zhao Qiangqin; Zhao Jie; Zhang Youyu; Tan Liang; Tang Hao; Xie Qingji; Li Haitao; Yao Shouzhuo

    2010-01-01

    A novel symmetric conjugated oligo(phenylene-ethynylene) (OPE) linear molecule (1,4-bis(4-aminophenylethynyl)benzene); BAB) was synthesized by Sonogashira cross-coupling reactions. The structure and purity of the compound were confirmed by 1 H NMR, 13 C NMR and infrared (IR) and mass spectrometry (MS). The electrochemical oxidation process and mechanism of BAB were investigated via in situ Fourier transform infrared (FTIR) spectroelectrochemistry and electrochemical quartz crystal microbalance (EQCM). The electrochemical oxidation mechanism of BAB was proposed. The studies revealed that the BAB concentration and oxidation potential had a significant influence on the growth of the polymer film. A densely packed polymer film, which exhibited nonelectroactivity, was formed when a high monomer concentration and a high oxidation potential were used. When the electropolymerization of BAB was conducted at a lower concentration, a new pair of redox peaks appeared, and the resultant thin film had better electroactivity. The in situ FTIR studies confirmed that BAB could be electro-oxidized into radical cations and then electropolymerized via para (N-N) and/or ortho (N-C) coupling reactions to form polymers with a larger conjugated π-electron system. The surface morphology of the poly-BAB was also investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM).

  10. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  11. A systematic investigation of differential effects of cell culture substrates on the extent of artifacts in single-molecule tracking.

    Directory of Open Access Journals (Sweden)

    Laura C Zanetti-Domingues

    Full Text Available Single-molecule techniques are being increasingly applied to biomedical investigation, notwithstanding the numerous challenges they pose in terms of signal-to-noise ratio issues. Non-specific binding of probes to glass substrates, in particular, can produce experimental artifacts due to spurious molecules on glass, which can be particularly deleterious in live-cell tracking experiments. In order to resolve the issue of non-specific probe binding to substrates, we performed systematic testing of a range of available surface coatings, using three different proteins, and then extended our assessment to the ability of these coatings to foster cell growth and retain non-adhesive properties. Linear PEG, a passivating agent commonly used both in immobilized-molecule single-molecule techniques and in tissue engineering, is able to both successfully repel non-specific adhesion of fluorescent probes and to foster cell growth when functionalized with appropriate adhesive peptides. Linear PEG treatment results in a significant reduction of tracking artifacts in EGFR tracking with Affibody ligands on a cell line expressing EGFR-eGFP. The findings reported herein could be beneficial to a large number of experimental situations where single-molecule or single-particle precision is required.

  12. Rydberg excitation of neutral nitric oxide molecules in strong UV and near-IR laser fields

    International Nuclear Information System (INIS)

    Lv Hang; Zhang Jun-Feng; Zuo Wan-Long; Xu Hai-Feng; Jin Ming-Xing; Ding Da-Jun

    2015-01-01

    Rydberg state excitations of neutral nitric oxide molecules are studied in strong ultraviolet (UV) and near-infra-red (IR) laser fields using a linear time-of-flight (TOF) mass spectrometer with the pulsed electronic field ionization method. The yield of Rydberg molecules is measured as a function of laser intensity and ellipticity, and the results in UV laser fields are compared with those in near-IR laser fields. The present study provides the first experimental evidence of neutral Rydberg molecules surviving in a strong laser field. The results indicate that a rescattering-after-tunneling process is the main contribution to the formation of Rydberg molecules in strong near-IR laser fields, while multi-photon excitation may play an important role in the strong UV laser fields. (paper)

  13. Fluorescence single-molecule counting assays for protein quantification using epi-fluorescence microscopy with quantum dots labeling

    International Nuclear Information System (INIS)

    Jiang Dafeng; Liu Chunxia; Wang Lei; Jiang Wei

    2010-01-01

    A single-molecule counting approach for quantifying the antibody affixed to a surface using quantum dots and epi-fluorescence microscopy is presented. Modifying the glass substrates with carboxyl groups provides a hydrophilic surface that reacts with amine groups of an antibody to allow covalent immobilization of the antibody. Nonspecific adsorption of single molecules on the modified surfaces was first investigated. Then, quantum dots were employed to form complexes with surface-immobilized antibody molecules and used as fluorescent probes for single-molecule imaging. Epi-fluorescence microscopy was chosen as the tool for single-molecule fluorescence detection here. The generated fluorescence signals were taken by an electron multiplying charge-coupled device and were found to be proportional to the sample concentrations. Under optimal conditions, a linear response range of 5.0 x 10 -14 -3.0 x 10 -12 mol L -1 was obtained between the number of single molecules and sample concentration via a single-molecule counting approach.

  14. Reversible Guest Exchange Mechanisms in Supramolecular Host-GuestAssemblies

    Energy Technology Data Exchange (ETDEWEB)

    Pluth, Michael D.; Raymond, Kenneth N.

    2006-09-01

    Synthetic chemists have provided a wide array of supramolecular assemblies able to encapsulate guest molecules. The scope of this tutorial review focuses on supramolecular host molecules capable of reversibly encapsulating polyatomic guests. Much work has been done to determine the mechanism of guest encapsulation and guest release. This review covers common methods of monitoring and characterizing guest exchange such as NMR, UV-VIS, mass spectroscopy, electrochemistry, and calorimetry and also presents representative examples of guest exchange mechanisms. The guest exchange mechanisms of hemicarcerands, cucurbiturils, hydrogen-bonded assemblies, and metal-ligand assemblies are discussed. Special attention is given to systems which exhibit constrictive binding, a motif common in supramolecular guest exchange systems.

  15. On the local theory of resonant inelastic collisions of slow electrons with carbon dioxide

    International Nuclear Information System (INIS)

    Kazansky, A.K.; Sergeeva, L.Yu.

    1994-01-01

    A method of calculating the cross sections of inelastic vibronic transitions in collisions of slow electrons with polyatomic molecules in the framework of the local theory (the 'boomerang' model) is proposed. The method is based on the study of the time evolution of the initial vibronic wavefunction; the evolution is governed by the (complex valued) Hamiltonian of the intermediate anion state. The method has been applied to the consideration of inelastic electron collisions with the CO 2 molecule in the two-mode approximation (symmetrical stretching and bending). The results obtained demonstrate the importance of the two-mode description for the system which can undergo the Renner transition. (Author)

  16. Checking the foundation: recent radiobiology and the linear no-threshold theory.

    Science.gov (United States)

    Ulsh, Brant A

    2010-12-01

    The linear no-threshold (LNT) theory has been adopted as the foundation of radiation protection standards and risk estimation for several decades. The "microdosimetric argument" has been offered in support of the LNT theory. This argument postulates that energy is deposited in critical cellular targets by radiation in a linear fashion across all doses down to zero, and that this in turn implies a linear relationship between dose and biological effect across all doses. This paper examines whether the microdosimetric argument holds at the lowest levels of biological organization following low dose, low dose-rate exposures to ionizing radiation. The assumptions of the microdosimetric argument are evaluated in light of recent radiobiological studies on radiation damage in biological molecules and cellular and tissue level responses to radiation damage. There is strong evidence that radiation initially deposits energy in biological molecules (e.g., DNA) in a linear fashion, and that this energy deposition results in various forms of prompt DNA damage that may be produced in a pattern that is distinct from endogenous (e.g., oxidative) damage. However, a large and rapidly growing body of radiobiological evidence indicates that cell and tissue level responses to this damage, particularly at low doses and/or dose-rates, are nonlinear and may exhibit thresholds. To the extent that responses observed at lower levels of biological organization in vitro are predictive of carcinogenesis observed in vivo, this evidence directly contradicts the assumptions upon which the microdosimetric argument is based.

  17. Astronomical chemistry.

    Science.gov (United States)

    Klemperer, William

    2011-01-01

    The discovery of polar polyatomic molecules in higher-density regions of the interstellar medium by means of their rotational emission detected by radioastronomy has changed our conception of the universe from essentially atomic to highly molecular. We discuss models for molecule formation, emphasizing the general lack of thermodynamic equilibrium. Detailed chemical kinetics is needed to understand molecule formation as well as destruction. Ion molecule reactions appear to be an important class for the generally low temperatures of the interstellar medium. The need for the intrinsically high-quality factor of rotational transitions to definitively pin down molecular emitters has been well established by radioastronomy. The observation of abundant molecular ions both positive and, as recently observed, negative provides benchmarks for chemical kinetic schemes. Of considerable importance in guiding our understanding of astronomical chemistry is the fact that the larger molecules (with more than five atoms) are all organic.

  18. Investigation into interaction of CO/sub 2/ molecules with zeolites by infrared spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ignat' eva, L A; Levshin, L V; Chukin, G D; Efimenko, L V; Kozlova, T I [Moskovskij Gosudarstvennyj Univ. (USSR). Kafedra Optiki

    1975-07-01

    Interaction of CO/sub 2/ molecules with zeolites, particularly with SrNaJ was studied by infrared-spectroscopy. To obtain infrared-spectra the zeolites were pressed into tablets and were calcinated at 500 deg. In the spectra the bands of chemisorbed CO/sub 2/ absorption were found in the range 1300 - 1600 cm/sup -1/. The CO/sub 2/ molecule was found to be strongly deformed due to chemisorption. In terms of electronic structure of the zeolite crystalline skeleton several types of CO/sub 2/ molecules interaction with different active zeolites were found. The position of the high-frequency band of CO/sub 2/ absorption in zeolites spectra was found to be a linear function of electrostatic field of the cations.

  19. QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-10-01

    Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

  20. Polarization dependent effects in photo-fragmentation dynamics of free molecules

    International Nuclear Information System (INIS)

    Mocellin, A.; Marinho, R.R.T.; Coutinho, L.H.; Burmeister, F.; Wiesner, K.; Naves de Brito, A.

    2003-01-01

    We present multicoincidence spectra of nitrogen, formic acid and methyl methacrylate. We demonstrate how to probe the local symmetry of molecular orbitals from molecules core excited with linearly polarized synchrotron radiation. The intensity distribution of the photoelectron photo-ion photo-ion coincidence (PEPIPICO) spectrum reflects the selectivity and localization of core excitation by polarized light. By simulating the spectra the angular dependence of the fragmentation is determined

  1. Polarization dependent effects in photo-fragmentation dynamics of free molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mocellin, A.; Marinho, R.R.T.; Coutinho, L.H.; Burmeister, F.; Wiesner, K.; Naves de Brito, A

    2003-04-01

    We present multicoincidence spectra of nitrogen, formic acid and methyl methacrylate. We demonstrate how to probe the local symmetry of molecular orbitals from molecules core excited with linearly polarized synchrotron radiation. The intensity distribution of the photoelectron photo-ion photo-ion coincidence (PEPIPICO) spectrum reflects the selectivity and localization of core excitation by polarized light. By simulating the spectra the angular dependence of the fragmentation is determined.

  2. Growing interstellar molecules with ion-molecule reactions

    International Nuclear Information System (INIS)

    Bohme, D.K.

    1989-01-01

    Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

  3. Inducing elliptically polarized high-order harmonics from aligned molecules with linearly polarized femtosecond pulses

    DEFF Research Database (Denmark)

    Etches, Adam; Madsen, Christian Bruun; Madsen, Lars Bojer

    2010-01-01

    A recent paper reported elliptically polarized high-order harmonics from aligned N2 using a linearly polarized driving field [X. Zhou et al., Phys. Rev. Lett. 102, 073902 (2009)]. This observation cannot be explained in the standard treatment of the Lewenstein model and has been ascribed to many...

  4. Permanent and induced dipole requirements in ab initio calculations of electron affinities of polar molecules

    International Nuclear Information System (INIS)

    Garrett, W.R.

    1979-01-01

    Through the use of a molecular pseudopotential method, we determine the a approximate magnitudes of errors that result when electron affinity determinations of polar negative ions are made through ab initio calculations in which the use of a given basis set yields inappropriate values for permanent and induced dipole moments of the neutral molecule. These results should prove useful in assessing the adequacy of basis sets in ab initio calculations of molecular electron affinities for simple linear polar molecules

  5. Influence of sulfur-bearing polyatomic species on high precision measurements of Cu isotopic composition

    Science.gov (United States)

    Pribil, M.J.; Wanty, R.B.; Ridley, W.I.; Borrok, D.M.

    2010-01-01

    An increased interest in high precision Cu isotope ratio measurements using multi-collector inductively coupled plasma mass spectrometry (MC-ICP-MS) has developed recently for various natural geologic systems and environmental applications, these typically contain high concentrations of sulfur, particularly in the form of sulfate (SO42-) and sulfide (S). For example, Cu, Fe, and Zn concentrations in acid mine drainage (AMD) can range from 100??g/L to greater than 50mg/L with sulfur species concentrations reaching greater than 1000mg/L. Routine separation of Cu, Fe and Zn from AMD, Cu-sulfide minerals and other geological matrices usually incorporates single anion exchange resin column chromatography for metal separation. During chromatographic separation, variable breakthrough of SO42- during anion exchange resin column chromatography into the Cu fractions was observed as a function of the initial sulfur to Cu ratio, column properties, and the sample matrix. SO42- present in the Cu fraction can form a polyatomic 32S-14N-16O-1H species causing a direct mass interference with 63Cu and producing artificially light ??65Cu values. Here we report the extent of the mass interference caused by SO42- breakthrough when measuring ??65Cu on natural samples and NIST SRM 976 Cu isotope spiked with SO42- after both single anion column chromatography and double anion column chromatography. A set of five 100??g/L Cu SRM 976 samples spiked with 500mg/L SO42- resulted in an average ??65Cu of -3.50?????5.42??? following single anion column separation with variable SO42- breakthrough but an average concentration of 770??g/L. Following double anion column separation, the average SO42-concentration of 13??g/L resulted in better precision and accuracy for the measured ??65Cu value of 0.01?????0.02??? relative to the expected 0??? for SRM 976. We conclude that attention to SO42- breakthrough on sulfur-rich samples is necessary for accurate and precise measurements of ??65Cu and may require

  6. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  7. Adsorption of polar organic molecules on sediments: Case-study on Callovian-Oxfordian claystone.

    Science.gov (United States)

    Rasamimanana, S; Lefèvre, G; Dagnelie, R V H

    2017-08-01

    The release and transport of anthropogenic organic matter through the geosphere is often an environmental criterion of safety. Sedimentary rocks are widely studied in this context as geological barriers for waste management. It is the case of Callovian-Oxfordian claystone (COx), for which several studies report adsorption of anthropogenic organic molecules. In this study, we evaluated and reviewed adsorption data of polar organic molecules on COx claystone. Experiments were performed on raw claystone, decarbonated and clay fractions. Adsorption isotherms were measured with adsorbates of various polarities: adipate, benzoate, ortho-phthalate, succinate, gluconate, oxalate, EDTA, citrate. A significant adsorption was observed for multidentate polycarboxylic acids as evidenced with phthalate, succinate, oxalate, gluconate, EDTA and citrate (R d  = 1.53, 3.52, 8.4, 8.8, 12.4, 54.7 L kg -1 respectively). Multiple linear regression were performed as a statistical analysis to determine the predictors from these adsorption data. A linear correlation between adsorption data (R d ) and dipole moment (μ) of adsorbates was evidenced (R 2  = 0.91). Molecules with a high dipole moment, μ(D) > 2.5, displayed a significant adsorption, R d ≫1 L kg -1 . A qualitative correlation can be easily estimated using the water/octanol partition coefficient, P ow , of adsorbates (R 2  = 0.77). In this case, two opposite trends were distinguished for polar and apolar molecules. The use of organic carbon content in sediments is relevant for predicting adsorption of apolar compounds, log (P ow )>+1. The oxides/clays contents may be relevant regarding polar molecules, log ( apparent P ow )<-1. The proposed scheme offers a general methodology for investigation of geo-barriers towards heterogeneous organic plumes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. In Situ Detection of Organic Molecules on the Martian Surface With the Mars Organic Molecule Analyzer (MOMA) on Exomars 2018

    Science.gov (United States)

    Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.

    2015-01-01

    The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.

  9. Analytic Morse/long-range potential energy surfaces and "adiabatic-hindered-rotor" treatment for a symmetric top-linear molecule dimer: A case study of CH3F-H2

    Science.gov (United States)

    Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui

    2018-03-01

    A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.

  10. Ground state of a hydrogen ion molecule immersed in an inhomogeneous electron gas

    International Nuclear Information System (INIS)

    Diaz-Valdes, J.; Gutierrez, F.A.; Matamala, A.R.; Denton, C.D.; Vargas, P.; Valdes, J.E.

    2007-01-01

    In this work we have calculated the ground state energy of the hydrogen molecule, H 2 + , immersed in the highly inhomogeneous electron gas around a metallic surface within the local density approximation. The molecule is perturbed by the electron density of a crystalline surface of Au with the internuclear axis parallel to the surface. The surface spatial electron density is calculated through a linearized band structure method (LMTO-DFT). The ground state of the molecule-ion was calculated using the Born-Oppenheimer approximation for a fixed-ion while the screening effects of the inhomogeneous electron gas are depicted by a Thomas-Fermi like electrostatic potential. We found that within our model the molecular ion dissociates at the critical distance of 2.35a.u. from the first atomic layer of the solid

  11. Thermally induced charge current through long molecules

    Science.gov (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Investigating organic molecules responsible of auxin-like activity of humic acid fraction extracted from vermicompost

    Energy Technology Data Exchange (ETDEWEB)

    Scaglia, Barbara, E-mail: barbara.scaglia@unimi.it [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy); Nunes, Ramom Rachide; Rezende, Maria Olímpia Oliveira [Laboratório de Química Ambiental, Universidade de São Paulo, Instituto de Química de São Carlos, Avenida Trabalhador São Carlense, 400, São Carlos (Brazil); Tambone, Fulvia [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy); Adani, Fabrizio, E-mail: fabrizio.adani@unimi.it [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy)

    2016-08-15

    This work studied the auxin-like activity of humic acids (HA) obtained from vermicomposts produced using leather wastes plus cattle dung at different maturation stages (fresh, stable and mature). Bioassays were performed by testing HA concentrations in the range of 100–6000 mg carbon L{sup −1}. {sup 13}C CPMAS-NMR and GC–MS instrumental methods were used to assess the effect of biological processes and starting organic mixtures on HA composition. Not all HAs showed IAA-like activity and in general, IAA-like activity increased with the length of the vermicomposting process. The presence of leather wastes was not necessary to produce the auxin-like activity of HA, since HA extracted from a mix of cattle manure and sawdust, where no leather waste was added, showed IAA-like activity as well. CPMAS {sup 13}CNMR revealed that HAs were similar independently of the mix used and that the humification process involved the increasing concentration of pre-existing alkali soluble fractions in the biomass. GC/MS allowed the identification of the molecules involved in IAA-like effects: carboxylic acids and amino acids. The concentration of active molecules, rather than their simple presence in HA, determined the bio-stimulating effect, and a good linear regression between auxin-like activity and active stimulating molecules concentration was found (R{sup 2} = − 0.85; p < 0.01, n = 6). - Highlights: • Vermicomposting converts waste into organic fertilizer. • Vermicomposts can have biostimulating effect for the presence of hormone-like molecules. • Auxine-like activity was associated to the vermicompost humic acid fraction (HA). • HA carboxylic acids and amino acids, were reported to act as auxin-like molecules. • A linear regression was found between molecules and auxin-like activity.

  14. Polarization effects on the electric properties of urea and thiourea molecules in solid phase

    International Nuclear Information System (INIS)

    Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.

    2015-01-01

    We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal

  15. Calculating constants of the rates of the reactions of excitation, ionization, and atomic exchange: A model of a shock oscillator with a change of the Hamiltonian of the system

    Science.gov (United States)

    Tsyganov, D. L.

    2017-11-01

    A new model for calculating the rates of reactions of excitation, ionization, and atomic exchange is proposed. Diatomic molecule AB is an unstructured particle M upon the exchange of elastic-vibrational (VT) energy, i.e., a model of a shock forceful oscillator with a change in Hamiltonian (SFOH). The SFOH model is based on the quantum theory of strong perturbations. The SFOH model allows generalization in simulating the rates of the reactions of excitation, ionization, and atomic exchange in the vibrational-vibrational (VV) energy exchange of diatomic molecules, and the exchange of VV- and VT-energy of polyatomic molecules. The rate constants of the excitation of metastables A 3Σ u +, B 3Π g , W 3Δ u , B'3Σ u -, a'3Σ u -, and the ionization of a nitrogen molecules from ground state X2Σ g + upon a collision with a heavy structureless particle (a nitrogen molecule), are found as examples.

  16. Time-dependent local-to-normal mode transition in triatomic molecules

    Science.gov (United States)

    Cruz, Hans; Bermúdez-Montaña, Marisol; Lemus, Renato

    2018-01-01

    Time-evolution of the vibrational states of two interacting harmonic oscillators in the local mode scheme is presented. A local-to-normal mode transition (LNT) is identified and studied from temporal perspective through time-dependent frequencies of the oscillators. The LNT is established as a polyad-breaking phenomenon from the local standpoint for the stretching degrees of freedom in a triatomic molecule. This study is carried out in the algebraic representation of bosonic operators. The dynamics of the states are determined via the solutions of the corresponding nonlinear Ermakov equation and a local time-dependent polyad is obtained as a tool to identify the LNT. Applications of this formalism to H2O, CO2, O3 and NO2 molecules in the adiabatic, sudden and linear regime are considered.

  17. Applications of a simple dynamical model to the reaction path Hamiltonian: tunneling corrections to rate constants, product state distributions, line widths of local mode overtones, and mode specificity in unimolecular decomposition

    International Nuclear Information System (INIS)

    Cerjan, C.J.; Shi, S.; Miller, W.H.

    1982-01-01

    A simple but often reasonably accurate dynamical model--a synthesis of the semiclassical perturbation (SCP) approximation of Miller and Smith and the infinite order sudden (IOS) approximation--has been shown previously to take an exceptionally simple form when applied to the reaction path Hamiltonian derived by Miller, Handy, and Adams. This paper shows how this combined SCP-IOS reaction path model can be used to provide a simple but comprehensive description of a variety of phenomena in the dynamics of polyatomic molecules

  18. Alignment of symmetric top molecules by short laser pulses

    DEFF Research Database (Denmark)

    Hamilton, Edward; Seideman, Tamar; Ejdrup, Tine

    2005-01-01

    -resolved photofragment imaging. Using methyliodide and tert-butyliodide as examples, we calculate and measure the alignment dynamics, focusing on the temporal structure and intensity of the revival patterns, including their dependence on the pulse duration, and their behavior at long times, where centrifugal distortion......Nonadiabatic alignment of symmetric top molecules induced by a linearly polarized, moderately intense picosecond laser pulse is studied theoretically and experimentally. Our studies are based on the combination of a nonperturbative solution of the Schrodinger equation with femtosecond time...

  19. Active liquid/liquid interfaces: contributions of non linear optics and tensiometry

    International Nuclear Information System (INIS)

    Gassin, P.M.

    2013-01-01

    Liquid-liquid extraction processes are widely used in the industrial fields of selective separation. Despite its numerous applications, the microscopic mechanisms which occur during a liquid-liquid extraction processes are really unknown specially at the liquid/liquid interface. Thus, this work deals on the understanding of the phenomena which drive the mass transfer across a liquid/liquid interface. Two experimental techniques were used in this work: dynamic interfacial tension measurement and non-linear optical experiments. Along with the use of this experimental approach, a numerical model describing the mass transfer dynamic has been developed. This model works under the assumption that both diffusion and a chemical step describing adsorption and desorption processes contribute to the global transfer kinetics. Model systems of surfactant molecules, chromophore molecules and complexing molecule were investigated at liquid/liquid and air/liquid interface. Interfacial phenomena like adsorption, surface aggregation and ion complexing were studied. Finally, the methodology developed in this work was applied to studied an extractant molecule with potential industrial application. (author) [fr

  20. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  1. Global bending quantum number and the absence of monodromy in the HCN-CNH molecule

    NARCIS (Netherlands)

    Efstathiou, K; Joyeux, M; Sadovskií, D. A.

    We introduce and analyze a model system based on a deformation of a spherical pendulum that can be used to reproduce large amplitude bending vibrations of flexible triatomic molecules with two stable linear equilibria. On the basis of our model and the recent vibrational potential [ J. Chem. Phys.

  2. Spectral properties of minimal-basis-set orbitals: Implications for molecular electronic continuum states

    Science.gov (United States)

    Langhoff, P. W.; Winstead, C. L.

    Early studies of the electronically excited states of molecules by John A. Pople and coworkers employing ab initio single-excitation configuration interaction (SECI) calculations helped to simulate related applications of these methods to the partial-channel photoionization cross sections of polyatomic molecules. The Gaussian representations of molecular orbitals adopted by Pople and coworkers can describe SECI continuum states when sufficiently large basis sets are employed. Minimal-basis virtual Fock orbitals stabilized in the continuous portions of such SECI spectra are generally associated with strong photoionization resonances. The spectral attributes of these resonance orbitals are illustrated here by revisiting previously reported experimental and theoretical studies of molecular formaldehyde (H2CO) in combination with recently calculated continuum orbital amplitudes.

  3. LINEAR2007, Linear-Linear Interpolation of ENDF Format Cross-Sections

    International Nuclear Information System (INIS)

    2007-01-01

    1 - Description of program or function: LINEAR converts evaluated cross sections in the ENDF/B format into a tabular form that is subject to linear-linear interpolation in energy and cross section. The code also thins tables of cross sections already in that form. Codes used subsequently need thus to consider only linear-linear data. IAEA1311/15: This version include the updates up to January 30, 2007. Changes in ENDF/B-VII Format and procedures, as well as the evaluations themselves, make it impossible for versions of the ENDF/B pre-processing codes earlier than PREPRO 2007 (2007 Version) to accurately process current ENDF/B-VII evaluations. The present code can handle all existing ENDF/B-VI evaluations through release 8, which will be the last release of ENDF/B-VI. Modifications from previous versions: - Linear VERS. 2007-1 (JAN. 2007): checked against all ENDF/B-VII; increased page size from 60,000 to 600,000 points 2 - Method of solution: Each section of data is considered separately. Each section of File 3, 23, and 27 data consists of a table of cross section versus energy with any of five interpolation laws. LINEAR will replace each section with a new table of energy versus cross section data in which the interpolation law is always linear in energy and cross section. The histogram (constant cross section between two energies) interpolation law is converted to linear-linear by substituting two points for each initial point. The linear-linear is not altered. For the log-linear, linear-log and log- log laws, the cross section data are converted to linear by an interval halving algorithm. Each interval is divided in half until the value at the middle of the interval can be approximated by linear-linear interpolation to within a given accuracy. The LINEAR program uses a multipoint fractional error thinning algorithm to minimize the size of each cross section table

  4. Ab initio calculation of contact effects on electron transport through single molecules by the RTM/NEGF method

    International Nuclear Information System (INIS)

    Hirose, Kenji; Kobayashi, Nobuhiko

    2006-01-01

    Using the recursion-transfer-matrix (RTM) method combined with the nonequilibrium Green's function (NEGF) method, we study the electronic states and current-voltage (I-V) characteristics of atomic-scale nanocontact systems. We find that non-linear behaviors appear in the I-V characteristics even without molecules between electrodes. Such non-linear behaviors emerge when the nanocontacts are not well constructed and the transport properties change from tunneling to ballistic regimes

  5. Effect of Skimmer Cone Material on the Spectra of Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Amr, M.A.; Zahran, N.F.; Helal, A.I.

    2002-01-01

    The inductively coupled plasma ion source for mass spectrometry is very sensitive for multielement analysis with detection limits down to sub part per trillion (ppt). Polyatomic ions which could be formed in the mass spectra may interfere in the analysis of some element. Experimental conditions have great influences on the formation of polyatomic ions. The present work demonstrates that the skimmer materials (Au, Ag, Ni, and Cu) are participating in the formation of polyatomic ions, meanwhile the sampler materials have no real effect. The mechanism of formation of polyatomic ions is explained. Heats of formation of polyatomic species formed from the skimmer materials such as: Au X, Ag X, Ni X and Cu X; where X= Ar, O, N, C and H are calculated by Gaussian program (G 94 W)

  6. Percolation of polyatomic species on site diluted lattices

    International Nuclear Information System (INIS)

    Cornette, V.; Ramirez-Pastor, A.J.; Nieto, F.

    2006-01-01

    In this Letter, the percolation of (a) linear segments of size k and (b) k-mers (particles occupying k adjacent sites) of different structures and forms deposited on a diluted square lattice have been studied. The diluted lattice is built by randomly selecting a fraction of sites which are considered forbidden for deposition. The analysis of the obtained results is made in the framework of the finite size scaling theory. The characteristic parameters of the percolation problem are dependent not only on the form and structure of the k-mers but also on the properties of the lattice where they are deposited. A phase diagram separating a percolating from a non-percolating region is determined and discussed

  7. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  8. Imaging a multidimensional multichannel potential energy surface: Photodetachment of H(-)(NH3) and NH4 (.).

    Science.gov (United States)

    Hu, Qichi; Song, Hongwei; Johnson, Christopher J; Li, Jun; Guo, Hua; Continetti, Robert E

    2016-06-28

    Probes of the Born-Oppenheimer potential energy surfaces governing polyatomic molecules often rely on spectroscopy for the bound regions or collision experiments in the continuum. A combined spectroscopic and half-collision approach to image nuclear dynamics in a multidimensional and multichannel system is reported here. The Rydberg radical NH4 and the double Rydberg anion NH4 (-) represent a polyatomic system for benchmarking electronic structure and nine-dimensional quantum dynamics calculations. Photodetachment of the H(-)(NH3) ion-dipole complex and the NH4 (-) DRA probes different regions on the neutral NH4 PES. Photoelectron energy and angular distributions at photon energies of 1.17, 1.60, and 2.33 eV compare well with quantum dynamics. Photoelectron-photofragment coincidence experiments indicate dissociation of the nascent NH4 Rydberg radical occurs to H + NH3 with a peak kinetic energy of 0.13 eV, showing the ground state of NH4 to be unstable, decaying by tunneling-induced dissociation on a time scale beyond the present scope of multidimensional quantum dynamics.

  9. Geometry optimization of molecules within an LCGTO local-density functional approach

    International Nuclear Information System (INIS)

    Mintmire, J.W.

    1990-01-01

    We describe our implementation of geometry optimization techniques within the linear combination of Gaussian-type orbitals (LCGTO) approach to local-density functional theory. The algorithm for geometry optimization is based on the evaluation of the gradient of the total energy with respect to internal coordinates within the local-density functional scheme. We present optimization results for a range of small molecules which serve as test cases for our approach

  10. Stress and neutron scattering measurements on linear polymer melts undergoing steady elongational flow

    DEFF Research Database (Denmark)

    Hassager, Ole; Mortensen, Kell; Bach, Anders

    2012-01-01

    We use small-angle neutron scattering to measure the molecular stretching in polystyrene melts undergoing steady elongational flow at large stretch rates. The radius of gyration of the central segment of a partly deuterated polystyrene molecule is, in the stretching direction, increasing...... exhibited by the linear polystyrene melt....

  11. Photon-assisted tunneling in a Fe8 single-molecule magnet

    Science.gov (United States)

    Sorace, L.; Wernsdorfer, W.; Thirion, C.; Barra, A.-L.; Pacchioni, M.; Mailly, D.; Barbara, B.

    2003-12-01

    The low-temperature spin dynamics of a Fe8 single-molecule magnet was studied under circularly polarized electromagnetic radiation allowing us to establish clearly photon-assisted tunneling. This effect, while linear at low power, becomes highly nonlinear above a relatively low-power threshold. Heating due to phonon emission, spin-spin interactions, and coherent emission/absorption of photons might lead to the observed nonlinearity. These results are of importance if such systems are to be used as quantum computers.

  12. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  13. Ejection of Coulomb Crystals from a Linear Paul Ion Trap for Ion-Molecule Reaction Studies.

    Science.gov (United States)

    Meyer, K A E; Pollum, L L; Petralia, L S; Tauschinsky, A; Rennick, C J; Softley, T P; Heazlewood, B R

    2015-12-17

    Coulomb crystals are being increasingly employed as a highly localized source of cold ions for the study of ion-molecule chemical reactions. To extend the scope of reactions that can be studied in Coulomb crystals-from simple reactions involving laser-cooled atomic ions, to more complex systems where molecular reactants give rise to multiple product channels-sensitive product detection methodologies are required. The use of a digital ion trap (DIT) and a new damped cosine trap (DCT) are described, which facilitate the ejection of Coulomb-crystallized ions onto an external detector for the recording of time-of-flight (TOF) mass spectra. This enables the examination of reaction dynamics and kinetics between Coulomb-crystallized ions and neutral molecules: ionic products are typically cotrapped, thus ejecting the crystal onto an external detector reveals the masses, identities, and quantities of all ionic species at a selected point in the reaction. Two reaction systems are examined: the reaction of Ca(+) with deuterated isotopologues of water, and the charge exchange between cotrapped Xe(+) with deuterated isotopologues of ammonia. These reactions are examples of two distinct types of experiment, the first involving direct reaction of the laser-cooled ions, and the second involving reaction of sympathetically-cooled heavy ions to form a mixture of light product ions. Extensive simulations are conducted to interpret experimental results and calculate optimal operating parameters, facilitating a comparison between the DIT and DCT approaches. The simulations also demonstrate a correlation between crystal shape and image shape on the detector, suggesting a possible means for determining crystal geometry for nonfluorescing ions.

  14. Linearization Method and Linear Complexity

    Science.gov (United States)

    Tanaka, Hidema

    We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.

  15. A harmonic approximation of intramolecular vibrations in a mixed quantum-classical methodology: Linear absorbance of a dissolved Pheophorbid-a molecule as an example

    International Nuclear Information System (INIS)

    Megow, Joerg; Kulesza, Alexander; Qu Zhengwang; Ronneberg, Thomas; Bonacic-Koutecky, Vlasta; May, Volkhard

    2010-01-01

    Graphical abstract: Structure of a single Pheo (green: C-atoms, blue: N-atoms, red; O-atoms, light grey: H-atoms). - Abstract: Linear absorption spectra of a single Pheophorbid-a molecule (Pheo) dissolved in ethanol are calculated in a mixed quantum-classical approach. In this computational scheme the absorbance is mainly determined by the time-dependent fluctuations of the energy gap between the Pheo ground and excited electronic state. The actual magnitude of the energy gap is caused by the electrostatic solvent solute coupling as well as by contributions due to intra Pheo vibrations. For the latter a new approach is proposed which is based on precalculated potential energy surfaces (PES) described in a harmonic approximation. To get the respective nuclear equilibrium configurations and Hessian matrices of the two involved electronic states we carried out the necessary electronic structure calculations in a DFT-framework. Since the Pheo changes its spatial orientation in the course of a MD run, the nuclear equilibrium configurations change their spatial position, too. Introducing a particular averaging procedure, these configurations are determined from the actual MD trajectories. The usability of the approach is underlined by a perfect reproduction of experimental data. This also demonstrates that our proposed method is suitable for the description of more complex systems in future investigations.

  16. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  17. Electronic relaxation processes in polyatomic molecules. Progress report, October 1, 1975--September 30, 1976

    International Nuclear Information System (INIS)

    Lim, E.C.

    1976-09-01

    Excitation energy dependence of radiationless decay rate under collision-free conditions was utilized as a probe of intramolecular vibrational relaxation in tetracene and pentacene. The results give evidence of vibrational relaxation which competes with electronic relaxation. The substitution dependence of T 1 (nπ*) → S 0 radiationless transition in monocyclic diazines and the temperature dependence of S 1 non-radiative decay rate in alcoholic solutions of polycyclic monoazines indicate that the vibronic interaction between the lowest energy nπ* and ππ* states leads to a rapid radiationless deactivation of the lower of the two electronic states. Finally, a photon-counting spectrofluorometer of very high sensitivity was constructed, and it was used to record T 2 → T 1 fluorescence in bromoanthracenes and S 2 → S 1 fluorescence in azulene. These spectra represent the first bona-fide, or the most convincing, observation of fluorescence between excited electronic states

  18. Structure/property relationships in non-linear optical materials

    Energy Technology Data Exchange (ETDEWEB)

    Cole, J M [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); [Durham Univ. (United Kingdom); Howard, J A.K. [Durham Univ. (United Kingdom); McIntyre, G J [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1997-04-01

    The application of neutrons to the study of structure/property relationships in organic non-linear optical materials (NLOs) is described. In particular, charge-transfer effects and intermolecular interactions are investigated. Charge-transfer effects are studied by charge-density analysis and an example of one such investigation is given. The study of intermolecular interactions concentrates on the effects of hydrogen-bonding and an example is given of two structurally similar molecules with very disparate NLO properties, as a result of different types of hydrogen-bonding. (author). 3 refs.

  19. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

    Science.gov (United States)

    Yu, Hua-Gen

    2008-05-21

    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  20. Cold Rydberg molecules

    Science.gov (United States)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  1. Reduced order dynamic model for polysaccharides molecule attached to an atomic force microscope

    International Nuclear Information System (INIS)

    Tang Deman; Li Aiqin; Attar, Peter; Dowell, Earl H.

    2004-01-01

    A dynamic analysis and numerical simulation has been conducted of a polysaccharides molecular structure (a ten (10) single-α-D-glucose molecule chain) connected to a moving atomic force microscope (AFM). Sinusoidal base excitation of the AFM cantilevered beam is considered. First a linearized perturbation model is constructed for the complex polysaccharides molecular structure. Then reduced order (dynamic) models based upon a proper orthogonal decomposition (POD) technique are constructed using global modes for both the linearized perturbation model and for the full nonlinear model. The agreement between the original and reduced order models (ROM/POD) is very good even when only a few global modes are included in the ROM for either the linear case or for the nonlinear case. The computational advantage of the reduced order model is clear from the results presented

  2. QSPR study of the retention/release property of odorant molecules in pectin gels using statistical methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-11-01

    Full Text Available The ACD/ChemSketch, MarvinSketch, and ChemOffice programmes were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. The best descriptors were selected to establish the Quantitative Structure-Property Relationship (QSPR of the retention/release property of odorant molecules in pectin gels using Principal Components Analysis (PCA, Multiple Linear Regression (MLR, Multiple Non-linear Regression (MNLR and Artificial Neural Network (ANN methods We propose a quantitative model based on these analyses. PCA has been used to select descriptors that exhibit high correlation with the retention/release property. The MLR method yielded correlation coefficients of 0.960 and 0.958 for PG-0.4 (pectin concentration: 0.4% w/w and PG-0.8 (pectin concentration: 0.8% w/w media, respectively. Internal and external validations were used to determine the statistical quality of the QSPR of the two MLR models. The MNLR method, considering the relevant descriptors obtained from the MLR, yielded correlation coefficients of 0.978 and 0.975 for PG-0.4 and PG-0.8 media, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outside compounds. The effects of different descriptors on the retention/release property are described, and these descriptors were used to study and design new compounds with higher and lower values of the property than the existing ones. Keywords: Odorant Molecules, Retention/Release, Pectin Gels, Quantitative Structure Property Relationship, Multiple Linear Regression, Artificial Neural Network

  3. Application of Fourier transform infrared ellipsometry to assess the concentration of biological molecules

    Science.gov (United States)

    Garcia-Caurel, Enric; Drevillon, Bernard; De Martino, Antonello; Schwartz, Laurent

    2002-12-01

    Spectroscopic ellipsometry is a noninvasive optical characterization technique mainly used in the semiconductor field to characterize bare substrates and thin films. In particular, it allows the gathering of information concerning the physical structure of the sample, such as roughness and film thickness, as well as its optical response. In the mid-infrared (IR) range each molecule exhibits a characteristic absorption fingerprint, which makes this technique chemically selective. Phase-modulated IR ellipsometry does not require a baseline correction procedure or suppression of atmospheric CO2 and water-vapor absorption bands, thus greatly reducing the subjectivity in data analysis. We have found that ellipsometric measurements of thin films, such as the solid residuals left on a plane surface after evaporation of a liquid drop containing a given compound in solution, are particularly favorable for dosing purposes because the intensity of IR absorptions shows a linear behavior along a wide range of solution concentrations of the given compound. Our aim is to illustrate with a concrete example and to justify theoretically the linearity experimentally found between radiation absorption and molecule concentration. For the example, we prepared aqueous solutions of glycogen, a molecule of huge biological importance currently tested in biochemical analyses, at concentrations ranging from 1 mg/l to 1 g/l, which correspond to those found in physiological conditions. The results of this example are promising for the application of ellipsometry for dosing purposes in biochemistry and biomedicine.

  4. Electron-excited molecule interactions

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Tennessee Univ., Knoxville, TN

    1991-01-01

    In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

  5. Small molecule hydration energy and entropy from 3D-RISM

    Science.gov (United States)

    Johnson, J.; Case, D. A.; Yamazaki, T.; Gusarov, S.; Kovalenko, A.; Luchko, T.

    2016-09-01

    Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases.

  6. Small molecule hydration energy and entropy from 3D-RISM

    International Nuclear Information System (INIS)

    Johnson, J; Case, D A; Yamazaki, T; Gusarov, S; Kovalenko, A; Luchko, T

    2016-01-01

    Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases. (paper)

  7. Experimental study on pion capture by hydrogen bound in molecules

    International Nuclear Information System (INIS)

    Horvath, D.; Aniol, K.A.; Entezami, F.; Measday, D.F.; Noble, A.J.; Stanislaus, S.; Virtue, C.J.

    1988-08-01

    An experiment was performed at TRIUMF to study the formation of pionic hydrogen atoms and molecules in solids, particularly in groups of organic molecules of slightly different structure in order to help further clarify the problem. The nuclear capture of pions by hydrogen was measured using the charge exchange of stopped pions. The coincident photons emitted by the decaying π 0 mesons were detected by TRIUMF's two large NaI spectrometers. New experimental results were obtained for the capture probability of stopped π - mesons in the nuclei of hydrogen atoms, chemically bound in molecules of some simple hydrides, acid anhydrides, and sugar isomers. A linear relation was found between pion capture in hydrogen and melting point in sugar isomers. The pion capture probability in acid anhydrides is fairly well described by a simple atomic capture model in which the capture probability on the hydrogen dramatically increases as the hydrogen atom is separated from the strongly electronegative C 2 O 3 group. Both effects are consistent with a correlation between pion capture and electron density on hydrogen atoms. (Author) (38 refs., 4 tabs., 7 figs.)

  8. Organic Semiconductor-Containing Supramolecules: Effect of Small Molecule Crystallization and Molecular Packing

    KAUST Repository

    Rancatore, Benjamin J.

    2016-01-21

    © 2016 American Chemical Society. Small molecules (SMs) with unique optical or electronic properties provide an opportunity to incorporate functionality into block copolymer (BCP)-based supramolecules. However, the assembly of supramolecules based on these highly crystalline molecules differs from their less crystalline counterparts. Here, two families of organic semiconductor SMs are investigated, where the composition of the crystalline core, the location (side- vs end-functionalization) of the alkyl solubilizing groups, and the constitution (branched vs linear) of the alkyl groups are varied. With these SMs, we present a systematic study of how the phase behavior of the SMs affects the overall assembly of these organic semiconductor-based supramolecules. The incorporation of SMs has a large effect on the interfacial curvature, the supramolecular periodicity, and the overall supramolecular morphology. The crystal packing of the SM within the supramolecule does not necessarily lead to the assembly of the comb block within the BCP microdomains, as is normally observed for alkyl-containing supramolecules. An unusual lamellar morphology with a wavy interface between the microdomains is observed due to changes in the packing structure of the small molecule within BCP microdomains. Since the supramolecular approach is modular and small molecules can be readily switched out, present studies provide useful guidance toward access supramolecular assemblies over several length scales using optically active and semiconducting small molecules.

  9. Electroluminescence from completely horizontally oriented dye molecules

    Energy Technology Data Exchange (ETDEWEB)

    Komino, Takeshi [Education Center for Global Leaders in Molecular System for Devices, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Sagara, Yuta [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Tanaka, Hiroyuki [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Chemistry, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Oki, Yuji [Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Electronics, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Nakamura, Nozomi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); International Institute for Carbon Neutral Energy Research (WPI-I2CNER), Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fujimoto, Hiroshi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fukuoka i" 3-Center for Organic Photonics and Electronics Research (i3-OPERA), Fukuoka 819-0388 (Japan); and others

    2016-06-13

    A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimate orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.

  10. Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

    Science.gov (United States)

    Galvão, B R L; Rodrigues, S P J; Varandas, A J C

    2008-07-28

    A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

  11. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  12. Linear-scaling evaluation of the local energy in quantum Monte Carlo

    International Nuclear Information System (INIS)

    Austin, Brian; Aspuru-Guzik, Alan; Salomon-Ferrer, Romelia; Lester, William A. Jr.

    2006-01-01

    For atomic and molecular quantum Monte Carlo calculations, most of the computational effort is spent in the evaluation of the local energy. We describe a scheme for reducing the computational cost of the evaluation of the Slater determinants and correlation function for the correlated molecular orbital (CMO) ansatz. A sparse representation of the Slater determinants makes possible efficient evaluation of molecular orbitals. A modification to the scaled distance function facilitates a linear scaling implementation of the Schmidt-Moskowitz-Boys-Handy (SMBH) correlation function that preserves the efficient matrix multiplication structure of the SMBH function. For the evaluation of the local energy, these two methods lead to asymptotic linear scaling with respect to the molecule size

  13. Dipole Correlation of the Electronic Structures of theConformations of Water Molecule Evolving Through theNormal Modes of Vibrations Between Angular (C2v to Linear(D∝h Shapes

    Directory of Open Access Journals (Sweden)

    Arindam Chakraborty

    2006-03-01

    orbital in almost all conformations. One more important result of the present study is that, with the physical process of structural evolution from close angular shape to the linear transition state, the length of the σ (O–H decreases and its strength increases as a monotone function of reaction coordinates. The bond length is shortest and the strength is largest at the transition state of structural inversion. Result of structural effect of the present study during the evolution of molecular conformations is quite consistent with the result of a very refined calculation that one physically significant feature of force field that the stretching force constants at the linear geometry are considerably larger than their equilibrium counter parts. The variation of bond strength and the hybridization of s and p orbitals on O atom center to form the σ (O–H bond as a function of evolution of conformations is in accordance with Coulson’s prediction. The total dipole moment of all conformations is partitioned into the contribution from bonds and lone pairs and correlated in terms of the computed hybridization in lone pairs. The analysis of the variation of dipole moment as a function of angular to linear structural evolution reveals that the dipole moment of H2O molecule is not due to the bond moments only but a significant contribution comes from a lone pair. It is strongly established that the dipole moment of water molecule at and around the equilibrium geometry is not due to the bond moments only and the major part of the molecular dipole comes from the contribution of lone pair electrons. This necessitates the accommodation of a lone pair of electrons in a hybrid orbital on O atom. The computed LMO’s webbed with partitioned molecular dipole reveal that one lone pair is in a pure p- type orbital and the other lone pair is in a hybrid of s and p, and not in a pure s type orbital as suggested on the basis of

  14. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  15. Accurate Calculations of Rotationally Inelastic Scattering Cross Sections Using Mixed Quantum/Classical Theory.

    Science.gov (United States)

    Semenov, Alexander; Babikov, Dmitri

    2014-01-16

    For computational treatment of rotationally inelastic scattering of molecules, we propose to use the mixed quantum/classical theory, MQCT. The old idea of treating translational motion classically, while quantum mechanics is used for rotational degrees of freedom, is developed to the new level and is applied to Na + N2 collisions in a broad range of energies. Comparison with full-quantum calculations shows that MQCT accurately reproduces all, even minor, features of energy dependence of cross sections, except scattering resonances at very low energies. The remarkable success of MQCT opens up wide opportunities for computational predictions of inelastic scattering cross sections at higher temperatures and/or for polyatomic molecules and heavier quenchers, which is computationally close to impossible within the full-quantum framework.

  16. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  17. Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

    Energy Technology Data Exchange (ETDEWEB)

    Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

  18. Ellipticity and the offset angle of high harmonics generated by homonuclear diatomic molecules

    International Nuclear Information System (INIS)

    Odzak, S; Milosevic, D B

    2011-01-01

    In our recent paper (2010 Phys. Rev. A 82 023412) we introduced a theory of high-order harmonic generation by diatomic molecules exposed to an elliptically polarized laser field and have shown that the nth harmonic emission rate has contributions of the components of the T-matrix element in the direction of the laser-field polarization and in the direction perpendicular to it. Using both components of the T-matrix element we now develop a theoretical approach for calculating ellipticity and the offset angle of high harmonics. We show that the emitted harmonics generated by aligned molecules are elliptically polarized even if the applied field is linearly polarized. Using examples of N 2 , O 2 and Ar 2 molecules we show the existence of extrema and sudden changes of the harmonic ellipticity and the offset angle for particular molecular alignment and explain them by the destructive two-centre interference. Taking into account that the aligned molecules are an anisotropic medium for high harmonic generation, we introduce elliptic dichroism as a measure of this anisotropy, for both components of the T-matrix element. We propose that the measurement of the elliptic dichroism may reveal further information about the molecular structure.

  19. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  20. Enhancement of strong-field multiple ionization in the vicinity of the conical intersection in 1,3-cyclohexadiene ring opening

    International Nuclear Information System (INIS)

    Petrovic, Vladimir S.; Kim, Jaehee; Schorb, Sebastian; White, James; Cryan, James P.; Zipp, Lucas; Glownia, J. Michael; Broege, Douglas; Miyabe, Shungo; Tao, Hongli; Martinez, Todd; Bucksbaum, Philip H.

    2013-01-01

    Nonradiative energy dissipation in electronically excited polyatomic molecules proceeds through conical intersections, loci of degeneracy between electronic states. We observe a marked enhancement of laser-induced double ionization in the vicinity of a conical intersection during a non-radiative transition. We measured double ionization by detecting the kinetic energy of ions released by laser-induced strong-field fragmentation during the ring-opening transition between 1,3-cyclohexadiene and 1,3,5-hexatriene. The enhancement of the double ionization correlates with the conical intersection between the HOMO and LUMO orbitals

  1. Applied group theory selected readings in physics

    CERN Document Server

    Cracknell, Arthur P

    1968-01-01

    Selected Readings in Physics: Applied Group Theory provides information pertinent to the fundamental aspects of applied group theory. This book discusses the properties of symmetry of a system in quantum mechanics.Organized into two parts encompassing nine chapters, this book begins with an overview of the problem of elastic vibrations of a symmetric structure. This text then examines the numbers, degeneracies, and symmetries of the normal modes of vibration. Other chapters consider the conditions under which a polyatomic molecule can have a stable equilibrium configuration when its electronic

  2. Some aspects of vacuum ultraviolet radiation physics

    CERN Document Server

    Damany, Nicole; Vodar, Boris

    2013-01-01

    Some Aspects of Vacuum Ultraviolet Radiation Physics presents some data on the state of research in vacuum ultraviolet radiation in association with areas of physics. Organized into four parts, this book begins by elucidating the optical properties of solids in the vacuum ultraviolet region (v.u.v.), particularly the specific methods of determination of optical constants in v.u.v., the properties of metals, and those of ionic insulators. Part II deals with molecular spectroscopy, with emphasis on the spectra of diatomic and simple polyatomic molecules, paraffins, and condensed phases. Part III

  3. Observation of rotational revivals for iodine molecules in helium droplets using a near-adiabatic laser pulse

    Science.gov (United States)

    Shepperson, Benjamin; Chatterley, Adam S.; Christiansen, Lars; Søndergaard, Anders A.; Stapelfeldt, Henrik

    2018-01-01

    A 160-ps near-Gaussian, linearly polarized laser pulse is used to align iodine (I2) molecules embedded in helium nanodroplets. The rise time of the laser pulse is sufficiently long and smooth that the alignment, characterized by , behaves adiabatically during the pulse turnon. However, after the laser pulse has turned off stays above 0.50 and a recurrence structure occurs ˜650 ps later. Measurements on isolated (I2) molecules with identical laser pulses are used to identify, through analysis of the observed half- and full-rotational revivals, that the nonadiabatic postpulse alignment dynamics results from a mild truncation of the trailing edge of the laser pulse. This truncation establishes a well-defined starting time for coherent rotation, which leads to the revival structures observed both for isolated molecules and molecules in He droplets. In the latter case the time-dependent trace recorded here is compared to that obtained previously for a 450-fs alignment pulse. It is found that the observed revivals are very similar.

  4. The Role of Molecules in Low Temperature Plasmas for Lighting

    International Nuclear Information System (INIS)

    Lapatovich, Walter P.

    2007-01-01

    High intensity discharge (HID) lamps are low temperature (∼0.5eV), weakly ionized plasmas sustained in a refractory but light transmissive envelope for the purpose of converting electrical power into visible radiation. For commercial applications this conversion must occur with good efficiency and with sufficient spectral content throughout the visible (380-780nm) to permit the light so generated to render colors in a fashion comparable to natural sunlight. These goals are often achieved by adding multiple metals to a basic mercury discharge. Because the vapor pressure of most metals is very much lower than mercury itself, chemical compounds containing the desired metals, and having higher vapor pressures are used to introduce the material into the basic discharge. Complexing agents which further improve the vapor pressure are used to enhance the amount of metals in the discharge. The metal compound and complexes are usually polyatomic species which vaporize and subsequently dissociate as they diffuse into the bulk plasma. Under the approximation of local thermodynamic equilibrium (LTE) the particles are in equilibrium, but not with the radiation Held. Strong thermal (106K/m) and density gradients are sustained in the discharge. Atomic and molecular radiation produced in the high temperature core transits through colder gas regions before exiting the lamp. In these regions where the complex molecular species exists in an undissociated state, bound-free transitions can result in energy being effectively converted from light radiation into heat in the mantle. Bound-bound transitions In Identifiable molecules can result in modification of the spectral output in unpredictable and counter-intuitive ways. Examples of completing agents and their effect on the spectral output of typical rare-earth containing HID lamps will be given. The melt composition and the complexing agents themselves may change with time, as chemical reactions in the lamp occur, and their benefit

  5. Transport behavior of water molecules through two-dimensional nanopores

    International Nuclear Information System (INIS)

    Zhu, Chongqin; Li, Hui; Meng, Sheng

    2014-01-01

    Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

  6. Quantum switching of π-electron rotations in a nonplanar chiral molecule by using linearly polarized UV laser pulses.

    Science.gov (United States)

    Mineo, Hirobumi; Yamaki, Masahiro; Teranishi, Yoshiaki; Hayashi, Michitoshi; Lin, Sheng Hsien; Fujimura, Yuichi

    2012-09-05

    Nonplanar chiral aromatic molecules are candidates for use as building blocks of multidimensional switching devices because the π electrons can generate ring currents with a variety of directions. We employed (P)-2,2'-biphenol because four patterns of π-electron rotations along the two phenol rings are possible and theoretically determine how quantum switching of the π-electron rotations can be realized. We found that each rotational pattern can be driven by a coherent excitation of two electronic states under two conditions: one is the symmetry of the electronic states and the other is their relative phase. On the basis of the results of quantum dynamics simulations, we propose a quantum control method for sequential switching among the four rotational patterns that can be performed by using ultrashort overlapped pump and dump pulses with properly selected relative phases and photon polarization directions. The results serve as a theoretical basis for the design of confined ultrafast switching of ring currents of nonplanar molecules and further current-induced magnetic fluxes of more sophisticated systems.

  7. Spin-dependent transport properties of oleic acid molecule self-assembled La0.7Sr0.3MnO3 nanoparticles

    International Nuclear Information System (INIS)

    Xi, L.; Du, J.H.; Ma, J.H.; Wang, Z.; Zuo, Y.L.; Xue, D.S.

    2013-01-01

    Highlights: ► Spin-dependent transport property of LSMO/oleic acid nanoparticles is investigated. ► Transport properties and MR measured by Cu/nanoparticle assembly/elargol device. ► Non-linear I–V curve indicates a tunneling type transport properties. ► Tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting I–V curves. ► LFMR of LSMO/oleic acid molecules value reaches −18% with current of 0.1 μA at 10 K. - Abstract: Spin-dependent transport property through molecules is investigated using a monolayer of oleic acid molecule self-assembled half metallic La 0.7 Sr 0.3 MnO 3 (LSMO) nanoparticles, which was synthesized using a coprecipitation method. Fourier transform infrared spectroscopy was used to confirm that one-monolayer oleic acid molecules chemically bond to the LSMO nanoparticles. The transport properties and magnetoresistance (MR) effect of the oleic acid molecule coated LSMO nanoparticles were measured by a direct current four probes method using a Cu/nanoparticle assembly/elargol electrode sandwich device with various temperatures and bias voltages. The non-linear I–V curve indicates a tunneling type transport properties. The tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting the I–V curve according to the Simmons equation. The magnetoresistance curves can be divided to high-field MR and low-field MR (LFMR) parts. The former is ascribed to the influence of spin disorder or canting within the LSMO nanoparticle surface and the latter one with strong bias dependence is attributed to the spin-dependent tunneling effect through the insulating surface layer of LSMO and oleic acid molecules. The enhanced LFMR effect for oleic acid coated LSMO with respect to the bare LSMO was attributed to the enhanced tunneling transport and weak spin scattering in oleic acid molecule barrier.

  8. Substitution Structures of Large Molecules and Medium Range Correlations in Quantum Chemistry Calculations

    Science.gov (United States)

    Evangelisti, Luca; Pate, Brooks

    2017-06-01

    A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on

  9. Non-detection of HC11N towards TMC-1: constraining the chemistry of large carbon-chain molecules

    Science.gov (United States)

    Loomis, Ryan A.; Shingledecker, Christopher N.; Langston, Glen; McGuire, Brett A.; Dollhopf, Niklaus M.; Burkhardt, Andrew M.; Corby, Joanna; Booth, Shawn T.; Carroll, P. Brandon; Turner, Barry; Remijan, Anthony J.

    2016-12-01

    Bell et al. reported the first detection of the cyanopolyyne HC11N towards the cold dark cloud TMC-1; no subsequent detections have been reported towards any source. Additional observations of cyanopolyynes and other carbon-chain molecules towards TMC-1 have shown a log-linear trend between molecule size and column density, and in an effort to further explore the underlying chemical processes driving this trend, we have analysed Green Bank Telescope observations of HC9N and HC11N towards TMC-1. Although we find an HC9N column density consistent with previous values, HC11N is not detected and we derive an upper limit column density significantly below that reported in Bell et al. Using a state-of-the-art chemical model, we have investigated possible explanations of non-linearity in the column density trend. Despite updating the chemical model to better account for ion-dipole interactions, we are not able to explain the non-detection of HC11N, and we interpret this as evidence of previously unknown carbon-chain chemistry. We propose that cyclization reactions may be responsible for the depleted HC11N abundance, and that products of these cyclization reactions should be investigated as candidate interstellar molecules.

  10. Linear Algebra and Smarandache Linear Algebra

    OpenAIRE

    Vasantha, Kandasamy

    2003-01-01

    The present book, on Smarandache linear algebra, not only studies the Smarandache analogues of linear algebra and its applications, it also aims to bridge the need for new research topics pertaining to linear algebra, purely in the algebraic sense. We have introduced Smarandache semilinear algebra, Smarandache bilinear algebra and Smarandache anti-linear algebra and their fuzzy equivalents. Moreover, in this book, we have brought out the study of linear algebra and vector spaces over finite p...

  11. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M

    2007-12-15

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  12. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  13. A series of fluorene-based two-photon absorbing molecules: synthesis, linear and nonlinear characterization, and bioimaging

    Science.gov (United States)

    Andrade, Carolina D.; Yanez, Ciceron O.; Rodriguez, Luis; Belfield, Kevin D.

    2010-01-01

    The synthesis, structural, and photophysical characterization of a series of new fluorescent donor–acceptor and acceptor-acceptor molecules, based on the fluorenyl ring system, with two-photon absorbing properties is described. These new compounds exhibited large Stokes shifts, high fluorescent quantum yields, and, significantly, high two-photon absorption cross sections, making them well suited for two-photon fluorescence microscopy (2PFM) imaging. Confocal and two-photon fluorescence microscopy imaging of COS-7 and HCT 116 cells incubated with probe I showed endosomal selectivity, demonstrating the potential of this class of fluorescent probes in multiphoton fluorescence microscopy. PMID:20481596

  14. Amplified release through the stimulus triggered degradation of self-immolative oligomers, dendrimers, and linear polymers.

    Science.gov (United States)

    Wong, Andrew D; DeWit, Matthew A; Gillies, Elizabeth R

    2012-08-01

    In recent years, numerous delivery systems based on polymers, dendrimers, and nano-scale assemblies have been developed to improve the properties of drug molecules. In general, for the drug molecules to be active, they must be released from these delivery systems, ideally in a selective manner at the therapeutic target. As the changes in physiological conditions are relatively subtle from one tissue to another and the concentrations of specific enzymes are often quite low, a release strategy involving the amplification of a biological signal is particularly attractive. This article describes the development of oligomers, dendrimers, and linear polymers based on self-immolative spacers. This new class of molecules is designed to undergo a cascade of intramolecular reactions in response to the cleavage of a trigger moiety, resulting in molecular fragmentation and the release of multiple reporter or drug molecules. Progress in the development of these materials as drug delivery vehicles and sensors will be highlighted. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Strategy to discover diverse optimal molecules in the small molecule universe.

    Science.gov (United States)

    Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N

    2015-03-23

    The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.

  16. Coherent control of atto-second emission from aligned molecules

    Energy Technology Data Exchange (ETDEWEB)

    Boutu, W; Haessler, S; Merdji, H; Breger, P; Monchicourt, P; Carre, B; Salieres, P [CEA Saclay, DSM, Serv Photons Atomes Mol, F-91191 Gif Sur Yvette, (France); Waters, G [Univ Reading, JJ Thomson Phys Lab, Reading RG6 6AF, Berks, (United Kingdom); Stankiewicz, M [Jagiellonian Univ, Inst Phys, PL-30059 Krakow, (Poland); Frasinski, L J [Univ London Imperial Coll Sci Technol and Med, Blackett Lab, London SW7 2BW, (United Kingdom); Taieb, R; Caillat, J; Maquet, A [Univ Paris 06, UMR 7614, Lab Chim Phys Matiere Rayonnement, F-75231 Paris 05, (France); Taieb, R; Caillat, J; Maquet, A [LCPMR, UMR 7614, CNRS, F-75005 Paris, (France)

    2008-07-01

    Controlling atto-second electron wave packets and soft X-ray pulses represents a formidable challenge of general implication to many areas of science. A strong laser field interacting with atoms or molecules drives ultrafast intra-atomic/molecular electron wave packets on a sub femtosecond timescale, resulting in the emission of atto-second bursts of extreme-ultraviolet light. Controlling the intra-atomic/molecular electron dynamics enables steering of the atto-second emission. Here, we carry out a coherent control in linear molecules, where the interaction of the laser-driven electron wave packet with the core leads to quantum interferences. We demonstrate that these interferences can be finely controlled by turning the molecular axis relative to the laser polarization, that is, changing the electron re-collision angle. The wave-packet coulombic distortion modifies the spectral phase jump measured in the extreme-ultraviolet emission. Our atto-second control of the interference results in atto-second pulse shaping, useful for future applications in ultrafast coherent control of atomic and molecular processes. (authors)

  17. Effects of molecular orientation in the laser ionization of molecules

    International Nuclear Information System (INIS)

    Xinhua Xie; Gerald Jordan; Christopher Ede; Armin Scrinzi

    2006-01-01

    Complete test of publication follows. Time-dependent electron momentum distributions are calculated during ionization of linear molecules by a strong laser pulse and upon recollision. For typical experimental laser parameters, we find a strong influence of molecular orientation and initial state symmetry on the total ionization rates and also on momentum distributions, compared to which the effect of electron correlation is less important for simple molecules. The dynamics of electron release and subsequent recollision with the parent ion largely determines the time-frequency structure of harmonic radiation, which underlies the generation of attosecond XUV pulses and the time-resolved imaging techniques for the electronic structure of molecules. In the present work, the effects of orientation and initial orbital symmetry are investigated by solving the time-dependent Schroedinger equation for a two-dimensional diatomic molecule in the single-active electron approximation. As in the presence of strong external fields recolliding electrons cannot be easily separated from bound electrons, the electron wave packet is probed at some distance from where all electrons can be safety considered as detached. We find that momentum distributions strongly depend on molecular size, orientation of the molecular axis, and node structure of the initial state. In order to determine the momentum spectra at the time of electron release and upon recollision, we classically propagate the Wigner distributions of probed wavepackets backward and forward in time, respectively. We find that the times of peak recollision current can vary strongly with the orientation of the molecule. Moreover, correlation effects on the electron spectra are included using the multi-configuration time-dependent Hartree-Fock method. The calculations are performed in three spatial dimensions with the restriction to cylindrical symmetry, where the molecule is aligned with the laser field. Correlation is studied

  18. How to probe transverse magnetic anisotropy of a single-molecule magnet by electronic transport?

    Science.gov (United States)

    Misiorny, M.; Burzuri, E.; Gaudenzi, R.; Park, K.; Leijnse, M.; Wegewijs, M.; Paaske, J.; Cornia, A.; van der Zant, H.

    We propose an approach for in-situ determination of the transverse magnetic anisotropy (TMA) of an individual molecule by electronic transport measurements, see Phys. Rev. B 91, 035442 (2015). We study a Fe4 single-molecule magnet (SMM) captured in a gateable junction, a unique tool for addressing the spin in different redox states of a molecule. We show that, due to mixing of the spin eigenstates of the SMM, the TMA significantly manifests itself in transport. We predict and experimentally observe the pronounced intensity modulation of the Coulomb peak amplitude with the magnetic field in the linear-response transport regime, from which the TMA parameter E can be estimated. Importantly, the method proposed here does not rely on the small induced tunnelling effects and, hence, works well at temperatures and electron tunnel broadenings by far exceeding the tunnel splittings and even E itself. We deduce that the TMA for a single Fe4 molecule captured in a junction is substantially larger than the bulk value. Work supported by the Polish Ministry of Science and Education as `Iuventus Plus' project (IP2014 030973) in years 2015-2016.

  19. Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules.

    Science.gov (United States)

    Risser, Steven Michael

    This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb

  20. Vibrational spectroscopy of H{sub 3}{sup +} - advancing into the visible spectral region

    Energy Technology Data Exchange (ETDEWEB)

    Berg, Max; Bing, Dennis; Petrignani, Annemieke; Wolf, Andreas [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)

    2010-07-01

    The triatomic hydrogen ion H{sub 3}{sup +} is a highly reactive key component in many astrophysical and technological plasmas. Being the simplest polyatomic molecule, it is also an important benchmark system against which various quantum mechanical calculations are tested. While the rovibrational levels near the triangular equilibrium structure are well understood, the rovibrational spectrum of this elementary system at strongly deformed geometry, above the barrier to linearity near 10000 cm{sup -1}, represents a formidable task for theory. Its experimental exploration so far ended slightly above 13900 cm{sup -1} from the ground state E{sub 0}({lambda}{proportional_to}720 nm). We report new measurements in a cryogenic 22 pole trap in the range of very high vibrational overtones, reaching levels up to {proportional_to}16500 cm{sup -1} ({lambda}{proportional_to}600 nm) from E{sub 0}. Chemical probing spectroscopy revealed its use for ultra-sensitive detection of transitions six to seven orders of magnitude weaker than the fundamental. Aside from the transition frequencies ({+-}0.005 cm{sup -1}), we present results from a new method to derive precise transition intensities, helping theoretical assignment of the lines.

  1. Imaging a multidimensional multichannel potential energy surface: Photodetachment of H{sup −}(NH{sub 3}) and NH{sub 4}{sup −}

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Qichi; Johnson, Christopher J.; Continetti, Robert E., E-mail: hguo@umn.edu, E-mail: rcontinetti@ucsd.edu [Department of Chemistry and Biochemistry, University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0340 (United States); Song, Hongwei; Guo, Hua, E-mail: hguo@umn.edu, E-mail: rcontinetti@ucsd.edu [Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, New Mexico 87131 (United States); Li, Jun [School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China)

    2016-06-28

    Probes of the Born-Oppenheimer potential energy surfaces governing polyatomic molecules often rely on spectroscopy for the bound regions or collision experiments in the continuum. A combined spectroscopic and half-collision approach to image nuclear dynamics in a multidimensional and multichannel system is reported here. The Rydberg radical NH{sub 4} and the double Rydberg anion NH{sub 4}{sup −} represent a polyatomic system for benchmarking electronic structure and nine-dimensional quantum dynamics calculations. Photodetachment of the H{sup −}(NH{sub 3}) ion-dipole complex and the NH{sub 4}{sup −} DRA probes different regions on the neutral NH{sub 4} PES. Photoelectron energy and angular distributions at photon energies of 1.17, 1.60, and 2.33 eV compare well with quantum dynamics. Photoelectron-photofragment coincidence experiments indicate dissociation of the nascent NH{sub 4} Rydberg radical occurs to H + NH{sub 3} with a peak kinetic energy of 0.13 eV, showing the ground state of NH{sub 4} to be unstable, decaying by tunneling-induced dissociation on a time scale beyond the present scope of multidimensional quantum dynamics.

  2. Towards a Quantum Dynamical Study of the H_2O+H_2O Inelastic Collision: Representation of the Potential and Preliminary Results

    Science.gov (United States)

    Ndengue, Steve Alexandre; Dawes, Richard

    2017-06-01

    Water, an essential ingredient of life, is prevalent in space and various media. H_2O in the gas phase is the major polyatomic species in the interstellar medium (ISM) and a primary target of current studies of collisional dynamics. In recent years a number of theoretical and experimental studies have been devoted to H_2O-X (with X=He, H_2, D_2, Ar, ?) elastic and inelastic collisions in an effort to understand rotational distributions of H_2O in molecular clouds. Although those studies treated several abundant species, no quantum mechanical calculation has been reported to date for a nonlinear polyatomic collider. We present in this talk the preliminary steps toward this goal, using the H_2O molecule itself as our collider, the very accurate MB-Pol surface to describe the intermolecular interaction and the MultiConfiguration Time Dependent (MCTDH) algorithm to study the dynamics. One main challenge in this effort is the need to express the Potential Energy Surface (PES) in a sum-of-products form optimal for MCTDH calculations. We will describe how this was done and present preliminary results of state-to-state probabilities.

  3. Influence of intrinsic decoherence on tripartite entanglement and bipartite fidelity of polar molecules in pendular states

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jia-Xing; Hu, Yuan; Jin, Yu [Key Laboratory of Micro-Nano Measurement-Manipulation and Physics (Ministry of Education), School of Physics and Nuclear Energy Engineering, Beihang University, Xueyuan Road No. 37, Beijing 100191 (China); Zhang, Guo-Feng, E-mail: gf1978zhang@buaa.edu.cn [Key Laboratory of Micro-Nano Measurement-Manipulation and Physics (Ministry of Education), School of Physics and Nuclear Energy Engineering, Beihang University, Xueyuan Road No. 37, Beijing 100191 (China); State Key Laboratory of Software Development Environment, Beihang University, Xueyuan Road No. 37, Beijing 100191 (China); State Key Laboratory of Low-Dimensional Quantum Physics, Tsinghua University, Beijing 100084 (China); Key Laboratory of Quantum Information, University of Science and Technology of China, Chinese Academy of Sciences, Hefei 230026 (China)

    2016-04-07

    An array of ultracold polar molecules trapped in an external electric field is regarded as a promising carrier of quantum information. Under the action of this field, molecules are compelled to undergo pendular oscillations by the Stark effect. Particular attention has been paid to the influence of intrinsic decoherence on the model of linear polar molecular pendular states, thereby we evaluate the tripartite entanglement with negativity, as well as fidelity of bipartite quantum systems for input and output signals using electric dipole moments of polar molecules as qubits. According to this study, we consider three typical initial states for both systems, respectively, and investigate the temporal evolution with variable values of the external field intensity, the intrinsic decoherence factor, and the dipole-dipole interaction. Thus, we demonstrate the sound selection of these three main parameters to obtain the best entanglement degree and fidelity.

  4. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    was probed with fluorescently-labeled probe molecules and imaged. When only the probes were stained and hybridized in a vial, it had 6 orders of magnitude dynamic range with a detection limit of ~0.7 copy/cell. A second dye was added to lower the false positive levels. Although there was a sacrifice of two orders of magnitude in detection limit, the number of false positives was reduced to zero. HPV-16 DNA was also hybridized and detected on surface-tethered probes. When the entire human genomic DNA and HPV was labeled and hybridized, the detection limit was similar to that of one-color assay detected in capillary. However, non-specific adsorption was high, and the dynamic range was narrow because of saturation of the surface and electrostatic repulsion between hybridized targets on the surface. The second probe was introduced to lower non-specific adsorption, and the strategy succeeded in 4 orders of magnitude linear dynamic range in a log-log plot, along with 2.4 copies/cell detection limit. DNA extracts of cell lines that contained a known copy number of HPV-16 DNA were tested with the four strategies described above. The calculated numbers from observed molecule counts matched the known values. Results from the Pap test sample with added HPV DNA were similar to those of purified DNA, suggesting our method is compatible with the conventional Pap test sample collection method. Further optimization will be needed before this single molecule level detection and identification can actually be used in a real clinical lab, but it has good potential and applicability. Improvement such as automated imaging and scanning, more accurate data processing software as well as sensitive camera, should help increase the efficiency and throughput.

  5. Data mining for materials design: A computational study of single molecule magnet

    Energy Technology Data Exchange (ETDEWEB)

    Dam, Hieu Chi [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Pham, Tien Lam; Ho, Tu Bao [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Nguyen, Anh Tuan [Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Nguyen, Viet Cuong [HPC Systems, Inc., 3-9-15 Kaigan, Minato-ku, Tokyo 108-0022 (Japan)

    2014-01-28

    We develop a method that combines data mining and first principles calculation to guide the designing of distorted cubane Mn{sup 4+} Mn {sub 3}{sup 3+} single molecule magnets. The essential idea of the method is a process consisting of sparse regressions and cross-validation for analyzing calculated data of the materials. The method allows us to demonstrate that the exchange coupling between Mn{sup 4+} and Mn{sup 3+} ions can be predicted from the electronegativities of constituent ligands and the structural features of the molecule by a linear regression model with high accuracy. The relations between the structural features and magnetic properties of the materials are quantitatively and consistently evaluated and presented by a graph. We also discuss the properties of the materials and guide the material design basing on the obtained results.

  6. Reduction of Linear Programming to Linear Approximation

    OpenAIRE

    Vaserstein, Leonid N.

    2006-01-01

    It is well known that every Chebyshev linear approximation problem can be reduced to a linear program. In this paper we show that conversely every linear program can be reduced to a Chebyshev linear approximation problem.

  7. Differential solvation of intrinsically disordered linkers drives the formation of spatially organized droplets in ternary systems of linear multivalent proteins

    Science.gov (United States)

    Harmon, Tyler S.; Holehouse, Alex S.; Pappu, Rohit V.

    2018-04-01

    Intracellular biomolecular condensates are membraneless organelles that encompass large numbers of multivalent protein and nucleic acid molecules. The bodies assemble via a combination of liquid–liquid phase separation and gelation. A majority of condensates included multiple components and show multilayered organization as opposed to being well-mixed unitary liquids. Here, we put forward a simple thermodynamic framework to describe the emergence of spatially organized droplets in multicomponent systems comprising of linear multivalent polymers also known as associative polymers. These polymers, which mimic proteins and/or RNA have the architecture of domains or motifs known as stickers that are interspersed by flexible spacers known as linkers. Using a minimalist numerical model for a four-component system, we have identified features of linear multivalent molecules that are necessary and sufficient for generating spatially organized droplets. We show that differences in sequence-specific effective solvation volumes of disordered linkers between interaction domains enable the formation of spatially organized droplets. Molecules with linkers that are preferentially solvated are driven to the interface with the bulk solvent, whereas molecules that have linkers with negligible effective solvation volumes form cores in the core–shell architectures that emerge in the minimalist four-component systems. Our modeling has relevance for understanding the physical determinants of spatially organized membraneless organelles.

  8. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  9. Concentration-related response potentiometric titrations to study the interaction of small molecules with large biomolecules.

    Science.gov (United States)

    Hamidi-Asl, Ezat; Daems, Devin; De Wael, Karolien; Van Camp, Guy; Nagels, Luc J

    2014-12-16

    In the present paper, the utility of a special potentiometric titration approach for recognition and calculation of biomolecule/small-molecule interactions is reported. This approach is fast, sensitive, reproducible, and inexpensive in comparison to the other methods for the determination of the association constant values (Ka) and the interaction energies (ΔG). The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small-molecule ligand. The biomolecule is used as a titrant. The potential is measured versus a reference electrode and transformed into a concentration-related signal over the entire concentration interval, also at low concentrations, where the millivolt (y-axis) versus log canalyte (x-axis) potentiometric calibration curve is not linear. In the procedure, Ka is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anticocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides and aptamers are tested, as well as other small ligand molecules such as tetrakis(4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated Ka compared favorably to the value reported in the literature using surface plasmon resonance. The potentiometric titration approach called "concentration-related response potentiometry" is used to study molecular interaction for seven macromolecular target molecules and four small-molecule ligands.

  10. RapidRMSD: Rapid determination of RMSDs corresponding to motions of flexible molecules.

    Science.gov (United States)

    Neveu, Emilie; Popov, Petr; Hoffmann, Alexandre; Migliosi, Angelo; Besseron, Xavier; Danoy, Grégoire; Bouvry, Pascal; Grudinin, Sergei

    2018-03-15

    The root mean square deviation (RMSD) is one of the most used similarity criteria in structural biology and bioinformatics. Standard computation of the RMSD has a linear complexity with respect to the number of atoms in a molecule, making RMSD calculations time-consuming for the large-scale modeling applications, such as assessment of molecular docking predictions or clustering of spatially proximate molecular conformations. Previously we introduced the RigidRMSD algorithm to compute the RMSD corresponding to the rigid-body motion of a molecule. In this study we go beyond the limits of the rigid-body approximation by taking into account conformational flexibility of the molecule. We model the flexibility with a reduced set of collective motions computed with e.g. normal modes or principal component analysis. The initialization of our algorithm is linear in the number of atoms and all the subsequent evaluations of RMSD values between flexible molecular conformations depend only on the number of collective motions that are selected to model the flexibility. Therefore, our algorithm is much faster compared to the standard RMSD computation for large-scale modeling applications. We demonstrate the efficiency of our method on several clustering examples, including clustering of flexible docking results and molecular dynamics (MD) trajectories. We also demonstrate how to use the presented formalism to generate pseudo-random constant-RMSD structural molecular ensembles and how to use these in cross-docking. We provide the algorithm written in C ++ as the open-source RapidRMSD library governed by the BSD-compatible license, which is available at http://team.inria.fr/nano-d/software/RapidRMSD/. The constant-RMSD structural ensemble application and clustering of MD trajectories is available at http://team.inria.fr/nano-d/software/nolb-normal-modes/. sergei.grudinin@inria.fr. Supplementary data are available at Bioinformatics.

  11. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  12. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  13. Design and Application of a High-Temperature Linear Ion Trap Reactor

    Science.gov (United States)

    Jiang, Li-Xue; Liu, Qing-Yu; Li, Xiao-Na; He, Sheng-Gui

    2018-01-01

    A high-temperature linear ion trap reactor with hexapole design was homemade to study ion-molecule reactions at variable temperatures. The highest temperature for the trapped ions is up to 773 K, which is much higher than those in available reports. The reaction between V2O6 - cluster anions and CO at different temperatures was investigated to evaluate the performance of this reactor. The apparent activation energy was determined to be 0.10 ± 0.02 eV, which is consistent with the barrier of 0.12 eV calculated by density functional theory. This indicates that the current experimental apparatus is prospective to study ion-molecule reactions at variable temperatures, and more kinetic details can be obtained to have a better understanding of chemical reactions that have overall barriers. [Figure not available: see fulltext.

  14. Powerful effective one-electron Hamiltonian for describing many-atom interacting systems

    International Nuclear Information System (INIS)

    Lugo, J.O.; Vergara, L.I.; Bolcatto, P.G.; Goldberg, E.C.

    2002-01-01

    In this paper, we present an alternative way to build the effective one-electron picture of a many-atom interacting system. By simplifying the many-body general problem we present two different options for the bond-pair model Hamiltonian. We have found that the successive approximations in order to achieve the effective description have a dramatic influence on the result. Thus, only the model that introduces the correct renormalization in the diagonal term due to the overlap is able to reproduce, even in a quantitative fashion, the main properties of simple homonuclear diatomic molecules. The success of the model resides in the accurate definitions (free of parametrization) of the Hamiltonian terms, which, therefore, could be used to describe more complex interacting systems such as polyatomic molecules, adsorbed species, or atoms scattered by a surface

  15. Introductory quantum chemistry

    International Nuclear Information System (INIS)

    Chandra, A.K.

    1974-01-01

    This book on quantum chemistry is primarily intended for university students at the senior undergraduate level. It serves as an aid to the basic understanding of the important concepts of quantum mechanics introduced in the field of chemistry. Various chapters of the book are devoted to the following : (i) Waves and quanta, (ii) Operator concept in quantum chemistry, (iii) Wave mechanics of some simple systems, (iv) Perturbation theory, (v) Many-electron atoms and angular momenta (vi) Molecular orbital theory and its application to the electronic structure of diatomic molecules, (vii) Chemical bonding in polyatomic molecules and (viii) Chemical applications of Hellmann-Feynman theorem. At the end of each chapter, a set of problems is given and the answers to these problems are given at the end of the book. (A.K.)

  16. Resonances in electron-molecule scattering and photoionization

    International Nuclear Information System (INIS)

    Schneider, B.I.; Collins, L.A.

    1984-05-01

    The development of reliable theoretical models for calculating the decay of quasi-stationary states of molecular systems has become an important endeavor for theoretical chemists. The understanding and analysis of a wide variety of physical and chemical phenomena depend on a knowledge of the behavior of these states in both collisional and photoionization problems. In this article we describe the theory and calculation of these cross sections using our Linear Algebraic/Optical Potential method. The theory makes optimal use of the numerical methods developed to solve large sets of coupled integral equations and the bound state techniques used by quantum chemists. Calculations are presented for a representative class of diatomic and triatomic molecules at varying levels of sophistication and for collisional and photoionization cross sections. 48 references, 11 figures

  17. Lubricating and waxy esters, I. Synthesis, crystallization, and melt behavior of linear monoesters.

    Science.gov (United States)

    Bouzidi, Laziz; Li, Shaojun; Di Biase, Steve; Rizvi, Syed Q; Narine, Suresh S

    2012-01-01

    Four pure jojoba wax-like esters (JLEs), having carbon chain length of 36, 40 (two isomers) and 44, were prepared by Steglish esterification of fatty acids (or acid chlorides) with fatty alcohols at room temperature. Calorimetric and diffraction data was used to elucidate the phase behavior of the esters. The primary thermal parameters (crystallization and melting temperatures) obtained from the DSC of the symmetrical molecules correspond well with the carbon numbers of the JLEs. However, the data also suggests that carbon number is not the only factor since the symmetry of the molecule also plays a significant role in the phase behavior. Overall, the JLEs show very little polymorphic activity at the experimental conditions used, suggesting that they are likely to transform the same way during melting as well as crystallization, a characteristic which may be useful in designing new waxes and lubricants. The XRD data clearly show that the solid phase in all samples consists of a mixture of a β-phase and a β'-phase; fully distinguishable by their characteristic diffraction peaks. Subtle differences between the subcell patterns and phase development of the samples were observed. Different layering of the samples was also observed, understandably because of the chain length differences between the compounds. The long spacings were perfectly linearly proportional to the number of carbon atoms. The length of the ester layers with n carbon atoms can be calculated by a formula similar to that used for the layers in linear alkane molecules. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  18. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M

    2007-12-15

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  19. A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

    Science.gov (United States)

    Krishnan, M.

    2017-05-01

    We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or

  20. Solution of the Schrodinger Equation for a Diatomic Oscillator Using Linear Algebra: An Undergraduate Computational Experiment

    Science.gov (United States)

    Gasyna, Zbigniew L.

    2008-01-01

    Computational experiment is proposed in which a linear algebra method is applied to the solution of the Schrodinger equation for a diatomic oscillator. Calculations of the vibration-rotation spectrum for the HCl molecule are presented and the results show excellent agreement with experimental data. (Contains 1 table and 1 figure.)

  1. A theoretical perspective of the nature of hydrogen-bond types - the atoms in molecules approach

    Science.gov (United States)

    Vijaya Pandiyan, B.; Kolandaivel, P.; Deepa, P.

    2014-06-01

    Hydrogen bonds and their strength were analysed based on their X-H proton-donor bond properties and the parameters of the H-Y distance (Y proton acceptor). Strong, moderate and weak interactions in hydrogen-bond types were verified through the proton affinities of bases (PA), deprotanation enthalpies of acids (DPE) and the chemical shift (σ). The aromaticity and anti-aromaticity were analysed by means of the NICS (0) (nucleus-independent chemical shift), NICS (1) and ΔNICS (0), ΔNICS (1) of hydrogen-bonded molecules. The strength of a hydrogen bond depends on the capacity of hydrogen atom engrossing into the electronegative acceptor atom. The correlation between the above parameters and their relations were discussed through curve fitting. Bader's theory of atoms in molecules has been applied to estimate the occurrence of hydrogen bonds through eight criteria reported by Popelier et al. The lengths and potential energy shifts have been found to have a strong negative linear correlation, whereas the lengths and Laplacian shifts have a strong positive linear correlation. This study illustrates the common factors responsible for strong, moderate and weak interactions in hydrogen-bond types.

  2. An advanced kinetic theory for morphing continuum with inner structures

    Science.gov (United States)

    Chen, James

    2017-12-01

    Advanced kinetic theory with the Boltzmann-Curtiss equation provides a promising tool for polyatomic gas flows, especially for fluid flows containing inner structures, such as turbulence, polyatomic gas flows and others. Although a Hamiltonian-based distribution function was proposed for diatomic gas flow, a general distribution function for the generalized Boltzmann-Curtiss equations and polyatomic gas flow is still out of reach. With assistance from Boltzmann's entropy principle, a generalized Boltzmann-Curtiss distribution for polyatomic gas flow is introduced. The corresponding governing equations at equilibrium state are derived and compared with Eringen's morphing (micropolar) continuum theory derived under the framework of rational continuum thermomechanics. Although rational continuum thermomechanics has the advantages of mathematical rigor and simplicity, the presented statistical kinetic theory approach provides a clear physical picture for what the governing equations represent.

  3. Simulations of smog-chamber experiments using the two-dimensional volatility basis set: linear oxygenated precursors.

    Science.gov (United States)

    Chacon-Madrid, Heber J; Murphy, Benjamin N; Pandis, Spyros N; Donahue, Neil M

    2012-10-16

    We use a two-dimensional volatility basis set (2D-VBS) box model to simulate secondary organic aerosol (SOA) mass yields of linear oxygenated molecules: n-tridecanal, 2- and 7-tridecanone, 2- and 7-tridecanol, and n-pentadecane. A hybrid model with explicit, a priori treatment of the first-generation products for each precursor molecule, followed by a generic 2D-VBS mechanism for later-generation chemistry, results in excellent model-measurement agreement. This strongly confirms that the 2D-VBS mechanism is a predictive tool for SOA modeling but also suggests that certain important first-generation products for major primary SOA precursors should be treated explicitly for optimal SOA predictions.

  4. An approach to global rovibrational analysis based on anharmonic ladder operators: Application to Hydrogen Selenide (H{sub 2}{sup 80}Se)

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez-Bajo, O. [Dpto. Fisica Aplicada, Facultad de Ciencias Experimentales, Universidad de Huelva, 21071 Huelva (Spain); Carvajal, M., E-mail: miguel.carvajal@dfa.uhu.es [Dpto. Fisica Aplicada, Facultad de Ciencias Experimentales, Universidad de Huelva, 21071 Huelva (Spain); Perez-Bernal, F. [Dpto. Fisica Aplicada, Facultad de Ciencias Experimentales, Universidad de Huelva, 21071 Huelva (Spain)

    2012-01-02

    Graphical abstract: Schematic diagram of a bent triatomic molecule, depicting the atom numbering, and molecular axis system. An algebraic approach to perform global rovibrational analysis is presented. Highlights: Black-Right-Pointing-Pointer Novel approach for a global rovibrational analysis of polyatomic molecules spectra. Black-Right-Pointing-Pointer One-dimensional vibron model limit combined with rotational degrees of freedom. Black-Right-Pointing-Pointer Phase space Hamiltonian written in terms of anharmonic ladder operators. Black-Right-Pointing-Pointer Algebraic calculations performed with a symmetry-adapted rovibrational basis. Black-Right-Pointing-Pointer Description of the rovibrational spectrum of H{sub 2}Se in the ground electronic state. - Abstract: An algebraic approach to perform global rovibrational analysis of molecular spectra is presented. The approach combines the one-dimensional limit of the vibron model with rotational degrees of freedom. The model is based on the expression of the phase space Hamiltonian in terms of anharmonic ladder operators and the use of a symmetry-adapted basis set given by the linear combination of products of local vibrational and rotational wavefunctions. As an example we model the rovibrational spectra of a bent triatomic molecule, providing a global analysis for vibrational bands up to polyad 12 and J{sub max} = 5 of Hydrogen Selenide (H{sub 2}Se). Satisfactory fits of vibrational and rovibrational energies are obtained. A prediction of 2579 rovibrational energies up to J Less-Than-Or-Slanted-Equal-To 5 and polyad 12 for the 140 lowest vibrational bands is also obtained. A possible extension of the model to reach spectroscopic quality results in larger molecular systems is also given.

  5. Entropic potential field formed for a linear-motor protein near a filament: Statistical-mechanical analyses using simple models.

    Science.gov (United States)

    Amano, Ken-Ichi; Yoshidome, Takashi; Iwaki, Mitsuhiro; Suzuki, Makoto; Kinoshita, Masahiro

    2010-07-28

    We report a new progress in elucidating the mechanism of the unidirectional movement of a linear-motor protein (e.g., myosin) along a filament (e.g., F-actin). The basic concept emphasized here is that a potential field is entropically formed for the protein on the filament immersed in solvent due to the effect of the translational displacement of solvent molecules. The entropic potential field is strongly dependent on geometric features of the protein and the filament, their overall shapes as well as details of the polyatomic structures. The features and the corresponding field are judiciously adjusted by the binding of adenosine triphosphate (ATP) to the protein, hydrolysis of ATP into adenosine diphosphate (ADP)+Pi, and release of Pi and ADP. As the first step, we propose the following physical picture: The potential field formed along the filament for the protein without the binding of ATP or ADP+Pi to it is largely different from that for the protein with the binding, and the directed movement is realized by repeated switches from one of the fields to the other. To illustrate the picture, we analyze the spatial distribution of the entropic potential between a large solute and a large body using the three-dimensional integral equation theory. The solute is modeled as a large hard sphere. Two model filaments are considered as the body: model 1 is a set of one-dimensionally connected large hard spheres and model 2 is a double helical structure formed by two sets of connected large hard spheres. The solute and the filament are immersed in small hard spheres forming the solvent. The major findings are as follows. The solute is strongly confined within a narrow space in contact with the filament. Within the space there are locations with sharply deep local potential minima along the filament, and the distance between two adjacent locations is equal to the diameter of the large spheres constituting the filament. The potential minima form a ringlike domain in model 1

  6. Isotope separation using vibrationally excited molecules

    International Nuclear Information System (INIS)

    Woodroffe, J.A.; Keck, J.C.

    1979-01-01

    Vibrational excitation of molecules having components of a selected isotope type is used to produce a conversion from vibrational to translational excitation of the molecules by collision with the molecules of a heavy carrier gas. The resulting difference in translaton between the molecules of the selected isotope type and all other molecules of the same compound permits their separate collection. When applied to uranium enrichment, a subsonic cryogenic flow of molecules of uranium hexafluoride in combination with an argon carrier gas is directed through a cooled chamber that is illuminated by laser radiaton tuned to vibrationally excite the uranium hexafluoride molecules of a specific uranium isotope. The excited molecules collide with carrier gas molecules, causing a conversion of the excitation energy into a translation of the excited molecule, which results in a higher thermal energy or diffusivity than that of the other uranium hexafluoride molecules. The flowing molecules including the excited molecules directly enter a set of cryogenically cooled channels. The higher thermal velocity of the excited molecules increases the probability of their striking a collector surface. The molecules which strike this surface immediately condense. After a predetermined thickness of molecules is collected on the surface, the flow of uranium hexafluoride is interrupted and the chamber heated to the point of vaporization of the collected hexafluoride, permitting its removal. (LL)

  7. Nanoscale contacts to organic molecules based on layered semiconductor substrates

    Energy Technology Data Exchange (ETDEWEB)

    Strobel, Sebastian

    2009-06-15

    This work reports on the integration of organic molecules as nanoelectronic device units on semiconductor substrates. Two novel preparation methods for sub-10-nm separated metal electrodes are presented using current microelectronics process technology. The first method utilises AlGaAs/GaAs heterostructures grown by molecular beam epitaxy (MBE) as mold to create planar metal electrodes employing a newly developed, high resolution nanotransfer printing (nTP) process. The second method uses commercially available Silicon-on-Insulator (SOI) substrates as base material for the fabrication of nanogap electrode devices. This sandwich-like material stack consists of a silicon substrate, a thin silicon oxide layer, and a capping silicon layer on top. Electronic transport measurements verified their excellent electrical properties at liquid helium temperatures. Specifically tailored nanogap devices featured an electrode insulation in the GW range even up to room temperature as well as within aqueous electrolyte solution. Finally, the well defined layer architecture facilitated the fabrication of electrodes with gap separations below-10-nm to be directly bridged by molecules. Approximately 12-nm-long conjugated molecules with extended -electron system were assembled onto the devices from solution. A large conductance gap was observed with a steep increase in current at a bias voltage of V{sub T}{approx}{+-}1.5 V. Theoretical calculations based on density functional theory and non-equilibrium Green's function formalism confirmed the measured non-linear IV-characteristics qualitatively and lead to the conclusion that the conductance gap mainly originates from the oxygen containing linker. Temperature dependent investigations of the conductance indicated a hopping charge transport mechanism through the central part of the molecule for bias voltages near but below V{sub T}. (orig.)

  8. Before the Ring: synthesis of linear organic molecules in astrophysical ices by low energy electron impact

    Science.gov (United States)

    Huels, Michael A.; Bass Andrew, D.; Mirsaleh-Kohan, Nasrin; Sanche, Leon

    The question of the origin for the building blocks of life, either synthesized here on earth, or in space [1], has been the subject of much debate, experimental investigation, or astronomical observation, much of it stimulated by the early experiments of Miller [2], and subsequent space radiation related variations thereof [3-5]. And while the precise details of the formation of even the simplest biomolecules that make up life on earth still remain shrouded inmystery, one of the notions that persist throughout the debate is that the building blocks of life, such as amino-acids, or even the cyclic components of RNA and DNA, or other cyclic hydrocarbons (e.g. PHAs), where synthesized via radiolysis [6] either in the earths proto-atmosphere, its early oceans, or in the near interstellar space surrounding the early earth. Here we provide experimental evidence for the hypothesis that interactions of low energy secondary electrons and ions, formed during the radiolysis of matter, with atoms and molecules in the medium, may have played, and may still play an important role in the chemical transformation of astrophysical or planetary surface ices [7], where they lead to the synthesis of more complex chemical species from less complex, naturally occurring components. We report the synthesis and desorption of new chemical species from simple molecular surface ices, containing CH4 / CD4 , C2 D2 , O2 , CO, CO2 , or N2 in various combination mixtures, irradiated by low energy (CO+ (n = 1-3), among others. The formation of all these linear, pre-biotic molecular species, produced here by electron initiated cation-reactions in simple molecular films, suggests that similar mechanisms likely precede the synthesis of life's most basic cyclic molecular components in planetary, or astrophysical surface ices that are continuously subjected to the types of space radiations (UV, X-or -ray, or heavy ions) that can generate such low energy secondary electrons. [Funded by NSERC and Canadian

  9. Scattering and stopping of swift diatomic molecules under Coulomb explosion

    International Nuclear Information System (INIS)

    Sigmund, P.

    1992-01-01

    The scattering and stopping of the fragments of a fast diatomic molecule under Coulomb explosion has been analysed theoretically. The central assumption in the scheme is the dominance of Coulomb explosion, while electronic stopping (including wake forces) and elastic scattering are treated as perturbations. Charge exchange has been neglected. Coulomb images of penetration phenomena are heavily distorted. For small penetrated layer thicknesses, images appear contracted in the direction of the molecular axis, and expanded perpendicular to it. This distortion is described quantitatively by a linear transformation. General expressions have been derived for the effect of continuous and stochastic forces on the distribution of fragment velocities from Coulomb explosion (the ''ring pattern''). Moreover, relations have been found that allow to scale velocity distributions valid in the absence of Coulomb explosion into distributions allowing for Coulomb explosion. Applications concern the shift in ring pattern due to electronic stopping, the lateral broadening due to multiple scattering, and the effect of zero-point motion on the Coulomb image of a molecule. (orig.)

  10. Scattering and stopping of swift diatomic molecules under Coulomb explosion

    International Nuclear Information System (INIS)

    Sigmund, P.

    1991-01-01

    The scattering and stopping of the fragments of a fast diatomic molecule under Coulomb explosion has been analyzed theoretically. The central assumption in the scheme is the dominance of Coulomb explosion, while electronic stopping (including wake forces) and elastic scattering are treated as perturbations. Charge exchange has been neglected. Coulomb images of penetration phenomena are heavily distorted. For small penetrated layer thicknesses, images appear contracted in the direction of the molecular axis, and expanded perpendicular to it. This distortion is described quantitatively by a linear transformation. General expressions have been derived for the effect of continuous and stochastic forces on the distribution of fragment velocities from Coulomb explosion (the ''ring pattern''). Moreover, relations have been found that allow to scale velocity distributions valid in the absence of Coulomb explosion into distributions allowing for Coulomb explosion. Applications concern the shift in ring pattern due to electronic stopping, the lateral broadening due to multiple scattering and the effect of zero-point motion on the Coulomb image of a molecule. 14 refs., 5 figs

  11. Selective excitation, relaxation, and energy channeling in molecular systems

    International Nuclear Information System (INIS)

    Rhodes, W.C.

    1993-08-01

    Research involves theoretical studies of response, relaxation, and correlated motion in time-dependent behavior of large molecular systems ranging from polyatomic molecules to protein molecules in their natural environment. Underlying theme is subsystem modulation dynamics. Main idea is that quantum mechanical correlations between components of a system develop with time, playing a major role in determining the balance between coherent and dissipative forces. Central theme is interplay of coherence and dissipation in determining the nature of dynamic structuring and energy flow in molecular transformation mechanisms. Subsystem equations of motion are being developed to show how nonlinear, dissipative dynamics of a particular subsystem arise from correlated interactions with the rest of the system (substituent groups, solvent, lattice modes, etc.); one consequence is resonance structures and networks. Quantum dynamics and thermodynamics are being applied to understand control and energy transfer mechanisms in biological functions of protein molecules; these mechanisms are both global and local. Besides the above theory, the research deals with phenomenological aspects of molecular systems

  12. Direct Visualization of Valence Electron Motion Using Strong-Field Photoelectron Holography

    Science.gov (United States)

    He, Mingrui; Li, Yang; Zhou, Yueming; Li, Min; Cao, Wei; Lu, Peixiang

    2018-03-01

    Watching the valence electron move in molecules on its intrinsic timescale has been one of the central goals of attosecond science and it requires measurements with subatomic spatial and attosecond temporal resolutions. The time-resolved photoelectron holography in strong-field tunneling ionization holds the promise to access this realm. However, it remains to be a challenging task hitherto. Here we reveal how the information of valence electron motion is encoded in the hologram of the photoelectron momentum distribution (PEMD) and develop a novel approach of retrieval. As a demonstration, applying it to the PEMDs obtained by solving the time-dependent Schrödinger equation for the prototypical molecule H2+ , the attosecond charge migration is directly visualized with picometer spatial and attosecond temporal resolutions. Our method represents a general approach for monitoring attosecond charge migration in more complex polyatomic and biological molecules, which is one of the central tasks in the newly emerging attosecond chemistry.

  13. Molecular beam studies of reaction dynamics

    International Nuclear Information System (INIS)

    Lee, Yuan T.

    1991-03-01

    The major thrust of this research project is to elucidate detailed dynamics of simple elementary reactions that are theoretically important and to unravel the mechanism of complex chemical reactions or photochemical processes that play important roles in many macroscopic processes. Molecular beams of reactants are used to study individual reactive encounters between molecules or to monitor photodissociation events in a collision-free environment. Most of the information is derived from measurement of the product fragment energy, angular, and state distributions. Recent activities are centered on the mechanisms of elementary chemical reactions involving oxygen atoms with unsaturated hydrocarbons, the dynamics of endothermic substitution reactions, the dependence of the chemical reactivity of electronically excited atoms on the alignment of excited orbitals, the primary photochemical processes of polyatomic molecules, intramolecular energy transfer of chemically activated and locally excited molecules, the energetics of free radicals that are important to combustion processes, the infrared-absorption spectra of carbonium ions and hydrated hydronium ions, and bond-selective photodissociation through electric excitation

  14. Molecular beam studies of reaction dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y.T. [Lawrence Berkeley Laboratory, CA (United States)

    1993-12-01

    The major thrust of this research project is to elucidate detailed dynamics of simple elementary reactions that are theoretically important and to unravel the mechanism of complex chemical reactions or photochemical processes that play important roles in many macroscopic processes. Molecular beams of reactants are used to study individual reactive encounters between molecules or to monitor photodissociation events in a collision-free environment. Most of the information is derived from measurement of the product fragment energy, angular, and state distributions. Recent activities are centered on the mechanisms of elementary chemical reactions involving oxygen atoms with unsaturated hydrocarbons, the dynamics of endothermic substitution reactions, the dependence of the chemical reactivity of electronically excited atoms on the alignment of excited orbitals, the primary photochemical processes of polyatomic molecules, intramolecular energy transfer of chemically activated and locally excited molecules, the energetics of free radicals that are important to combustion processes, the infrared-absorption spectra of carbonium ions and hydrated hydronium ions, and bond-selective photodissociation through electric excitation.

  15. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Coupled-cluster treatment of molecular strong-field ionization

    Science.gov (United States)

    Jagau, Thomas-C.

    2018-05-01

    Ionization rates and Stark shifts of H2, CO, O2, H2O, and CH4 in static electric fields have been computed with coupled-cluster methods in a basis set of atom-centered Gaussian functions with a complex-scaled exponent. Consideration of electron correlation is found to be of great importance even for a qualitatively correct description of the dependence of ionization rates and Stark shifts on the strength and orientation of the external field. The analysis of the second moments of the molecular charge distribution suggests a simple criterion for distinguishing tunnel and barrier suppression ionization in polyatomic molecules.

  17. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  18. Linearly and circularly polarized laser photoinduced molecular order in azo dye doped polymer films

    Directory of Open Access Journals (Sweden)

    Saad Bendaoud

    2017-01-01

    Full Text Available Photo-induced behavior of Azo Disperse one (AZD1 doped Poly(Methyl MethAcrylate (PMMA using both linear and circular polarized light is studied. The anisotropy is not erased by the circular polarization light. The circular polarization light combined with relatively long lifetime of the cis state in azo dye doped polymers activate all transverse directions of the angular hole burning through the spot in the film inducing anisotropy. Under circular polarized light, there is no orientation perpendicularly to the helex described by the rotating electric field vector, trans molecules reorients in the propagation direction of the pump beam. The polarization state of the probe beam after propagation through the pumped spot depends strongly on the angle of incidence of both pump and probe beams on the input face. In the case where circular polarized pump and probe beams are under the same angle of incidence, the probe beam “sees” anisotropic film as if it is isotropic. Results of this work shows the possibility to reorient azobenzene-type molecules in two orthogonal directions using alternately linearly and circularly polarized beams.

  19. Electron Accumulative Molecules.

    Science.gov (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  20. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  1. The Molecule Cloud - compact visualization of large collections of molecules

    Directory of Open Access Journals (Sweden)

    Ertl Peter

    2012-07-01

    Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large

  2. Challenges for single molecule electronic devices with nanographene and organic molecules. Do single molecules offer potential as elements of electronic devices in the next generation?

    Science.gov (United States)

    Enoki, Toshiaki; Kiguchi, Manabu

    2018-03-01

    Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.

  3. Linear versus non-linear supersymmetry, in general

    Energy Technology Data Exchange (ETDEWEB)

    Ferrara, Sergio [Theoretical Physics Department, CERN,CH-1211 Geneva 23 (Switzerland); INFN - Laboratori Nazionali di Frascati,Via Enrico Fermi 40, I-00044 Frascati (Italy); Department of Physics and Astronomy, UniversityC.L.A.,Los Angeles, CA 90095-1547 (United States); Kallosh, Renata [SITP and Department of Physics, Stanford University,Stanford, California 94305 (United States); Proeyen, Antoine Van [Institute for Theoretical Physics, Katholieke Universiteit Leuven,Celestijnenlaan 200D, B-3001 Leuven (Belgium); Wrase, Timm [Institute for Theoretical Physics, Technische Universität Wien,Wiedner Hauptstr. 8-10, A-1040 Vienna (Austria)

    2016-04-12

    We study superconformal and supergravity models with constrained superfields. The underlying version of such models with all unconstrained superfields and linearly realized supersymmetry is presented here, in addition to the physical multiplets there are Lagrange multiplier (LM) superfields. Once the equations of motion for the LM superfields are solved, some of the physical superfields become constrained. The linear supersymmetry of the original models becomes non-linearly realized, its exact form can be deduced from the original linear supersymmetry. Known examples of constrained superfields are shown to require the following LM’s: chiral superfields, linear superfields, general complex superfields, some of them are multiplets with a spin.

  4. Linear versus non-linear supersymmetry, in general

    International Nuclear Information System (INIS)

    Ferrara, Sergio; Kallosh, Renata; Proeyen, Antoine Van; Wrase, Timm

    2016-01-01

    We study superconformal and supergravity models with constrained superfields. The underlying version of such models with all unconstrained superfields and linearly realized supersymmetry is presented here, in addition to the physical multiplets there are Lagrange multiplier (LM) superfields. Once the equations of motion for the LM superfields are solved, some of the physical superfields become constrained. The linear supersymmetry of the original models becomes non-linearly realized, its exact form can be deduced from the original linear supersymmetry. Known examples of constrained superfields are shown to require the following LM’s: chiral superfields, linear superfields, general complex superfields, some of them are multiplets with a spin.

  5. Indomethacin induced gastropathy in CD18, intercellular adhesion molecule 1, or P-selectin deficient mice

    Science.gov (United States)

    Morise, Z; Granger, D; Fuseler, J; Anderson, D; Grisham, M

    1999-01-01

    BACKGROUND—Neutrophil-endothelial cell interactions are thought to play a critical role in the pathophysiology of non-steroidal anti-inflammatory drug (NSAID) induced gastropathy.
AIMS—To optimise a mouse model of NSAID induced gastropathy and to evaluate the importance of adhesion molecules using adhesion molecule deficient mice.
METHODS—Gastropathy was induced in C57BL/6 mice or their adhesion molecule deficient counterparts via oral administration of indomethacin (20 mg/kg). Lesion scores, mucosal permeability, and histopathology were used to assess gastric mucosal injury.
RESULTS—Intragastric administration of indomethacin induced linear haemorrhagic mucosal lesions, primarily in the corpus of the stomach that were first observed at six hours. These lesions continued to develop over the next six hours with maximal lesion scores and mucosal permeabilities at 12 hours. When indomethacin was administered to mice deficient in CD18, intercellular adhesion molecule 1 (ICAM-1), or P-selectin, there were significant decreases in lesion scores compared with their C57BL/6 controls. In addition, mucosal permeabilities were found to be significantly lower in CD18 or ICAM-1 deficient mice observed at 12 hours.
CONCLUSION—Certain leucocyte and endothelial cell adhesion molecules are important determinants for full expression of indomethacin induced gastropathy. It is proposed that this modification of the mouse model may be useful for the investigation of other pathophysiological mechanisms of NSAID induced gastropathy.


Keywords: indomethacin; gastropathy; cyclooxygenase; intercellular adhesion molecule; VCAM; vascular cell adhesion molecule; P-selectin PMID:10486359

  6. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  7. Preparation of translationally cold neutral molecules.

    Science.gov (United States)

    Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas

    2011-01-01

    Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.

  8. Single-Molecule Electronics with Cross- Conjugated Molecules: Quantum Interference, IETS and Non-Equilibrium "Temperatures"

    DEFF Research Database (Denmark)

    Jørgensen, Jacob Lykkebo

    Abstract The idea of using single-molecules as components in electronic devices is fas- cinating. For this idea to come into fruition, a number of technical and theo- retical challenges must be overcome. In this PhD thesis, the electron-phonon interaction is studied for a special class of molecules......, which is characterised by destructive quantum interference. The molecules are cross-conjugated, which means that the two parts of the molecules are conjugated to a third part, but not to each other. This gives rise to an anti-resonance in the trans- mission. In the low bias and low temperature regime......-conjugated molecules. We nd that the vibrational modes that would be expected to dominate, following the propensity, rules are very weak. Instead, other modes are found to be the dominant ones. We study this phenomenon for a number of cross-conjugated molecules, and link these ndings to the anti...

  9. Single Molecule Electronics and Devices

    Science.gov (United States)

    Tsutsui, Makusu; Taniguchi, Masateru

    2012-01-01

    The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345

  10. Ionization of molecules by electron impact: Differential and total cross sections

    Energy Technology Data Exchange (ETDEWEB)

    Rezkallah, Z. [Laboratoire de Physique Quantique et Systemes Dynamiques, Departement de physique, Faculte des sciences, Universite Ferhat Abbas, Setif 19000 (Algeria); Houamer, S., E-mail: hosalim@yahoo.com [Laboratoire de Physique Quantique et Systemes Dynamiques, Departement de physique, Faculte des sciences, Universite Ferhat Abbas, Setif 19000 (Algeria); Dal Cappello, C. [Laboratoire de Physique Moleculaire et des Collisions, Universite Paul Verlaine-Metz, Institut de Physique, 1 Boulevard Arago, 57078 Metz Cedex 3 (France); Charpentier, I. [Laboratoire de Physique et Mecanique des Materiaux, Universite Paul Verlaine-Metz UMR 7554, ile du Saulcy, 57045 Metz Cedex 1 (France); Roy, A.C. [School of Mathematical Sciences, Ramakrishna Mission Vivekananda University, Belur Math 711202, West Bengal (India)

    2011-12-01

    The first Born approximation is applied to calculate differential and total ionization cross sections of a set of small molecules, namely, HF, H{sub 2}O, NH{sub 3} and CH{sub 4} by electron impact. The molecular targets are described by single center molecular orbitals consisting of linear combinations of atomic orbitals (MO-LCAO). First, we have considered electron momentum spectroscopy experiments to check the accuracy of the wave functions. The triply, doubly, singly differential and total cross sections are then evaluated in a systematic way for a variety of kinematics. The results are discussed and compared with experiments.

  11. EDITORIAL: Focus on Cold and Ultracold Molecules FOCUS ON COLD AND ULTRACOLD MOLECULES

    Science.gov (United States)

    Carr, Lincoln D.; Ye, Jun

    2009-05-01

    Cold and ultracold molecules are the next wave of ultracold physics, giving rise to an exciting array of scientific opportunities, including many body physics for novel quantum phase transitions, new states of matter, and quantum information processing. Precision tests of fundamental physical laws benefit from the existence of molecular internal structure with exquisite control. The study of novel collision and reaction dynamics will open a new chapter of quantum chemistry. Cold molecules bring together researchers from a variety of fields, including atomic, molecular, and optical physics, chemistry and chemical physics, quantum information science and quantum simulations, condensed matter physics, nuclear physics, and astrophysics, a truly remarkable synergy of scientific explorations. For the past decade there have been steady advances in direct cooling techniques, from buffer-gas cooling to cold molecular beams to electro- and magneto-molecular decelerators. These techniques have allowed a large variety of molecules to be cooled for pioneering studies. Recent amazing advances in experimental techniques combining the ultracold and the ultraprecise have furthermore brought molecules to the point of quantum degeneracy. These latter indirect cooling techniques magnetically associate atoms from a Bose-Einstein condensate and/or a quantum degenerate Fermi gas, transferring at 90% efficiency highly excited Fano-Feshbach molecules, which are on the order of 10 000 Bohr radii in size, to absolute ground state molecules just a few Bohr across. It was this latter advance, together with significant breakthroughs in internal state manipulations, which inspired us to coordinate this focus issue now, and is the reason why we say the next wave of ultracold physics has now arrived. Whether directly or indirectly cooled, heteronuclear polar molecules offer distinct new features in comparison to cold atoms, while sharing all of their advantages (purity, high coherence

  12. Single-Molecule Photocurrent at a Metal-Molecule-Semiconductor Junction.

    Science.gov (United States)

    Vezzoli, Andrea; Brooke, Richard J; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J

    2017-11-08

    We demonstrate here a new concept for a metal-molecule-semiconductor nanodevice employing Au and GaAs contacts that acts as a photodiode. Current-voltage traces for such junctions are recorded using a STM, and the "blinking" or "I(t)" method is used to record electrical behavior at the single-molecule level in the dark and under illumination, with both low and highly doped GaAs samples and with two different types of molecular bridge: nonconjugated pentanedithiol and the more conjugated 1,4-phenylene(dimethanethiol). Junctions with highly doped GaAs show poor rectification in the dark and a low photocurrent, while junctions with low doped GaAs show particularly high rectification ratios in the dark (>10 3 for a 1.5 V bias potential) and a high photocurrent in reverse bias. In low doped GaAs, the greater thickness of the depletion layer not only reduces the reverse bias leakage current, but also increases the volume that contributes to the photocurrent, an effect amplified by the point contact geometry of the junction. Furthermore, since photogenerated holes tunnel to the metal electrode assisted by the HOMO of the molecular bridge, the choice of the latter has a strong influence on both the steady state and transient metal-molecule-semiconductor photodiode response. The control of junction current via photogenerated charge carriers adds new functionality to single-molecule nanodevices.

  13. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  14. Nonadiabatic Response Model of Laser-Induced Ultrafast π-Electron Rotations in Chiral Aromatic Molecules

    International Nuclear Information System (INIS)

    Kanno, Manabu; Kono, Hirohiko; Fujimura, Yuichi; Lin, Sheng H.

    2010-01-01

    We theoretically investigated the nonadiabatic couplings between optically induced π-electron rotations and molecular vibrations in a chiral aromatic molecule irradiated by a nonhelical, linearly polarized laser pulse. The results of wave packet dynamics simulation show that the vibrational amplitudes strongly depend on the initial rotation direction, clockwise or counterclockwise, which is controlled by the polarization direction of the incident pulse. This suggests that attosecond π-electron rotations can be observed by spectroscopic detection of femtosecond molecular vibrations.

  15. [Detection of the functionally active domains in the molecule of the lethal factor of the anthrax exotoxin].

    Science.gov (United States)

    Noskov, A N; Kravchenko, T B; Noskova, V P

    1996-01-01

    Three functional domains were revealed in the molecule of the lethal factor of B. anthracis. They are located in the linear structure of the molecula as follows: the associative domain occupies the area from Lys39 to Met242, the stabilizing domain from Leu517 to Lys614, and the effector domain still further to the COOH-terminal Lys mino acid.

  16. Highly Accurate and Precise Infrared Transition Frequencies of the H_3^+ Cation

    Science.gov (United States)

    Perry, Adam J.; Markus, Charles R.; Hodges, James N.; Kocheril, G. Stephen; McCall, Benjamin J.

    2016-06-01

    Calculation of ab initio potential energy surfaces for molecules to high accuracy is only manageable for a handful of molecular systems. Among them is the simplest polyatomic molecule, the H_3^+ cation. In order to achieve a high degree of accuracy (Diniz, J.R. Mohallem, A. Alijah, M. Pavanello, L. Adamowicz, O.L. Polyansky, J. Tennyson Phys. Rev. A (2013), 88, 032506 O.L. Polyansky, A. Alijah, N.F. Zobov, I.I. Mizus, R.I. Ovsyannikov, J. Tennyson, L. Lodi, T. Szidarovszky, A.G. Császár Phil. Trans. R. Soc. A (2012), 370, 5014 J.N. Hodges, A.J. Perry, P.A. Jenkins II, B.M. Siller, B.J. McCall J. Chem. Phys. (2013), 139, 164201 A.J. Perry, J.N. Hodges, C.R. Markus, G.S. Kocheril, B.J. McCall J. Molec. Spectrosc. (2015), 317, 71-73.

  17. Nonunique and nonuniform mapping in few-body Coulomb-explosion imaging

    Science.gov (United States)

    Sayler, A. M.; Eckner, E.; McKenna, J.; Esry, B. D.; Carnes, K. D.; Ben-Itzhak, I.; Paulus, G. G.

    2018-03-01

    Much of our knowledge of molecular geometry and interaction dynamics comes from indirect measurements of the molecular fragments following breakup. This technique—Coulomb-explosion imaging (CEI), i.e., determining the initial molecular configuration of a system from the momenta of the resulting fragments using knowledge of the particle interactions—is one of the fundamental tools of molecular physics. Moreover, CEI has been a staple of molecular studies for decades. Here we show that one often cannot assign a unique initial configuration to the few-body breakup of a polyatomic molecule given the measurement of the resulting fragments' momenta. Specifically, multiple initial configurations can result in identical momenta for a molecule breaking into three or more parts. Further, the nonunique and nonuniform mapping from the initial configuration to the measured momenta also significantly complicates the determination of molecular alignment at the time of breakup.

  18. Stability of matter-antimatter molecules

    International Nuclear Information System (INIS)

    Wong, Cheuk-Yin; Lee, Teck-Ghee

    2011-01-01

    Highlights: → We examine stability of matter-antimatter molecules with four constituents. → The binding of matter-antimatter molecules is a common phenomenon. → Molecules have bound states if ratio of constituent masses greater than ∼4. → We evaluate molecular binding energies and annihilation lifetimes. - Abstract: We examine the stability of matter-antimatter molecules by reducing the four-body problem into a simpler two-body problem with residual interactions. We find that matter-antimatter molecules with constituents (m 1 + ,m 2 - ,m-bar 2 + ,m-bar 1 - ) possess bound states if their constituent mass ratio m 1 /m 2 is greater than about 4. This stability condition suggests that the binding of matter-antimatter molecules is a rather common phenomenon. We evaluate the binding energies and eigenstates of matter-antimatter molecules (μ + e - )-(e + μ - ),(π + e - )-(e + π - ),(K + e - )-(e + K - ),(pe - )-(e + p-bar),(pμ - )-(μ + p-bar), and (K + μ - ) - (μ + K - ), which satisfy the stability condition. We estimate the molecular annihilation lifetimes in their s states.

  19. Foundations of linear and generalized linear models

    CERN Document Server

    Agresti, Alan

    2015-01-01

    A valuable overview of the most important ideas and results in statistical analysis Written by a highly-experienced author, Foundations of Linear and Generalized Linear Models is a clear and comprehensive guide to the key concepts and results of linear statistical models. The book presents a broad, in-depth overview of the most commonly used statistical models by discussing the theory underlying the models, R software applications, and examples with crafted models to elucidate key ideas and promote practical model building. The book begins by illustrating the fundamentals of linear models,

  20. Modelling of energetic molecule-surface interactions

    International Nuclear Information System (INIS)

    Kerford, M.

    2000-09-01

    This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)

  1. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    International Nuclear Information System (INIS)

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana

    2014-01-01

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode

  2. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  3. The optimization of the nonlinear parameters in the transcorrelated method: the hydrogen molecule

    International Nuclear Information System (INIS)

    Huggett, J.P.; Armour, E.A.G.

    1976-01-01

    The nonlinear parameters in a transcorrelated calculation of the groundstate energy and wavefunction of the hydrogen molecule are optimized using the method of Boys and Handy (Proc. R. Soc. A.; 309:195 and 209, 310:43 and 63, 311:309 (1969)). The method gives quite accurate results in all cases and in some cases the results are highly accurate. This is the first time the method has been applied to the optimization of a term in the correlation function which depends linearly on the interelectronic distance. (author)

  4. On the linear programming bound for linear Lee codes.

    Science.gov (United States)

    Astola, Helena; Tabus, Ioan

    2016-01-01

    Based on an invariance-type property of the Lee-compositions of a linear Lee code, additional equality constraints can be introduced to the linear programming problem of linear Lee codes. In this paper, we formulate this property in terms of an action of the multiplicative group of the field [Formula: see text] on the set of Lee-compositions. We show some useful properties of certain sums of Lee-numbers, which are the eigenvalues of the Lee association scheme, appearing in the linear programming problem of linear Lee codes. Using the additional equality constraints, we formulate the linear programming problem of linear Lee codes in a very compact form, leading to a fast execution, which allows to efficiently compute the bounds for large parameter values of the linear codes.

  5. Spectroscopic investigations using density functional theory on 2-methoxy- 4(phenyliminomethyl)phenol: A non linear optical material

    Science.gov (United States)

    Hijas, K. M.; Madan Kumar, S.; Byrappa, K.; Geethakrishnan, T.; Jeyaram, S.; Nagalakshmi, R.

    2018-03-01

    Single crystals of 2-methoxy-4(phenyliminomethyl)phenol were grown from ethanol by slow evaporation solution growth technique. Single crystal X-ray diffraction experiment reveals the crystallization in orthorhombic system having non-centrosymmetric space group C2221. Geometrical optimization by density functional theory method was carried out using Gaussian program and compared with experimental results. Detailed experimental and theoretical vibrational analyses were carried out and the results were correlated to find close agreement. Thermal analyses show the material is thermally stable with a melting point of 159 °C. Natural bond orbital analysis was carried out to explain charge transfer interactions through hydrogen bonding. Relatively smaller HOMO-LUMO band gap favors the non linear optical activity of the molecule. Natural population analysis and molecular electrostatic potential calculations visualize the charge distribution in an isolated molecule. Calculated first-order molecular hyperpolarizability and preliminary second harmonic generation test carried out using Kurtz-Perry technique establish 2-methoxy-4(phenyliminomethyl)phenol crystal as a good non linear optical material. Z-scan proposes the material for reverse saturable absorption.

  6. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  7. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  8. Structural and Interfacial Properties of Hyperbranched-Linear Polymer Surfactant.

    Science.gov (United States)

    Qiang, Taotao; Bu, Qiaoqiao; Huang, Zhaofeng; Wang, Xuechuan

    2014-01-01

    With oleic acid grafting modification, a series of hyperbranched-linear polymer surfactants (HLPS) were prepared by hydroxyl-terminated hyperbranched polymer (HBP), which was gained through a step synthesis method using trimethylolpropane and AB 2 monomer. The AB 2 monomers were obtained through the Michael addition reaction of methyl acrylate and diethanol amine. The structures of HLPS were characterised by Fourier transform infrared spectrophotometer and nuclear magnetic resonance (NMR), which indicated that HBP was successfully modified by oleic acid. Furthermore, the properties of surface tension and critical micelle concentration of HLPS solution showed that HLPS can significantly reduce the surface tension of water. The morphology of the HLPS solution was characterised by dynamic light scattering, which revealed that HLPS exhibited a nonmonotonic appearance in particle size at different scattering angles owing to the different replaced linear portions. The relationships of the surface pressure to monolayer area and time were measured using the Langmuir-Blodgett instrument, which showed that the surface tension of monolayer molecules increased with the increasing of hydrophobic groups. In addition, the interface conditions of different replaced HLPS solutions were simulated.

  9. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  10. RNAspa: a shortest path approach for comparative prediction of the secondary structure of ncRNA molecules

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2007-10-01

    Full Text Available Abstract Background In recent years, RNA molecules that are not translated into proteins (ncRNAs have drawn a great deal of attention, as they were shown to be involved in many cellular functions. One of the most important computational problems regarding ncRNA is to predict the secondary structure of a molecule from its sequence. In particular, we attempted to predict the secondary structure for a set of unaligned ncRNA molecules that are taken from the same family, and thus presumably have a similar structure. Results We developed the RNAspa program, which comparatively predicts the secondary structure for a set of ncRNA molecules in linear time in the number of molecules. We observed that in a list of several hundred suboptimal minimal free energy (MFE predictions, as provided by the RNAsubopt program of the Vienna package, it is likely that at least one suggested structure would be similar to the true, correct one. The suboptimal solutions of each molecule are represented as a layer of vertices in a graph. The shortest path in this graph is the basis for structural predictions for the molecule. We also show that RNA secondary structures can be compared very rapidly by a simple string Edit-Distance algorithm with a minimal loss of accuracy. We show that this approach allows us to more deeply explore the suboptimal structure space. Conclusion The algorithm was tested on three datasets which include several ncRNA families taken from the Rfam database. These datasets allowed for comparison of the algorithm with other methods. In these tests, RNAspa performed better than four other programs.

  11. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  12. Time-dependent quantum chemistry of laser driven many-electron molecules

    International Nuclear Information System (INIS)

    Nguyen-Dang, Thanh-Tung; Couture-Bienvenue, Étienne; Viau-Trudel, Jérémy; Sainjon, Amaury

    2014-01-01

    A Time-Dependent Configuration Interaction approach using multiple Feshbach partitionings, corresponding to multiple ionization stages of a laser-driven molecule, has recently been proposed [T.-T. Nguyen-Dang and J. Viau-Trudel, J. Chem. Phys. 139, 244102 (2013)]. To complete this development toward a fully ab-initio method for the calculation of time-dependent electronic wavefunctions of an N-electron molecule, we describe how tools of multiconfiguration quantum chemistry such as the management of the configuration expansion space using Graphical Unitary Group Approach concepts can be profitably adapted to the new context, that of time-resolved electronic dynamics, as opposed to stationary electronic structure. The method is applied to calculate the detailed, sub-cycle electronic dynamics of BeH 2 , treated in a 3–21G bound-orbital basis augmented by a set of orthogonalized plane-waves representing continuum-type orbitals, including its ionization under an intense λ = 800 nm or λ = 80 nm continuous-wave laser field. The dynamics is strongly non-linear at the field-intensity considered (I ≃ 10 15 W/cm 2 ), featuring important ionization of an inner-shell electron and strong post-ionization bound-electron dynamics

  13. Theoretical studies of MHD plasma molecules. I. Potential energy curves and dipole moments of linear KOH

    International Nuclear Information System (INIS)

    England, W.B.

    1978-01-01

    Uncorrelated and correlated potential energy curves and dipole moments are reported for linear KOH. The compound is found to be ionic, K + OH - . Minimum energy bond lengths are R/sub KO/=4.2913 au and R/sub OH/=1.7688 au, with an estimated accuracy of 2%. The corresponding dipole moment is 3.3 au (8.46 D) with a similar accuracy estimate. This is to our knowledge the first value ever reported for the KOH dipole moment, and the large value suggests that KOH will be an effective electron scatterer in MHD plasmas

  14. Improving the first hyperpolarizability of anthracene through interaction with HX molecules (Xdbnd F, Cl, Br): A theoretical study

    Science.gov (United States)

    Abdolmaleki, Ahmad; Dadsetani, Mehrdad; Zabardasti, Abedin

    2018-05-01

    The variations in nonlinear optical activity (NLO) of anthracene (C14H10) was investigated via intermolecular interactions between C14H10 and HX molecules (Xdbnd F, Cl and Br) using B3LYP-D3 method at 6-311++G(d,p) basis set. The stabilization of those complexes was investigated via vibrational analysis, quantum theory of atoms in molecules, molecular electrostatic potential, natural bond orbitals and symmetry-adapted perturbation theory (SAPT) analysis. Furthermore, the optical spectra and the first hyperpolarizabilities of C14H10⋯HX complexes were computed. The adsorption of hydrogen halide through C14H10⋯HX complex formation, didn't change much the linear optical activities of C14H10 molecule, but the magnitude of the first hyperpolarizability of the C14H10⋯HX complexes to be as much as that of urea.

  15. Interactions of molecules and the properties of crystals

    Science.gov (United States)

    McConnell, Thomas Daniel Leigh

    In this thesis the basic theory of the lattice dynamics of molecular crystals is considered, with particular reference to the specific case of linear molecules. The objective is to carry out a critical investigation of a number of empirical potentials as models for real systems. Suitable coordinates are introduced, in particular vibrational coordinates which are used to describe the translational and rotational modes of the free molecule. The Taylor expansion of the intermolecular potential is introduced and its terms considered, in particular the (first-order) equilibrium conditions for such a system and the (second-order) lattice vibrations. The elastic properties are also considered, in particular with reference to the specific case of rhombohedral crystals. The compressibility and a number of conditions for elastic stability are introduced. The total intermolecular interaction potential is divided into three components using perturbation methods, the electrostatic energy, the repulsion energy and the dispersion energy. A number of models are introduced for these various components. The induction energy is neglected. The electrostatic interaction is represented by atomic multipole and molecular multipole models. The repulsion and dispersion energies are modelled together in a central interaction potential, either the Lennard-Jones atom-atom potential or the anisotropic Berne-Pechukas molecule-molecule potential. In each case, the Taylor expansion coefficients, used to calculate the various molecular properties, are determined. An algorithm is described which provides a relatively simple method for calculating cartesian tensors, which are found in the Taylor expansion coefficients of the multipolar potentials. This proves to be particularly useful from a computational viewpoint, both in terms of programming and calculating efficiency. The model system carbonyl sulphide is introduced and its lattice properties are described. Suitable parameters for potentials used

  16. Pro-aromatic and anti-aromatic π-conjugated molecules: an irresistible wish to be diradicals

    KAUST Repository

    Zeng, Zebing

    2015-01-01

    © 2015 The Royal Society of Chemistry. Aromaticity is an important concept to understand the stability and physical properties of π-conjugated molecules. Recent studies on pro-aromatic and anti-aromatic molecules revealed their irresistible tendency to become diradicals in the ground state. Diradical character thus becomes another very important concept and it is fundamentally correlated to the physical (optical, electronic and magnetic) properties and chemical reactivity of most of the organic optoelectronic materials. Molecules with distinctive diradical character show unique properties which are very different from those of traditional closed-shell π-conjugated systems, and thus they have many potential applications in organic electronics, spintronics, non-linear optics and energy storage. This critical review first introduces the fundamental electronic structure of Kekulé diradicals within the concepts of anti-aromaticity and pro-aromaticity in the context of Hückel aromaticity and diradical character. Then recent research studies on various stable/persistent diradicaloids based on pro-aromatic and anti-aromatic compounds are summarized and discussed with regard to their synthetic chemistry, physical properties, structure-property relationships and potential material applications. A summary and personal perspective is given at the end.

  17. Molecule-by-Molecule Writing Using a Focused Electron Beam

    DEFF Research Database (Denmark)

    Van Dorp, Willem F.; Zhang, Xiaoyan; Feringa, Ben L.

    2012-01-01

    atoms also be written with an electron beam? We verify this with focused electron-beam-induced deposition (FEBID), a direct-write technique that has the current record for the smallest feature written by (electron) optical lithography. We show that the deposition of an organometallic precursor...... on graphene can be followed molecule-by-molecule with FEBID. The results show that mechanisms that are inherent to the process inhibit a further increase in control over the process. Hence, our results present the resolution limit of (electron) optical lithography techniques. The writing of isolated...

  18. Observation of pendular butterfly Rydberg molecules

    Science.gov (United States)

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  19. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  20. Linear algebra

    CERN Document Server

    Shilov, Georgi E

    1977-01-01

    Covers determinants, linear spaces, systems of linear equations, linear functions of a vector argument, coordinate transformations, the canonical form of the matrix of a linear operator, bilinear and quadratic forms, Euclidean spaces, unitary spaces, quadratic forms in Euclidean and unitary spaces, finite-dimensional space. Problems with hints and answers.

  1. Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jiangwei [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a

  2. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  3. Effects of microwave on spin tunneling in single-molecule magnets

    Science.gov (United States)

    Kim, Gwang-Hee; Kim, Tae-Suk

    2005-03-01

    We study theoretically the effects of the irradiated microwave on the magnetization in single-molecule magnets (SMMs) like V15 and Fe8. We find that the shape of magnetization depends on the microwave intensity as well as the microwave polarization. The applied microwave field enhances the tunneling probability. The linearly polarized microwaves induce the suppression of magnetization at both positive and negative magnetic fields. The circularly polarized microwaves are absorbed either at one direction of magnetic field or at both directions of magnetic fields, depending on the polarization directions with respect to the direction of longitudinal magnetic field. The generic features we found will be compared with the recent experimental results.

  4. A Mott-like State of Molecules

    International Nuclear Information System (INIS)

    Duerr, S.; Volz, T.; Syassen, N.; Bauer, D. M.; Hansis, E.; Rempe, G.

    2006-01-01

    We prepare a quantum state where each site of an optical lattice is occupied by exactly one molecule. This is the same quantum state as in a Mott insulator of molecules in the limit of negligible tunneling. Unlike previous Mott insulators, our system consists of molecules which can collide inelastically. In the absence of the optical lattice these collisions would lead to fast loss of the molecules from the sample. To prepare the state, we start from a Mott insulator of atomic 87Rb with a central region, where each lattice site is occupied by exactly two atoms. We then associate molecules using a Feshbach resonance. Remaining atoms can be removed using blast light. Our method does not rely on the molecule-molecule interaction properties and is therefore applicable to many systems

  5. Towards efficient ab initio calculations of electron scattering by polyatomic molecules: III. Modelling correlation-polarization interactions

    Czech Academy of Sciences Publication Activity Database

    Čurík, Roman; Šulc, M.

    2010-01-01

    Roč. 43, č. 17 (2010), s. 175205 ISSN 0953-4075 R&D Projects: GA MŠk(CZ) OC10046; GA MŠk OC09079; GA AV ČR KJB400400803; GA ČR GA202/08/0631 Institutional research plan: CEZ:AV0Z40400503 Keywords : Ab initio calculations * Commonly used * DFT potential Subject RIV: CF - Physical ; The oretical Chemistry Impact factor: 1.902, year: 2010

  6. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  7. Heparin-based hydrogels with tunable sulfation & degradation for anti-inflammatory small molecule delivery.

    Science.gov (United States)

    Peng, Yifeng; Tellier, Liane E; Temenoff, Johnna S

    2016-08-16

    Sustained release of anti-inflammatory agents remains challenging for small molecule drugs due to their low molecular weight and hydrophobicity. Therefore, the goal of this study was to control the release of a small molecule anti-inflammatory agent, crystal violet (CV), from hydrogels fabricated with heparin, a highly sulfated glycosaminoglycan capable of binding positively-charged molecules such as CV. In this system, both electrostatic interactions between heparin and CV and hydrogel degradation were tuned simultaneously by varying the level of heparin sulfation and varying the amount of dithiothreitol within hydrogels, respectively. It was found that heparin sulfation significantly affected CV release, whereby more sulfated heparin hydrogels (Hep and Hep(-N)) released CV with near zero-order release kinetics (R-squared values between 0.96-0.99). Furthermore, CV was released more quickly from fast-degrading hydrogels than slow-degrading hydrogels, providing a method to tune total CV release between 5-15 days while maintaining linear release kinetics. In particular, N-desulfated heparin hydrogels exhibited efficient CV loading (∼90% of originally included CV), near zero-order CV release kinetics, and maintenance of CV bioactivity after release, making this hydrogel formulation a promising CV delivery vehicle for a wide range of inflammatory diseases.

  8. High precision optical spectroscopy and quantum state selected photodissociation of ultracold 88Sr2 molecules in an optical lattice

    Science.gov (United States)

    McDonald, Mickey

    2017-04-01

    Over the past several decades, rapid progress has been made toward the accurate characterization and control of atoms, epitomized by the ever-increasing accuracy and precision of optical atomic lattice clocks. Extending this progress to molecules will have exciting implications for chemistry, condensed matter physics, and precision tests of physics beyond the Standard Model. My thesis describes work performed over the past six years to establish the state of the art in manipulation and quantum control of ultracold molecules. We describe a thorough set of measurements characterizing the rovibrational structure of weakly bound 88Sr2 molecules from several different perspectives, including determinations of binding energies; linear, quadratic, and higher order Zeeman shifts; transition strengths between bound states; and lifetimes of narrow subradiant states. Finally, we discuss measurements of photofragment angular distributions produced by photodissociation of molecules in single quantum states, leading to an exploration of quantum-state-resolved ultracold chemistry. The images of exploding photofragments produced in these studies exhibit dramatic interference effects and strongly violate semiclassical predictions, instead requiring a fully quantum mechanical description.

  9. To bend or not to bend – are heteroatom interactions within conjugated molecules effective in dictating conformation and planarity?

    KAUST Repository

    Conboy, Gary; Spencer, Howard J.; Angioni, Enrico; Kanibolotsky, Alexander L.; Findlay, Neil J.; Coles, Simon J.; Wilson, Claire; Pitak, Mateusz B.; Risko, Chad; Coropceanu, Veaceslav; Bredas, Jean-Luc; Skabara, Peter J.

    2016-01-01

    We consider the roles of heteroatoms (mainly nitrogen, the halogens and the chalcogens) in dictating the conformation of linear conjugated molecules and polymers through non-covalent intramolecular interactions. Whilst hydrogen bonding is a competitive and sometimes more influential interaction, we provide unambiguous evidence that heteroatoms are able to determine the conformation of such materials with reasonable predictability.

  10. To bend or not to bend – are heteroatom interactions within conjugated molecules effective in dictating conformation and planarity?

    KAUST Repository

    Conboy, Gary

    2016-04-26

    We consider the roles of heteroatoms (mainly nitrogen, the halogens and the chalcogens) in dictating the conformation of linear conjugated molecules and polymers through non-covalent intramolecular interactions. Whilst hydrogen bonding is a competitive and sometimes more influential interaction, we provide unambiguous evidence that heteroatoms are able to determine the conformation of such materials with reasonable predictability.

  11. Molecular Design of Branched and Binary Molecules at Ordered Interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Genson, Kirsten Larson [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    This study examined five different branched molecular architectures to discern the effect of design on the ability of molecules to form ordered structures at interfaces. Photochromic monodendrons formed kinked packing structures at the air-water interface due to the cross-sectional area mismatch created by varying number of alkyl tails and the hydrophilic polar head group. The lower generations formed orthorhombic unit cell with long range ordering despite the alkyl tails tilted to a large degree. Favorable interactions between liquid crystalline terminal groups and the underlying substrate were observed to compel a flexible carbosilane dendrimer core to form a compressed elliptical conformation which packed stagger within lamellae domains with limited short range ordering. A twelve arm binary star polymer was observed to form two dimensional micelles at the air-water interface attributed to the higher polystyrene block composition. Linear rod-coil molecules formed a multitude of packing structures at the air-water interface due to the varying composition. Tree-like rod-coil molecules demonstrated the ability to form one-dimensional structures at the air-water interface and at the air-solvent interface caused by the preferential ordering of the rigid rod cores. The role of molecular architecture and composition was examined and the influence chemically competing fragments was shown to exert on the packing structure. The amphiphilic balance of the different molecular series exhibited control on the ordering behavior at the air-water interface and within bulk structures. The shell nature and tail type was determined to dictate the preferential ordering structure and molecular reorganization at interfaces with the core nature effect secondary.

  12. Linear and non-linear optics of condensed matter

    International Nuclear Information System (INIS)

    McLean, T.P.

    1977-01-01

    Part I - Linear optics: 1. General introduction. 2. Frequency dependence of epsilon(ω, k vector). 3. Wave-vector dependence of epsilon(ω, k vector). 4. Tensor character of epsilon(ω, k vector). Part II - Non-linear optics: 5. Introduction. 6. A classical theory of non-linear response in one dimension. 7. The generalization to three dimensions. 8. General properties of the polarizability tensors. 9. The phase-matching condition. 10. Propagation in a non-linear dielectric. 11. Second harmonic generation. 12. Coupling of three waves. 13. Materials and their non-linearities. 14. Processes involving energy exchange with the medium. 15. Two-photon absorption. 16. Stimulated Raman effect. 17. Electro-optic effects. 18. Limitations of the approach presented here. (author)

  13. Control of optical bistability and third-order nonlinearity via tunneling induced quantum interference in triangular quantum dot molecules

    International Nuclear Information System (INIS)

    Tian, Si-Cong; Tong, Cun-Zhu; Zhang, Jin-Long; Shan, Xiao-Nan; Fu, Xi-Hong; Zeng, Yu-Gang; Qin, Li; Ning, Yong-Qiang; Wan, Ren-Gang

    2015-01-01

    The optical bistability of a triangular quantum dot molecules embedded inside a unidirectional ring cavity is studied. The type, the threshold and the hysteresis loop of the optical bistability curves can be modified by the tunneling parameters, as well as the probe laser field. The linear and nonlinear susceptibilities of the medium are also studied to interpret the corresponding results. The physical interpretation is that the tunneling can induce the quantum interference, which modifies the linear and the nonlinear response of the medium. As a consequence, the characteristics of the optical bistability are changed. The scheme proposed here can be utilized for optimizing and controlling the optical switching process

  14. Differential and total cross sections for the ionization of water molecule by electron impact

    International Nuclear Information System (INIS)

    Houamer, S.; Dal Cappello, C.; Mansouri, A.

    2007-01-01

    A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

  15. Study of diamagnetism in uranyl complexes of some Schiff bases

    International Nuclear Information System (INIS)

    Dodwad, S.S.; Sawant, A.S.

    1992-01-01

    Uranyl complexes of Schiff bases obtained by condensing salicylaldehyde with aromatic amines have been isolated and characterised. The complexes have the formula M (LH) 2 (NO 3 ) 2 where M = UO 2 and LH = Schiff base. The magnetic susceptibilities of these complexes have been measured on a Gouy balance. These values have been compared with the computed ones. The percentage deviation between the observed and computed values of molar magnetic susceptibilities clearly show that they are outside experimental error and therefore significant. These deviations have been discussed in the light of VanVleck's, equation for molar susceptibility of polyatomic molecule. (author). 3 refs., 1 tab

  16. Quantum Theories of Self-Localization

    Science.gov (United States)

    Bernstein, Lisa Joan

    In the classical dynamics of coupled oscillator systems, nonlinearity leads to the existence of stable solutions in which energy remains localized for all time. Here the quantum-mechanical counterpart of classical self-localization is investigated in the context of two model systems. For these quantum models, the terms corresponding to classical nonlinearities modify a subset of the stationary quantum states to be particularly suited to the creation of nonstationary wavepackets that localize energy for long times. The first model considered here is the Quantized Discrete Self-Trapping model (QDST), a system of anharmonic oscillators with linear dispersive coupling used to model local modes of vibration in polyatomic molecules. A simple formula is derived for a particular symmetry class of QDST systems which gives an analytic connection between quantum self-localization and classical local modes. This formula is also shown to be useful in the interpretation of the vibrational spectra of some molecules. The second model studied is the Frohlich/Einstein Dimer (FED), a two-site system of anharmonically coupled oscillators based on the Frohlich Hamiltonian and motivated by the theory of Davydov solitons in biological protein. The Born-Oppenheimer perturbation method is used to obtain approximate stationary state wavefunctions with error estimates for the FED at the first excited level. A second approach is used to reduce the first excited level FED eigenvalue problem to a system of ordinary differential equations. A simple theory of low-energy self-localization in the FED is discussed. The quantum theories of self-localization in the intrinsic QDST model and the extrinsic FED model are compared.

  17. Chirp effects on impulsive vibrational spectroscopy: a multimode perspective.

    Science.gov (United States)

    Wand, Amir; Kallush, Shimshon; Shoshanim, Ofir; Bismuth, Oshrat; Kosloff, Ronnie; Ruhman, Sanford

    2010-03-07

    The well-documented propensity of negatively-chirped pulses to enhance resonant impulsive Raman scattering has been rationalized in terms of a one pulse pump-dump sequence which "follows" the evolution of the excited molecules and dumps them back at highly displaced configurations. The aim of this study was to extend the understanding of this effect to molecules with many displaced vibrational modes in the presence of condensed surroundings. In particular, to define an optimally chirped pulse, to investigate what exactly it "follows" and to discover how this depends on the molecule under study. To this end, linear chirp effects on vibrational coherences in poly-atomics are investigated experimentally and theoretically. Chirped pump-impulsive probe experiments are reported for Sulforhodamine-B ("Kiton Red"), Betaine-30 and Oxazine-1 in ethanol solutions with <10 fs resolution. Numerical simulations, including numerous displaced modes and electronic dephasing, are conducted to reproduce experimental results. Through semi-quantitative reproduction of experimental results in all three systems we show that the effect of group velocity dispersion (GVD) on the buildup of ground state wave-packets depends on the pulse spectrum, on the displacements of vibrational modes upon excitation, on the detuning of the excitation pulses from resonance, and on electronic dephasing rates. Akin to scenarios described for frequency-domain resonance Raman, within the small-displacement regime each mode responds to excitation chirp independently and the optimal GVD is mode-specific. Highly-displaced modes entangle the dynamics of excitation in different modes, requiring a multi-dimensional description of the response. Rapid photochemistry and ultrafast electronic dephasing narrow the window of opportunity for coherent manipulations, leading to a reduced and similar optimal chirp for different modes. Finally, non-intuitive coherent aspects of chirp "following" are predicted in the small

  18. Neutral molecules in tokamak edge plasma - role of vibrationally excited hydrogen molecules

    International Nuclear Information System (INIS)

    Cadez, I.; Cercek, M.; Pelicon, P.; Razpet, A.

    2003-01-01

    The role of neutral molecules in edge plasma is discussed with special emphasis on the vibrationally excited hydrogen. Neutral molecules are formed mostly by surface processes on the walls and then released to the edge plasma where they take part in volumetric reactions with other particles. Typically these molecules are formed in excited states and data are needed for their reactions on the wall and in the volume. Processes in edge plasma determine particle and energy flux what is especially critical issue in tokamak divertor region. Various cross sections and reaction rates are needed for modelling edge plasma and its interaction with walls. (author)

  19. Single Molecule Analysis Research Tool (SMART: an integrated approach for analyzing single molecule data.

    Directory of Open Access Journals (Sweden)

    Max Greenfeld

    Full Text Available Single molecule studies have expanded rapidly over the past decade and have the ability to provide an unprecedented level of understanding of biological systems. A common challenge upon introduction of novel, data-rich approaches is the management, processing, and analysis of the complex data sets that are generated. We provide a standardized approach for analyzing these data in the freely available software package SMART: Single Molecule Analysis Research Tool. SMART provides a format for organizing and easily accessing single molecule data, a general hidden Markov modeling algorithm for fitting an array of possible models specified by the user, a standardized data structure and graphical user interfaces to streamline the analysis and visualization of data. This approach guides experimental design, facilitating acquisition of the maximal information from single molecule experiments. SMART also provides a standardized format to allow dissemination of single molecule data and transparency in the analysis of reported data.

  20. Linearity and Non-linearity of Photorefractive effect in Materials ...

    African Journals Online (AJOL)

    In this paper we have studied the Linearity and Non-linearity of Photorefractive effect in materials using the band transport model. For low light beam intensities the change in the refractive index is proportional to the electric field for linear optics while for non- linear optics the change in refractive index is directly proportional ...