International Nuclear Information System (INIS)
Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S
2008-01-01
Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.
2017-06-06
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-06-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-01-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Difference Raman spectroscopy of DNA molecules
International Nuclear Information System (INIS)
Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu
2015-01-01
In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule
Nano-manipulation of single DNA molecules
International Nuclear Information System (INIS)
Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie
2004-01-01
Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)
Rotational partition functions for linear molecules
International Nuclear Information System (INIS)
McDowell, R.S.
1988-01-01
An accurate closed-form expression for the rotational partition function of linear polyatomic molecules in 1 summation electronic states is derived, including the effect of nuclear spin (significant at very low temperatures) and of quartic and sextic centrifugal distortion terms (significant at moderate and high temperatures). The proper first-order quantum correction to the classical rigid-rotator partition function is shown to yield Q/sub r/ ≅β -1 exp(β/3), where βequivalenthcB/kT and B is the rotational constant in cm -1 ; for β≥0.2 additional power-series terms in β are necessary. Comparison between the results of this treatment and exact summations are made for HCN and C 2 H 2 at temperatures from 2 to 5000 K, including separate evaluation of the contributions of nuclear spin and centrifugal distortion
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
International Nuclear Information System (INIS)
Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira
2009-01-01
We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
International Nuclear Information System (INIS)
Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana
2014-01-01
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
Energy Technology Data Exchange (ETDEWEB)
Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)
2014-01-31
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.
Electron microscope autoradiography of isolated DNA molecules
International Nuclear Information System (INIS)
Delain, Etienne; Bouteille, Michel
1980-01-01
Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections
Single Molecule Screening of Disease DNA Without Amplification
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)
2006-01-01
was probed with fluorescently-labeled probe molecules and imaged. When only the probes were stained and hybridized in a vial, it had 6 orders of magnitude dynamic range with a detection limit of ~0.7 copy/cell. A second dye was added to lower the false positive levels. Although there was a sacrifice of two orders of magnitude in detection limit, the number of false positives was reduced to zero. HPV-16 DNA was also hybridized and detected on surface-tethered probes. When the entire human genomic DNA and HPV was labeled and hybridized, the detection limit was similar to that of one-color assay detected in capillary. However, non-specific adsorption was high, and the dynamic range was narrow because of saturation of the surface and electrostatic repulsion between hybridized targets on the surface. The second probe was introduced to lower non-specific adsorption, and the strategy succeeded in 4 orders of magnitude linear dynamic range in a log-log plot, along with 2.4 copies/cell detection limit. DNA extracts of cell lines that contained a known copy number of HPV-16 DNA were tested with the four strategies described above. The calculated numbers from observed molecule counts matched the known values. Results from the Pap test sample with added HPV DNA were similar to those of purified DNA, suggesting our method is compatible with the conventional Pap test sample collection method. Further optimization will be needed before this single molecule level detection and identification can actually be used in a real clinical lab, but it has good potential and applicability. Improvement such as automated imaging and scanning, more accurate data processing software as well as sensitive camera, should help increase the efficiency and throughput.
A linear algebraic approach to electron-molecule collisions
International Nuclear Information System (INIS)
Collins, L.A.; Schnieder, B.I.
1982-01-01
The linear algebraic approach to electron-molecule collisions is examined by firstly deriving the general set of coupled integrodifferential equations that describe electron collisional processes and then describing the linear algebraic approach for obtaining a solution to the coupled equations. Application of the linear algebraic method to static-exchange, separable exchange and effective optical potential, is examined. (U.K.)
Linear algebraic approach to electron-molecule collisions
International Nuclear Information System (INIS)
Schneider, B.I.; Collins, L.A.
1983-01-01
The various levels of sophistication of the linear algebraic method are discussed and its application to electron-molecule collisions of H 2 , N 2 LiH, LiF and HCl is described. 13 references, 2 tables
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I
National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...
On the identification techniques for ionizing radiation structure breaks in the DNA molecule
International Nuclear Information System (INIS)
Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.
2012-01-01
In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
Dispersion interaction between an atom and linear molecule
International Nuclear Information System (INIS)
Carvalho, I.L. de
1987-01-01
The Jacobi-Csanak method is adapted to the calculation of the dipole-dipole, dipole-quadrupole, quadrupole-dipole, and quadrupole-quadrupole terms of the dispersion energy of an atom-linear molecule system. The angle-dependent parts of the Born amplitudes for the linear molecule are represented by real spherical harmonics. The dispersion energy is finite at all distances and reproduces the usual expression in the asymptotic region (R≥4.7 (angstrom)). In the intermediary region (2.4(angstrom) ≤ R [pt
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Quantifying DNA melting transitions using single-molecule force spectroscopy
International Nuclear Information System (INIS)
Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J
2009-01-01
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
Quantifying DNA melting transitions using single-molecule force spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu
2009-01-21
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
DEFF Research Database (Denmark)
Nosek, J.; Novotna, M.; Hlavatovicova, Z.
2004-01-01
The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...
Single-molecule chemical reactions on DNA origami
DEFF Research Database (Denmark)
Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru
2010-01-01
as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...
DNA analysis by single molecule stretching in nanofluidic biochips
DEFF Research Database (Denmark)
Abad, E.; Juarros, A.; Retolaza, A.
2011-01-01
Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...
How to read and write mechanical information in DNA molecules
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
A single molecule DNA flow stretching microscope for undergraduates
Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.
2011-01-01
The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no
Automation of a single-DNA molecule stretching device
DEFF Research Database (Denmark)
Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels
2015-01-01
We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...
DNA molecules and human therapeutics | Danquah | African Journal ...
African Journals Online (AJOL)
Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...
Visualizing Single-molecule DNA Replication with Fluorescence Microscopy
Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van
2009-01-01
We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The
Highly parallel translation of DNA sequences into small molecules.
Directory of Open Access Journals (Sweden)
Rebecca M Weisinger
Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
Developing DNA nanotechnology using single-molecule fluorescence.
Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal
2014-06-17
CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Effect of Cisplatin on the Flexibility of Linear DNA
International Nuclear Information System (INIS)
Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye
2011-01-01
With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)
Detection of kinetic change points in piece-wise linear single molecule motion
Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.
2018-03-01
Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.
Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond
Directory of Open Access Journals (Sweden)
David eDavidson
2013-01-01
Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA
Yoo, Hyejin
2012-10-25
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
Yoo, Hyejin; Furumaki, Shu; Yang, Jaesung; Lee, Ji-Eun; Chung, Heejae; Oba, Tatsuya; Kobayashi, Hiroyuki; Rybtchinski, Boris; Wilson, Thea M.; Wasielewski, Michael R.; Vacha, Martin; Kim, Dongho
2012-01-01
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
Single-molecule mechanics of protein-labelled DNA handles
Directory of Open Access Journals (Sweden)
Vivek S. Jadhav
2016-01-01
Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
Analysis of DNA interactions using single-molecule force spectroscopy.
Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert
2013-06-01
Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.
DNA replication at the single-molecule level
Stratmann, S.A.; Oijen, A.M. van
2014-01-01
A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or
Single Molecule Study of DNA Organization and Recombination
Xiao, Botao
We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force
Single-strand DNA molecule translocation through nanoelectrode gaps
International Nuclear Information System (INIS)
Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W
2007-01-01
Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation
Inhibition of DNA glycosylases via small molecule purine analogs.
Directory of Open Access Journals (Sweden)
Aaron C Jacobs
Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.
Photocleavage of DNA: irradiation of quinone-containing reagents converts supercoiled to linear DNA
International Nuclear Information System (INIS)
Kock, T.; Schuster, G.B.; Ropp, J.D.; Sligar, S.G.
1993-01-01
Irradiation (350 nm) of air-saturated solutions of reagents containing an anthraquinone group linked to quaternary alkyl ammonium groups converts supercoiled DNA to circular and to linear DNA. Generation of linear DNA does not occur by accumulation of numerous single-strand cuts but by coincident-site double-strand cleavage of DNA. Irradiation forms the triplet state of the anthraquinone, which reacts either by hydrogen atom abstraction from a sugar of DNA or by electron transfer from a base of the DNA. Subsequent reactions result in chain scission. The quinone is apparently reformed after this sequence and reirradiation leads to double-strand cleavage. (Author)
Single-molecule denaturation mapping of DNA in nanofluidic channels
DEFF Research Database (Denmark)
Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli
2010-01-01
Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
Single molecule DNA detection with an atomic vapor notch filter
Energy Technology Data Exchange (ETDEWEB)
Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)
2015-12-01
The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)
International Nuclear Information System (INIS)
Wu, N.; Wang, Q.
2012-01-01
The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Evaluation of synthetic linear motor-molecule actuation energetics
Brough, Branden; Northrop, Brian H.; Schmidt, Jacob J.; Tseng, Hsian-Rong; Houk, Kendall N.; Stoddart, J. Fraser; Ho, Chih-Ming
2006-01-01
By applying atomic force microscope (AFM)-based force spectroscopy together with computational modeling in the form of molecular force-field simulations, we have determined quantitatively the actuation energetics of a synthetic motor-molecule. This multidisciplinary approach was performed on specifically designed, bistable, redox-controllable [2]rotaxanes to probe the steric and electrostatic interactions that dictate their mechanical switching at the single-molecule level. The fusion of expe...
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules
Sitek, A.; Machnikowski, P.
2008-11-01
We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.
Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations
Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.
2018-04-01
Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.
Multiplex single-molecule interaction profiling of DNA barcoded proteins
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.
2014-01-01
In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978
Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.
Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J
2003-10-01
Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.
Rotational and vibrational synthetic spectra of linear parent molecules in comets
International Nuclear Information System (INIS)
Crovisier, J.
1987-01-01
We evaluate and model the excitation conditions of linear parent molecules in cometary atmospheres. The model is valid for most linear molecules without electronic angular momentum. It takes into account collisions and infrared excitation. The molecule rotational population distribution is computed as a function of distance to nucleus. The line intensities of the strongest parallel and perpendicular fundamental vibrational bands, as well as the pure rotational lines, can then be evaluated. This model is applied to several candidate parent molecules, for observing conditions corresponding to available or planned instruments, either ground-based or aboard aircrafts, satellites or space probes
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
International Nuclear Information System (INIS)
Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.
1976-01-01
Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
DEFF Research Database (Denmark)
Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders
2011-01-01
We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....
Application of the method of continued fractions for electron scattering by linear molecules
International Nuclear Information System (INIS)
Lee, M.-T.; Iga, I.; Fujimoto, M.M.; Lara, O.; Brasilia Univ., DF
1995-01-01
The method of continued fractions (MCF) of Horacek and Sasakawa is adapted for the first time to study low-energy electron scattering by linear molecules. Particularly, we have calculated the reactance K-matrices for an electron scattered by hydrogen molecule and hydrogen molecular ion as well as by a polar LiH molecule in the static-exchange level. For all the applications studied herein. the calculated physical quantities converge rapidly, even for a strongly polar molecule such as LiH, to the correct values and in most cases the convergence is monotonic. Our study suggests that the MCF could be an efficient method for studying electron-molecule scattering and also photoionization of molecules. (Author)
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Thermophoretic forces on DNA measured with a single-molecule spring balance
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe
2014-01-01
We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
The elastic theory of a single DNA molecule
Indian Academy of Sciences (India)
methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.
Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET
Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William
2018-01-01
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...
International Nuclear Information System (INIS)
Feng, H.; Zheng, Y.; Ding, S.
2007-01-01
Infrared multiphoton vibrational excitation of the linear triatomic molecule has been studied using the quadratic anharmonic Lie-algebra model, unitary transformations, and Magnus approximation. An explicit Lie-algebra expression for the vibrational transition probability is obtained by using a Lie-algebra approach. This explicit Lie-algebra expressions for time-evolution operator and vibrational transition probabilities make the computation clearer and easier. The infrared multiphoton vibrational excitation of the DCN linear tri-atomic molecule is discussed as an example
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels
Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses
International Nuclear Information System (INIS)
Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.
2003-01-01
DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses
Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.
Directory of Open Access Journals (Sweden)
Marijn T J van Loenhout
Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru
2010-01-01
DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....
Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments
International Nuclear Information System (INIS)
Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.
2007-01-01
We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics
Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap
Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael
2013-05-01
In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.
How to determine local stretching and tension in a flow-stretched DNA molecule
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders
2016-01-01
We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....
From stripe to slab confinement for DNA linearization in nanochannels
Cifra, Peter; Benkova, Zuzana; Namer, Pavol
We investigate suggested advantageous analysis in the linearization experiments with macromolecules confined in a stripe-like channel using Monte Carlo simulations. The enhanced chain extension in a stripe that is due to significant excluded volume interactions between monomers in two dimensions weakens on transition to experimentally feasible slit-like channel. Based on the chain extension-confinement strength dependence and the structure factor behavior for the chain in stripe we infer the excluded volume regime typical for two-dimensional systems. On transition to the slab geometry, the advantageous chain extension decreases and the Gaussian regime is observed for not very long semiflexible chains. The evidence for pseudo-ideality in confined chains is based on indicators such as the extension curves, variation of the extension with the persistence length or the structure factor. The slab behavior is observed when the stripe (originally of monomer thickness) reaches the thickness larger than cca 10nm in the third dimension. This maximum height of the slab to retain the advantage of the stripe is very low and this have implication for DNA linearization experiments. The presented analysis, however, has a broader relevance for confined polymers. Support from Slovak R&D Agency (SRDA-0451-11) is acknowledged.
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev
2017-01-01
Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes
Directory of Open Access Journals (Sweden)
Kazuo Umemura
2016-10-01
Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.
Electron re-scattering from aligned linear molecules using the R-matrix method
International Nuclear Information System (INIS)
Harvey, A G; Tennyson, J
2009-01-01
Electron re-scattering in a strong laser field provides an important probe of molecular structure and processes. The laser field drives the ionization of the molecule, followed by acceleration and subsequent recollision of the electron with the parent molecular ion, the scattered electrons carry information about the nuclear geometry and electronic states of the molecular ion. It is advantageous in strong field experiments to work with aligned molecules, which introduces extra physics compared to the standard gas-phase, electron-molecule scattering problem. The formalism for scattering from oriented linear molecules is presented and applied to H 2 and CO 2 . Differential cross sections are presented for (re-)scattering by these systems concentrating on the most common, linear alignment. In H 2 these cross sections show significant angular structure which, particularly for a scattering angle of 90 deg., are predicted to vary significantly between re-collisions stimulated by an even or an odd number of photons. In CO 2 these cross sections are zero indicating the necessity of using non-parallel alignment with this molecule.
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
Abdalla, S; Obaid, A; Al-Marzouki, F M
2017-12-01
Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Single-molecule analysis of DNA replication in Xenopus egg extracts
Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel
The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules
International Nuclear Information System (INIS)
Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.
1979-01-01
The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage
Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates
DEFF Research Database (Denmark)
Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru
2012-01-01
Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...
Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA
Czech Academy of Sciences Publication Activity Database
Hanzálek, Petr; Kypr, Jaroslav
2001-01-01
Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001
Real-time single-molecule observation of rolling-circle DNA replication
Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van
2009-01-01
We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities
Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET
Hohlbein, J.; Kapanidis, A.N.
2016-01-01
Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open
van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.
2008-01-01
Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of
Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy
Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto
2011-01-01
DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016
A 3D-DNA Molecule Made of PlayMais
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems
Williams, Mark C
2011-01-01
This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...
Symmetry Adaptation of the Rotation-Vibration Theory for Linear Molecules
Directory of Open Access Journals (Sweden)
Katy L. Chubb
2018-04-01
Full Text Available A numerical application of linear-molecule symmetry properties, described by the D ∞ h point group, is formulated in terms of lower-order symmetry groups D n h with finite n. Character tables and irreducible representation transformation matrices are presented for D n h groups with arbitrary n-values. These groups can subsequently be used in the construction of symmetry-adapted ro-vibrational basis functions for solving the Schrödinger equations of linear molecules. Their implementation into the symmetrisation procedure based on a set of “reduced” vibrational eigenvalue problems with simplified Hamiltonians is used as a practical example. It is shown how the solutions of these eigenvalue problems can also be extended to include the classification of basis-set functions using ℓ, the eigenvalue (in units of ℏ of the vibrational angular momentum operator L ^ z . This facilitates the symmetry adaptation of the basis set functions in terms of the irreducible representations of D n h . 12 C 2 H 2 is used as an example of a linear molecule of D ∞ h point group symmetry to illustrate the symmetrisation procedure of the variational nuclear motion program Theoretical ROVibrational Energies (TROVE.
Directory of Open Access Journals (Sweden)
Alexey Lyulin
2012-01-01
Full Text Available We report results from Brownian dynamics computer simulations of systems comprised by two terminally charged hyperbranched molecules preferentially branched in the periphery, with an oppositely charged linear chain of varying length. Comparison of the findings from the present study to stoichiometric counterparts and to analogous dendrimer-based complexes, reveal that the presence of the second hyperbranched molecule incurs significant changes in the conformational characteristics of both components of the complex. Instead of step-like changes in the average size and shape of the hyperbranched component that were noted in the previously studied stoichiometric systems, a rather smooth change is observed upon increase of the length of the linear component. In addition, a markedly different behavior is also noticed in the conformational characteristics of the linear chain when compared to that in similar dendrimer-based systems. The above findings are consistent with the higher degree of deformability of the peripherally branched molecules which allow appropriate rearrangements in shape in order to accommodate the favorable Coulombic interactions between the two components of the complex. This behavior offers new insight towards the design of more efficient hyperbranched-based systems which can take advantage of the multifunctionality and the structural properties of the highly branched polymer components.
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Friedrich, Sarah; Wang, Tza-Huei
Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.
Electrochemical single-molecule conductivity of duplex and quadruplex DNA
DEFF Research Database (Denmark)
Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens
2017-01-01
Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...
DNA minor groove binding of small molecules: Experimental and ...
Indian Academy of Sciences (India)
Administrator
Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...
Radioprotection of DNA molecule by oxido-reduction's coenzymes
International Nuclear Information System (INIS)
Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.
1978-01-01
The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)
Morse potential in DNA molecule – An experiment proposal
Indian Academy of Sciences (India)
2012-07-27
Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...
Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology
DEFF Research Database (Denmark)
Olsen, Eva Maria
2012-01-01
Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
Adams, Alice; Lindahl, Tomas; Klein, George
1973-01-01
High-molecular-weight DNA from cell line Raji (derived from Burkitt's lymphoma), which contains 50-60 copies of Epstein-Barr virus DNA per cell, was fractionated in neutral solution by several cycles of CsCl gradient centrifugation in fixed-angle rotors. Under the fractionation conditions used, intact Epstein-Barr virus DNA from virus particles can be separated from the less-dense cellular DNA. In contrast, a large proportion of the intrinsic Epstein-Barr virus DNA component of Raji cells remains associated with cellular DNA, as determined by nucleic acid hybridization. This interaction, which is resistant to Pronase and phenol treatment, is not the result of aggregation. When the molecular weight of Raji DNA is reduced by hydrodynamic shear, the amount of virus DNA associated with cell DNA decreases. However, some virus DNA still remains bound to fragments of cellular DNA after shearing. The association is completely destroyed in alkaline solution. Molecular weight analysis of Raji DNA after denaturation showed that the alkali-induced release of Epstein-Barr virus DNA was specific and not the result of random single-strand breaks. These data indicate that Epstein-Barr virus DNA is linearly integrated into Raji cell DNA by alkali-labile bonds. PMID:4355371
International Nuclear Information System (INIS)
Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.
2011-01-01
To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)
Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.
Directory of Open Access Journals (Sweden)
Mária Džunková
Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.
Bertolotto, Jorge A.; Umazano, Juan P.
2016-06-01
In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Moayed, F.; Mashaghi, A.; Tans, S.J.
2013-01-01
Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an
Single-tube linear DNA amplification (LinDA) for robust ChIP-seq
Shankaranarayanan, P.; Mendoza-Parra, M.A.; Walia, M.; Wang, L.; Li, N.; Trindade, L.M.; Gronemeyer, H.
2011-01-01
Genome-wide profiling of transcription factors based on massive parallel sequencing of immunoprecipitated chromatin (ChIP-seq) requires nanogram amounts of DNA. Here we describe a high-fidelity, single-tube linear DNA amplification method (LinDA) for ChIP-seq and reChIP-seq with picogram DNA amounts
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Greta Zubaite
2017-02-01
Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.
DEFF Research Database (Denmark)
List, Nanna Holmgaard; Coriani, Sonia; Kongsted, Jacob
2014-01-01
are specifically motivated by a twofold aim: (i) computation of core excitations in realistic surroundings and (ii) examination of the effect of the differential response of the environment upon excitation solely related to the CC multipliers (herein denoted the J matrix) in computations of excitation energies......We present an extension of a previously reported implementation of a Lanczos-driven coupled-cluster (CC) damped linear response approach to molecules in condensed phases, where the effects of a surrounding environment are incorporated by means of the polarizable embedding formalism. We...... and transition moments of polarizable-embedded molecules. Numerical calculations demonstrate that the differential polarization of the environment due to the first-order CC multipliers provides only minor contributions to the solvatochromic shift for all transitions considered. We thus complement previous works...
Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V
2017-08-04
Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Linear-algebraic approach to electronic excitation of atoms and molecules by electron impact
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1983-01-01
A linear-algebraic method, based on an integral equations formulation, is applied to the excitation of atoms and molecules by electron impact. Various schemes are devised for treating the one-electron terms that sometimes cause instabilities when directly incorporated into the solution matrix. These include introducing Lagrange undetermined multipliers and correlation terms. Good agreement between the method and other computational techniques is obtained for electron scattering for hydrogenic and Li-like atomic ions and for H 2 + in two- to five-state close-coupling calculations
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1984-01-01
The linear algebraic, separable potential approach is applied to the electronic excitation of atoms and molecules by electron impact. By representing the exchange and off-diagonal direct terms on a basis, the standard set of coupled inelastic equations is reduced to a set of elastic inhomogeneous equations. The procedure greatly simplifies the formulation by allowing a large portion of the problem to be handled by standard bound-state techniques and by greatly reducing the order of the scattering equations that must be solved. Application is made to the excitation of atomic hydrogen in the three-state close-coupling (1s, 2s, 2p) approximation. (author)
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
Linear-algebraic approach to electron-molecule collisions: General formulation
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1981-01-01
We present a linear-algebraic approach to electron-molecule collisions based on an integral equations form with either logarithmic or asymptotic boundary conditions. The introduction of exchange effects does not alter the basic form or order of the linear-algebraic equations for a local potential. In addition to the standard procedure of directly evaluating the exchange integrals by numerical quadrature, we also incorporate exchange effects through a separable-potential approximation. Efficient schemes are developed for reducing the number of points and channels that must be included. The method is applied at the static-exchange level to a number of molecular systems including H 2 , N 2 , LiH, and CO 2
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...
[The effect of spermine on acid-base equilibrium in DNA molecule].
Slonitskiĭ, S V; Kuptsov, V Iu
1990-01-01
The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Huels, Michael A.; Bass Andrew, D.; Mirsaleh-Kohan, Nasrin; Sanche, Leon
The question of the origin for the building blocks of life, either synthesized here on earth, or in space [1], has been the subject of much debate, experimental investigation, or astronomical observation, much of it stimulated by the early experiments of Miller [2], and subsequent space radiation related variations thereof [3-5]. And while the precise details of the formation of even the simplest biomolecules that make up life on earth still remain shrouded inmystery, one of the notions that persist throughout the debate is that the building blocks of life, such as amino-acids, or even the cyclic components of RNA and DNA, or other cyclic hydrocarbons (e.g. PHAs), where synthesized via radiolysis [6] either in the earths proto-atmosphere, its early oceans, or in the near interstellar space surrounding the early earth. Here we provide experimental evidence for the hypothesis that interactions of low energy secondary electrons and ions, formed during the radiolysis of matter, with atoms and molecules in the medium, may have played, and may still play an important role in the chemical transformation of astrophysical or planetary surface ices [7], where they lead to the synthesis of more complex chemical species from less complex, naturally occurring components. We report the synthesis and desorption of new chemical species from simple molecular surface ices, containing CH4 / CD4 , C2 D2 , O2 , CO, CO2 , or N2 in various combination mixtures, irradiated by low energy (CO+ (n = 1-3), among others. The formation of all these linear, pre-biotic molecular species, produced here by electron initiated cation-reactions in simple molecular films, suggests that similar mechanisms likely precede the synthesis of life's most basic cyclic molecular components in planetary, or astrophysical surface ices that are continuously subjected to the types of space radiations (UV, X-or -ray, or heavy ions) that can generate such low energy secondary electrons. [Funded by NSERC and Canadian
In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.
Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C
2017-12-14
Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
International Nuclear Information System (INIS)
Waters, R.
1980-01-01
The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not
Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution
Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.
2016-01-01
We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Energy Technology Data Exchange (ETDEWEB)
Yavari, M., E-mail: yavari@iaukashan.ac.ir [Islamic Azad University, Kashan Branch (Iran, Islamic Republic of)
2016-06-15
We generalize the results of Nesterenko [13, 14] and Gogilidze and Surovtsev [15] for DNA structures. Using the generalized Hamiltonian formalism, we investigate solutions of the equilibrium shape equations for the linear free energy model.
Hussain, Tanveer
2017-09-14
Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr
2003-01-01
Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.
Directory of Open Access Journals (Sweden)
Scott S Walker
Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.
Single-tube linear DNA amplification for genome-wide studies using a few thousand cells
Shankaranarayanan, P.; Mendoza-Parra, M.A.; Gool, van W.; Trindade, L.M.; Gronemeyer, H.
2012-01-01
Linear amplification of DNA (LinDA) by T7 polymerase is a versatile and robust method for generating sufficient amounts of DNA for genome-wide studies with minute amounts of cells. LinDA can be coupled to a great number of global profiling technologies. Indeed, chromatin immunoprecipitation coupled
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.
Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi
2017-12-06
We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.
Kühnemund, M; Nilsson, M
2015-05-15
Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.
Characterization of a linear epitope on Chlamydia trachomatis serovar L2 DnaK-like protein
DEFF Research Database (Denmark)
Ozkokmen, D; Birkelund, Svend; Christiansen, Gunna
1994-01-01
A cytoplasmic 75-kDa immunogen from Chlamydia trachomatis serovar L2 has previously been characterized as being similar to the Escherichia coli heat shock protein DnaK. We have localized a linear epitope for one monoclonal antibody specific for C. trachomatis DnaK. By use of a recombinant DNA...... technique, the epitope was limited to 14 amino acids. With synthetic peptides, the epitope was further limited to eight amino acids. Six of these amino acids are conserved in bovine HSP70, which has a known three-dimensional structure. The amino acid sequence homologous to the epitope is located in a linear...
Linear Ion Traps in Space: The Mars Organic Molecule Analyzer (MOMA) Instrument and Beyond
Arevalo, Ricardo; Brinckerhoff, William; Mahaffy, Paul; van Amerom, Friso; Danell, Ryan; Pinnick, Veronica; Li, Xiang; Hovmand, Lars; Getty, Stephanie; Grubisic, Andrej; Goesmann, Fred; Cottin, Hervé
2015-11-01
Historically, quadrupole mass spectrometer (QMS) instruments have been used to explore a wide survey of planetary targets in our solar system, from Venus (Pioneer Venus) to Saturn (Cassini-Huygens). However, linear ion trap (LIT) mass spectrometers have found a niche as smaller, versatile alternatives to traditional quadrupole analyzers.The core astrobiological experiment of ESA’s ExoMars Program is the Mars Organic Molecule Analyzer (MOMA) onboard the ExoMars 2018 rover. The MOMA instrument is centered on a linear (or 2-D) ion trap mass spectrometer. As opposed to 3-D traps, LIT-based instruments accommodate two symmetrical ion injection pathways, enabling two complementary ion sources to be used. In the case of MOMA, these two analytical approaches are laser desorption mass spectrometry (LDMS) at Mars ambient pressures, and traditional gas chromatography mass spectrometry (GCMS). The LIT analyzer employed by MOMA also offers: higher ion capacity compared to a 3-D trap of the same volume; redundant detection subassemblies for extended lifetime; and, a link to heritage QMS designs and assembly logistics. The MOMA engineering test unit (ETU) has demonstrated the detection of organics in the presence of wt.%-levels of perchlorate, effective ion enhancement via stored waveform inverse Fourier transform (SWIFT), and derivation of structural information through tandem mass spectrometry (MS/MS).A more progressive linear ion trap mass spectrometer (LITMS), funded by the NASA ROSES MatISSE Program, is being developed at NASA GSFC and promises to augment the capabilities of the MOMA instrument by way of: an expanded mass range (i.e., 20 - 2000 Da); detection of both positive and negative ions; spatially resolved (<1 mm) characterization of individual rock core layers; and, evolved gas analysis and GCMS with pyrolysis up to 1300° C (enabling breakdown of refractory phases). The Advanced Resolution Organic Molecule Analyzer (AROMA) instrument, being developed through NASA
Directory of Open Access Journals (Sweden)
Jorge A. Bertolotto
2016-06-01
Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.
Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R
2017-01-01
During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
Multiplex single-molecule interaction profiling of DNA-barcoded proteins.
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M
2014-11-27
In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.
2018-01-01
Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.
Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J
2018-01-10
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination
Directory of Open Access Journals (Sweden)
Hsiu-Fang Fan
2018-05-01
Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.
Single-molecule studies of DNA transcription using atomic force microscopy
International Nuclear Information System (INIS)
Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer
2012-01-01
Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)
Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun
2015-07-13
We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.
Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level
Raducanu, Vlad-Stefan
2016-05-01
Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET
Directory of Open Access Journals (Sweden)
Mengyi Yang
2018-01-01
Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing
Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.
Directory of Open Access Journals (Sweden)
Jonghyun Park
2010-11-01
Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.
DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.
Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg
2014-04-15
DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target
Li, Xiaosong; Zhu, Junke; Lai, Guoqi; Yan, Lei; Hu, Jieli; Chen, Juan; Tang, Ni; Huang, Ailong
2015-01-01
Studies on molecular mechanisms of the persist infection of hepatitis B virus have been hampered by a lack of a robust animal model. We successfully established a simple, versatile, and reproducible HBV persist infection model in vitro and in vivo with the circularized HBV DNA. The cells and mice were transfected or injected with circularized HBV DNA and pAAV/HBV1.2, respectively. At the indicated time, the cells, supernatants, serum samples, and liver tissues were collected for virological and serological detection. Both in vitro and in vivo, the circularized HBV DNA and pAAV/HBV1.2 could replicate and transcribe efficiently, but the infection effect of the former was superior to the latter (p HBV genome DNA into the mice robustly supported HBV infection and approximately 80% of HBV infected mice established persistent infection for at least 10 weeks. This study demonstrated that the infection efficiency and replication ability of the circularized structure of HBV DNA overmatched that of the expression plasmid containing the linear structure of HBV DNA in vitro and in vivo. Meanwhile, this research results could provide useful tools and methodology for further study of pathogenic mechanisms and potential antiviral treatments of human chronic HBV infection in vitro and in vivo. PMID:25751726
Shirbini, Afnan
2017-01-01
and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan
1999-01-01
By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first
The implications of non-linearity for excitation transfer in DNA
International Nuclear Information System (INIS)
Baverstock, K.F.; Cundall, R.B.
1990-01-01
Non-linear effects which arise from the coupling of anharmonic interactions can completely change excitation transport through molecular chains. The consequences of this for an understanding of the effect of ionising radiation on DNA are discussed. We consider that these effects should be taken into account in the interpretation of experimental data. (author)
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
Electronic properties and assambly of DNA-based molecules on gold surfaces
DEFF Research Database (Denmark)
Salvatore, Princia
, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049
International Nuclear Information System (INIS)
Le, Anh-Thu; Lin, C. D.; Lucchese, R. R.
2010-01-01
We present theoretical calculations for polarization and ellipticity of high-order harmonics from aligned N 2 , CO 2 , and O 2 molecules generated by linearly polarized lasers. Within the rescattering model, the two polarization amplitudes of the harmonics are determined by the photo-recombination amplitudes for photons emitted with polarization parallel or perpendicular to the direction of the same returning electron wave packet. Our results show clear species-dependent polarization states, in excellent agreement with experiments. We further note that the measured polarization ellipse of the harmonic furnishes the needed parameters for a 'complete' experiment in molecules.
International Nuclear Information System (INIS)
Larriba-Andaluz, Carlos; Hogan, Christopher J.
2014-01-01
Structural characterization of ions in the gas phase is facilitated by measurement of ion collision cross sections (CCS) using techniques such as ion mobility spectrometry. Further information is gained from CCS measurement when comparison is made between measurements and accurately predicted CCSs for model ion structures and the gas in which measurements are made. While diatomic gases, namely molecular nitrogen and air, are being used in CCS measurement with increasingly prevalency, the majority of studies in which measurements are compared to predictions use models in which gas molecules are spherical or non-rotating, which is not necessarily appropriate for diatomic gases. Here, we adapt a momentum transfer based CCS calculation approach to consider rotating, diatomic gas molecule collisions with polyatomic ions, and compare CCS predictions with a diatomic gas molecule to those made with a spherical gas molecular for model spherical ions, tetra-alkylammonium ions, and multiply charged polyethylene glycol ions. CCS calculations are performed using both specular-elastic and diffuse-inelastic collisions rules, which mimic negligible internal energy exchange and complete thermal accommodation, respectively, between gas molecule and ion. The influence of the long range ion-induced dipole potential on calculations is also examined with both gas molecule models. In large part we find that CCSs calculated with specular-elastic collision rules decrease, while they increase with diffuse-inelastic collision rules when using diatomic gas molecules. Results clearly show the structural model of both the ion and gas molecule, the potential energy field between ion and gas molecule, and finally the modeled degree of kinetic energy exchange between ion and gas molecule internal energy are coupled to one another in CCS calculations, and must be considered carefully to obtain results which agree with measurements
Shirbini, Afnan
2017-05-01
Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.
Directory of Open Access Journals (Sweden)
Toshitsugu Fujita
2015-09-01
Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.
International Nuclear Information System (INIS)
Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.
2006-01-01
Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.
Yumura, Takashi; Yamamoto, Wataru
2017-09-20
We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the
International Nuclear Information System (INIS)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick
2009-01-01
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.
Energy Technology Data Exchange (ETDEWEB)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)
2009-11-20
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.
On the linearity of the dose-effect relationship of DNA double strand breaks
International Nuclear Information System (INIS)
Chadwick, K.H.; Leenhouts, H.P.
1994-01-01
Most radiation biologists believe that DNA double-strand breaks are induced linearly with radiation dose for all types of radiation. Since 1985, with the advent of elution and gel electrophoresis techniques which permit the measurement of DNA double-strand breaks induced in mammalian cells at doses having radiobiological relevance, the true nature of the dose-effect relationship has been brought into some doubt. Many investigators measured curvilinear dose-effect relationships and a few found good correlations between the induction of the DNA double-strand breaks and cell survival. We approach the problem pragmatically by assuming that the induction of DNA double-strand breaks by 125 I Auger electron emitters incorporated into the DNA of the cells is a linear function of the number of 125 I decays, and by comparing the dose-effect relationship for sparsely ionizing radiation against this standard. The conclusion drawn that the curvilinear dose-effect relationships and the correlations with survival are real. (Author)
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.
Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai
2018-01-09
Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Madsen, Lars Bojer; Tolstikhin, Oleg I.; Morishita, Toru
2012-01-01
The recently developed weak-field asymptotic theory [ Phys. Rev. A 84 053423 (2011)] is applied to the analysis of tunneling ionization of a molecular ion (H2+), several homonuclear (H2, N2, O2) and heteronuclear (CO, HF) diatomic molecules, and a linear triatomic molecule (CO2) in a static...... electric field. The dependence of the ionization rate on the angle between the molecular axis and the field is determined by a structure factor for the highest occupied molecular orbital. This factor is calculated using a virtually exact discrete variable representation wave function for H2+, very accurate...... Hartree-Fock wave functions for the diatomics, and a Hartree-Fock quantum chemistry wave function for CO2. The structure factors are expanded in terms of standard functions and the associated structure coefficients, allowing the determination of the ionization rate for any orientation of the molecule...
Directory of Open Access Journals (Sweden)
Ilko Bald
2014-09-01
Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.
Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library
DEFF Research Database (Denmark)
Petersen, L. K.; Blakskjær, P.; Chaikuad, A.
2016-01-01
A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...
Theoretical study of molecular vibration and Application to linear triatomic molecules: case of OCS
International Nuclear Information System (INIS)
Andrianavalomahefa, A.
2014-01-01
Our aim is to give a theoretical approach to the calculation of vibrational energy levels of polyatomic molecules. By using matrix calculation, we have to solve an eigenvalue equation that gives normal vibration frequencies of the system. A basis change introduces normal coordinates of vibration, which diagonalize the Hamiltonian. The harmonic approximation gives a rough evaluation of parameters which describe the system. Then, we introduce nonlinear terms to take into account the anharmonicity of interatomic bounds. Morse oscillator gives good approximation for diatomic molecules. We consider cubic and quartic potential terms for polyatomic molecules. We treat the problem both in classical and quantum approach. The results thus obtained are applied to study longitudinal vibration of carbonyl sulfide. [fr
Directory of Open Access Journals (Sweden)
Fatemeh Moayed
Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.
Molecules with linear pi-conjugated pathways between all substituents : Omniconjugation
van der Veen, M.H.; Rispens, M.T; Jonkman, H.T.; Hummelen, J.C.
In this paper, omniconjugation is introduced as a topological phenomenon in pi-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully pi-conjugated pathways between all subdstituents attached to them. Surprisingly, until now such topologies have never
Molecules with Linear π-Conjugated Pathways between All Substituents : Omniconjugation
Veen, Marleen H. van der; Rispens, Minze T.; Jonkman, Harry T.; Hummelen, Jan C.
2004-01-01
In this paper, omniconjugation is introduced as a topological phenomenon in π-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully π-conjugated pathways between all substituents attached to them. Surprisingly, until now such topologies have never
Petrov, E.G.; Marchenko, A.; Kapitanchuk, O.; Katsonis, Nathalie Hélène; Fichou, D.
2014-01-01
The conductance properties of 1,3-(trimethylsilyl)-1-tridecene-6,12-diyne, a non-conjugated trimethylsil-acetylene molecule have been investigated both experimentally and theoretically. Based on scanning tunnelling spectroscopy experiments, a discussion on the mechanisms controlling the charge
International Nuclear Information System (INIS)
Yamamoto, Takatoki; Fujii, Teruo
2010-01-01
Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.
Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules
International Nuclear Information System (INIS)
Gareev, F.A.; Gareeva, G.F.
2001-01-01
Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe
In silico single-molecule manipulation of DNA with rigid body dynamics.
Directory of Open Access Journals (Sweden)
Pascal Carrivain
2014-02-01
Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.
Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip
2014-10-21
Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.
Directory of Open Access Journals (Sweden)
Haowei Wang
Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
A novel small molecule inhibitor of the DNA repair protein Ku70/80.
Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka
2016-07-01
Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All
DEFF Research Database (Denmark)
Etches, Adam; Madsen, Christian Bruun; Madsen, Lars Bojer
2010-01-01
A recent paper reported elliptically polarized high-order harmonics from aligned N2 using a linearly polarized driving field [X. Zhou et al., Phys. Rev. Lett. 102, 073902 (2009)]. This observation cannot be explained in the standard treatment of the Lewenstein model and has been ascribed to many...
A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior
Energy Technology Data Exchange (ETDEWEB)
Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui
2010-04-20
Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.
International Nuclear Information System (INIS)
Oliveira, Joao Paulo Cavalcante; Mota, F. de Brito; Rivelino, Roberto
2011-01-01
Full text. Carbon nano wires made of long linear atomic chains have attracted considerable interest due to their potential applications in nano electronics. We report a density-functional-theory study of the nuclear spin-spin coupling constants for nano assemblies made of two coronene molecules bridged by carbon linear chains, considering distinct sizes and spin multiplicities. Also, we examine the effects of two terminal conformations (syn and anti) of the terminal anchor pieces on the magnetic properties of the carbon chains via 13 C NMR calculations. Our results reveal that simplified chemical models such as those based on cumulenes or polyynes are not appropriate to describe the linear chains with sp 2 terminations. For these types of atomic chains, the electronic ground state of the even-numbered chains can be singlet or triplet, whereas the ground state of the odd-numbered chains can be doublet or quartet. We discuss how the 13 C NMR chemical shift absorption is affected by increasing the size and changing the parity of the linear carbon chains. We have found that the J coupling constants between the carbon atoms in the linear chains present a well-defined pattern, in good accordance with our electronic structure calculations. For example, in the -C 4 - units we obtain couplings of 43.8, 114.5, 84.6, 114.5, and 43.8 Hz from one end to the other
Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun
2017-11-01
The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.
Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.
2016-01-01
Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595
Geertsema, Hylkje
2014-01-01
De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
Energy Technology Data Exchange (ETDEWEB)
Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)
2009-07-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
International Nuclear Information System (INIS)
Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.
2009-01-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Sub-wavelength plasmonic readout for direct linear analysis of optically tagged DNA
Varsanik, Jonathan; Teynor, William; LeBlanc, John; Clark, Heather; Krogmeier, Jeffrey; Yang, Tian; Crozier, Kenneth; Bernstein, Jonathan
2010-02-01
This work describes the development and fabrication of a novel nanofluidic flow-through sensing chip that utilizes a plasmonic resonator to excite fluorescent tags with sub-wavelength resolution. We cover the design of the microfluidic chip and simulation of the plasmonic resonator using Finite Difference Time Domain (FDTD) software. The fabrication methods are presented, with testing procedures and preliminary results. This research is aimed at improving the resolution limits of the Direct Linear Analysis (DLA) technique developed by US Genomics [1]. In DLA, intercalating dyes which tag a specific 8 base-pair sequence are inserted in a DNA sample. This sample is pumped though a nano-fluidic channel, where it is stretched into a linear geometry and interrogated with light which excites the fluorescent tags. The resulting sequence of optical pulses produces a characteristic "fingerprint" of the sample which uniquely identifies any sample of DNA. Plasmonic confinement of light to a 100 nm wide metallic nano-stripe enables resolution of a higher tag density compared to free space optics. Prototype devices have been fabricated and are being tested with fluorophore solutions and tagged DNA. Preliminary results show evanescent coupling to the plasmonic resonator is occurring with 0.1 micron resolution, however light scattering limits the S/N of the detector. Two methods to reduce scattered light are presented: index matching and curved waveguides.
Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya
2015-08-01
Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Ejection of Coulomb Crystals from a Linear Paul Ion Trap for Ion-Molecule Reaction Studies.
Meyer, K A E; Pollum, L L; Petralia, L S; Tauschinsky, A; Rennick, C J; Softley, T P; Heazlewood, B R
2015-12-17
Coulomb crystals are being increasingly employed as a highly localized source of cold ions for the study of ion-molecule chemical reactions. To extend the scope of reactions that can be studied in Coulomb crystals-from simple reactions involving laser-cooled atomic ions, to more complex systems where molecular reactants give rise to multiple product channels-sensitive product detection methodologies are required. The use of a digital ion trap (DIT) and a new damped cosine trap (DCT) are described, which facilitate the ejection of Coulomb-crystallized ions onto an external detector for the recording of time-of-flight (TOF) mass spectra. This enables the examination of reaction dynamics and kinetics between Coulomb-crystallized ions and neutral molecules: ionic products are typically cotrapped, thus ejecting the crystal onto an external detector reveals the masses, identities, and quantities of all ionic species at a selected point in the reaction. Two reaction systems are examined: the reaction of Ca(+) with deuterated isotopologues of water, and the charge exchange between cotrapped Xe(+) with deuterated isotopologues of ammonia. These reactions are examples of two distinct types of experiment, the first involving direct reaction of the laser-cooled ions, and the second involving reaction of sympathetically-cooled heavy ions to form a mixture of light product ions. Extensive simulations are conducted to interpret experimental results and calculate optimal operating parameters, facilitating a comparison between the DIT and DCT approaches. The simulations also demonstrate a correlation between crystal shape and image shape on the detector, suggesting a possible means for determining crystal geometry for nonfluorescing ions.
International Nuclear Information System (INIS)
England, W.B.
1978-01-01
Uncorrelated and correlated potential energy curves and dipole moments are reported for linear KOH. The compound is found to be ionic, K + OH - . Minimum energy bond lengths are R/sub KO/=4.2913 au and R/sub OH/=1.7688 au, with an estimated accuracy of 2%. The corresponding dipole moment is 3.3 au (8.46 D) with a similar accuracy estimate. This is to our knowledge the first value ever reported for the KOH dipole moment, and the large value suggests that KOH will be an effective electron scatterer in MHD plasmas
Paximadis, M; Rey, M E
2001-12-01
The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.
Czech Academy of Sciences Publication Activity Database
Nosek, J.; Novotná, Marcela; Hlavaticová, Z.; Ussery, D. W.; Fajkus, Jiří; Tomáška, L.
2004-01-01
Roč. 272, č. 2 (2004), s. 173-180 ISSN 1617-4615 Grant - others:Howard Hughes Medical Institute(US) 55000327; VEGA MŠ SR(SK) 1/9153/02; VEGA MŠ SR(SK) 1/0006/03; APVT(SK) 20-003902; Fogarty International NIH(US) 1-R03-TW05654-01 Institutional research plan: CEZ:AV0Z5004920 Keywords : Candida parapsilosis * linear mitochondrial DNA * telomeric circles (t-circles) Subject RIV: BO - Biophysics Impact factor: 2.371, year: 2004
Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules
International Nuclear Information System (INIS)
Gareev, F.A.; Gareeva, G.F.
2001-01-01
Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of
Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain
2010-04-22
Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G
Molecular-beam electric-resonance studies of linear triatomic molecules
International Nuclear Information System (INIS)
Reinartz, J.M.L.J.
1976-01-01
In the present work, the MBER technique has been employed to investigate the spectra of the high temperature species KCN and CsOH and at low temperatures the spectra of five different isotopic species of OCS in natural mixture and the most abundant isotopic species of N 2 O and ClCN. For the low temperature species, spectra in the ground state and in the first excited state of the bending mode have been obtained. Bending vibrational effects on hyperfine constants and on electric and magnetic constants have been deduced from these spectra. The introduction of nozzle beam sources has been a factor of great importance for this study. For the ground states, high resolution spectra have been obtained both in external electric and in combined parallel electric and magnetic fields. These spectra could well be explained by the known theories for molecules in a 1 Σ state to within an experimental accuracy of about 50-150 Hz. Extension of the theory needed for the interpretation of the spectra for excited bending states is given. Hyperfine properties and electric and magnetic constants have been obtained with very high accuracy from the analysis of the frequencies of the observed transitions within one rotational state (ΔJ = 0 transitions)
Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi
2012-03-14
We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.
Energy Technology Data Exchange (ETDEWEB)
Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)
1999-02-01
DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)
Energy Technology Data Exchange (ETDEWEB)
Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))
1989-07-11
Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.
Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.
Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D
2007-12-15
The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.
The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA
Directory of Open Access Journals (Sweden)
Lee Robert W
2009-03-01
Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this
James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John
2016-01-15
The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Jacobson, Daniel; Stratt, Richard M.
2014-05-01
Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.
Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia
2017-08-01
A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.
Counting molecules in cell-free DNA and single cells RNA
Karlsson, Kasper
2016-01-01
The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...
A single thiazole orange molecule forms an exciplex in a DNA i-motif.
Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei
2014-06-18
A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.
Directory of Open Access Journals (Sweden)
Zach Hensel
Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason
2009-03-01
The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
International Nuclear Information System (INIS)
Pham, Quang Trung
2014-01-01
The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level
Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik
2012-01-01
While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...
Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi
2008-12-15
The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.
Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.
Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik
2012-06-27
While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.
Size distribution of DNA molecules recovered from non-denaturing filter elution
International Nuclear Information System (INIS)
Bloecher, D.; Iliakis, G.
1991-01-01
DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)
Energy Technology Data Exchange (ETDEWEB)
Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)
2015-06-01
Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.
Visualization of DNA double-strand break repair: From molecules to cells
Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.
2008-01-01
DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation
Energy Technology Data Exchange (ETDEWEB)
Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie
1981-01-01
Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.
Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2017-11-17
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.
Klapacz, Joanna; Pottenger, Lynn H; Engelward, Bevin P; Heinen, Christopher D; Johnson, George E; Clewell, Rebecca A; Carmichael, Paul L; Adeleye, Yeyejide; Andersen, Melvin E
2016-01-01
From a risk assessment perspective, DNA-reactive agents are conventionally assumed to have genotoxic risks at all exposure levels, thus applying a linear extrapolation for low-dose responses. New approaches discussed here, including more diverse and sensitive methods for assessing DNA damage and DNA repair, strongly support the existence of measurable regions where genotoxic responses with increasing doses are insignificant relative to control. Model monofunctional alkylating agents have in vitro and in vivo datasets amenable to determination of points of departure (PoDs) for genotoxic effects. A session at the 2013 Society of Toxicology meeting provided an opportunity to survey the progress in understanding the biological basis of empirically-observed PoDs for DNA alkylating agents. Together with the literature published since, this review discusses cellular pathways activated by endogenous and exogenous alkylation DNA damage. Cells have evolved conserved processes that monitor and counteract a spontaneous steady-state level of DNA damage. The ubiquitous network of DNA repair pathways serves as the first line of defense for clearing of the DNA damage and preventing mutation. Other biological pathways discussed here that are activated by genotoxic stress include post-translational activation of cell cycle networks and transcriptional networks for apoptosis/cell death. The interactions of various DNA repair and DNA damage response pathways provide biological bases for the observed PoD behaviors seen with genotoxic compounds. Thus, after formation of DNA adducts, the activation of cellular pathways can lead to the avoidance of a mutagenic outcome. The understanding of the cellular mechanisms acting within the low-dose region will serve to better characterize risks from exposures to DNA-reactive agents at environmentally-relevant concentrations. Copyright © 2015 Elsevier B.V. All rights reserved.
Klapacz, Joanna; Pottenger, Lynn H.; Engelward, Bevin P.; Heinen, Christopher D.; Johnson, George E.; Clewell, Rebecca A.; Carmichael, Paul L.; Adeleye, Yeyejide; Andersen, Melvin E.
2016-01-01
From a risk assessment perspective, DNA-reactive agents are conventionally assumed to have genotoxic risks at all exposure levels, thus applying a linear extrapolation for low-dose responses. New approaches discussed here, including more diverse and sensitive methods for assessing DNA damage and DNA repair, strongly support the existence of measurable regions where genotoxic responses with increasing doses are insignificant relative to control. Model monofunctional alkylating agents have in vitro and in vivo datasets amenable to determination of points of departure (PoDs) for genotoxic effects. A session at the 2013 Society of Toxicology meeting provided an opportunity to survey the progress in understanding the biological basis of empirically-observed PoDs for DNA alkylating agents. Together with the literature published since, this review discusses cellular pathways activated by endogenous and exogenous alkylation DNA damage. Cells have evolved conserved processes that monitor and counteract a spontaneous steady-state level of DNA damage. The ubiquitous network of DNA repair pathways serves as the first line of defense for clearing of the DNA damage and preventing mutation. Other biological pathways discussed here that are activated by genotoxic stress include post-translational activation of cell cycle networks and transcriptional networks for apoptosis/cell death. The interactions of various DNA repair and DNA damage response pathways provide biological bases for the observed PoD behaviors seen with genotoxic compounds. Thus, after formation of DNA adducts, the activation of cellular pathways can lead to the avoidance a mutagenic outcome. The understanding of the cellular mechanisms acting within the low-dose region will serve to better characterize risks from exposures to DNA-reactive agents at environmentally-relevant concentrations. PMID:27036068
2012-09-05
... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...
Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level
Raducanu, Vlad-Stefan
2016-01-01
Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners
International Nuclear Information System (INIS)
Todd, M.B.
1980-06-01
A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome
Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow
Hatlo, Marius M.; Panja, Debabrata; van Roij, René
2011-08-01
Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.
Elimination Voltammetry with Linear Scan as a New Detection Method for DNA Sensors
Directory of Open Access Journals (Sweden)
Rene Kizek
2005-11-01
Full Text Available The paper describes successful coupling of adsorptive transfer stripping (AdTS andelimination voltammetry with linear scan (EVLS for the resolution of reduction signals of cytosine (Cand adenine (A residues in hetero-oligodeoxynucleotides (ODNs. Short ODNs (9-mers and 20-merswere adsorbed from a small volume on a hanging mercury drop electrode (HMDE. After washing ofthe ODN-modified electrode by water and its transferring to an electrochemical cell, voltammetric curves were measured. The AdTS EVLS was able to determine of C/A ratio of ODNs through theelimination function conserving the diffusion current component and eliminating kinetic and chargingcurrent components. This function, which provides the elimination signal in a peak-counterpeak form,increased the current sensitivity for A and C resolution, and for the recognition of bases sequences inODN chains. Optimal conditions of elimination experiments such as pH, time of adsorption, and scanrate were found. The combination of EVLS with AdTS procedure can be considered as a newdetection method in a DNA sensor.
Energy Technology Data Exchange (ETDEWEB)
Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2015-01-07
Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three
Energy Technology Data Exchange (ETDEWEB)
Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)
2016-10-12
Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.
Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes
International Nuclear Information System (INIS)
Pinak, Miroslav
2004-12-01
Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)
Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei
2013-10-01
The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Reisner, Walter; Beech, J. P.; Larsen, Niels Bent
2007-01-01
100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....
Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels
Orlandini, Enzo; Micheletti, Cristian
2014-03-01
Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.
International Nuclear Information System (INIS)
Decout, J.L.; Lhomme, J.
1983-01-01
To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)
Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device
DEFF Research Database (Denmark)
Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David
2013-01-01
as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....
Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang
2017-01-01
The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.
DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].
2001
This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…
True single-molecule DNA sequencing of a pleistocene horse bone
DEFF Research Database (Denmark)
Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa
2011-01-01
-preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...
Energy Technology Data Exchange (ETDEWEB)
Grohmann, Thomas
2012-05-31
In this thesis the wave packet dynamics of nuclear spin isomers of polyatomic molecules after interaction with static and time-dependent magnetic fields and moderate intense nonresonant laser pulses is investigated. In particular, the process of inducing (internal) molecular rotation as well as alignment of molecules by manipulating their rotational or rotational-torsional degrees of freedom is studied. In the first part of the thesis all theoretical concepts for identifying nuclear spin isomers and for describing their quantum dynamics will be discussed. Especially the symmetrization postulate and themolecular symmetry group will be introduced and illustrated for some examples of molecules. These concepts will be extended to the case of identifying nuclear spin isomers in the presence of an external field. In the second part it is shown for nitromethane that magnetic fields are able to induce unidirectional rotations in opposite directions for different nuclear spin isomers of molecules containing methyl groups if the dipolar interaction is included. Additionally, it is demonstrated that different nuclear spin isomers of a chemical compound may show different alignment after the interaction with a moderate intense laser pulse. As shown for the rigid symmetric top propadien and the rigid asymmetric tops ethene and analogues, distinct pairs of nuclear spin isomers show at certain points in time a complementary behavior: while one isomer is showing alignment the partner isomer is showing anti-alignment. Moreover, it is illustrated that not every nuclear spin isomer can be aligned equally efficient. The alignment of non-rigid molecules is considered as well. As an example for a molecule with feasible torsion in the electronic ground state, the alignment of diboron tetrafluoride is investigated. It becomes apparent that not only rotational but also the torsional dynamics of the molecules is nuclear spin selective; different nuclear spin isomers have at distinct points
Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun
2018-04-12
Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai
2018-01-01
Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283
The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.
Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth
2012-09-01
We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.
Interactive measurement and characterization of DNA molecules by analysis of AFM images
Czech Academy of Sciences Publication Activity Database
Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.
2005-01-01
Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005
Gadkar, Vijay J; Filion, Martin
2013-06-01
In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.
Function of the UVR marker in dark repair of DNA molecules
Energy Technology Data Exchange (ETDEWEB)
Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky
1975-01-01
It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.
Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.
Gopinath, Ashwin; Rothemund, Paul W K
2014-12-23
Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.
Aptamer-conjugated DNA nano-ring as the carrier of drug molecules
Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung
2018-03-01
Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.
International Nuclear Information System (INIS)
Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon
2008-01-01
We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations
Energy Technology Data Exchange (ETDEWEB)
Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)
2016-05-01
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.
A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules
DEFF Research Database (Denmark)
Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum
2014-01-01
. The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...
Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi
2012-01-01
Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502
Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun
2016-09-01
To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.
Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules
DEFF Research Database (Denmark)
Schlemmer, B O; Sorensen, B S; Overgaard, J
2004-01-01
of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...
van der Ende, A.; Langeveld, S. A.; Teertstra, R.; van Arkel, G. A.; Weisbeek, P. J.
1981-01-01
Incubation of phi X174 replication form I DNA with the A* protein of phi X174 in the presence of MN2+ results in the formation of three different types of DNA molecules: open circular form DNA (RFII), linear form DNA (RFIII) and the relaxed covalently closed form DNA (RFIV). The RFII and RFIII DNAs
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D
2013-07-01
The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.
Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.
2012-01-01
A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183
International Nuclear Information System (INIS)
Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui
2011-01-01
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
Energy Technology Data Exchange (ETDEWEB)
Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2011-01-24
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
International Nuclear Information System (INIS)
Gaudry, Jean-Baptiste
2000-01-01
This research thesis reports the study of two mechanisms of non linear interaction of a laser wave with matter. More particularly, it reports the experimental investigation of non linear optical properties of organometallic molecules in solution, as well as the damage of perfect silica under laser irradiation by using simulation codes. As far as optical properties are concerned, the author highlights the influence of the electronic configuration of the metal present in the organometallic compound, and the influence of the ligand on the second-order non-linear response. As far as the simulation is concerned, some experimental results have been reproduced. This work can be useful for the investigation of the extrinsic damage of imperfect materials, and for the design of experiments of transient measurements of excited silica [fr
Directory of Open Access Journals (Sweden)
Francesco Gentile
2018-04-01
Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.
International Nuclear Information System (INIS)
Eckl, P.
1981-01-01
This study was initiated to investigate, whether there are any radiation-induced changes in DNA-content and if these changes can be repaired. Seeds of Vicia faba L. were grown in glass culture vessels. After 10 to 20 days the seedings were irradiated using a 1 C1 60 Co gammasource (90mrad/h and 33 rad/h) and a 5 mCi 252 Cf neutronsource (90 mrad/h). Both, neutron and gamma irradiation cause a reduction in nuclear DNA-content even after low doses (1 to 10 rad). The extent of depression is only depending on linear energy transfer. Parallel to the induced minimum in DNA-content, but shifted to higher doses, also the mitotic activity reaches a minimum. Whereas neutron irradiation results in a total stop after doses of 8 rad, gamma-irradiation only induces a depression of 80 %. Whith higher doses the mitotic activity increases again. The neutron-induced changes in DNA-content seem to be restored within 90 minutes after irradiation. No continuous increase could be found after low gamma-doses. Gamma-irradiation with higher dose rates ( 60 Co, 33 rad/h) causes a general decrease over the dose-range studied (100 to 1600 rad). Following doses of 100 rad the mitotic activity increases significantly. With higher doses the decrease is exponential. A dose-dependent mitotic delay could also be observed. As described by many authors, unscheduled DNA-synthesis (UDS) could not be detected in nuclei of Vicia faba. This indicates that an other system, perhaps acting in situ - at the damaged place - is responsible for the repair of radiation-induced thymine-damages. (Author)
International Nuclear Information System (INIS)
Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.
2014-01-01
The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)
DNA Open states and DNA hydratation
International Nuclear Information System (INIS)
Lema-Larre, B. de; Martin-Landrove, M
1995-01-01
It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es
DNA expressions - A formal notation for DNA
Vliet, Rudy van
2015-01-01
We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Binding branched and linear DNA structures: From isolated clusters to fully bonded gels
Fernandez-Castanon, J.; Bomboi, F.; Sciortino, F.
2018-01-01
The proper design of DNA sequences allows for the formation of well-defined supramolecular units with controlled interactions via a consecution of self-assembling processes. Here, we benefit from the controlled DNA self-assembly to experimentally realize particles with well-defined valence, namely, tetravalent nanostars (A) and bivalent chains (B). We specifically focus on the case in which A particles can only bind to B particles, via appropriately designed sticky-end sequences. Hence AA and BB bonds are not allowed. Such a binary mixture system reproduces with DNA-based particles the physics of poly-functional condensation, with an exquisite control over the bonding process, tuned by the ratio, r, between B and A units and by the temperature, T. We report dynamic light scattering experiments in a window of Ts ranging from 10 °C to 55 °C and an interval of r around the percolation transition to quantify the decay of the density correlation for the different cases. At low T, when all possible bonds are formed, the system behaves as a fully bonded network, as a percolating gel, and as a cluster fluid depending on the selected r.
Andrade, Carolina D.; Yanez, Ciceron O.; Rodriguez, Luis; Belfield, Kevin D.
2010-01-01
The synthesis, structural, and photophysical characterization of a series of new fluorescent donor–acceptor and acceptor-acceptor molecules, based on the fluorenyl ring system, with two-photon absorbing properties is described. These new compounds exhibited large Stokes shifts, high fluorescent quantum yields, and, significantly, high two-photon absorption cross sections, making them well suited for two-photon fluorescence microscopy (2PFM) imaging. Confocal and two-photon fluorescence microscopy imaging of COS-7 and HCT 116 cells incubated with probe I showed endosomal selectivity, demonstrating the potential of this class of fluorescent probes in multiphoton fluorescence microscopy. PMID:20481596
Mineo, Hirobumi; Fujimura, Yuichi
2015-06-01
We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.
Mineo, Hirobumi; Yamaki, Masahiro; Teranishi, Yoshiaki; Hayashi, Michitoshi; Lin, Sheng Hsien; Fujimura, Yuichi
2012-09-05
Nonplanar chiral aromatic molecules are candidates for use as building blocks of multidimensional switching devices because the π electrons can generate ring currents with a variety of directions. We employed (P)-2,2'-biphenol because four patterns of π-electron rotations along the two phenol rings are possible and theoretically determine how quantum switching of the π-electron rotations can be realized. We found that each rotational pattern can be driven by a coherent excitation of two electronic states under two conditions: one is the symmetry of the electronic states and the other is their relative phase. On the basis of the results of quantum dynamics simulations, we propose a quantum control method for sequential switching among the four rotational patterns that can be performed by using ultrashort overlapped pump and dump pulses with properly selected relative phases and photon polarization directions. The results serve as a theoretical basis for the design of confined ultrafast switching of ring currents of nonplanar molecules and further current-induced magnetic fluxes of more sophisticated systems.
Wang, Fei; Chen, Quanjiao; Li, Shuntang; Zhang, Chenyao; Li, Shanshan; Liu, Min; Mei, Kun; Li, Chunhua; Ma, Lixin; Yu, Xiaolan
2017-06-01
Linear DNA vaccines provide effective vaccination. However, their application is limited by high cost and small scale of the conventional polymerase chain reaction (PCR) generally used to obtain sufficient amounts of DNA effective against epidemic diseases. In this study, a two-step, large-scale PCR was established using a low-cost DNA polymerase, RKOD, expressed in Pichia pastoris. Two linear DNA vaccines encoding influenza H1N1 hemagglutinin (HA) 1, LEC-HA, and PTO-LEC-HA (with phosphorothioate-modified primers), were produced by the two-step PCR. Protective effects of the vaccines were evaluated in a mouse model. BALB/c mice were immunized three times with the vaccines or a control DNA fragment. All immunized animals were challenged by intranasal administration of a lethal dose of influenza H1N1 virus 2 weeks after the last immunization. Sera of the immunized animals were tested for the presence of HA-specific antibodies, and the total IFN-γ responses induced by linear DNA vaccines were measured. The results showed that the DNA vaccines but not the control DNA induced strong antibody and IFN-γ responses. Additionally, the PTO-LEC-HA vaccine effectively protected the mice against the lethal homologous mouse-adapted virus, with a survival rate of 100% versus 70% in the LEC-HA-vaccinated group, showing that the PTO-LEC-HA vaccine was more effective than LEC-HA. In conclusion, the results indicated that the linear H1N1 HA-coding DNA vaccines induced significant immune responses and protected mice against a lethal virus challenge. Thus, the low-cost, two-step, large-scale PCR can be considered a potential tool for rapid manufacturing of linear DNA vaccines against emerging infectious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin
2014-01-01
Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.
Directory of Open Access Journals (Sweden)
Lindy L. Esterhuizen
2012-09-01
Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.
Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C
2015-04-01
DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sahoo, Amaresh Kumar; Sk, Md Palashuddin; Ghosh, Siddhartha Sankar; Chattopadhyay, Arun
2011-10-01
Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the composite strongly interacted with the bacterial cell walls leading to cell bursting. Interestingly, enhancement in the reactive oxygen species (ROS) generation in bacteria was observed in the presence of the composite. It is proposed that the ROS generation led to oxidation of the dimer to N-acetyl-p-benzoquinone imine (NAPQI). The generated NAPQI acted as a DNA gyrase inhibitor causing cell death following linearization of DNA.Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the
Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar
2016-06-03
Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo
2010-11-01
Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity
Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina
2018-01-01
Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion
DNA maintenance in plastids and mitochondria of plants
Directory of Open Access Journals (Sweden)
Delene J Oldenburg
2015-10-01
Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.
International Nuclear Information System (INIS)
Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.
1999-01-01
The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi
2017-03-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.
International Nuclear Information System (INIS)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi
2017-01-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)
Nayak, Alpana; Suresh, K. A.
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
Hansen, J S; Daivis, Peter J; Todd, B D
2009-10-01
In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.
Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K
2005-01-01
Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the
Sadorra, Mark; LaMere, Brandon J.; Kail, Randi; Aldrich, Carrie; Kinney, Walter; Fetterman, Barbara; Lorey, Thomas; Schiffman, Mark; Castle, Philip E.
2012-01-01
The cobas human papillomavirus (HPV) test (cobas) was recently approved by the U.S. Food and Drug Administration (FDA) and identifies HPV16 and HPV18 separately as well as detecting a pool of 11 HR-HPV genotypes (HPV31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -68) and also HPV66. We compared cobas, Linear Array (LA), and Hybrid Capture 2 (HC2) assays for detection of carcinogenic HPV DNA, and cobas and LA for detection of HPV16 and HPV18 DNA, among the first 1,852 women enrolled in the HPV Persistence and Progression Cohort (PaP Cohort) study. Specimens were tested by all 3 assays 1 year after an HC2-positive result. In 1,824 specimens with cobas results, cobas had an 85.9% agreement with HC2 and 91.0% agreement with LA for carcinogenic HPV detection. When results between cobas and HC2 disagreed, cobas tended to call more women HPV positive (P < 0.01). Categorizing cobas and LA results hierarchically according to cancer risk (HPV16, HPV18, other carcinogenic HPV genotypes, or carcinogen negative), there was a 90% agreement for all categories of HPV (n = 1,824). We found good agreement between the two U.S. FDA-approved HPV tests, with discrepancies between the two assays due to specific characteristics of the individual assays. Additional studies are needed to compare HC2 and cobas for detecting and predicting CIN3 to understand the clinical implications of the discrepant test results between the two tests. PMID:22075592
International Nuclear Information System (INIS)
Tabet, J.
2007-11-01
The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)
Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin
2014-05-01
Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].
Evolution of linear chromosomes and multipartite genomes in yeast mitochondria
Valach, Matus; Farkas, Zoltan; Fricova, Dominika; Kovac, Jakub; Brejova, Brona; Vinar, Tomas; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Lang, B. Franz; Nosek, Jozef
2011-01-01
Mitochondrial genome diversity in closely related species provides an excellent platform for investigation of chromosome architecture and its evolution by means of comparative genomics. In this study, we determined the complete mitochondrial DNA sequences of eight Candida species and analyzed their molecular architectures. Our survey revealed a puzzling variability of genome architecture, including circular- and linear-mapping and multipartite linear forms. We propose that the arrangement of large inverted repeats identified in these genomes plays a crucial role in alterations of their molecular architectures. In specific arrangements, the inverted repeats appear to function as resolution elements, allowing genome conversion among different topologies, eventually leading to genome fragmentation into multiple linear DNA molecules. We suggest that molecular transactions generating linear mitochondrial DNA molecules with defined telomeric structures may parallel the evolutionary emergence of linear chromosomes and multipartite genomes in general and may provide clues for the origin of telomeres and pathways implicated in their maintenance. PMID:21266473
Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.
2015-03-01
Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated
Energy Technology Data Exchange (ETDEWEB)
Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)
2013-10-15
Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.
International Nuclear Information System (INIS)
Megow, Joerg; Kulesza, Alexander; Qu Zhengwang; Ronneberg, Thomas; Bonacic-Koutecky, Vlasta; May, Volkhard
2010-01-01
Graphical abstract: Structure of a single Pheo (green: C-atoms, blue: N-atoms, red; O-atoms, light grey: H-atoms). - Abstract: Linear absorption spectra of a single Pheophorbid-a molecule (Pheo) dissolved in ethanol are calculated in a mixed quantum-classical approach. In this computational scheme the absorbance is mainly determined by the time-dependent fluctuations of the energy gap between the Pheo ground and excited electronic state. The actual magnitude of the energy gap is caused by the electrostatic solvent solute coupling as well as by contributions due to intra Pheo vibrations. For the latter a new approach is proposed which is based on precalculated potential energy surfaces (PES) described in a harmonic approximation. To get the respective nuclear equilibrium configurations and Hessian matrices of the two involved electronic states we carried out the necessary electronic structure calculations in a DFT-framework. Since the Pheo changes its spatial orientation in the course of a MD run, the nuclear equilibrium configurations change their spatial position, too. Introducing a particular averaging procedure, these configurations are determined from the actual MD trajectories. The usability of the approach is underlined by a perfect reproduction of experimental data. This also demonstrates that our proposed method is suitable for the description of more complex systems in future investigations.
Arevalo, Ricardo, Jr.; Brinckerhoff, William B.; Pinnick, Veronica T.; van Amerom, Friso H. W.; Danell, Ryan M.; Li, Xiang; Getty, Stephanie; Hovmand, Lars; Atanassova, Martina; Mahaffy, Paul R.;
2014-01-01
The 2018 ExoMars rover mission includes the Mars Organic Molecule Analyzer (MOMA) investigation. MOMA will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from degradation derived from cosmic radiation and/or oxidative chemical reactions. When combined with the complement of instruments in the rover's Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds. The MOMA investigation is led by the Max Planck Institute for Solar System Research (MPS) with the mass spectrometer subsystem provided by NASA GSFC. MOMA's linear ion trap mass spectrometer (ITMS) is designed to analyze molecular composition of: (i) gas evolved from pyrolyzed powder samples and separated in a gas chromatograph; and, (ii) ions directly desorbed from crushed solid samples at Mars ambient pressure, as enabled by a pulsed UV laser system, fast-actuating aperture valve and capillary ion inlet. Breadboard ITMS and associated electronics have been advanced to high end-to-end fidelity in preparation for flight hardware delivery to Germany in 2015.
International Nuclear Information System (INIS)
Luo Jiao; Liu Meiling; Zhao Qiangqin; Zhao Jie; Zhang Youyu; Tan Liang; Tang Hao; Xie Qingji; Li Haitao; Yao Shouzhuo
2010-01-01
A novel symmetric conjugated oligo(phenylene-ethynylene) (OPE) linear molecule (1,4-bis(4-aminophenylethynyl)benzene); BAB) was synthesized by Sonogashira cross-coupling reactions. The structure and purity of the compound were confirmed by 1 H NMR, 13 C NMR and infrared (IR) and mass spectrometry (MS). The electrochemical oxidation process and mechanism of BAB were investigated via in situ Fourier transform infrared (FTIR) spectroelectrochemistry and electrochemical quartz crystal microbalance (EQCM). The electrochemical oxidation mechanism of BAB was proposed. The studies revealed that the BAB concentration and oxidation potential had a significant influence on the growth of the polymer film. A densely packed polymer film, which exhibited nonelectroactivity, was formed when a high monomer concentration and a high oxidation potential were used. When the electropolymerization of BAB was conducted at a lower concentration, a new pair of redox peaks appeared, and the resultant thin film had better electroactivity. The in situ FTIR studies confirmed that BAB could be electro-oxidized into radical cations and then electropolymerized via para (N-N) and/or ortho (N-C) coupling reactions to form polymers with a larger conjugated π-electron system. The surface morphology of the poly-BAB was also investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM).
Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.
2018-01-01
The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784
Directory of Open Access Journals (Sweden)
Yoshiyuki Koyama
2015-07-01
Full Text Available We have reported that ternary complexes of plasmid DNA with conventional linear polyethylenimine (l-PEI and certain polyanions were very stably dispersed, and, with no cryoprotectant, they could be freeze-dried and re-hydrated without the loss of transfection ability. These properties enabled the preparation of a concentrated suspension of very small pDNA complex, by preparing the complexes at highly diluted conditions, followed by condensation via lyophilization-and-rehydration procedure. Recently, a high potency linear polyethylenimine having no residual protective groups, i.e., Polyethylenimine “Max” (PEI “Max”, is available, which has been reported to induce much higher gene expression than conventional l-PEI. We tried to prepare the small DNA/PEI “Max”/polyanion complexes by a similar freeze-drying method. Small complex particles could be obtained without apparent aggregation, but transfection activity of the rehydrated complexes was severely reduced. Complex-preparation conditions were investigated in details to achieve the freeze-dried DNA/PEI “Max”/polyanion small ternary complexes with high transfection efficiency. DNA/PEI “Max”/polyanion complexes containing cytokine-coding plasmids were then prepared, and their anti-tumor therapeutic efficacy was examined in tumor-bearing mice.
Czech Academy of Sciences Publication Activity Database
Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.
2006-01-01
Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006
DEFF Research Database (Denmark)
Østerberg, Frederik Westergaard; Rizzi, Giovanni; Donolato, Marco
2014-01-01
For the first time DNA coils formed by rolling circle amplification are quantified on-chip by Brownian relaxation measurements on magnetic nanobeads using a magnetoresistive sensor. No external magnetic fields are required besides the magnetic field arising from the current through the sensor...
Directory of Open Access Journals (Sweden)
Thomas A Ward
Full Text Available Flap endonuclease 1 (FEN1 is a structure selective endonuclease required for proficient DNA replication and the repair of DNA damage. Cellularly active inhibitors of this enzyme have previously been shown to induce a DNA damage response and, ultimately, cell death. High-throughput screens of human cancer cell-lines identify colorectal and gastric cell-lines with microsatellite instability (MSI as enriched for cellular sensitivity to N-hydroxyurea series inhibitors of FEN1, but not the PARP inhibitor olaparib or other inhibitors of the DNA damage response. This sensitivity is due to a synthetic lethal interaction between FEN1 and MRE11A, which is often mutated in MSI cancers through instabilities at a poly(T microsatellite repeat. Disruption of ATM is similarly synthetic lethal with FEN1 inhibition, suggesting that disruption of FEN1 function leads to the accumulation of DNA double-strand breaks. These are likely a result of the accumulation of aberrant replication forks, that accumulate as a consequence of a failure in Okazaki fragment maturation, as inhibition of FEN1 is toxic in cells disrupted for the Fanconi anemia pathway and post-replication repair. Furthermore, RAD51 foci accumulate as a consequence of FEN1 inhibition and the toxicity of FEN1 inhibitors increases in cells disrupted for the homologous recombination pathway, suggesting a role for homologous recombination in the resolution of damage induced by FEN1 inhibition. Finally, FEN1 appears to be required for the repair of damage induced by olaparib and cisplatin within the Fanconi anemia pathway, and may play a role in the repair of damage associated with its own disruption.
Ma, Q.; Boulet, C.; Tipping, R. H.
2014-01-01
The refinement of the Robert-Bonamy (RB) formalism by considering the line coupling for isotropic Raman Q lines of linear molecules developed in our previous study [Q. Ma, C. Boulet, and R. H. Tipping, J. Chem. Phys. 139, 034305 (2013)] has been extended to infrared P and R lines. In these calculations, the main task is to derive diagonal and off-diagonal matrix elements of the Liouville operator iS1 - S2 introduced in the formalism. When one considers the line coupling for isotropic Raman Q lines where their initial and final rotational quantum numbers are identical, the derivations of off-diagonal elements do not require extra correlation functions of the ^S operator and their Fourier transforms except for those used in deriving diagonal elements. In contrast, the derivations for infrared P and R lines become more difficult because they require a lot of new correlation functions and their Fourier transforms. By introducing two dimensional correlation functions labeled by two tensor ranks and making variable changes to become even functions, the derivations only require the latters' two dimensional Fourier transforms evaluated at two modulation frequencies characterizing the averaged energy gap and the frequency detuning between the two coupled transitions. With the coordinate representation, it is easy to accurately derive these two dimensional correlation functions. Meanwhile, by using the sampling theory one is able to effectively evaluate their two dimensional Fourier transforms. Thus, the obstacles in considering the line coupling for P and R lines have been overcome. Numerical calculations have been carried out for the half-widths of both the isotropic Raman Q lines and the infrared P and R lines of C2H2 broadened by N2. In comparison with values derived from the RB formalism, new calculated values are significantly reduced and become closer to measurements.
Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre
2016-01-01
Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S
2018-04-18
Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.
DNA confinement in nanochannels: physics and biological applications
DEFF Research Database (Denmark)
Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H
2012-01-01
in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...
Grosberg, Alexander Y.
2016-09-01
The effect of DNA topology simplification by type II topoisomerase enzymes was discovered experimentally by Rybenkov et al. [1] 20 years ago - which motivates me to borrow the title for this comment from Alexandre Dumas [2]. Ever since the original discovery, the effect keeps entertaining theorists - but the most surprising fact is that the original experiment was never repeated, let alone improved. I do not understand why it is so. In my opinion, there is an acute need of new experiments, not only repeating the original measurements, but also examining numerous other aspects of the phenomenon. In this sense, the review [3] by Vologodskii, one of the original discoverers, is both timely and important. In his review, Vologodskii concentrates on what I would call mechanical aspect of the problem - how bent are T- and G-segments, what kinds of juxtaposition are relevant, etc. The importance of these issues notwithstanding, I want to complement this approach, and to consider in greater detail the thermodynamics of the process. My main points are as follows: action of topo II enzyme violates detailed balance for DNA, leading to circular currents and dissipation (which is indeed quite a common occurrence in many living systems). These currents are potentially observable, and dissipation measurable, which should challenge experimenters. The main goal of this comment is to show how general phenomenological point of view allows to formulate theoretical prediction for the energy dissipation rate.
International Nuclear Information System (INIS)
Dai, Jiawen; Baskar, Rajamanickam
2014-01-01
Ionizing radiation is an invaluable diagnostic and treatment tool used in various clinical applications and also in cancer control. However, assessing normal tissue injury is of a great interest. Since radiation sensitivity varies with different phases of cell cycle, understanding how these cells differ in their sensitivity will help to prevent or reduce the radiation injury. We have used both proliferating and quiescent human normal lung fibroblast cells and investigated key proteins involved in the cell cycle, DNA damage and death, further the radioprotective role of small molecule after low doses (d ≤1Gy) of radiation exposure. Among the cell cycle/death proteins investigated, p53 and phosphorylation of p53 (Ser-15) were induced in both the proliferating and quiescent phases of cells when studied at different time intervals. In the proliferating cells after irradiation along with p53, cyclin dependent kinase (CDK) inhibitors p21, p27 were induced. However, similarly in the quiescent cells along with the p53, p21 and p27 were also induced. The DNA damage assessed by phosphorylation of histone H2AX expression showed an increase even in the non-dividing quiescent cells after 1 Gy of radiation exposure. Whereas cell cycle proteins Cyclin A and E and cell death proteins Bax and cytochrome-c did not show any increase in the quiescent cells. In conclusion, human normal lung fibroblast cells that are not actively dividing are also showed similar radiation response as of proliferating cells. Furthermore, proliferating and quiescent cells treated with small molecules attenuate p53 and its downstream target protein p21 indicating radioprotection of the cells. The specific activation of p53, phosphorylation of p53 (Ser-15), p21 and phosphorylation of histone H2AX following radiation doses of d ≤ 1 Gy in the quiescent cells demonstrated in this study may give us a better understanding about the radiation response of non-dividing fibroblast cells, which is present in many
The structure and DNA-binding properties of Mgm101 from a yeast with a linear mitochondrial genome
Czech Academy of Sciences Publication Activity Database
Pevala, V.; Truban, D.; Bauer, J. A.; Koštan, J.; Kunová, N.; Bellová, J.; Brandstetter, M.; Marini, V.; Krejčí, L.; Tomáška, L´.; Nosek, J.; Kutejová, Eva
2016-01-01
Roč. 44, č. 5 (2016), s. 2227-2239 ISSN 1362-4962 R&D Projects: GA ČR GAP207/12/2323 Institutional support: RVO:61388971 Keywords : SMALL-ANGLE SCATTERING * SINGLE-STRANDED-DNA * HUMAN RAD52 PROTEIN Subject RIV: EE - Microbiology, Virology
Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.
2013-01-01
In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323
van der Wiel, M. H. D.; Pagani, L.; van der Tak, F. F. S.; Kaźmierczak, M.; Ceccarelli, C.
2013-05-01
Context. Linear rotor molecules such as CO, HCO+ and HCN are important probes of star-forming gas. For these species, temperatures of ≲ 50 K are sufficient to produce emission lines that are observable from the ground at (sub)millimeter wavelengths. Molecular gas in the environment of massive protostellar objects, however, is known to reach temperatures of several hundred K. To probe this, space-based far-infrared observations are required. Aims: We aim to reveal the gas energetics in the circumstellar environment of the prototypical high-mass protostellar object AFGL 2591. Methods: Rotational spectral line signatures of CO species, HCO+, CS, HCN and HNC from a 490-1240 GHz survey with Herschel/HIFI, complemented by ground-based JCMT and IRAM 30 m spectra, cover transitions in the energy range (Eup/k) between 5 K and ~ 300 K. Selected frequency settings in the highest frequency HIFI bands (up to 1850 GHz) extend this range to 750 K for 12C16O. The resolved spectral line profiles are used to separate and study various kinematic components. Observed line intensities are compared with a numerical model that calculates excitation balance and radiative transfer based on spherical geometry. Results: The line profiles show two emission components, the widest and bluest of which is attributed to an approaching outflow and the other to the envelope. We find evidence for progressively more redshifted and wider line profiles from the envelope gas with increasing energy level. This trend is qualitatively explained by residual outflow contribution picked up in the systematically decreasing beam size. Integrated line intensities for each species decrease as Eup/k increases from ≲ 50 to ~700 K. The H2 density and temperature of the outflow gas are constrained to ~105-106 cm-3 and 60-200 K. In addition, we derive a temperature between 9 and 17 K and N(H2) ~ 3 × 1021 cm-2 for a known foreground cloud seen in absorption, and N(H2) ≲ 1019 cm-2 for a second foreground component
Robertson, Carol
2016-01-01
Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…
Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik
2016-12-01
Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.
Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L
2016-05-01
Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.
Indian Academy of Sciences (India)
DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.
Lucchetti, Liana; Fraccia, Tommaso P; Ciciulla, Fabrizio; Bellini, Tommaso
2017-07-10
Throughout the whole history of liquid crystals science, the balancing of intrinsic elasticity with coupling to external forces has been the key strategy for most application and investigation. While the coupling of the optical field to the nematic director is at the base of a wealth of thoroughly described optical effects, a significant variety of geometries and materials have not been considered yet. Here we show that by adopting a simple cell geometry and measuring the optically induced birefringence, we can readily extract the twist elastic coefficient K 22 of thermotropic and lyotropic chiral nematics (N*). The value of K 22 we obtain for chiral doped 5CB thermotropic N* well matches those reported in the literature. With this same strategy, we could determine for the first time K 22 of the N* phase of concentrated aqueous solutions of DNA oligomers, bypassing the limitations that so far prevented measuring the elastic constants of this class of liquid crystalline materials. The present study also enlightens the significant nonlinear optical response of DNA liquid crystals.
International Nuclear Information System (INIS)
Kozlov, D N; Kobtsev, V D; Stel'makh, O M; Smirnov, Valery V; Stepanov, E V
2013-01-01
Employing the methods of linear absorption spectroscopy and nonlinear four-wave mixing spectroscopy using laserinduced gratings we have simultaneously measured the local concentrations of H 2 O molecules and the gas temperature in the process of the H 2 – O 2 mixture heating. During the measurements of the deactivation rates of pulsed-laser excited singlet oxygen O 2 (b 1 Σ + g ) in collisions with H 2 in the range 294 – 850 K, the joint use of the two methods made it possible to determine the degree of hydrogen oxidation at a given temperature. As the mixture is heated, H 2 O molecules are formed by 'dark' reactions of H 2 with O 2 in the ground state. The experiments have shown that the measurements of tunable diode laser radiation absorption along an optical path through the inhomogeneously heated gas mixture in a cell allows high-accuracy determination of the local H 2 O concentration in the O 2 laser excitation volume, if the gas temperature in this volume is known. When studying the collisional deactivation of O 2 (b 1 Σ + g ) molecules, the necessary measurements of the local temperature can be implemented using laser-induced gratings, arising due to spatially periodic excitation of O 2 (X 3 Σ - g ) molecules to the b 1 Σ + g state by radiation of the pump laser of the four-wave mixing spectrometer. (laser spectroscopy)
Alaofi, Ahmed; On, Ngoc; Kiptoo, Paul; Williams, Todd D; Miller, Donald W; Siahaan, Teruna J
2016-02-01
The aim of this study is to evaluate the effect of peptide cyclization on the blood-brain barrier (BBB) modulatory activity and plasma stability of His-Ala-Val peptides, which are derived from the extracellular 1 domain of human E-cadherin. The activities to modulate the intercellular junctions by linear HAV4 (Ac-SHAVAS-NH2), cyclic cHAVc1 (Cyclo(1,8)Ac-CSHAVASC-NH2), and cyclic cHAVc3 (Cyclo(1,6)Ac-CSHAVC-NH2) were compared in in vitro and in vivo BBB models. Linear HAV4 and cyclic cHAVc1 have the same junction modulatory activities as assessed by in vitro MDCK monolayer model and in situ rat brain perfusion model. In contrast, cyclic cHAVc3 was more effective than linear HAV4 in modulating MDCK cell monolayers and in improving in vivo brain delivery of Gd-DTPA on i.v. administration in Balb/c mice. Cyclic cHAVc3 (t1/2 = 12.95 h) has better plasma stability compared with linear HAV4 (t1/2 = 2.4 h). The duration of the BBB modulation was longer using cHAVc3 (2-4 h) compared with HAV4 (brain delivery of IRdye800cw-PEG (25 kDa) as detected by near IR imaging. The result showed that cyclic cHAVc3 peptide had better activity and plasma stability than linear HAV4 peptide. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Radiation damage of DNA. Model for direct ionization of DNA
International Nuclear Information System (INIS)
Kobayashi, Kazuo; Tagawa, Seiichi
2004-01-01
Current aspects of radiation damage of DNA, particularly induced by the direct effect of radiation, and author's method of pulse radiolysis are described in relation to behavior of ions formed by radiation and active principles to induce the strand break. In irradiation of DNA solution in water, the direct effect of radiation is derived from ionization of DNA itself and indirect one, from the reaction between DNA and radicals generated from water molecules and the former direct one has been scarcely investigated due to difficulty of experimental approach. Radicals generated in sugar moiety of DNA are shown important in the strand break by recent studies on crystalline DNA irradiated by X-ray, DNA solution by electron and photon beams, hydrated DNA by γ-ray and by high linear energy transfer (LET) ion. Author's pulse radiolysis studies have revealed behaviors of guanine and adenine radical cations in dynamics of DNA oxidation. Since reactions described are the model, the experimental approach is thought necessary for elucidation of the actually occurring DNA damage in living cells. (N.I.)
Structural Transitions in Supercoiled Stretched DNA
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
Li, Jiaru; Joubert-Doriol, Loïc; Izmaylov, Artur F.
2017-08-01
We investigate geometric phase (GP) effects in nonadiabatic transitions through a conical intersection (CI) in an N-dimensional linear vibronic coupling (ND-LVC) model. This model allows for the coordinate transformation encompassing all nonadiabatic effects within a two-dimensional (2D) subsystem, while the other N - 2 dimensions form a system of uncoupled harmonic oscillators identical for both electronic states and coupled bi-linearly with the subsystem coordinates. The 2D subsystem governs ultra-fast nonadiabatic dynamics through the CI and provides a convenient model for studying GP effects. Parameters of the original ND-LVC model define the Hamiltonian of the transformed 2D subsystem and thus influence GP effects directly. Our analysis reveals what values of ND-LVC parameters can introduce symmetry breaking in the 2D subsystem that diminishes GP effects.
DNA molecules and human therapeutics
African Journals Online (AJOL)
PRECIOUS
2009-12-29
Dec 29, 2009 ... vectors, display non-toxicity and are simpler to develop. This review ... technology as well as a staged delivery mechanism for the introduction of plasmid-borne gene to target cells via the ... pathogen's gene to provide immunity against diseases by ... human cytomegalovirus, simian virus, human elongation.
International Nuclear Information System (INIS)
Bracalente, Candelaria; Ibañez, Irene L.; Molinari, Beatriz; Palmieri, Mónica; Kreiner, Andrés; Valda, Alejandro
2013-01-01
Purpose: To evaluate the cell response to DNA double-strand breaks induced by low and high linear energy transfer (LET) radiations when the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an essential protein of the nonhomologous end-joining repair pathway, lacks kinase activity. Methods and Materials: CHO10B2, a Chinese hamster ovary cell line, and its derived radiosensitive mutant cell line, irs-20, lacking DNA-PKcs activity, were evaluated after 0 to 3 Gy of γ-rays, plateau and Bragg peak protons, and lithium beams by clonogenic assay, and as a measurement of double-strand breaks, phosphorylated H2AX (γH2AX) foci number and size were quantified by immunocytofluorescence. Results: Irs-20 exhibited greater radiosensitivity and a higher amount of γH2AX foci than CHO10B2 at 6 hours after irradiation for all types of radiations. Remarkably, CHO10B2 and irs-20 maintained their difference in radiosensitivity after high-LET radiation. Six hours after low-LET radiations, irs-20 did not reach basal levels of γH2AX at high doses, whereas CHO10B2 recovered basal levels for all doses. After high-LET radiation, only CHO10B2 exhibited a reduction in γH2AX foci, but it never reached basal levels. Persistent foci in irs-20 confirmed a repair deficiency. Interestingly, after 30 minutes of high-LET radiation both cell lines exhibited large foci (size >0.9 μm 2 ) related to the damage nature, whereas at 6 hours irs-20 showed a higher amount of large foci than CHO10B2, with a 7-fold increase at 3 Gy, that could also be associated to radiosensitivity. Conclusions: We demonstrated, for the first time, an association between deficient DNA-PKcs activity and not only high levels of H2AX phosphorylation but also persistence and size increase of γH2AX foci after high-LET irradiation
Energy Technology Data Exchange (ETDEWEB)
Bracalente, Candelaria; Ibañez, Irene L. [Departamento de Micro y Nanotecnología, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Molinari, Beatriz [Departamento de Radiobiología, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Palmieri, Mónica [Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires (Argentina); Kreiner, Andrés [Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Gerencia de Investigación y Aplicaciones, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Escuela de Ciencia y Tecnología, Universidad Nacional de San Martín, San Martín, Buenos Aires (Argentina); Valda, Alejandro [Escuela de Ciencia y Tecnología, Universidad Nacional de San Martín, San Martín, Buenos Aires (Argentina); and others
2013-11-15
Purpose: To evaluate the cell response to DNA double-strand breaks induced by low and high linear energy transfer (LET) radiations when the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an essential protein of the nonhomologous end-joining repair pathway, lacks kinase activity. Methods and Materials: CHO10B2, a Chinese hamster ovary cell line, and its derived radiosensitive mutant cell line, irs-20, lacking DNA-PKcs activity, were evaluated after 0 to 3 Gy of γ-rays, plateau and Bragg peak protons, and lithium beams by clonogenic assay, and as a measurement of double-strand breaks, phosphorylated H2AX (γH2AX) foci number and size were quantified by immunocytofluorescence. Results: Irs-20 exhibited greater radiosensitivity and a higher amount of γH2AX foci than CHO10B2 at 6 hours after irradiation for all types of radiations. Remarkably, CHO10B2 and irs-20 maintained their difference in radiosensitivity after high-LET radiation. Six hours after low-LET radiations, irs-20 did not reach basal levels of γH2AX at high doses, whereas CHO10B2 recovered basal levels for all doses. After high-LET radiation, only CHO10B2 exhibited a reduction in γH2AX foci, but it never reached basal levels. Persistent foci in irs-20 confirmed a repair deficiency. Interestingly, after 30 minutes of high-LET radiation both cell lines exhibited large foci (size >0.9 μm{sup 2}) related to the damage nature, whereas at 6 hours irs-20 showed a higher amount of large foci than CHO10B2, with a 7-fold increase at 3 Gy, that could also be associated to radiosensitivity. Conclusions: We demonstrated, for the first time, an association between deficient DNA-PKcs activity and not only high levels of H2AX phosphorylation but also persistence and size increase of γH2AX foci after high-LET irradiation.
Directory of Open Access Journals (Sweden)
See-Hyoung Park
2015-08-01
Full Text Available BACKGROUND: Poly(ADP-ribose polymerase 1 (PARP1, γH2AX, BRCA1, and BRCA2 are conventional molecular indicators of DNA damage in cells and are often overexpressed in various cancers. In this study, we aimed, using immunohistochemical detection, whether the co-expression of PARP1, γH2AX, BRCA1, and BRCA2 in breast carcinoma (BCA tissue can provide more reliable prediction of survival of BCA patients. MATERIALS AND METHODS: We investigated immunohistochemical expression and prognostic significance of the expression of PARP1, γH2AX, BRCA1, and BRCA2 in 192 cases of BCAs. RESULTS: The expression of these four molecules predicted earlier distant metastatic relapse, shorter overall survival (OS, and relapse-free survival (RFS by univariate analysis. Multivariate analysis revealed the expression of PARP1, γH2AX, and BRCA2 as independent poor prognostic indicators of OS and RFS. In addition, the combined expressional pattern of BRCA1, BRCA2, PARP1, and γH2AX (CSbbph was an additional independent prognostic predictor for OS (P < .001 and RFS (P < .001. The 10-year OS rate was 95% in the CSbbph-low (CSbbph scores 0 and 1 subgroup, but that was only 35% in the CSbbph-high (CSbbph score 4 subgroup. CONCLUSION: This study has demonstrated that the individual and combined expression patterns of PARP1, γH2AX, BRCA1, and BRCA2 could be helpful in determining an accurate prognosis for BCA patients and for the selection of BCA patients who could potentially benefit from anti-PARP1 therapy with a combination of genotoxic chemotherapeutic agents.
Energy Technology Data Exchange (ETDEWEB)
Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.
2009-05-11
The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.
Maurer, Reinhard J; Reuter, Karsten
2013-07-07
Accurate and efficient simulation of excited state properties is an important and much aspired cornerstone in the study of adsorbate dynamics on metal surfaces. To this end, the recently proposed linear expansion Δ-self-consistent field method by Gavnholt et al. [Phys. Rev. B 78, 075441 (2008)] presents an efficient alternative to time consuming quasi-particle calculations. In this method, the standard Kohn-Sham equations of density-functional theory are solved with the constraint of a non-equilibrium occupation in a region of Hilbert-space resembling gas-phase orbitals of the adsorbate. In this work, we discuss the applicability of this method for the excited-state dynamics of metal-surface mounted organic adsorbates, specifically in the context of molecular switching. We present necessary advancements to allow for a consistent quality description of excited-state potential-energy surfaces (PESs), and illustrate the concept with the application to Azobenzene adsorbed on Ag(111) and Au(111) surfaces. We find that the explicit inclusion of substrate electronic states modifies the topologies of intra-molecular excited-state PESs of the molecule due to image charge and hybridization effects. While the molecule in gas phase shows a clear energetic separation of resonances that induce isomerization and backreaction, the surface-adsorbed molecule does not. The concomitant possibly simultaneous induction of both processes would lead to a significantly reduced switching efficiency of such a mechanism.
Directory of Open Access Journals (Sweden)
Nuri ÖZTÜRK
2018-02-01
Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.
Lin, Mong-Shang; Fu, Chang-Ling; Olague-Marchan, Monica; Hacker, Mary K; Zillikens, Detlef; Giudice, George J; Fairley, Janet A
2002-03-01
Linear IgA bullous disease (LABD) is an autoimmune skin disease characterized by subepidermal blisters and IgA autoantibodies directed against the epidermal basement membrane zone (BMZ) of the skin. Various antigens have been identified as targets of IgA autoantibodies including BP180, a type II glycoprotein that spans the BMZ and lamina lucida. Previously, we have identified a subset of LABD patients whose sera contained IgA antibodies against the 16th noncollagenous (NC16A) domain of BP180. NC16A was previously shown to harbor epitopes that are recognized by both autoantibodies and T cells from patients with bullous pemphigoid and herpes gestationis and is thought to be associated with the development of these immunobullous diseases. The aim of this study was to determine whether T lymphocytes from LABD patients with anti-NC16A IgA autoantibodies respond to epitopes in the same region of the BP180 protein. Indeed, of the four LABD patients in our study, all had T cells that specifically proliferated in response to NC16A. Moreover, two subfragments of NC16A were identified as the predominant targets of LABD T cells. Further analysis of T cell lines and clones derived from these patients revealed that these cells express a CD4 memory T cell phenotype and secrete a Th1/Th2 mixed-cytokine profile, characteristics similar to those of T cells in bullous pemphigoid patients. Our data suggest that the BP180 protein, typically the NC16A region, is the common target of both cellular and humoral immune responses in some LABD patients. This information helps to further elucidate the autoimmune mechanisms in this disease.
Uesaka, M.; Demachi, K.; Fujiwara, T.; Dobashi, K.; Fujisawa, H.; Chhatkuli, R. B.; Tsuda, A.; Tanaka, S.; Matsumura, Y.; Otsuki, S.; Kusano, J.; Yamamoto, M.; Nakamura, N.; Tanabe, E.; Koyama, K.; Yoshida, M.; Fujimori, R.; Yasui, A.
2015-06-01
We are developing compact electron linear accelerators (hereafter linac) with high RF (Radio Frequency) frequency (9.3 GHz, wavelength 32.3 mm) of X-band and applying to medicine and non-destructive testing. Especially, potable 950 keV and 3.95 MeV linac X-ray sources have been developed for on-site transmission testing at several industrial plants and civil infrastructures including bridges. 6 MeV linac have been made for pinpoint X-ray dynamic tracking cancer therapy. The length of the accelerating tube is ∼600 mm. The electron beam size at the X-ray target is less than 1 mm and X-ray spot size at the cancer is less than 3 mm. Several hardware and software are under construction for dynamic tracking therapy for moving lung cancer. Moreover, as an ultimate compact linac, we are designing and manufacturing a laser dielectric linac of ∼1 MeV with Yr fiber laser (283 THz, wavelength 1.06 pm). Since the wavelength is 1.06 μm, the length of one accelerating strcture is tens pm and the electron beam size is in sub-micro meter. Since the sizes of cell and nuclear are about 10 and 1 μm, respectively, we plan to use this “On-chip” linac for radiation-induced DNA damage/repair analysis. We are thinking a system where DNA in a nucleus of cell is hit by ∼1 μm electron or X-ray beam and observe its repair by proteins and enzymes in live cells in-situ.
Phosphate vibrations as reporters of DNA hydration
Corcelli, Steven
The asymmetric phosphate stretch vibrational frequency is extraordinarily sensitive to its local solvent environment. Using density functional theory calculations on the model compound dimethyl phosphate, the asymmetric phosphate stretch vibrational frequency was found to shift linearly with the magnitude of an electric field along the symmetry axis of the PO2 moiety (i.e. the asymmetric phosphate stretch is an excellent linear vibrational Stark effect probe). With this linear relationship established, asymmetric phosphate stretch vibrational frequencies were computed during the course of a molecular dynamics simulation of fully hydrated DNA. Moreover, contributions to shifts in the frequencies from subpopulations of water molecules (e.g. backbone, minor groove, major groove, etc.) were calculated to reveal how phosphate vibrations report the onset of DNA hydration in experiments that vary the relative humidity of non-condensing (dry) DNA samples.
DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...
Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui
2018-03-01
A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.
Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface
Energy Technology Data Exchange (ETDEWEB)
Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)
2005-01-01
Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.
Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL
2009-03-10
A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.
Directory of Open Access Journals (Sweden)
Arindam Chakraborty
2006-03-01
orbital in almost all conformations. One more important result of the present study is that, with the physical process of structural evolution from close angular shape to the linear transition state, the length of the à (O–H decreases and its strength increases as a monotone function of reaction coordinates. The bond length is shortest and the strength is largest at the transition state of structural inversion. Result of structural effect of the present study during the evolution of molecular conformations is quite consistent with the result of a very refined calculation that one physically significant feature of force field that the stretching force constants at the linear geometry are considerably larger than their equilibrium counter parts. The variation of bond strength and the hybridization of s and p orbitals on O atom center to form the à (O–H bond as a function of evolution of conformations is in accordance with Coulson’s prediction. The total dipole moment of all conformations is partitioned into the contribution from bonds and lone pairs and correlated in terms of the computed hybridization in lone pairs. The analysis of the variation of dipole moment as a function of angular to linear structural evolution reveals that the dipole moment of H2O molecule is not due to the bond moments only but a significant contribution comes from a lone pair. It is strongly established that the dipole moment of water molecule at and around the equilibrium geometry is not due to the bond moments only and the major part of the molecular dipole comes from the contribution of lone pair electrons. This necessitates the accommodation of a lone pair of electrons in a hybrid orbital on O atom. The computed LMO’s webbed with partitioned molecular dipole reveal that one lone pair is in a pure p- type orbital and the other lone pair is in a hybrid of s and p, and not in a pure s type orbital as suggested on the basis of
Probe DNA-Cisplatin Interaction with Solid-State Nanopores
Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration
2014-03-01
Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.
Specificity of DNA import into isolated mitochondria from plants and mammals
Directory of Open Access Journals (Sweden)
Koulintchenko M. V.
2014-01-01
Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.
Seeman, Nadrian C.; Sleiman, Hanadi F.
2018-01-01
DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.
International Nuclear Information System (INIS)
Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.
1988-01-01
The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA
Czech Academy of Sciences Publication Activity Database
Fessl, Tomáš; Adamec, František; Polívka, Tomáš; Foldynová-Trantírková, Silvie; Vácha, František; Trantírek, L.
2012-01-01
Roč. 40, č. 16 (2012), s. 10 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z60220518 Keywords : in-cell FRET * fluorescence * DNA * nucleic acid * ATTO * in vivo Subject RIV: BO - Biophysics Impact factor: 8.278, year: 2012
Patterning nanocrystals using DNA
Energy Technology Data Exchange (ETDEWEB)
Williams, Shara Carol [Univ. of California, Berkeley, CA (United States)
2003-01-01
One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices
International Nuclear Information System (INIS)
Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo
2006-01-01
We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA
Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.
2016-01-01
DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770
DEFF Research Database (Denmark)
Dai, Zhuojun; Gjetting, Torben; Mattebjerg, Maria Ahlm
2011-01-01
In the present study we compare LPEI and BPEI characteristics related to DNA condensation and their role as free polycation chains in gene transfection. Using radioactive 32P labeled DNA, we investigated the effect of free PEI chains on the cellular uptake of polyplexes. Our investigations show d...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...
Eguchi, Asuka; Lee, Garrett O; Wan, Fang; Erwin, Graham S; Ansari, Aseem Z
2014-09-15
Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate.
Czech Academy of Sciences Publication Activity Database
Šebest, Peter; Brázdová, Marie; Fojta, Miroslav; Pivoňková, Hana
2015-01-01
Roč. 16, č. 2 (2015), s. 3163-3177 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : TUMOR-SUPPRESSOR P53 * CISPLATIN -DAMAGED DNA * SUPERCOILED DNA Subject RIV: BO - Biophysics Impact factor: 3.257, year: 2015
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Atkins, Peters
2003-01-01
Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.
Solomon, Philip M.
1973-01-01
Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)
Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays
Liu, Wenyan
DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.
2017-10-01
A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.
DEFF Research Database (Denmark)
Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir
1998-01-01
This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...
Dynamic constitutional frameworks for DNA biomimetic recognition.
Catana, Romina; Barboiu, Mihail; Moleavin, Ioana; Clima, Lilia; Rotaru, Alexandru; Ursu, Elena-Laura; Pinteala, Mariana
2015-02-07
Linear and cross-linked dynamic constitutional frameworks generated from reversibly interacting linear PEG/core constituents and cationic sites shed light on the dominant coiling versus linear DNA binding behaviours, closer to the histone DNA binding wrapping mechanism.
Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E
2014-01-01
Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.
Directory of Open Access Journals (Sweden)
Mark J Hoser
Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.
Directory of Open Access Journals (Sweden)
Andrew J. Bowling
2014-04-01
Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.
Preedy, Victor R
2016-01-01
This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.
Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi
2013-07-01
A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy = 2,2-bipyridine, Hbcpip = 2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5 ± 1.4) × 105 M-1 in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived.
Directory of Open Access Journals (Sweden)
A. V. Shapovalov
2018-02-01
Full Text Available This review deals with ideas and approaches to nonlinear phenomena, based on different branches of physics and related to biological systems, that focus on how small impacts can significantly change the state of the system at large spatial scales. This problem is very extensive, and it cannot be fully resolved in this paper. Instead, some selected physical effects are briefly reviewed. We consider sine-Gordon solitons and nonlinear Schrodinger solitons in some models of DNA as examples of self-organization at the molecular level, as well as examine features of their formation and dynamics under the influence of external influences. In addition, the formation of patterns in the generalized Fisher–KPP model is viewed as a simple example of self-organization in a system with nonlocal interaction at the cellular level. Symmetries of model equations are employed to analyze the considered nonlinear phenomena. In this context the possible relations between phenomena considered and released activity effect, which is assessed differently in the literature, are discussed.
Directory of Open Access Journals (Sweden)
Lin Li
2010-08-01
Full Text Available Abstract Background Targeting Signal Transducer and Activator of Transcription 3 (STAT3 signaling is an attractive therapeutic approach for most types of human cancers with constitutively activated STAT3. A novel small molecular STAT3 inhibitor, FLLL32 was specifically designed from dietary agent, curcumin to inhibit constitutive STAT3 signaling in multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells. Results FLLL32 was found to be a potent inhibitor of STAT3 phosphorylation, STAT3 DNA binding activity, and the expression of STAT3 downstream target genes in vitro, leading to the inhibition of cell proliferation as well as the induction of Caspase-3 and PARP cleavages in human multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cell lines. However, FLLL32 exhibited little inhibition on some tyrosine kinases containing SH2 or both SH2 and SH3 domains, and other protein and lipid kinases using a kinase profile assay. FLLL32 was also more potent than four previously reported JAK2 and STAT3 inhibitors as well as curcumin to inhibit cell viability in these cancer cells. Furthermore, FLLL32 selectively inhibited the induction of STAT3 phosphorylation by Interleukin-6 but not STAT1 phosphorylation by IFN-γ. Conclusion Our findings indicate that FLLL32 exhibits potent inhibitory activity to STAT3 and has potential for targeting multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells expressing constitutive STAT3 signaling.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:
Das, Animesh; Gieb, Klaus; Krupskaya, Yulia; Demeshko, Serhiy; Dechert, Sebastian; Klingeler, Rüdiger; Kataev, Vladislav; Büchner, Bernd; Müller, Paul; Meyer, Franc
2011-03-16
First members of a new family of heterometallic Mn/Ni complexes [Mn(2)Ni(3)X(2)L(4)(LH)(2)(H(2)O)(2)] (X = Cl: 1; X = Br: 2) with the new ligand 2-{3-(2-hydroxyphenyl)-1H-pyrazol-1-yl}ethanol (H(2)L) have been synthesized, and single crystals obtained from CH(2)Cl(2) solutions have been characterized crystallographically. The molecular structures feature a quasi-linear Mn(III)-Ni(II)-Ni(II)-Ni(II)-Mn(III) core with six-coordinate metal ions, where elongated axes of all the distorted octahedral coordination polyhedra are aligned parallel and are fixed with respect to each other by intramolecular hydrogen bonds. 1 and 2 exhibit quite strong ferromagnetic exchange interactions throughout (J(Mn-Ni) ≈ 40 K (1) or 42 K (2); J(Ni-Ni) ≈ 22 K (1) or 18 K (2)) that lead to an S(tot) = 7 ground state, and a sizable uniaxial magnetoanisotropy with D(mol) values -0.55 K (1) and -0.45 K (2). These values are directly derived also from frequency- and temperature-dependent high-field EPR spectra. Slow relaxation of the magnetization at low temperatures and single-molecule magnet (SMM) behavior are evident from frequency-dependent peaks in the out-of-phase ac susceptibilities and magnetization versus dc field measurements, with significant energy barriers to spin reversal U(eff) = 27 K (1) and 22 K (2). Pronounced quantum tunnelling steps are observed in the hysteresis loops of the temperature- and scan rate-dependent magnetization data, but with the first relaxation step shifted above (1) or below (2) the zero crossing of the magnetic field, despite the very similar molecular structures. The different behavior of 1 and 2 is interpreted in terms of antiferromagnetic (1) or ferromagnetic (2) intermolecular interactions, which are discussed in view of the subtle differences of intermolecular contacts within the crystal lattice.
McLenachan, Samuel; Sarsero, Joseph P; Ioannou, Panos A
2007-06-01
Using the lipofection reagent LipofectAMINE 2000 we have examined the delivery of plasmid DNA (5-200 kb) to mouse embryonic stem (mES) cells by flow cytometry. To follow the physical uptake of lipoplexes we labeled DNA molecules with the fluorescent dye TOTO-1. In parallel, expression of an EGFP reporter cassette in constructs of different sizes was used as a measure of nuclear delivery. The cellular uptake of DNA lipoplexes is dependent on the uptake competence of mES cells, but it is largely independent of DNA size. In contrast, nuclear delivery was reduced with increasing plasmid size. In addition, linear DNA is transfected with lower efficiency than circular DNA. Inefficient cytoplasmic trafficking appears to be the main limitation in the nonviral delivery of large DNA constructs to the nucleus of mES cells. Overcoming this limitation should greatly facilitate functional studies with large genomic fragments in embryonic stem cells.
International Nuclear Information System (INIS)
Radford, I.R.
1990-01-01
The suggestion by Okayasu and Iliakis (1989) that the non-linear dose-response curve, obtained with the non-denaturing filter elution technique for mammalian cells exposed to low-LET radiation, is the result of a technical artefact, was not confirmed. (author)
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2006-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...
Shilov, Georgi E
1977-01-01
Covers determinants, linear spaces, systems of linear equations, linear functions of a vector argument, coordinate transformations, the canonical form of the matrix of a linear operator, bilinear and quadratic forms, Euclidean spaces, unitary spaces, quadratic forms in Euclidean and unitary spaces, finite-dimensional space. Problems with hints and answers.
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
In the 'research and development of an ultimate atom and molecule manipulation technology', research has been made on an organic atom and molecule identification and manipulation technology and a dynamic organic molecule simulation technology. This paper summarizes the achievements in fiscal 1999. In the magnetic force controlling AFM for the force spectroscopy aimed at non-destructive atom and molecule identification, a prototype cantilever was fabricated that can excite and detect displacement in lateral direction and is suitable for friction measurement. The SrO surface and TiO2 surface of SrTiO{sub 3}. A carbon nano-tube was employed as a probe. In addition, the molecule inserting SAM technology was used to have developed a technology to measure electric conductivity inside and between molecules. With an aim at realizing a high-speed DNA base arrangement analyzing method, research is being performed upon noticing the single molecule method based on the light measuring method using the single molecule imaging as the base and the scanning probe microscope method. For the dynamic organic molecule simulation technology, theoretical analysis was advanced on synthesis of methanol on copper surface. (NEDO)
DEFF Research Database (Denmark)
Kristiansen, Martin; Kryger, Mille; Zhang, Zhao
2012-01-01
A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...
Nucleic Acids as Information Molecules.
McInerney, Joseph D.
1996-01-01
Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)
Czech Academy of Sciences Publication Activity Database
Dlasková, Andrea; Engstová, Hana; Plecitá-Hlavatá, Lydie; Lessard, M.; Alán, Lukáš; Reguera Pajuelo, David; Jabůrek, Martin; Ježek, Petr
2015-01-01
Roč. 47, č. 3 (2015), s. 255-263 ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA MŠk(CZ) EE2.3.30.0025; GA MŠk(CZ) ED1.1.00/02.0109; GA ČR(CZ) GA13-02033S Institutional support: RVO:67985823 Keywords : mitochondrial network * mitochondrial DNA * nucleoids * 4Pimicroscopy Subject RIV: EA - Cell Biology Impact factor: 2.080, year: 2015
International Nuclear Information System (INIS)
Diao, Y; Hinson, K; Sun, Y; Arsuaga, J
2015-01-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Diao, Y.; Hinson, K.; Sun, Y.; Arsuaga, J.
2015-10-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-03-01
This paper describes R and D of the ultimate manipulation technology of atoms and molecules (atom technology). Through the observation of super spiral DNA fixed on a spermin or spermidine treated mica substrate by AFM (atomic force microscope), fixation of DNA without any deformation in solution was clarified, and visualization of the spiral structure of DNA were successfully achieved. Manipulation of Xe atoms adsorbed on an Si(111) surface was certainly possible by using STM (scanning tunneling microscope)/atom probe equipment. A nucleation mechanism in crystal growth was studied for various organic source-molecules/GaAs(001) surface systems, and formation of high-density nuclei on the GaAs surface was achieved by accelerating the translational energy of Ga material molecules up to 6eV or more. Ziegler- Natta catalysis important for industrial polymerization of olefin molecules was precisely analyzed by first-principle dynamic simulation. A large-scale simulation of zeolite catalyst is also in promotion for methanol to gasoline conversion. 51 refs., 87 figs., 7 tabs.
Energy Technology Data Exchange (ETDEWEB)
Clabo, D.A. Jr.
1987-04-01
Inclusion of the anharmonicity normal mode vibrations (i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface) is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules.
International Nuclear Information System (INIS)
Clabo, D.A. Jr.
1987-04-01
Inclusion of the anharmonicity normal mode vibrations [i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface] is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
Production of highly knotted DNA by means of cosmid circularization inside phage capsids
Directory of Open Access Journals (Sweden)
Trigueros Sonia
2007-12-01
Full Text Available Abstract Background The formation of DNA knots is common during biological transactions. Yet, functional implications of knotted DNA are not fully understood. Moreover, potential applications of DNA molecules condensed by means of knotting remain to be explored. A convenient method to produce abundant highly knotted DNA would be highly valuable for these studies. Results We had previously shown that circularization of the 11.2 kb linear DNA of phage P4 inside its viral capsid generates complex knots by the effect of confinement. We demonstrate here that this mechanism is not restricted to the viral genome. We constructed DNA cosmids as small as 5 kb and introduced them inside P4 capsids. Such cosmids were then recovered as a complex mixture of highly knotted DNA circles. Over 250 μg of knotted cosmid were typically obtained from 1 liter of bacterial culture. Conclusion With this biological system, DNA molecules of varying length and sequence can be shaped into very complex and heterogeneous knotted forms. These molecules can be produced in preparative amounts suitable for systematic studies and applications.
Antigen-antibody reactions of UV-irradiated phage DNA
International Nuclear Information System (INIS)
Fink, A.
1976-01-01
The observation of others could be confirmed that UV-irradiated DNA is a better immunogen than unirradiated DNA. The author's immune sera contained a high amount of antibodies with a specific action against photoproducts in the DNA. The thymine dimer was identified as relevant photoproduct and thus as antigenic determinant. In comparison, the amount of unspecific antibodies reacting with denaturated DNA was low and varied between sera. Thymin-dimer antibodies showed a high specificity without cross-reaction with other pyrimidine dimers such as anti CC and anti CT; they belong to the class of IgG molecules. UV-irradiated dinucleotide dTpT is sufficient to induce the formation of antibodies reacting with the cis-syn thymine dimers in UV-irradiated DNA. Antibody binding is proportional to the UV doses applied to the DNA. When using completely denaturated DNA, there is a linear increase changing into a plateau at higher doses. The extent of antigen-antibody binding is strongly dependent on the degree of denaturation of the DNA. With increasing denaturation, the antibody binding of the DNA increases. The antigen-antibody reaction can thus be used to estimate the degree of denaturation of the DNA. There were no signs of an influence of the degree of denaturation of the DNA on the quantum yield of thymine dimers. The different amounts of antibodies is therefore due to the masking of thymine dimers in native DNA. When irradiating intact phage particles, there was no sign of an influence of the phages' protein covers on the antibody binding capacity of DNA compared with DNA irradiated in vitro. (orig.) [de
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...
Detection of circular telomeric DNA without 2D gel electrophoresis.
Dlaska, Margit; Anderl, Conrad; Eisterer, Wolfgang; Bechter, Oliver E
2008-09-01
The end of linear chromosomes forms a lasso-like structure called the t-loop. Such t-loops resemble a DNA recombination intermediate, where the single-stranded 3' overhang is arrested in a stretch of duplex DNA. Presumably, such a t-loop can also be deleted via a recombination process. This would result in the occurrence of circular extrachromosomal telomeric DNA (t-circles), which are known to be abundantly present in immortal cells engaging the recombination-based alternative lengthening of telomeres pathway (ALT pathway). Little is known about the basic mechanism of telomeric recombination in these cells and what ultimately causes the generation of such t-circles. Current standard procedures for detecting these molecules involve 2D gel electrophoresis or electron microscopy. However, both methods are labor intense and sophisticated to perform. Here, we present a simpler, faster, and equally sensitive method for detecting t-circles. Our approach is a telomere restriction fragment assay that involves the enzymatic preservation of circular DNA with Klenow enzyme followed by Bal31 degradation of the remaining linear DNA molecules. We show that with this approach t-circles can be detected in ALT cell lines, whereas no t-circles are present in telomerase-positive cell lines. We consider our approach a valid method in which t-circle generation is the experimental readout.
Investigation of DNA double strand breaks induced by α particle and 7Li ions
International Nuclear Information System (INIS)
Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong
2006-01-01
α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)
Ten helical twist angles of B-DNA
Energy Technology Data Exchange (ETDEWEB)
Kabsch, W; Sander, C; Trifonov, E N
1982-01-01
On the assumption that the twist angles between adjacent base-pairs in the DNA molecule are additive a linear system of 40 equations was derived from experimental measurements of the total twist angles for different pieces of DNA of known sequences. This system of equations is found to be statistically consistent providing a solution for all ten possible twist angles of B-DNA by a least squares fitting procedure. Four of the calculated twist angles were not known before. The other six twist angles calculated are very close to the experimentally measured ones. The data used were obtained by the electrophoretic band-shift method, crystallography and nuclease digestion of DNA adsorbed to mica or Ca-phosphate surface. The validity of the principle of additivity of the twist angles implies that the angle between any particular two base-pairs is a function of only these base-pairs, independent of nearest neighbors.
International Nuclear Information System (INIS)
Suwono.
1978-01-01
A linear gate providing a variable gate duration from 0,40μsec to 4μsec was developed. The electronic circuity consists of a linear circuit and an enable circuit. The input signal can be either unipolar or bipolar. If the input signal is bipolar, the negative portion will be filtered. The operation of the linear gate is controlled by the application of a positive enable pulse. (author)
International Nuclear Information System (INIS)
Vretenar, M
2014-01-01
The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics
Energy Technology Data Exchange (ETDEWEB)
Geisert, M; Heicke, B; Metzmann, E; Zahn, R K
1975-04-01
Using a radioimmunoassay (RIA) based on the Farr technique with radioactively labeled /sup 3/H-DNA for quantitative measurements of anti-DNA antibodies in sera of patients with systemic lupus erythematosus (SLE), the influence of molecular weight of DNA (ranging from 0.1 x 10/sup 6/ to 22.0 x 10/sup 6/ daltons) on binding and precipitation in this system has been investigated. Comparing our results with mathematical models it follows that one antibody molecule is fixed on the average to a statistical DNA segment of 2 x 10/sup 6/ to 4 x 10/sup 6/ daltons. Furthermore binding capacity of the DNA was found to be independent of the molecular weight, as demonstrated in a double label experiment using /sup 14/C and /sup 3/H-labeled DNA of different size. However, the amount of radioactivity precipitated was found to depend on the molecular weight of the labeled DNA following a non-linear function. It was calculated that a minimal ratio of fixed antibody molecules per a certain size of DNA was necessary for precipitation. The mathematical treatment of the observed non-linear precipitation dependence will be discussed using various statistical models. The results indicate that the quantitative measurements of anti-DNA antibodies with the Farr technique e.g., for diagnosis and control of SLE in clinical immunology is highly dependent on the molecular weight of the labeled DNA used in the assay system and reliable results are only obtained with DNA of a sufficiently high molecular weight. (auth)
Antipina, M N; Gaĭnutdinov, R V; Rakhnianskaia, A A; Sergeev-Cherenkov, A N; Tolstikhina, A L; Iurova, T V; Kislov, V V; Khomutov, G B
2003-01-01
The formation of DNA complexes with Langmuir monolayers of the cationic lipid octadecylamine (ODA) and the new amphiphilic polycation poly-4-vinylpyridine with 16% of cetylpyridinium groups (PVP-16) on the surface of an aqueous solution of native DNA of low ionic strength was studied. Topographic images of Langmuir-Blodgett films of DNA/ODA and DNA/PVP-16 complexes applied to micaceous substrates were investigated by the method of atomic force microscopy. It was found that films of the amphiphilic polycation have an ordered planar polycrystalline structure. The morphology of planar DNA complexes with the amphiphilic cation substantially depended on the incubation time and the phase state of the monolayer on the surface of the aqueous DNA solution. Complex structures and individual DNA molecules were observed on the surface of the amphiphilic monolayer. Along with quasi-linear individual bound DNA molecules, characteristic extended net-like structures and quasi-circular toroidal condensed conformations of planar DNA complexes were detected. Mono- and multilayer films of DNA/PVP-16 complexes were used as templates and nanoreactors for the synthesis of inorganic nanostructures via the binding of metal cations from the solution and subsequent generation of the inorganic phase. As a result, ultrathin polymeric composite films with integrated DNA building blocks and quasi-linear arrays of inorganic semiconductor (CdS) and iron oxide nanoparticles and nanowires were obtained. The nanostructures obtained were characterized by scanning probe microscopy and transmission electron microscopy techniques. The methods developed are promising for investigating the mechanisms of structural organization and transformation in DNA and polyelectrolyte complexes at the gas-liquid interface and for the design of new extremely thin highly ordered planar polymeric and composite materials, films, and coatings with controlled ultrastructure for applications in nanoelectronics and
Linearization Method and Linear Complexity
Tanaka, Hidema
We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.
Single DNA imaging and length quantification through a mobile phone microscope
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
Energy Technology Data Exchange (ETDEWEB)
Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)
2000-06-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
International Nuclear Information System (INIS)
Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.
2000-01-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America
Said-Houari, Belkacem
2017-01-01
This self-contained, clearly written textbook on linear algebra is easily accessible for students. It begins with the simple linear equation and generalizes several notions from this equation for the system of linear equations and introduces the main ideas using matrices. It then offers a detailed chapter on determinants and introduces the main ideas with detailed proofs. The third chapter introduces the Euclidean spaces using very simple geometric ideas and discusses various major inequalities and identities. These ideas offer a solid basis for understanding general Hilbert spaces in functional analysis. The following two chapters address general vector spaces, including some rigorous proofs to all the main results, and linear transformation: areas that are ignored or are poorly explained in many textbooks. Chapter 6 introduces the idea of matrices using linear transformation, which is easier to understand than the usual theory of matrices approach. The final two chapters are more advanced, introducing t...
Fabrication of Low Noise Borosilicate Glass Nanopores for Single Molecule Sensing.
Directory of Open Access Journals (Sweden)
Jayesh A Bafna
Full Text Available We show low-cost fabrication and characterization of borosilicate glass nanopores for single molecule sensing. Nanopores with diameters of ~100 nm were fabricated in borosilicate glass capillaries using laser assisted glass puller. We further achieve controlled reduction and nanometer-size control in pore diameter by sculpting them under constant electron beam exposure. We successfully fabricate pore diameters down to 6 nm. We next show electrical characterization and low-noise behavior of these borosilicate nanopores and compare their taper geometries. We show, for the first time, a comprehensive characterization of glass nanopore conductance across six-orders of magnitude (1M-1μM of salt conditions, highlighting the role of buffer conditions. Finally, we demonstrate single molecule sensing capabilities of these devices with real-time translocation experiments of individual λ-DNA molecules. We observe distinct current blockage signatures of linear as well as folded DNA molecules as they undergo voltage-driven translocation through the glass nanopores. We find increased signal to noise for single molecule detection for higher trans-nanopore driving voltages. We propose these nanopores will expand the realm of applications for nanopore platform.
Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum
International Nuclear Information System (INIS)
Graham-Lorence, S.E.
1987-01-01
In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding
Stoll, R R
1968-01-01
Linear Algebra is intended to be used as a text for a one-semester course in linear algebra at the undergraduate level. The treatment of the subject will be both useful to students of mathematics and those interested primarily in applications of the theory. The major prerequisite for mastering the material is the readiness of the student to reason abstractly. Specifically, this calls for an understanding of the fact that axioms are assumptions and that theorems are logical consequences of one or more axioms. Familiarity with calculus and linear differential equations is required for understand
DEFF Research Database (Denmark)
Willerslev, Eske; Cooper, Alan
2004-01-01
ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...
DNA functionalization by dynamic chemistry
Directory of Open Access Journals (Sweden)
Zeynep Kanlidere
2016-10-01
Full Text Available Dynamic combinatorial chemistry (DCC is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80% was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue.
Solow, Daniel
2014-01-01
This text covers the basic theory and computation for a first course in linear programming, including substantial material on mathematical proof techniques and sophisticated computation methods. Includes Appendix on using Excel. 1984 edition.
Liesen, Jörg
2015-01-01
This self-contained textbook takes a matrix-oriented approach to linear algebra and presents a complete theory, including all details and proofs, culminating in the Jordan canonical form and its proof. Throughout the development, the applicability of the results is highlighted. Additionally, the book presents special topics from applied linear algebra including matrix functions, the singular value decomposition, the Kronecker product and linear matrix equations. The matrix-oriented approach to linear algebra leads to a better intuition and a deeper understanding of the abstract concepts, and therefore simplifies their use in real world applications. Some of these applications are presented in detailed examples. In several ‘MATLAB-Minutes’ students can comprehend the concepts and results using computational experiments. Necessary basics for the use of MATLAB are presented in a short introduction. Students can also actively work with the material and practice their mathematical skills in more than 300 exerc...
Berberian, Sterling K
2014-01-01
Introductory treatment covers basic theory of vector spaces and linear maps - dimension, determinants, eigenvalues, and eigenvectors - plus more advanced topics such as the study of canonical forms for matrices. 1992 edition.
Searle, Shayle R
2012-01-01
This 1971 classic on linear models is once again available--as a Wiley Classics Library Edition. It features material that can be understood by any statistician who understands matrix algebra and basic statistical methods.
Christofilos, N.C.; Polk, I.J.
1959-02-17
Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.
DEFF Research Database (Denmark)
Register, JC; Christiansen, Gunna; Griffith, J
1987-01-01
examined by electron microscopy: supertwisted double-stranded (ds) DNA and linear single-stranded (ss) DNA, linear dsDNA and circular ssDNA, and linear dsDNA and colinear ssDNA. Several major observations were: (i) with RecA protein bound to the DNA, plectonemic joints were ultrastructurally...
Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism
Jiang, Wen-Yan; Ran, Shi-Yong
2018-05-01
The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.
A Theoretical and Experimental Study of DNA Self-assembly
Chandran, Harish
The control of matter and phenomena at the nanoscale is fast becoming one of the most important challenges of the 21st century with wide-ranging applications from energy and health care to computing and material science. Conventional top-down approaches to nanotechnology, having served us well for long, are reaching their inherent limitations. Meanwhile, bottom-up methods such as self-assembly are emerging as viable alternatives for nanoscale fabrication and manipulation. A particularly successful bottom up technique is DNA self-assembly where a set of carefully designed DNA strands form a nanoscale object as a consequence of specific, local interactions among the different components, without external direction. The final product of the self-assembly process might be a static nanostructure or a dynamic nanodevice that performs a specific function. Over the past two decades, DNA self-assembly has produced stunning nanoscale objects such as 2D and 3D lattices, polyhedra and addressable arbitrary shaped substrates, and a myriad of nanoscale devices such as molecular tweezers, computational circuits, biosensors and molecular assembly lines. In this dissertation we study multiple problems in the theory, simulations and experiments of DNA self-assembly. We extend the Turing-universal mathematical framework of self-assembly known as the Tile Assembly Model by incorporating randomization during the assembly process. This allows us to reduce the tile complexity of linear assemblies. We develop multiple techniques to build linear assemblies of expected length N using far fewer tile types than previously possible. We abstract the fundamental properties of DNA and develop a biochemical system, which we call meta-DNA, based entirely on strands of DNA as the only component molecule. We further develop various enzyme-free protocols to manipulate meta-DNA systems and provide strand level details along with abstract notations for these mechanisms. We simulate DNA circuits by
Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study
Energy Technology Data Exchange (ETDEWEB)
Li, Jiangwei [Iowa State Univ., Ames, IA (United States)
2008-01-01
Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a
DNA nanotechnology: On-command molecular Trojans
Niemeyer, Christof M.
2017-12-01
Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:
Wu, Tsai-Chin; Anderson, Rae
We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.
Alternative end-joining of DNA breaks
Schendel, Robin van
2016-01-01
DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA
Energy Technology Data Exchange (ETDEWEB)
Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.
2008-01-28
Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.
Olive, David J
2017-01-01
This text covers both multiple linear regression and some experimental design models. The text uses the response plot to visualize the model and to detect outliers, does not assume that the error distribution has a known parametric distribution, develops prediction intervals that work when the error distribution is unknown, suggests bootstrap hypothesis tests that may be useful for inference after variable selection, and develops prediction regions and large sample theory for the multivariate linear regression model that has m response variables. A relationship between multivariate prediction regions and confidence regions provides a simple way to bootstrap confidence regions. These confidence regions often provide a practical method for testing hypotheses. There is also a chapter on generalized linear models and generalized additive models. There are many R functions to produce response and residual plots, to simulate prediction intervals and hypothesis tests, to detect outliers, and to choose response trans...
International Nuclear Information System (INIS)
Alcaraz, J.
2001-01-01
After several years of study e''+ e''- linear colliders in the TeV range have emerged as the major and optimal high-energy physics projects for the post-LHC era. These notes summarize the present status form the main accelerator and detector features to their physics potential. The LHC era. These notes summarize the present status, from the main accelerator and detector features to their physics potential. The LHC is expected to provide first discoveries in the new energy domain, whereas an e''+ e''- linear collider in the 500 GeV-1 TeV will be able to complement it to an unprecedented level of precision in any possible areas: Higgs, signals beyond the SM and electroweak measurements. It is evident that the Linear Collider program will constitute a major step in the understanding of the nature of the new physics beyond the Standard Model. (Author) 22 refs
Edwards, Harold M
1995-01-01
In his new undergraduate textbook, Harold M Edwards proposes a radically new and thoroughly algorithmic approach to linear algebra Originally inspired by the constructive philosophy of mathematics championed in the 19th century by Leopold Kronecker, the approach is well suited to students in the computer-dominated late 20th century Each proof is an algorithm described in English that can be translated into the computer language the class is using and put to work solving problems and generating new examples, making the study of linear algebra a truly interactive experience Designed for a one-semester course, this text adopts an algorithmic approach to linear algebra giving the student many examples to work through and copious exercises to test their skills and extend their knowledge of the subject Students at all levels will find much interactive instruction in this text while teachers will find stimulating examples and methods of approach to the subject
DNA Knots: Theory and Experiments
Sumners, D. W.
Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.
Blood extracellular DNA after irradiation
International Nuclear Information System (INIS)
Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.
1993-01-01
It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action
International Nuclear Information System (INIS)
Terlain, Anne
1984-01-01
The 2D (two-dimensional) phase transitions and orientational order in N 2 O, CO 2 , C 2 N 2 and C 2 D 2 films physi-sorbed on the (0001) face of graphite or lamellar halides, were studied experimentally by adsorption isotherm measurements and neutron diffraction. The thermodynamic functions derived from sets of isotherms suggest that crystal monolayers of N 2 O, CO 2 , and C 2 N 2 adsorbed on graphite are orientationally ordered and that the quadrupolar interaction stabilizes the 2D crystal with respect to the 2D liquid. This stabilization leads to an increase in the 2D triple point temperature, T 2t as compared with the 2D critical temperature T 2c . For C 2 N 2 this stabilization is so pronounced that T 2t becomes virtually higher than T 2c , and the phase diagram qualitatively different, having no gas-liquid coexistence domain. From a neutron diffraction experiment we have determined the crystal structure of the C 2 N 2 monolayer. It supports our interpretation of the monolayer phase diagram. In N 2 O, CO 2 , C 2 N 2 films adsorbed on graphite the molecules lie flat on the surface and their orientational order hence differs from that in the bulk crystals resulting in a loss of adsorbate-adsorbate interaction energy. Beyond a given film thickness this loss will not be compensated by the adsorbate-substrate interaction and the film will stop growing. For most of the films studied a partial wetting transition is observed at which the film thickness increases discontinuously with temperature. Although C 2 N 2 and C 2 D 2 monolayers on graphite have comparable adsorption energies, only C 2 D 2 is adsorbed on lamellar halides. This adsorption is possible only because the monolayer has a large entropy due to orientational disorder. For C 2 N 2 , which has a higher moment of inertia, such an orientational disorder cannot exist. (author) [fr
Checking the foundation: recent radiobiology and the linear no-threshold theory.
Ulsh, Brant A
2010-12-01
The linear no-threshold (LNT) theory has been adopted as the foundation of radiation protection standards and risk estimation for several decades. The "microdosimetric argument" has been offered in support of the LNT theory. This argument postulates that energy is deposited in critical cellular targets by radiation in a linear fashion across all doses down to zero, and that this in turn implies a linear relationship between dose and biological effect across all doses. This paper examines whether the microdosimetric argument holds at the lowest levels of biological organization following low dose, low dose-rate exposures to ionizing radiation. The assumptions of the microdosimetric argument are evaluated in light of recent radiobiological studies on radiation damage in biological molecules and cellular and tissue level responses to radiation damage. There is strong evidence that radiation initially deposits energy in biological molecules (e.g., DNA) in a linear fashion, and that this energy deposition results in various forms of prompt DNA damage that may be produced in a pattern that is distinct from endogenous (e.g., oxidative) damage. However, a large and rapidly growing body of radiobiological evidence indicates that cell and tissue level responses to this damage, particularly at low doses and/or dose-rates, are nonlinear and may exhibit thresholds. To the extent that responses observed at lower levels of biological organization in vitro are predictive of carcinogenesis observed in vivo, this evidence directly contradicts the assumptions upon which the microdosimetric argument is based.
International Nuclear Information System (INIS)
Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha
2012-01-01
DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)
Karloff, Howard
1991-01-01
To this reviewer’s knowledge, this is the first book accessible to the upper division undergraduate or beginning graduate student that surveys linear programming from the Simplex Method…via the Ellipsoid algorithm to Karmarkar’s algorithm. Moreover, its point of view is algorithmic and thus it provides both a history and a case history of work in complexity theory. The presentation is admirable; Karloff's style is informal (even humorous at times) without sacrificing anything necessary for understanding. Diagrams (including horizontal brackets that group terms) aid in providing clarity. The end-of-chapter notes are helpful...Recommended highly for acquisition, since it is not only a textbook, but can also be used for independent reading and study. —Choice Reviews The reader will be well served by reading the monograph from cover to cover. The author succeeds in providing a concise, readable, understandable introduction to modern linear programming. —Mathematics of Computing This is a textbook intend...
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
3D DNA Crystals and Nanotechnology
Directory of Open Access Journals (Sweden)
Paul J. Paukstelis
2016-08-01
Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
Modes of Escherichia coli Dps Interaction with DNA as Revealed by Atomic Force Microscopy.
Directory of Open Access Journals (Sweden)
Vladislav V Melekhov
Full Text Available Multifunctional protein Dps plays an important role in iron assimilation and a crucial role in bacterial genome packaging. Its monomers form dodecameric spherical particles accumulating ~400 molecules of oxidized iron ions within the protein cavity and applying a flexible N-terminal ends of each subunit for interaction with DNA. Deposition of iron is a well-studied process by which cells remove toxic Fe2+ ions from the genetic material and store them in an easily accessible form. However, the mode of interaction with linear DNA remained mysterious and binary complexes with Dps have not been characterized so far. It is widely believed that Dps binds DNA without any sequence or structural preferences but several lines of evidence have demonstrated its ability to differentiate gene expression, which assumes certain specificity. Here we show that Dps has a different affinity for the two DNA fragments taken from the dps gene regulatory region. We found by atomic force microscopy that Dps predominantly occupies thermodynamically unstable ends of linear double-stranded DNA fragments and has high affinity to the central part of the branched DNA molecule self-assembled from three single-stranded oligonucleotides. It was proposed that Dps prefers binding to those regions in DNA that provide more contact pads for the triad of its DNA-binding bundle associated with one vertex of the protein globule. To our knowledge, this is the first study revealed the nucleoid protein with an affinity to branched DNA typical for genomic regions with direct and inverted repeats. As a ubiquitous feature of bacterial and eukaryotic genomes, such structural elements should be of particular care, but the protein system evolutionarily adapted for this function is not yet known, and we suggest Dps as a putative component of this system.
Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate
Directory of Open Access Journals (Sweden)
Ju-Yeon Yoon
2014-03-01
Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.
Ultra-deep sequencing of mouse mitochondrial DNA: mutational patterns and their origins.
Directory of Open Access Journals (Sweden)
Adam Ameur
2011-03-01
Full Text Available Somatic mutations of mtDNA are implicated in the aging process, but there is no universally accepted method for their accurate quantification. We have used ultra-deep sequencing to study genome-wide mtDNA mutation load in the liver of normally- and prematurely-aging mice. Mice that are homozygous for an allele expressing a proof-reading-deficient mtDNA polymerase (mtDNA mutator mice have 10-times-higher point mutation loads than their wildtype siblings. In addition, the mtDNA mutator mice have increased levels of a truncated linear mtDNA molecule, resulting in decreased sequence coverage in the deleted region. In contrast, circular mtDNA molecules with large deletions occur at extremely low frequencies in mtDNA mutator mice and can therefore not drive the premature aging phenotype. Sequence analysis shows that the main proportion of the mutation load in heterozygous mtDNA mutator mice and their wildtype siblings is inherited from their heterozygous mothers consistent with germline transmission. We found no increase in levels of point mutations or deletions in wildtype C57Bl/6N mice with increasing age, thus questioning the causative role of these changes in aging. In addition, there was no increased frequency of transversion mutations with time in any of the studied genotypes, arguing against oxidative damage as a major cause of mtDNA mutations. Our results from studies of mice thus indicate that most somatic mtDNA mutations occur as replication errors during development and do not result from damage accumulation in adult life.
Reduction of Linear Programming to Linear Approximation
Vaserstein, Leonid N.
2006-01-01
It is well known that every Chebyshev linear approximation problem can be reduced to a linear program. In this paper we show that conversely every linear program can be reduced to a Chebyshev linear approximation problem.
DNA nanotechnology and fluorescence applications.
Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf
2016-06-01
Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Gothelf, Kurt Vesterager
2012-01-01
-dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...
Saini, Natalie
2015-12-01
21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.
Saini, Natalie
2015-01-01
21 years ago, the DNA Repair Enzyme was declared “Molecule of the Year”. Today, we are celebrating another “year of repair”, with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.
Quantification of cellular uptake of DNA nanostructures by qPCR.
Okholm, Anders Hauge; Nielsen, Jesper Sejrup; Vinther, Mathias; Sørensen, Rasmus Schøler; Schaffert, David; Kjems, Jørgen
2014-05-15
DNA nanostructures facilitating drug delivery are likely soon to be realized. In the past few decades programmed self-assembly of DNA building blocks have successfully been employed to construct sophisticated nanoscale objects. By conjugating functionalities to DNA, other molecules such as peptides, proteins and polymers can be precisely positioned on DNA nanostructures. This exceptional ability to produce modular nanoscale devices with tunable and controlled behavior has initiated an interest in employing DNA nanostructures for drug delivery. However, to obtain this the relationship between cellular interactions and structural and functional features of the DNA delivery device must be thoroughly investigated. Here, we present a rapid and robust method for the precise quantification of the component materials of DNA origami structures capable of entering cells in vitro. The quantification is performed by quantitative polymerase chain reaction, allowing a linear dynamic range of detection of five orders of magnitude. We demonstrate the use of this method for high-throughput screening, which could prove efficient to identify key features of DNA nanostructures enabling cell penetration. The method described here is suitable for quantification of in vitro uptake studies but should easily be extended to quantify DNA nanostructures in blood or tissue samples. Copyright © 2014 Elsevier Inc. All rights reserved.
DNA Open states and DNA hydratation; Estados abiertos del ADN e hidratacion del ADN
Energy Technology Data Exchange (ETDEWEB)
Lema-Larre, B de [Universidad Central de Venezuela (UCV), Facultad de Medicina, Caracas (Venezuela); Martin-Landrove, M [Universidad Central de Venezuela (UCV), Facultad de Ciencias, Centro de Resonancia Magnetica Caracas (Venezuela)
1995-07-01
It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic. [Spanish] Es un hecho bien conocido que existe un intercambio protonico entre filamentos naturales de ADN y polinucleotidos sinteticos con el solvente (1--2). La existencia de estados abiertos en el ADN, es decir estados para los cuales el interior de la molecula del ADN es expuesto al ambiente exterior, ha sido demostrado mediante experimentos de intercambio proton-deuterio (3). En el presente trabajo hemos realizado experimentos midiendo la dispersion de la tasa de relajacion transversal (4), como una funcion de la tasa de pulsacion en una secuencia de pulsos de Carr-Purcell-Meiboom-Gill (CPMG), para determinar cambios en la capa de hidratacion de la molecula de ADN. Los experimentos fueron realizados bajo diferentes condiciones experimentales para asi variar la probabilidad de que ocurran estados abiertos, tales como la temperatura o la exposicion a campos electromagneticos. Algunos modelos teoricos fueron supuestos para ajustar los resultados experimentales incluyendo aquellos relacionados con dinamica no lineal del ADN. (autor)
Biofunctionalization of zinc oxide nanowires for DNA sensory applications
Directory of Open Access Journals (Sweden)
Rudolph Bettina
2011-01-01
Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.
International Nuclear Information System (INIS)
Bartkowiak, J.; Gaczynski, M.
1978-01-01
Affinity chromatography has been used to compare the specificity of interaction between DNA and histone F2b. Histone-sepharose gels were prepared by binding the F2b protein to CNBr-activated Sepharose 4B (Pharmacia, Sweden). DNA was applied to columns formed from the gels, and a linear gradient of concentration of NaCl used for elution. Absorption at 260 nm, and derivative melting points were measured for those samples of effluent containing DNA. The results indicated that the fractionation of DNA was not conditioned only by the composition of the DNA bases. There were significant differences in the interaction with DNA of gels prepared from histone F2b molecules from X-irradiated and normal lymph nodes. It is concluded that histone F2b remaining in lymph nodes after irradiation had properties which differed from protein in normal tissue. (U.K.)
Concentrating and labeling genomic DNA in a nanofluidic array
DEFF Research Database (Denmark)
Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.
2018-01-01
, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...
Biosensors for DNA sequence detection
Vercoutere, Wenonah; Akeson, Mark
2002-01-01
DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.
Conformation-dependent DNA attraction
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Conformation-dependent DNA attraction.
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-06-21
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.
Directory of Open Access Journals (Sweden)
Tanwiwat Jaikuna
2017-02-01
Full Text Available Purpose: To develop an in-house software program that is able to calculate and generate the biological dose distribution and biological dose volume histogram by physical dose conversion using the linear-quadratic-linear (LQL model. Material and methods : The Isobio software was developed using MATLAB version 2014b to calculate and generate the biological dose distribution and biological dose volume histograms. The physical dose from each voxel in treatment planning was extracted through Computational Environment for Radiotherapy Research (CERR, and the accuracy was verified by the differentiation between the dose volume histogram from CERR and the treatment planning system. An equivalent dose in 2 Gy fraction (EQD2 was calculated using biological effective dose (BED based on the LQL model. The software calculation and the manual calculation were compared for EQD2 verification with pair t-test statistical analysis using IBM SPSS Statistics version 22 (64-bit. Results: Two and three-dimensional biological dose distribution and biological dose volume histogram were displayed correctly by the Isobio software. Different physical doses were found between CERR and treatment planning system (TPS in Oncentra, with 3.33% in high-risk clinical target volume (HR-CTV determined by D90%, 0.56% in the bladder, 1.74% in the rectum when determined by D2cc, and less than 1% in Pinnacle. The difference in the EQD2 between the software calculation and the manual calculation was not significantly different with 0.00% at p-values 0.820, 0.095, and 0.593 for external beam radiation therapy (EBRT and 0.240, 0.320, and 0.849 for brachytherapy (BT in HR-CTV, bladder, and rectum, respectively. Conclusions : The Isobio software is a feasible tool to generate the biological dose distribution and biological dose volume histogram for treatment plan evaluation in both EBRT and BT.
Czech Academy of Sciences Publication Activity Database
Němečková, Š.; Šmahel, M.; Hainz, P.; Macková, J.; Zurková, K.; Gabriel, P.; Indrová, Marie; Kutinová, L.
2007-01-01
Roč. 54, č. 4 (2007), s. 326-333 ISSN 0028-2685 R&D Projects: GA MZd NR8004 Institutional research plan: CEZ:AV0Z50520514 Keywords : vaccinia virus MVA expressing GM- CSF * DNA vaccine * HPV16 induced tumors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.208, year: 2007
Aligning molecules with intense nonresonant laser fields
DEFF Research Database (Denmark)
Larsen, J.J.; Safvan, C.P.; Sakai, H.
1999-01-01
Molecules in a seeded supersonic beam are aligned by the interaction between an intense nonresonant linearly polarized laser field and the molecular polarizability. We demonstrate the general applicability of the scheme by aligning I2, ICl, CS2, CH3I, and C6H5I molecules. The alignment is probed...... by mass selective two dimensional imaging of the photofragment ions produced by femtosecond laser pulses. Calculations on the degree of alignment of I2 are in good agreement with the experiments. We discuss some future applications of laser aligned molecules....
Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA
International Nuclear Information System (INIS)
Linz, U.
1983-09-01
The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de
Dixit, Aparna Banerjee; Ray, Krishanu; Black, Lindsay W
2012-12-11
Viral genome packaging into capsids is powered by high-force-generating motor proteins. In the presence of all packaging components, ATP-powered translocation in vitro expels all detectable tightly bound YOYO-1 dye from packaged short dsDNA substrates and removes all aminoacridine dye from packaged genomic DNA in vivo. In contrast, in the absence of packaging, the purified T4 packaging ATPase alone can only remove up to ∼1/3 of DNA-bound intercalating YOYO-1 dye molecules in the presence of ATP or ATP-γ-S. In sufficient concentration, intercalating dyes arrest packaging, but rare terminase mutations confer resistance. These distant mutations are highly interdependent in acquiring function and resistance and likely mark motor contact points with the translocating DNA. In stalled Y-DNAs, FRET has shown a decrease in distance from the phage T4 terminase C terminus to portal consistent with a linear motor, and in the Y-stem DNA compression between closely positioned dye pairs. Taken together with prior FRET studies of conformational changes in stalled Y-DNAs, removal of intercalating compounds by the packaging motor demonstrates conformational change in DNA during normal translocation at low packaging resistance and supports a proposed linear "DNA crunching" or torsional compression motor mechanism involving a transient grip-and-release structural change in B form DNA.
cGAS Conducts Micronuclei DNA Surveillance.
de Oliveira Mann, Carina C; Kranzusch, Philip J
2017-10-01
DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.
Do Identical Polar Diatomic Molecules Form Stacked or Linear ...
Indian Academy of Sciences (India)
ias
tractive and repulsive Coulomb interactions balance and cancel. Of course ... life, carbon (group 14), i.e., carbon bonding, has been proposed based ... Medical Institute EXROP program. ..... Hughes Medical Institute for support of this work. CW.
Diamond, Jared M.
1966-01-01
1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254
van den Berg, A.A.
2017-01-01
During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and
Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun
2016-09-15
We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Single-Molecule Stochastic Resonance
Directory of Open Access Journals (Sweden)
K. Hayashi
2012-08-01
Full Text Available Stochastic resonance (SR is a well-known phenomenon in dynamical systems. It consists of the amplification and optimization of the response of a system assisted by stochastic (random or probabilistic noise. Here we carry out the first experimental study of SR in single DNA hairpins which exhibit cooperatively transitions from folded to unfolded configurations under the action of an oscillating mechanical force applied with optical tweezers. By varying the frequency of the force oscillation, we investigate the folding and unfolding kinetics of DNA hairpins in a periodically driven bistable free-energy potential. We measure several SR quantifiers under varied conditions of the experimental setup such as trap stiffness and length of the molecular handles used for single-molecule manipulation. We find that a good quantifier of the SR is the signal-to-noise ratio (SNR of the spectral density of measured fluctuations in molecular extension of the DNA hairpins. The frequency dependence of the SNR exhibits a peak at a frequency value given by the resonance-matching condition. Finally, we carry out experiments on short hairpins that show how SR might be useful for enhancing the detection of conformational molecular transitions of low SNR.
Crump, S. E.; Sepúlveda, J.; Bunce, M.; Miller, G. H.
2017-12-01
Modern ecological studies are revealing that the "greening" of the Arctic, resulting from a poleward shift in woody vegetation ranges, is already underway. The increasing abundance of shrubs in tundra ecosystems plays an important role in the global climate system through multiple positive feedbacks, yet uncertainty in future predictions of terrestrial vegetation means that climate models are likely not capturing these feedbacks accurately. Recently developed molecular techniques for reconstructing past vegetation and climate allow for a closer look at the paleo-record in order to improve our understanding of tundra community responses to climate variability; our current research focus is to apply these tools to both Last Interglacial and Holocene warm times. Here we present initial results from a small lake on southern Baffin Island spanning the last 7.2 ka. We reconstruct climate with both bulk geochemical and biomarker proxies, primarily using biogenic silica and branched glycerol dialkyl glycerol tetraethers (brGDGTs) as temperature indicators. We assess shifts in plant community using multivariate analysis of sedimentary ancient DNA (sedaDNA) metabarcoding data. This combination of approaches reveals that the vegetation community has responded sensitively to early Holocene warmth, Neoglacial cooling, and possibly modern anthropogenic warming. To our knowledge, this represents the first combination of a quantitative, biomarker-based climate reconstruction with a sedaDNA-based paleoecological reconstruction, and offers a glimpse at the potential of these molecular techniques used in tandem.
Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.
2014-01-01
Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560
Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A
2014-10-15
Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.
Formation of Ultracold Molecules
Energy Technology Data Exchange (ETDEWEB)
Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)
2016-01-28
Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.
Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.
2015-07-01
This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.
DNA under Force: Mechanics, Electrostatics, and Hydration
Directory of Open Access Journals (Sweden)
Jingqiang Li
2015-02-01
Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
Linear electric field time-of-flight ion mass spectrometer
Funsten, Herbert O [Los Alamos, NM; Feldman, William C [Los Alamos, NM
2008-06-10
A linear electric field ion mass spectrometer having an evacuated enclosure with means for generating a linear electric field located in the evacuated enclosure and means for injecting a sample material into the linear electric field. A source of pulsed ionizing radiation injects ionizing radiation into the linear electric field to ionize atoms or molecules of the sample material, and timing means determine the time elapsed between ionization of atoms or molecules and arrival of an ion out of the ionized atoms or molecules at a predetermined position.
Dielectrophoresis of gold nanoparticles conjugated to DNA origami structures
Directory of Open Access Journals (Sweden)
Anja Henning-Knechtel
2016-07-01
Full Text Available DNA nanostructures are promising construction materials to bridge the gap between self-assembly of functional molecules and conventional top-down fabrication methods in nanotechnology. Their positioning onto specific locations of a microstructured substrate is an important task towards this aim. Here we study manipulation and positioning of pristine and of gold nanoparticle-conjugated tubular DNA origami structures using ac dielectrophoresis. The dielectrophoretic behavior was investigated employing fluorescence microscopy. For the pristine origami, a significant dielectrophoretic response was found to take place in the megahertz range, whereas, due to the higher polarizability of the metallic nanoparticles, the nanoparticle/DNA hybrid structures required a lower electrical field strength and frequency for a comparable trapping at the edges of the electrode structure. The nanoparticle conjugation additionally resulted in a remarkable alteration of the DNA structure arrangement. The growth of linear, chain-like structures in between electrodes at applied frequencies in the megahertz range was observed. The long-range chain formation is caused by a local, gold nanoparticle-induced field concentration along the DNA nanostructures, which in turn, creates dielectrophoretic forces that enable the observed self-alignment of the hybrid structures.
International Nuclear Information System (INIS)
Game, J.C.; Sitney, K.C.; Cook, V.E.; Mortimer, R.K.
1989-01-01
The authors describe a system that uses pulsed-field gels for the physical detection of recombinant DNA molecules, double-strand DNA breaks (DSB) and sister-chromatid exchange in the yeast Saccharomyces cerevisiae. The system makes use of a circular variant of chromosome II (Chr. III). Meiotic recombination between this ring chromosome and a linear homolog produces new molecules of sizes distinguishable on gels from either parental molecule. They demonstrate that these recombinant molecules are not present either in strains with two linear Chr. III molecules or in rad50 mutants, which are defective in meiotic recombination. In conjunction with the molecular endpoints. They present data on the timing of commitment to meiotic recombination scored genetically. They have used x-rays to linearize circular Chr. III, both to develop a sensitive method for measuring frequency of DSB and as a means of detecting double-size circles originating in part from sister-chromatid exchange, which they find to be frequent during meiosis
International Nuclear Information System (INIS)
Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN
1994-06-01
This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)
DNA damage, homology-directed repair, and DNA methylation.
Directory of Open Access Journals (Sweden)
Concetta Cuozzo
2007-07-01
Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.
Raithel, Georg; Zhao, Jianming
2017-04-01
Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).
DNA binding and aggregation by carbon nanoparticles
International Nuclear Information System (INIS)
An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo
2010-01-01
Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.
Supercoil Formation During DNA Melting
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
Linear Algebra and Smarandache Linear Algebra
Vasantha, Kandasamy
2003-01-01
The present book, on Smarandache linear algebra, not only studies the Smarandache analogues of linear algebra and its applications, it also aims to bridge the need for new research topics pertaining to linear algebra, purely in the algebraic sense. We have introduced Smarandache semilinear algebra, Smarandache bilinear algebra and Smarandache anti-linear algebra and their fuzzy equivalents. Moreover, in this book, we have brought out the study of linear algebra and vector spaces over finite p...
Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA
Altiparmak, Melek; Nakiboglu Tezer, Mahmure
2009-01-01
Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…
Radiation-induced DNA damage as a function of DNA hydration
International Nuclear Information System (INIS)
Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.
1995-01-01
Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage
Preparation and self-folding of amphiphilic DNA origami.
Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng
2015-03-01
Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Indian Academy of Sciences (India)
Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...